
==== Front
101573691
39703
Cell Rep
Cell Rep
Cell reports
2211-1247

39024100
10.1016/j.celrep.2024.114497
nihpa2019506
Article
Ceramide-induced cleavage of GPR64 intracellular domain drives Ewing sarcoma
Suvarna Kruthi 1
Jayabal Panneerselvam 1
Ma Xiuye 1
Wang Hu 2
Chen Yidong 134
Weintraub Susan T. 45
Han Xianlin 246
Houghton Peter J. 147
Shiio Yuzuru 1458*
1 Greehey Children’s Cancer Research Institute, The University of Texas Health Science Center, San Antonio, TX 78229, USA
2 Barshop Institute for Longevity and Aging Studies, The University of Texas Health Science Center, San Antonio, TX 78229, USA
3 Department of Population Health Sciences, The University of Texas Health Science Center, San Antonio, TX 78229, USA
4 Mays Cancer Center, The University of Texas Health Science Center, San Antonio, TX 78229, USA
5 Department of Biochemistry and Structural Biology, The University of Texas Health Science Center, San Antonio, TX 78229, USA
6 Department of Medicine, The University of Texas Health Science Center, San Antonio, TX 78229, USA
7 Department of Molecular Medicine, The University of Texas Health Science Center, San Antonio, TX 78229, USA
8 Lead contact
* Correspondence: shiio@uthscsa.edu
AUTHOR CONTRIBUTIONS

K.S., P.J., and Y.S. designed research; K.S., P.J., X.M., H.W., Y.C., S.T.W., P.J.H., and Y.S. performed research; K.S., P.J., X.M., H.W., Y.C., S.T.W., X.H., P.J.H., and Y.S. analyzed data; K.S. and Y.S. wrote the paper with input from other authors.

14 9 2024
27 8 2024
17 7 2024
22 9 2024
43 8 114497114497
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
SUMMARY

Ewing sarcoma is a cancer of bone and soft tissue in children and young adults primarily driven by the EWS-FLI1 fusion oncoprotein, which has been undruggable. Here, we report that Ewing sarcoma depends on secreted sphingomyelin phosphodiesterase 1 (SMPD1), a ceramide-generating enzyme, and ceramide. We find that G-protein-coupled receptor 64 (GPR64)/adhesion G-protein-coupled receptor G2 (ADGRG2) responds to ceramide and mediates critical growth signaling in Ewing sarcoma. We show that ceramide induces the cleavage of the C-terminal intracellular domain of GPR64, which translocates to the nucleus and restrains the protein levels of RIF1 in a manner dependent on SPOP, a substrate adaptor of the Cullin3-RING E3 ubiquitin ligase. We demonstrate that both SMPD1 and GPR64 are transcriptional targets of EWS-FLI1, indicating that SMPD1 and GPR64 are EWS-FLI1-induced cytokine-receptor dependencies. These results reveal the SMPD1-ceramide-GPR64 pathway, which drives Ewing sarcoma growth and is amenable to therapeutic intervention.

Graphical Abstract

In brief

Ceramide exhibits a variety of biological activities, but its role in receptor-mediated signaling is unknown. Suvarna et al. report that GPR64 responds to ceramide and mediates critical growth signaling in Ewing sarcoma. Ceramide induces the cleavage of the GPR64 intracellular domain, which serves as a platform for RIF1 degradation.
==== Body
pmcINTRODUCTION

Ewing sarcoma is a cancer of bone and soft tissue in children and young adults, characterized by a chromosomal translocation that fuses EWS and an ETS family transcription factor, most commonly FLI1.1-3 EWS-FLI1 is the primary driver of this cancer.1-3 The prognosis for patients with recurrent or metastatic Ewing sarcoma continues to be poor, and there is a need to develop a molecularly targeted therapy. Despite many attempts, however, EWS-FLI1-targeted therapy has not been developed to date. Previous research on Ewing sarcoma predominantly focused on how EWS-FLI1 regulates intracellular events such as gene transcription and mRNA splicing. Little is known about how EWS-FLI1 impacts the extracellular environment.

SMPD1 (sphingomyelin phosphodiesterase 1)/ASM (acid sphingomyelinase) is an enzyme that generates ceramide from sphingomyelin.4 It is secreted and also located in lysosomes.4 Mutational inactivation of SMPD1 results in Niemann-Pick disease, a hereditary metabolic disorder affecting the brain, spleen, liver, lung, and bone marrow.5 SMPD1 knockout mice display phenotypes similar to human patients with Niemann-Pick disease and are used as disease models.6 While relatively little is known about the biological roles of secreted SMPD1, a previous study found that SMPD1 secreted from platelets acts on melanoma cells to generate extracellular ceramide, leading to integrin activation, increased adhesion of tumor cells in the lung, and lung metastasis.7

GPR64 (G-protein-coupled receptor 64)/ADGRG2 (adhesion G-protein-coupled receptor G2) belongs to the G subfamily of adhesion G-protein-coupled receptors (GPCRs).8 In normal tissues, GPR64 displays restricted expression in epididymis, parathyroid gland, and chemosensory epithelial cells called tuft cells.9 In cancers, GPR64 is uniquely overexpressed in Ewing sarcoma10 and was proposed as a highly specific cell surface antigen for therapeutic targeting.11,12 The signaling pathways that regulate and are regulated by GPR64 are poorly understood.

RIF1 is a multi-functional nuclear protein implicated in the regulation of DNA replication timing and DNA damage repair.13,14 RIF1 delays MCM helicase activation at certain regions of the genome, making these regions replