
==== Front
J Anim Sci
J Anim Sci
jansci
Journal of Animal Science
0021-8812
1525-3163
Oxford University Press US

39022917
10.1093/jas/skae183
skae183
Feeds
AcademicSubjects/SCI00960
Dietary probiotic based on a dual-strain Bacillus subtilis improves immunity, intestinal health, and growth performance of broiler chickens
Cai Yuanli College of Life Science, Qilu Normal University, Jinan, Shandong 250200, China

https://orcid.org/0000-0002-5416-097X
Xiao Chuanpi Department of Animal Science and Medicine, Shandong Agricultural University, Taian, Shandong 271018, China

Tian Bo Department of Animal Science and Medicine, Shandong Agricultural University, Taian, Shandong 271018, China

Dorthe Sandvang Animal and Plant Health & Nutrition, Chr. Hansen A/S, Hørsholm 2970, Denmark

Meuter Antoine Animal and Plant Health & Nutrition, Chr. Hansen A/S, Hørsholm 2970, Denmark

Song Bochen Department of Animal Science and Medicine, Shandong Agricultural University, Taian, Shandong 271018, China

Song Zhigang Department of Animal Science and Medicine, Shandong Agricultural University, Taian, Shandong 271018, China

Correspondence author: bochensong@sdau.edu.cn.
2024
18 7 2024
18 7 2024
102 skae18316 2 2024
17 7 2024
23 9 2024
© The Author(s) 2024. Published by Oxford University Press on behalf of the American Society of Animal Science.
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (https://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact reprints@oup.com for reprints and translation rights for reprints. All other permissions can be obtained through our RightsLink service via the Permissions link on the article page on our site—for further information please contact journals.permissions@oup.com.

Abstract

The study investigated the effects of dietary probiotic of dual-strain Bacillus subtilis on production performance, intestinal barrier parameters, and microbiota in broiler chickens. In a randomized trial, male broiler chickens were allocated into 3 groups, a control group (basal diet), BS300 group (basal diet with 300 mg/kg of B. subtilis), and BS500 group (basal diet with 500 mg/kg of B. subtilis). The inclusion of 500 mg/kg of B. subtilis significantly reduced the feed conversion ratio by 4.55% during the starting phase. Both 300 and 500 mg/kg of B. subtilis supplementation increased jejunal villus height (by 17.89% and 24.8%, respectively) significantly and decreased jejunal crypt depth (by 27.2% and 31.9%, respectively) on day 21. The addition of 500 mg/kg of B. subtilis significantly elevated the gene expression of occludin on day 35. Moreover, of B. subtilis supplementation enhanced cytokine levels and immunoglobulins in both serum and jejunal mucosa. Microbial analysis indicated that B. subtilis increased the abundance of potential probiotics (Sutterella) and butyrate-producing bacteria (Lachnoclostridium, Tyzzerella, Anaerostipes, Clostridium_sensu_stricto_13, Prevotellaceae_NK3B31_group, and Lachnospiraceae_UCG-010). The abundances of Anaerostipes and Sutterella, are significantly correlated with growth performance and immune function. In conclusion, dietary supplementation with B. subtilis improved the growth performance, potentially through the regulation of immunity, intestinal barrier function, and microbiota in broilers. Notably, 500 mg/kg of B. subtilis exhibited more benefits for broilers compared to the 300 mg/kg.

This research highlights the efficacy of dual-strain Bacillus subtilis in improving feed conversion, intestinal morphology, immune function, and the gut microbiota in broiler chickens under the conditions of this experiment.

cecal microbes
immunity
intestinal morphology
tight junction
==== Body
pmcIntroduction

To improve chicken growth performance and health, growth-promoting antibiotics are commonly used worldwide. However, their widespread application has resulted in significant challenges, notably the occurrence of antibiotic resistance and associated food safety risks (Roth et al., 2019). Globally, most countries and regions have already banned antibiotics as feed additives by law, including the European Union in 2006, the United States in 2014, and China in 2020. Consequently, the animal industry is actively prioritizing the exploration of novel alternative additives. A variety of alternatives to growth-promoting antibiotics are currently in development, including phytogenics, organic acids, antimicrobial peptides, probiotics, prebiotics, synbiotics, and bacteriophages (Gadde et al., 2017a). Among these alternatives, B. subtilis, a spore-forming probiotic, stands out due to its resilience against a broad range of environmental challenges, such as high temperature, extremes of pH (Nicholson et al., 2012). Furthermore, Bacillus spores exhibit remarkable survival capabilities in harsh gastrointestinal circumstances, including exposure to bile salts and low pH (Shivaramaiah et al., 2011). Probiotics derived from B. subtilis exhibit remarkable resilience and durability in both feed processing and the broilers’ gastrointestinal tract, making them excellent contenders for improving the health of chickens (Zentek and Boroojeni, 2020). Research indicates that Bacillus in the intestinal tract can effectively hinder Staphylococcus aureus population sensing by producing fengycin, leading to the complete elimination of intestinal colonization by S. aureus (Piewngam et al., 2018).

In previous research, dietary B. subtilis has been shown to boost broiler growth performance and support the recovery of compromised gut function (Abdelqader et al., 2020). Furthermore, B. subtilis has been noted for its competitive interactions with pathogens, promotion of balance in intestinal microbiota in chickens (Abudabos et al., 2019). Recent investigations have uncovered that Bacillus-based probiotics exhibit effects specific to the strain employed, impacting host outcomes as gauged by production and health parameters. There is evidence that B. subtilis and B. amyloliquefaciens in broiler diets reduce pathogen growth, change gut flora, decrease intestinal inflammation, and change mucosal shape, all of which are beneficial for poultry production (Park et al., 2020; Wang et al., 2021). While former studies indicate that different B. subtilis strains can enhance the feed conversion rate (FCR) (Gadde et al., 2017b), conflicting findings exist, with other researchers reporting no marked changes in FCR with the use of different Bacillus strains (Ma et al., 2018; Jacquier et al., 2019; Luan et al., 2019). Strain-dependent effects on the host’s immune system and gut health have also been identified for B. subtilis (Azad et al., 2018). In contrast to single-strain probiotics, multistrain probiotics have been shown to differentially modulate intestinal cytokines. Specifically, a combination of B. subtilis RJGP16 and Lactobacillus salivarius B1 was found to be more effective in elevating cytokine levels related to gut mucosal immunity compared to single-strain probiotics (Deng et al., 2013). Additionally, ample studies have focused on an individual strain of B. subtilis, and our existing study focuses on a product combining 2 specific strains of B. subtilis. The inclusion of a dietary probiotic (2.4 × 109 CFU/kg diet of B. subtilis DSM32324 and DSM32325) was observed to elevate the mRNA level of interleukin-10 (IL-10) in the cecum of broilers. However, no significant effects were observed on other immune indicators and gut structure (Duangnumsawang et al., 2022, 2023). Notably, the impacts of this dual-strain B. subtilis DSM32324 and DSM32325-based probiotic on broiler gut health and gut microbiota remain unexplored. Therefore, we evaluated the impact of varying B. subtilis dosages on production performance in broilers and possible underlying mechanisms in this study.

Materials and Methods

Ethical approval

The Committee of Animal Utilization and Care from Shandong Agricultural University (Taian, Shandong, China) authorized the research methods. The study procedures were carried out following the rules of the Animal Welfare Committee.

Experimental design and management

A total of 768 male, 1-d-old Arbor Acres broilers with similar weight were divided into 3 groups and subjected to various dietary treatments. Each group consisted of 16 replicate pens with 16 chickens in per replicate. A basal diet (CON), a basal diet with 300 mg/kg of B. subtilis (BS300), and a basal diet with 500 mg/kg of B. subtilis (BS500) were the dietary interventions. The experimental dual-strain B. subtilis-based probiotic, incorporating strains DSM32324 and DSM32325, was sourced from Chr. Hansen Trading Co., Ltd. (Beijing, China).

The People’s Republic of China’s National Standard for “Compound Feed for Laying Chickens and Broilers” (GB/T 5916-2020), which details the components and chemical compositions, was followed in the formulation of the diet (Table 1). Two phases make up the feeding regimen: the starting phase (days 1 to 21) and the finisher phase (days 22 to 35). Food and water were freely available to broilers for 35 d during the experiment. Immunization procedures followed the commercial immunization program. Environmental conditions were carefully regulated, with temperature and lighting adhering to the feeding manual. The initial temperature was 35 °C, and then, the temperature was gradually decreased to 25 °C by 30 d of age. The average relative humidity was maintained at approximately 70% in the first 3 d and thereafter maintained between 55% and 65%. Broilers were kept under 23 h of light and 1 h of darkness in the first week, followed by 20 h of light and 4 h of darkness for the subsequent period. The use of antibiotic drugs was strictly prohibited during the test to ensure the test effect.

Table 1. Ingredients and composition of the experimental diets1 (air-dried basis).

Item	Days 1 to 21	Days 22 to 35	
Composition, %	
 Corn	51.38	60.02	
 Soybean meal (CP 46%)	40.71	25.54	
 Corn protein flour (CP 60%)	0.00	5.66	
 Soybean oil	3.75	3.32	
 Wheat flour	0.00	2.00	
 Dicalcium phosphate	1.86	1.33	
 Limestone	1.24	1.14	
 Sodium chloride	0.35	0.35	
 dl-Methionine (98%)	0.20	0.07	
 l-Lysine HCL (98%)	0.00	0.19	
 Vitamin premix2	0.03	0.03	
 Mineral premix3	0.20	0.20	
 Choline chloride (50%)	0.25	0.16	
 Sandoquin (Ethoxyquinoline)	0.030	0.00	
Calculated nutrient levels4	
 Metabolizable energy (kcal/kg)	2,928.97	3,100.00	
 Percent moisture (%)	12.90	13.20	
 Crude protein (%)	21.76	20.00	
 Crude fat (%)	5.94	5.81	
 Calcium (%)	1.01	0.90	
 Available phosphorus (%)	0.44	0.35	
 Digestible lysine (%)	1.14	1.00	
 Digestible methionine (%)	0.54	0.40	
1Diets were in mash form.

2Vitamin premix provided per kilogram of complete diet: vitamin A (retinylacetate), 9,500 IU; vitamin D3 (cholecalciferol), 2,500 IU; vitamin E (dl-a-tocopherol acetate), 30 IU; vitamin K3 (menadione sodium bisulfate), 2.65 mg; vitamin B12 (cyanocobalamin), 0.025 mg; biotin, 0.30 mg; folic acid, 1.25 mg; nicotinic acid, 50 mg; d-pantothenic acid, 12 mg; pyridoxine hydrochloride, 6.0 mg; riboflavin, 6.5 mg; thiamin mononitrate, 3.0 mg.

3Mineral premixes provided per kg of complete diet: iron, 80 mg; copper, 8 mg; manganese, 100 mg; zinc, 80 mg; iodine, 0.35 mg; selenium, 0.15 mg.

4Calculated values based on the analysis of experimental diets.

Growth performance

For every pen, feed consumption and body weight were carefully recorded on days 1, 21, and 35. Feed intake (FI) and body weight gain (BWG) were then calculated. The proportion of FI to BWG was then used to calculate the FCR.

Sample collection

From each pen, one chicken was selected randomly at days 21 and 35 for sampling. Blood was collected through the sinus of the subwing vein, and serum was separated for the determination of serum biochemical parameters, cytokines, and immunoglobulins. Subsequently, the jugular vein was bled and sacrificed. An extract of 1 cm of tissue from the middle of the jejunum was fixed in 4% paraformaldehyde for measurement of the microstructural characteristics of the jejunum. Samples of the cecum content, 0.5 cm tissue segments from the mid-jejunum, and jejunal mucosa were obtained and immediately frozen in liquid nitrogen. The materials were subsequently kept at −80 °C to enable a more thorough analysis in the future.

Serum biochemical index content analysis

A completely automated biochemical analyzer (7070; Hitachi, Co., Ltd, Tokyo, Japan) was used to measure the amounts of glucose and triglycerides, 2 of the serum biochemical indices. All operations were performed by colorimetric enzymatic methods according to the instructions in the diagnostic kits (Jiancheng Bioengineering Institute, Nanjing, China).

Jejunum morphological structure

The dehydration and paraffin embedding processes were applied to the fixed jejunum tissue. Hematoxylin–eosin (Olympus BX50; Tokyo, Japan) was applied to stain tissue slices that were precisely 4 μm thick. Ten undamaged villi were selected at random for each slice, and they were examined under a Leica microscope (Model DMi8, Wetzlar, Germany). Image-Pro Plus (6.0) was used as the image analysis program to quantify the height for every intestinal villus and the crypt depth aligned to it.

RNA isolation and quantitative polymerase chain reaction

Total RNA was extracted from jejunal tissues using Trizol Reagent (Invitrogen, Carlsbad, CA, USA). We evaluated the RNA quality with an Eppendorf biophotometer (Hamburg, Germany). The samples with A260/A280 ratios of 1.8 to 2.0 and A260/A230 ratios of 2.0 to 2.2 were chosen for subsequent determination. The samples were then subjected to reverse transcription by cDNA kits (Takara Biotechnology Company, Limited, Beijing, China). RT-PCR analysis was performed using the AB-7500 RT-PCR System (Applied Biosystems, Foster, CA, USA). After 10 s at 95 °C, 30 s were spent at 60 °C for the 40 cycles. Utilizing the 2−ΔΔCt technique, relative mRNA expression levels were determined (Livak and Schmittgen, 2001), with GAPDH serving as the reference gene. Table 2 provides details on the sequences of primers for the target genes and GAPDH.

Table 2. Sequences of the oligonucleotide primers for quantitative real-time PCR1 in the jejunum of the broilers

Genes2	Primer sequence (5ʹ to 3ʹ)3	Accession number	
GAPDH	F: AGAACATCATCCCAGCGTCC	NM_204305	
	R: CGGCAGGTCAGGTCAACAAC		
Claudin-1	F: AAGTGCATGGAGGATGACCA	NM_001013611.2	
	R: GCCACTCTGTTGCCATACCA		
Occludin	F: AGTTCGACACCGACCTGAAG	NM_205128.1	
	R: TCCTGGTATTGAGGGCTGTC		
ZO-1	F: ACAGCTCATCACAGCCTCCT	XM_015278981.1	
	R: TGAAGGGCTTACAGGAATGG		
1Primers designed using Primer Express software (Sangon Biotech, Shanghai, China).

2GAPDH, glyceraldehyde-3-phosphate; ZO-1, zonula occludens-1.

3F = forward; R = reverse.

Cytokine and immunoglobulin concentration in serum and jejunal mucosal

Using enzyme-linked immunosorbent assay (ELISA) kits (MLBIO Co., Shanghai, China), serum concentrations of interleukin 1 beta (IL-1β), interleukin 6 (IL-6), tumor necrosis factor-alpha (TNF-α), immunoglobulin A (IgA), and immunoglobulin G (IgG) were measured. Every assay method was carried out adherence to the guidance supplied by the corresponding kits.

Cecum microbiota

Following the instructions included in the kit, bacterial DNA was extracted from ileal digesta using the QIAamp DNA Stool Mini kit (Qiagen Inc., Valencia, CA). Barcoded primers (515F/806R) amplified the bacterial 16S rRNA gene in sections V3 and V4. The following protocols are outlined by Gao et al. (2023). Sequence processing and bioinformatics analysis were performed with the Pan et al. (2022) methods.

Statistical analysis

The data underwent analysis through the one-way Analysis of Variance (ANOVA) procedure. Differences between treatments were subsequently assessed using Duncan’s Multiple Range Test within the SPSS 25.0 software. The data are presented as means and standard error of the mean (SEM), with P < 0.05 designated as statistically significant; a P-value of 0.05 to 0.10 was regarded as a trend.

Results

Growth performance

The effect of B. subtilis supplementation on broiler growth performance is shown in Table 3. A significant reduction in the FCR of broilers during the starting period was observed with 500 mg/kg of B. subtilis supplementation (P < 0.05). Furthermore, at the same time, broiler FCR showed a tendency to decrease with the addition of 300 mg/kg of B. subtilis (0.05 < P < 0.10). Throughout the trial, no significant differences were seen between the 3 groups of feed consumption or BWG (P > 0.05).

Table 3. Effects of dietary B. subtilis on the growth performance of broilers

Items	CON1	BS3002	BS5003	SEM4	P value	
Body weight, g/bird	
 Day 1	41.08	41.32	41.552	0.097	0.113	
 Day 21	807.44	815.83	827.70	4.889	0.240	
 Day 35	2,062.69	2,082.48	2,109.10	19.565	0.633	
Body weight gain, g	
 Days 1 to 21	765.19	774.51	785.79	4.916	0.234	
 Days 22 to 35	1,258.43	1,267.72	1,283.76	14.962	0.790	
 Days 1 to 35	2,021.80	2,041.16	2,067.48	19.596	0.643	
Feed intake, g	
 Days 1 to 21	1,005.33	986.04	1,001.77	10.920	0.753	
 Days 22 to 35	1,997.54	2,010.84	2,005.80	18.369	0.958	
 Days 1 to 35	3,001.93	2,996.45	3,006.83	22.944	0.984	
Feed conversion ratio	
 Days 1 to 21	1.32a	1.27ab	1.26b	0.012	0.086	
 Days 22 to 35	1.59	1.57	1.56	0.010	0.549	
 Days 1 to 35	1.49	1.47	1.46	0.012	0.558	
Different letters in the shoulder indicated significant differences between groups (P < 0.05).

Number of replicates was 16.

1CON = basal diet provided as control.

2BS300 = basal diet supplemented with 300 mg/kg of B. subtilis.

3BS500 = basal diet supplemented with 500 mg/kg of B. subtilis.

4Standard error of mean.

Serum GLU and TG levels

The administration of B. subtilis at 500 mg/kg significantly reduced the serum triglyceride (TG) concentration in broilers on day 35 (P < 0.05), but no discernible impact on the broilers’ blood glucose (GLU) levels was found on days 21 and 35 (P > 0.05) (Figure 1).

Figure 1. Effect of dietary B. subtilis on the levels of glucose and triglycerides in the serum of broilers. The GLU and TG levels were analyzed using a fully automatic biochemical analyzer. All the data are presented as the mean, with the standard error of mean (SEM) shown as the whiskers. The indicators were analyzed using one-way ANOVA and least significant difference (LSD), and ANOVA was performed using Duncan’s multiple comparison test. The lowercase letters on the bar charts indicate significant differences (P < 0.05). CON: basal diet provided as a control group; BS300: basal diet supplemented with 300 mg/kg of B. subtilis; BS500: basal diet supplemented with 500 mg/kg of B. subtilis.

Morphological structure of the jejunum

The supplementation of B. subtilis at both 300 and 500 mg/kg significantly increased the jejunal villus height and villus height/crypt depth (V/C) (P < 0.05), and significantly decreased the jejunal crypt depth (P < 0.05) in broilers on day 21 (Figure 2A and B).

Figure 2. Effect of dietary B. subtilis on the intestinal barrier of broilers. The villus height and crypt depth (A) of the jejunum were analyzed by hematoxylin–eosin staining. The V/C of the jejunum (B) was calculated by dividing the villus height by the crypt depth. Hematoxylin–eosin-stained sections were monitored by optical microscopy at 200× to determine the differences in the villus height and crypt depth of the jejunum (C). The mRNA levels of Claudin-1, Occludin, and ZO-1 in the jejunum (D) were analyzed by RT-PCR. All the data are presented as the mean, with the SD shown as the whiskers. The indicators were analyzed using one-way ANOVA (LSD), and ANOVA was performed using Duncan’s multiple comparison test. The lowercase letters on the bar charts indicate significant differences (P < 0.05). CON: basal diet provided as a control group; BS300: basal diet supplemented with 300 mg/kg of B. subtilis; BS500: basal diet supplemented with 500 mg/kg of B. subtilis.

Expression of jejunal tight junction protein-related genes

To fully understand how B. subtilis affects intestinal barrier function, the gene expressions of tight junction proteins in the jejunum were assessed (Figure 2D). The addition of B. subtilis at 300 mg/kg considerably increased the mRNA level of zonula occludens-1 (ZO-1) in the jejunum of 35-d-old broilers as compared to the control group (P < 0.05). The treatment of B. subtilis at 500 mg/kg significantly enhanced the occludin mRNA abundance (P < 0.05) and showed a tendency to raise ZO-1 expression levels (0.05 < P < 0.10).

Serum and jejunal mucosal immunoglobulin and cytokine levels

The supplementation of 500 mg/kg of B. subtilis resulted in a substantial rise in TNF-α levels in the serum and jejunal mucosa of broilers on day 21 (P < 0.05) (Figure 3A and B). Additionally, the levels of serum IL-1β was significantly enhanced on day 35 (P < 0.05), the concentrations of jejunal mucosal IL-6 were significantly elevated on day 21 (P < 0.05), and the levels of TNF-α and IL-6 were significantly increased in the serum and jejunal mucosa on day 35 (P < 0.01). Furthermore, on day 35, the addition of 300 or 500 mg/kg of B. subtilis markedly elevated the levels of IL-1β in the broiler chicks’ jejunal mucosa (P < 0.01). The jejunal mucosa of 35-d broilers exhibited a significant rise in IL-1β, IL-6, and TNF-α levels (by 7.17%, 8.86%, and 43.76%, respectively) upon the addition of 300 mg/kg of B. subtilis (P < 0.01).

Figure 3. Effect of dietary B. subtilis on the levels of cytokines in the serum and jejunal mucosa of broilers. The levels of IL-1β, IL-6 and TNF-α in the serum (A) and the jejunal mucosa (B) were analyzed by ELISA kits. All the data are presented as the mean, with the SD shown as the whiskers. The indicators were analyzed using one-way ANOVA (LSD), and ANOVA was performed using Duncan’s multiple comparison test. The lowercase letters on the bar charts indicate significant differences (P < 0.05). CON: basal diet provided as a control group; BS300: basal diet supplemented with 300 mg/kg of B. subtilis; BS500: basal diet supplemented with 500 mg/kg of B. subtilis.

A 500-mg/kg dose of B. subtilis treatment was shown to significantly increase IgA concentrations in the jejunal mucosa on day 21 (by 7.08%) and in the serum on day 35 (by 14.19%) (P < 0.05) as well as IgG concentrations in the jejunal mucosa on days 21 and 35 (by 15.94% and 23.62%, respectively) (P < 0.01) in Figure 4A and B. The addition of 300 mg/kg of B. subtilis resulted in a rise (P < 0.05) in the jejunal mucosa’s IgA levels on day 21 (by 4.73%) and IgG levels on day 35 (by 22.97%).

Figure 4. Effect of dietary B. subtilis on the levels of immunoglobulins in the serum (A) and jejunal mucosa (B) of broilers. The levels of IgA and IgG in the serum were analyzed by ELISA kits. All the data are presented as the mean, with the SD shown as the whiskers. The indicators were analyzed using one-way ANOVA (LSD), and ANOVA was performed using Duncan’s multiple comparison test. The lowercase letters on the bar charts indicate significant differences (P < 0.05). CON: basal diet provided as a control group; BS300: basal diet supplemented with 300 mg/kg of B. subtilis; BS500: basal diet supplemented with 500 mg/kg of B. subtilis.

Cecum microbiota

Alpha diversity

The administration of B. subtilis at both 300 and 500 mg/kg exhibited no significant impact on the cecal microbiota’s Chao1, Pielou_e, Shannon, and Simpson indices on days 21 and 35 (P > 0.10) (Figure 5A).

Figure 5. Effect of dietary B. subtilis on the cecal microbiota of broilers. The alpha diversity of the cecal microbiota of broiler chickens was analyzed by the Chao1, Pielou_e, Shannon, and Simpson indices (A). The beta diversity of the cecal microbiota of broiler chickens on day 21 (B) and day 35 (C) was analyzed by NMDS. The top 10 microbes in the cecum of broiler chickens at the phylum level (D) and genus level (E). CN (CON): basal diet provided as a control group; BL: basal diet supplemented with 300 mg/kg of B. subtilis; BH: basal diet supplemented with 500 mg/kg of B. subtilis.

Beta diversity

Nonmetric multidimensional scaling (NMDS) is an unconstrained method for dimensionality reduction analysis of data, typically employed in NMDS plots. In this study, NMDS analysis was conducted on samples utilizing weighted UniFrac to cluster the samples, demonstrating the degree to which various samples and groupings’ community structures differ or are similar. The addition of B. subtilis at both 300 and 500 mg/kg did not lead to significant alterations in the structure of the cecal microbiota in broiler chickens (Figure 5B and C).

Top 10 microbes in the ileum

The prevailing microbial phyla in the cecum of broilers were Bacteroidota and Firmicutes, while at the genus level, Bacteroides emerged as the dominant microbe (Figure 5D and E).

t-Test for different microbes

B. subtilis at 300 mg/kg considerably increased the relative abundance of Clostridium_sensu_stricto_13 in the 21-d-old broiler’s cecum (P < 0.05) (Figure 6A).

The addition of B. subtilis at 500 mg/kg markedly enhanced the relative abundances of Prevotellaceae_NK3B31_group, Sutterella, and Lachnospiraceae_UCG-010 (P < 0.05) in the cecum of 21 d broilers (Figure 6B).

Figure 6. Differential microbes in the cecum of broiler chickens according to the t-test (A-D). Differential microbes in the cecum of broiler chickens according to LEfSe analysis (LDA score is greater than 4) (E). CN (CON): basal diet provided as a control group; BL: basal diet supplemented with 300 mg/kg of B. subtilis; BH: basal diet supplemented with 500 mg/kg of B. subtilis.

The administration of B. subtilis at 300 mg/kg dramatically elevated the relative abundances of Tyzzerella and Lachnoclostridium in cecum on day 35 (P < 0.05) (Figure 6C).

The addition of B. subtilis at 500 mg/kg significantly enhanced the Anaerostipes relative abundance in the cecum on day 35 (P < 0.05) (Figure 6D).

LEfSe analysis of differential microorganisms

LEfSe analysis of the taxa revealed a differential presence of 25 Operational Taxonomic Units among the 4 groups in the cecum (Figure 6E). The results visually highlight the distinctive dominant bacteria in the various treatment groups. In Figure 6E, it is evident that the treatment with B. subtilis at 300 mg/kg led to a significant increase in Firmicutes, Bacilli, Lactobacillus_aviarius, Alphaproteobacteria, Sphingomonadaceae, and Erysipelatoclostridium in the cecum of 21 d broilers (P < 0.05). However, in the cecum of 35-d-old broilers, the addition of B. subtilis at 500 mg/kg dramatically enhanced the relative abundance of Mogibacterium, Prevotellaceae, Bacteroides_dorei, and Bacteroides_fragilis (P < 0.05).

The heatmap of correlation for the various parameters and cecal microbes

The abundances of Anaerostipes, Sutterella, and Prevotellaceae_NK3B31_group are significantly correlated with growth performance (P < 0.05). Additionally, serum and jejunal immune function parameters exhibit a significant positive correlation with the abundances of Anaerostipes, Prevotellaceae_NK3B31_group, Sutterella, Lachnoclostridium, and Tyzzerella (P < 0.05) (Figure 7).

Figure 7. Correlation heatmap of the differential microbes in the cecum and differential parameters of broilers. Spearman’s correlations were calculated for all significantly different parameters and differential cecal microbes at the genus level. The colors of the squares represent the r values of Spearman’s correlation coefficient. *, P < 0.05.

Discussion

Growth performance

Probiotics, recognized as safe and environmentally friendly microecological preparations, have proven crucial in enhancing animal performance and health (Abd El‐Hack et al., 2020). Among these probiotics, B. subtilis stands out as a spore-forming bacterium known for its high resistance to temperature and harsh environmental conditions. These properties make it an ideal probiotic candidate for chicken production. Combining B. subtilis strains, such as 1,104 and 747, can significantly reduce FCR in previous studies (Gadde et al., 2017b). Additionally, the use of 1 × 108 CFU/kg of B. subtilis strain 29784 in broiler diets has been tested to improve FCR (Jacquier et al., 2019). Additionally, B. subtilis DSM32315 dietary supplements have been connected to better villus height, daily weight growth, body weight, and V/C ratio in broiler ileums on day 42 (Ma et al., 2018). Similarly, diets containing Bacillus coagulans TBC169 have been shown to enhance growth performance, and crude protein digestibility, and decrease FCR in broilers (Li et al., 2019). The addition of B. subtilis to broiler diets has also been shown to increase serum immunoglobulin levels, mRNA abundances of ZO-1, occludin, and claudin-1, and jejunal morphology (Qiu et al., 2021). In the current investigation, the broiler FCR was significantly decreased during the starting phase by adding 500 mg/kg of B. subtilis to feed; however, there was a trend for the FCR to decrease when 300 mg/kg of B. subtilis was added to their diet. However, neither the amount of feed consumed nor the rate of body weight increase with B. subtilis changed much. Further, B. subtilis inclusion has been shown to enhance starter-feeding performance by increasing BW and reducing FCR (Xu et al., 2021). Whereas other studies found no significant differences in FCR between different Bacillus species (Ma et al., 2018; Luan et al., 2019). The discrepancies in probiotic dose, rearing circumstances, feed composition, and strains employed might all be contributing factors to the inconsistent results. It was thought that B. subtilis produces helpful substances such as digestive enzymes, lysozymes, different antibiotics, and antifungal proteins, which contribute to growth performance (Sahu et al., 2008). An alternative explanation is that the incorporation of B. subtilis may enhance immune function (Dong et al., 2020) and modulate both intestinal health and the microbiota (Rodrigues et al., 2020).

Serum GLU and TG levels

The levels of GLU and TG in the serum provide insights into the state of energy and protein absorption and metabolism (Pourakbari et al., 2016). Triglycerides, being vital components of lipids, serve as crucial indicators reflecting the body’s fat metabolism. Under normal conditions, plasma triglycerides maintain a dynamic balance, primarily serving the function of supplying and storing energy in the body. The degree of poultry fat deposition and the serum triglyceride content are closely related (Cui et al., 2022). The current study revealed that the inclusion of 500 mg/kg of B. subtilis resulted in a decrease in the serum TG concentration of broiler chickens on day 35. Cui et al. (2013) reported similar results in pigs, where the addition of B. subtilis resulted in a considerable decrease in triglyceride levels. Fathi et al. (2018) reported a significant decrease in blood triglyceride levels when the diets of laying hens, exposed to high ambient temperatures, were supplemented with 200 to 400 mg/kg of B. subtilis. Similarly, in another study, hens fed diets enriched with B. subtilis exhibited significantly decreased blood triglyceride levels (Tsai et al., 2023). The decrease in serum TG levels may be attributed to a reduction in the mRNA levels of lipogenic enzymes in the liver. This effect is significant because the liver serves as the primary site for fatty acid synthesis in broiler chickens, as demonstrated by Cui et al. (2013). The gut barrier and nutrient absorption are significantly influenced by the shape of the intestines. Thus, the subsequent study set out to examine how B. subtilis affects the morphological structure of the broiler’s jejunum.

Morphological structure of the jejunum

The observed changes in gut morphology, characterized by improved villus height and V/C, signify an enhanced absorptive surface area and capacity (Sen et al., 2012). Gut epithelial cells are proliferated and differentiated by crypts, thereby promoting the growth of villi (Xiang et al., 2023). Notably, B. subtilis addition to the feed has been shown by Al-Fataftah and Abdelqader partially alleviating the negative effects of heat stress by repairing damaged intestinal tissue and promoting the colonization of good gut bacteria, thus improving broiler growth performance (Al-Fataftah and Abdelqader, 2014). Consistent with a prior study (Ma et al., 2018), the current investigation demonstrated that dietary inclusion of 300 and 500 mg/kg of B. subtilis significantly increased jejunal villus height and V/C while notably reducing jejunal crypt depth in broilers on day 21. These findings may offer insights into the decreased FCR observed in chickens during the starter phase.

Jejunal expression of tight junction genes

The intestinal epithelium is the important defense line against foreign antigens, such as toxins and pathogens from the gut lumen (Suzuki, 2012). The strongest protein complexes, known as tight junctions (TJs), join the apical side of intestinal epithelial cells. They are essential in stopping antigens from diffusing freely into the epithelial cells. TJs are composed of transmembrane proteins, including claudins, occludin, and junction-associated molecules. Among these, occludin plays a pivotal role as the primary transmembrane protein responsible for maintaining and regulating tight junction barrier function. Additionally, ZO proteins are intracellular proteins that work in conjunction with actomyosin and cytoskeletal actin (Turner, 2009). ZO-1 interacts with actin, occludin, and claudins to play a crucial part in the structural organization of TJs (Turner, 2009). Notably, by raising the ZO-1 mRNA level, B. subtilis has been shown to play a protective function against deoxynivalenol-induced barrier damage (Gu et al., 2014). In Clostridium perfringens-infected broilers, B. subtilis PB6 demonstrated the ability to upregulate the level of TJ proteins, including occludin and ZO-1, to varying degrees (Liu et al., 2021). The enhanced mRNA levels of occludin and ZO-1, which are the main components of epithelial TJs, can lead to improved intestinal barrier function and can promote gut health (Cani et al., 2009). Our results of ZO-1 and occludin were similar to the previous findings (Cani et al., 2009; Gu et al., 2014; Liu et al., 2021). Supplementation with 300 mg/kg of B. subtilis significantly elevated the mRNA level of ZO-1 in the jejunum of 35-d-old broilers. Furthermore, 35-d-old broilers in the BS500 group showed an increase in the mRNA level of occludin in their jejunum. These results imply that B. subtilis might improve the broilers’ intestinal barrier function.

Serum and jejunal mucosal immunoglobulin and cytokine levels

The immunoglobulins (IgG, IgA, and IgM) in serum or mucosa serve as crucial indicators of the nonspecific immune status of the animal (Long et al., 2020). Blood IgG, IgA, and IgM increased (by 1.93%, 3.74%, and 3.75%, respectively) when B. subtilis was supplemented in the diet (Qiu et al., 2021). The current study found that on day 35, broiler serum and jejunal mucosa IgA levels were higher with 500 mg/kg of B. subtilis (by 14.19% and 8.98%, respectively). Simultaneously, the 500 mg/kg meal dose of B. subtilis on day 35 enhanced the amounts of IgG in the broiler’s jejunal mucosa. These findings align with a previous study in which the addition of B. subtilis enhanced the levels of IgA and IgG in chickens (Guo et al., 2020). Consequently, B. subtilis demonstrates the ability to enhance immune function.

It is commonly known that probiotics typically have the opposite impact on pathogenic bacteria, frequently suppressing inflammation-inducing reactions instead of promoting them (Jijon et al., 2004). Accordingly, the pro-inflammatory response triggered by probiotics is currently being explored. In the present investigation, serum and mucosal pro-inflammatory cytokine (IL-1β, IL-6, and TNF-α) were significantly elevated on day 35 following the addition of 500 mg/kg of B. subtilis to the diet. In this study, the addition of 500 mg/kg of B. subtilis to the broiler meal on day 21 resulted in an increase in TNF-α concentrations in the broiler’s serum and jejunal mucosa. These findings align with a prior study where dietary B. subtilis was shown to enhance the mRNA levels of pro-inflammatory cytokines (IL-1β, IL-6, and IL-8) (Guo et al., 2020). Additionally, the probiotic VSL#3 was reported to activate TLR9-mediated NF-κB activation, causing pro-inflammatory cytokines including IL-6 and IL-12 to express more strongly (Rachmilewitz et al., 2004). In summary, the dietary inclusion of B. subtilis may contribute to the activation of pro-inflammatory cytokine production, thereby enhancing innate immune responses in broilers.

Cecum microbiota

For intestinal homeostasis, the gut microbiota is the most important symbiotic ecosystem. This microbiota has a big impact on how well birds absorb nutrients, digest feed, use energy, and produce eggs overall (Diaz Carrasco et al., 2019). The colonization and development of the microbiota in the chicken gut have the potential to impact various aspects of host physiology (Kers et al., 2018). It is well known that the main cause of growth-improving performance and gut morphology associated with probiotics is gut microbiota regulation (Crisol-Martínez et al., 2017). Thus, the impact of a probiotic based on 2 strains of B. subtilis on the gut microbiota was evaluated. The inclusion of B. subtilis in the diet changed the relative abundance of cecal microbiota in this investigation. Specifically, there were up-regulations in the relative abundances of Clostridium_sensu_stricto_13, Prevotellaceae_NK3B31_group, Sutterella, Lachnospiraceae, Lachnoclostridium, Tyzzerella, and Anaerostipes due to the administration of B. subtilis.

One microbe that is strongly correlated with growth performance and meat quality is Lachnoclostridium. It has been found that a high abundance of Lachnoclostridium leads to an increase in myogenic differentiation antigen expression and a greater diameter of muscle fibers in broilers (Lei et al., 2022). Individuals with irritable bowel syndrome displayed a significant reduction in the abundance of Lachnospiraceae_UCG-010 in their fecal samples. Conversely, healthy individuals showed an increased presence of this bacterium (Zhuang et al., 2018). The findings suggest that Lachnospiraceae_UCG-010 might be a beneficial bacterium; the increasing levels of this microbe might improve gut health. Additionally, Sutterella has been identified as a potential probiotic discovered in pigeon “milk,” demonstrating the ability to enhance growth rates and improve the FCR in chickens (Gillespie et al., 2012). In this investigation, the relative abundance of cecum Sutterella was considerably higher by 534.15% with 500 mg/kg of B. subtilis on day 21. Additionally, a favorable association was found between the growth performance metrics (BW and BWG) and Sutterella abundance.

There is a documented favorable correlation between the growth performance of broilers and the relative abundance of Lachnospiraceae-UCG-010 (Han et al., 2021). In the current experiment, the elevated level of Lachnospiraceae_UCG-010 in the 500 mg/kg of B. subtilis supplementation group was related to an improvement in the gut morphology and FCR on day 21. Furthermore, through the breakdown of plant fiber and the synthesis of short-chain fatty acids, Lachnospiraceae contribute to the promotion of intestinal development and health (Biddle et al., 2013). Acetic acid and total SCFA levels in the colon have been favorably connected with the Prevotellaceae_NK3B31_group ratio in the colonic bacterial community (Jiang et al., 2020). Anaerostipes sp. is human or animal gut commensals that metabolize carbohydrates to produce butyrate. Anaerostipes sp. has been associated with host health due to the observed beneficial effects of butyrate production. The abundance of butyrate-producing bacteria, including Lachnospiraceae_UCG-010, Prevotellaceae_NK3B31_group, Anaerostipes, Tyzzerella, and Clostridium_sensu_stricto_13, was increased with B. subtilis treatment. In addition to providing colon cells with a substantial energy source, butyrate also improves intestinal barrier function (Hamer et al., 2012). Therefore, the observed improvements in intestinal morphology and barrier function following B. subtilis administration may be associated with the production of butyrate by these microbial species.

Based on the findings of the Spearman correlation analysis, it can be concluded from this study that cecal microorganisms are linked to advantageous growth performance, including Anaerostipes, Prevotellaceae_NK3B31_group, and Sutterella. Microbes linked to promoting immune function in this study include Anaerostipes, Prevotellaceae_NK3B31_group, Sutterella, Lachnoclostridium, and Tyzzerella. Therefore, Anaerostipes, Prevotellaceae_NK3B31_group, and Sutterella may play crucial roles in enhancing intestinal health in broiler chickens through the dual-strain B. subtilis-based probiotic, making them potential candidates for probiotic applications.

Based on serum parameters (TG, IL-1β, IL-6, TNF-α, and IgA), jejunal mucosal parameters (IL-1β, IL-6, IgA, and IgG), and levels of jejunal barrier-related genes (occludin), 500 mg/kg of B. subtilis was more effective than 300 mg/kg of B. subtilis.

Conclusion

The immune system, intestinal barrier, and growth performance of broilers may all be enhanced by the inclusion of a dual-strain probiotic based on B. subtilis. These functions may be modulated by beneficial bacteria such as those associated with growth-promoting performance (Sutterella) and butyric acid-producing bacteria (Lachnospiraceae_UCG-010, Prevotellaceae_NK3B31_group, Anaerostipes, Tyzzerella, and Clostridium_sensu_stricto_13). In addition, 500 mg/kg of B. subtilis was more effective than 300 mg/kg of B. subtilis.

Acknowledgments

This study was supported by the Shandong Provincial Postdoctoral Program for Innovative Talent (SDBX2021013) and the Research Starting Fund of Shandong Agricultural University (76616).

Abbreviations:

BWG body weight gain

FCR feed conversion ratio

FI feed intake

GLU glucose

IgA immunoglobulin A

IgG immunoglobulin G

IL-1β interleukin 1 beta

IL-6 interleukin 6

TG triglyceride

TJ tight junctions

TNF-α tumor necrosis factor-alpha

V/C villus height/crypt depth

ZO-1 zonula occludens-1

Conflict of interest statement

We certify that there is no actual or potential conflict of interest, financial or otherwise. All authors have read and approved the manuscript for submission.

Data availability

The NCBI primary data archive (PDA) contains gene sequencing data of 16S rRNA collected and processed in the current investigation, accession number PRJNA 980449. You may get this information at https://www.ncbi.nlm.nih.gov/bioproject/980449.
==== Refs
Literature Cited

Abd El‐Hack, M. E., M. T.El‐Saadony, M. E.Shafi, S. Y. A.Qattan, G. E.Batiha, A. F.Khafaga, A. M. E.Abdel‐Moneim, and M.Alagawany. 2020. Probiotics in poultry feed: a comprehensive review. J. Anim. Physiol. Anim. Nutr. (Berl.). 104 :1835–1850. doi:10.1111/jpn.13454 32996177
Abdelqader, A., M.Abuajamieh, F.Hayajneh, and A. -R.Al-Fataftah. 2020. Probiotic bacteria maintain normal growth mechanisms of heat stressed broiler chickens. J. Therm. Biol. 92 :102654. doi:10.1016/j.jtherbio.2020.102654 32888580
Abudabos, A. M., H. A. A.Alhouri, I. A.Alhidary, M. A.Nassan, and A. A.Swelum. 2019. Ameliorative effect of Bacillus subtilis, Saccharomyces boulardii, oregano, and calcium montmorillonite on growth, intestinal histology, and blood metabolites on Salmonella-infected broiler chicken. Environ. Sci. Pollut. Res. Int. 26 :16274–16278. doi:10.1007/s11356-019-05105-1 30977003
Al-Fataftah, A. R., and A.Abdelqader. 2014. Effects of dietary Bacillus subtilis on heat-stressed broilers performance, intestinal morphology and microflora composition. Anim. Feed Sci. Technol. 198 :279–285. doi:10.1016/j.anifeedsci.2014.10.012
Azad, M. A., M.Sarker, and D.Wan. 2018. Immunomodulatory effects of probiotics on cytokine profiles. Biomed Res. Int. 2018 :8063647. doi:10.1155/2018/8063647 30426014
Biddle, A., L.Stewart, J.Blanchard, and S.Leschine. 2013. Untangling the genetic basis of fibrolytic specialization by Lachnospiraceae and Ruminococcaceae in diverse gut communities. Diversity-Basel. 5 :627–640. doi:10.3390/d5030627
Cani, P. D., S.Possemiers, T.Van de Wiele, Y.Guiot, A.Everard, O.Rottier, L.Geurts, D.Naslain, A.Neyrinck, D. M.Lambert, et al . 2009. Changes in gut microbiota control inflammation in obese mice through a mechanism involving GLP-2-driven improvement of gut permeability. Gut. 58 :1091–1103. doi:10.1136/gut.2008.165886 19240062
Crisol-Martínez, E., D.Stanley, M. S.Geier, R. J.Hughes, and R. J.Moore. 2017. Understanding the mechanisms of zinc bacitracin and avilamycin on animal production: linking gut microbiota and growth performance in chickens. Appl. Microbiol. Biotechnol. 101 :4547–4559. doi:10.1007/s00253-017-8193-9 28243710
Cui, C., C. J.Shen, G.Jia, and K. N.Wang. 2013. Effect of dietary Bacillus subtilis on proportion of Bacteroidetes and Firmicutes in swine intestine and lipid metabolism. Genet. Mol. Res. 12 :1766–1776. doi:10.4238/2013.May.23.1 23765983
Cui, Z. F., N. N.Jin, F. K.Amevor, G.Shu, X. X.Du, X. C.Kang, Z. F.Ning, X.Deng, Y. F.Tian, Q.Zhu, et al . 2022. Dietary supplementation of salidroside alleviates liver lipid metabolism disorder and inflammatory response to promote hepatocyte regeneration via PI3K/AKT/Gsk3-β pathway. Poult. Sci. 101 :102034. doi:10.1016/j.psj.2022.102034 35926351
Deng, J., Y. F.Li, J. H.Zhang, and Q.Yang. 2013. Co-administration of Bacillus subtilis RJGP16 and Lactobacillus salivarius B1 strongly enhances the intestinal mucosal immunity of piglets. Res. Vet. Sci. 94 :62–68. doi:10.1016/j.rvsc.2012.07.025 22901748
Diaz Carrasco, J. M., N. A.Casanova, and M. E.Fernández Miyakawa. 2019. Microbiota, gut health and chicken productivity: what is the connection? Microorganisms. 7 :374. doi:10.3390/microorganisms7100374 31547108
Dong, Y. X., R.Li, Y.Liu, L. Y.Ma, J. H.Zha, X. B.Qiao, T. J.Chai, and B.Wu. 2020. Benefit of dietary supplementation with Bacillus subtilis BYS2 on growth performance, immune response, and disease resistance of broilers. Probiotics Antimicro. 12 :1385–1397. doi:10.1007/s12602-020-09643-w
Duangnumsawang, Y., J.Zentek, W.Vahjen, J.Tarradas, and F. G.Boroojeni. 2022. Alterations in bacterial metabolites, cytokines, and mucosal integrity in the caecum of broilers caused by feed additives and host-related factors. Front. Physiol. 13 :935870. doi:10.3389/fphys.2022.935870 36171972
Duangnumsawang, Y., J.Zentek, W.Vahjen, J.Tarradas, and F. G.Boroojeni. 2023. Impact of feed additives and host-related factors on bacterial metabolites, mucosal integrity and immune response in the ileum of broilers. Vet. Res. Commun. 47 :1861–1878. doi:10.1007/s11259-023-10135-9 37160636
Fathi, M., I.Al-Homidan, A.Al-Dokhail, T.Ebeid, O.Abou-Emera, and A.Alsagan. 2018. Effects of dietary probiotic (Bacillus subtilis) supplementation on productive performance, immune response and egg quality characteristics in laying hens under high ambient temperature. Ital. J. Anim. Sci. 17 :804–814. doi:10.1080/1828051x.2018.1425104
Gadde, U., W. H.Kim, S. T.Oh, and H. S.Lillehoj. 2017a. Alternatives to antibiotics for maximizing growth performance and feed efficiency in poultry: a review. Anim. Health Res. Rev. 18 :26–45. doi:10.1017/S1466252316000207 28485263
Gadde, U., S. T.Oh, Y. S.Lee, E.Davis, N.Zimmerman, T.Rehberger, and H. S.Lillehoj. 2017b. The effects of direct-fed microbial supplementation, as an alternative to antibiotics, on growth performance, intestinal immune status, and epithelial barrier gene expression in broiler chickens. Probiotics Antimicrob. Proteins 9 :397–405. doi:10.1007/s12602-017-9275-9 28421423
Gao, M., J.Wang, and Z.Lv. 2023. Supplementing genistein for breeder hens alters the growth performance and intestinal health of offspring. Life-Basel. 13 :1468. doi:10.3390/life13071468 37511844
Gillespie, M. J., D.Stanley, H. L.Chen, J. A.Donald, K. R.Nicholas, R. J.Moore, and T. M.Crowley. 2012. Functional similarities between pigeon ‘milk’ and mammalian milk: induction of immune gene expression and modification of the microbiota. PLoS One 7 :e48363. doi:10.1371/journal.pone.0048363 23110233
Gu, M. J., S. K.Song, S. M.Park, I. K.Lee, and C. H.Yun. 2014. Protects porcine intestinal barrier from deoxynivalenol via improved zonula occludens-1 expression. Asian-Australas. J. Anim. Sci. 27 :580–586. doi:10.5713/ajas.2013.13744 25049991
Guo, M., M.Li, C.Zhang, X.Zhang, and Y.Wu. 2020. Dietary administration of the bacillus subtilis enhances immune responses and disease resistance in chickens. Front. Microbiol. 11 :1768. doi:10.3389/fmicb.2020.01768 32849392
Hamer, H. M., V.De Preter, K.Windey, and K.Verbeke. 2012. Functional analysis of colonic bacterial metabolism: relevant to health? Am. J. Physiol. Gastrointest. Liver Physiol. 302 :G1–G9. doi:10.1152/ajpgi.00048.2011 22016433
Han, H. Y., Y.Zhou, Q. X.Liu, G. J.Wang, J. H.Feng, and M. H.Zhang. 2021. Effects of ammonia on gut microbiota and growth performance of broiler chickens. Animals-Basel. 11 :1716. doi:10.3390/ani11061716 34201291
Jacquier, V., A.Nelson, M.Jlali, L.Rhayat, K. S.Brinch, and E.Devillard. 2019. Bacillus subtilis 29784 induces a shift in broiler gut microbiome toward butyrate-producing bacteria and improves intestinal histomorphology and animal performance. Poult. Sci. 98 :2548–2554. doi:10.3382/ps/pey602 30668816
Jiang, X. Y., N. S.Lu, H. C.Zhao, H.Yuan, D.Xia, and H. L.Lei. 2020. The microbiome-metabolome response in the colon of piglets under the status of weaning stress. Front. Microbiol. 11 :2055. doi:10.3389/fmicb.2020.02055 32983040
Jijon, H., J.Backer, H.Diaz, H.Yeung, D.Thiel, C.McKaigney, C.De Simone, and K.Madsen. 2004. DNA from probiotic bacteria modulates murine and human epithelial and immune function. Gastroenterology. 126 :1358–1373. doi:10.1053/j.gastro.2004.02.003 15131797
Kers, J. G., F. C.Velkers, E. A. J.Fischer, G. D. A.Hermes, J. A.Stegeman, and H.Smidt. 2018. Host and environmental factors affecting the intestinal microbiota in chickens. Front. Microbiol. 9 :235. doi:10.3389/fmicb.2018.00235 29503637
Lei, J. Q., Y. Y.Dong, Q. H.Hou, Y.He, Y. J.Lai, C. Y.Liao, Y.Kawamura, J. Y.Li, and B. K.Zhang. 2022. Intestinal microbiota regulate certain meat quality parameters in chicken. Front. Nutr. 9 :747705. doi:10.3389/fnut.2022.747705 35548562
Li, C. -L., J.Wang, H. -J.Zhang, S. -G.Wu, Q. -R.Hui, C. -B.Yang, R. -J.Fang, and G. -H.Qi. 2019. Intestinal morphologic and microbiota responses to dietary Bacillus spp. in a broiler chicken model. Front. Physiol. 9 . 1968. doi:10.3389/fphys.2018.01968 30705639
Liu, Y., S.Zhang, Z.Luo, and D.Liu. 2021. Supplemental Bacillus subtilis PB6 improves growth performance and gut health in broilers challenged with Clostridium perfringens. J. Immunol. Res. 2021 :1–11. doi:10.1155/2021/2549541
Livak, K. J., and T. D.Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25 :402–408. doi:10.1006/meth.2001.1262 11846609
Long, L. N., B. J.Kang, Q.Jiang, and J. S.Chen. 2020. Effects of dietary Lycium barbarum polysaccharides on growth performance, digestive enzyme activities, antioxidant status, and immunity of broiler chickens. Poult. Sci. 99 :744–751. doi:10.1016/j.psj.2019.10.043 32029159
Luan, S. J., Y. B.Sun, Y.Wang, R. N.Sa, and H. F.Zhang. 2019. Bacillus amyloliquefaciens spray improves the growth performance, immune status, and respiratory mucosal barrier in broiler chickens. Poult. Sci. 98 :1403–1409. doi:10.3382/ps/pey478 30285152
Ma, Y. B., W. W.Wang, H. J.Zhang, J.Wang, W. M.Zhang, J.Gao, S. G.Wu, and G. H.Qi. 2018. Supplemental Bacillus subtilis DSM 32315 manipulates intestinal structure and microbial composition in broiler chickens. Sci. Rep. 8 :15358. doi:10.1038/s41598-018-33762-8 30337568
Nicholson, J. K., E.Holmes, J.Kinross, R.Burcelin, G.Gibson, W.Jia, and S.Pettersson. 2012. Host-gut microbiota metabolic interactions. Science. 336 :1262–1267. doi:10.1126/science.1223813 22674330
Pan, X., Y.Cai, L.Kong, C.Xiao, Q.Zhu, and Z.Song. 2022. Probiotic effects of Bacillus licheniformis DSM5749 on growth performance and intestinal microecological balance of laying hens. Front. Nutr. 9 :868093. doi:10.3389/fnut.2022.868093 35571886
Park, I., N. P.Zimmerman, A. H.Smith, T. G.Rehberger, E. P.Lillehoj, and H. S.Lillehoj. 2020. Dietary supplementation with Bacillus subtilis direct-fed microbials alters chicken intestinal metabolite levels. Front. Vet. Sci. 7 :123. doi:10.3389/fvets.2020.00123 32195276
Piewngam, P., Y.Zheng, T. H.Nguyen, S. W.Dickey, H. S.Joo, A. E.Villaruz, K. A.Glose, E. L.Fisher, R. L.Hunt, B.Li, et al . 2018. Pathogen elimination by probiotic Bacillus via signalling interference. Nature. 562 :532–537. doi:10.1038/s41586-018-0616-y 30305736
Pourakbari, M., A.Seidavi, L.Asadpour, and A.Martínez. 2016. Probiotic level effects on growth performance, carcass traits, blood parameters, cecal microbiota, and immune response of broilers. An. Acad. Bras. Cienc. 88 :1011–1021. doi:10.1590/0001-3765201620150071 27254451
Qiu, K., C. L.Li, J.Wang, G. H.Qi, J.Gao, H. J.Zhang, and S. G.Wu. 2021. Effects of dietary supplementation with Bacillus subtilis, as an alternative to antibiotics, on growth performance, serum immunity, and intestinal health in broiler chickens. Front. Nutr. 8 :786878. doi:10.3389/fnut.2021.786878 34917643
Rachmilewitz, D., K.Katakura, F.Karmeli, T.Hayashi, C.Reinus, B.Rudensky, S.Akira, K.Takeda, J.Lee, K.Takabayashi, et al . 2004. Toll-like receptor 9 signaling mediates the anti-inflammatory effects of probiotics in murine experimental colitis. Gastroenterology. 126 :520–528. doi:10.1053/j.gastro.2003.11.019 14762789
Rodrigues, D. R., W.Briggs, A.Duff, K.Chasser, R.Murugesan, C.Pender, S.Ramirez, L.Valenzuela, and L.Bielke. 2020. Cecal microbiome composition and metabolic function in probiotic treated broilers. PLoS One. 15 :e0225921. doi:10.1371/journal.pone.0225921 32492021
Roth, N., A.Käsbohrer, S.Mayrhofer, U.Zitz, C.Hofacre, and K. J.Domig. 2019. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia coli: a global overview. Poult. Sci. 98 :1791–1804. doi:10.3382/ps/pey539 30544256
Sahu, M. K., N. S.Swarnakumar, K.Sivakumar, T.Thangaradjou, and L.Kannan. 2008. Probiotics in aquaculture: importance and future perspectives. Indian J. Microbiol. 48 :299–308. doi:10.1007/s12088-008-0024-3 23100726
Sen, S., S. L.Ingale, Y. W.Kim, J. S.Kim, K. H.Kim, J. D.Lohakare, E. K.Kim, H. S.Kim, M. H.Ryu, I. K.Kwon, et al . 2012. Effect of supplementation of Bacillus subtilis LS 1-2 to broiler diets on growth performance, nutrient retention, caecal microbiology and small intestinal morphology. Res. Vet. Sci. 93 :264–268. doi:10.1016/j.rvsc.2011.05.021 21757212
Shivaramaiah, S., N. R.Pumford, M. J.Morgan, R. E.Wolfenden, A. D.Wolfenden, A.Torres-Rodríguez, B. M.Hargis, and G.Téllez. 2011. Evaluation of Bacillus species as potential candidates for direct-fed microbials in commercial poultry. Poult. Sci. 90 :1574–1580. doi:10.3382/ps.2010-00745 21673174
Suzuki, T. 2012. Regulation of intestinal epithelial permeability by tight junctions. Cell. Mol. Life Sci. 70 :631–659. doi:10.1007/s00018-012-1070-x 22782113
Tsai, M. Y., B. L.Shih, R. B.Liaw, W. T.Chen, T. Y.Lee, H. W.Hung, K. H.Hung, and Y. F.Lin. 2023. Effect of dietary supplementation of Bacillus subtilis TLRI 211-1 on laying performance, egg quality and blood characteristics of Leghorn layers. Anim. Biosci. 36 :609–618. doi:10.5713/ab.22.0274 36634665
Turner, J. R. 2009. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 9 :799–809. doi:10.1038/nri2653 19855405
Wang, B. K., Y. H.Zhou, L.Tang, Z. H.Zeng, L.Gong, Y. P.Wu, and W. F.Li. 2021. Effects of Bacillus amyloliquefaciens instead of antibiotics on growth performance, intestinal health, and intestinal microbiota of broilers. Front. Vet. Sci. 8 :679368. doi:10.3389/fvets.2021.679368 34150896
Xiang, J. N., J. G.Guo, S. Y.Zhang, H. G.Wu, Y. G.Chen, J. P.Wang, B. J.Li, and H. J.Liu. 2023. A stromal lineage maintains crypt structure and villus homeostasis in the intestinal stem cell niche. BMC Biol. 21 :169. doi:10.1186/s12915-023-01667-2 37553612
Xu, Y. L., Y.Yu, Y. Y.Shen, Q.Li, J. H.Lan, Y. P.Wu, R. Q.Zhang, G. T.Cao, and C. M.Yang. 2021. Effects of Bacillus subtilis and Bacillus licheniformis on growth performance, immunity, short chain fatty acid production, antioxidant capacity, and cecal microflora in broilers. Poult. Sci. 100 :101358. doi:10.1016/j.psj.2021.101358 34358955
Zentek, J., and F. G.Boroojeni. 2020. (Bio)technological processing of poultry and pig feed: impact on the composition, digestibility, anti-nutritional factors and hygiene. Anim. Feed Sci. Technol. 268 :114576. doi:10.1016/j.anifeedsci.2020.114576
Zhuang, X. J., Z. Y.Tian, L.Li, Z. R.Zeng, M. H.Chen, and L. S.Xiong. 2018. Fecal microbiota alterations associated with diarrhea-predominant irritable bowel syndrome. Front. Microbiol. 9 :1600. doi:10.3389/fmicb.2018.01600 30090090
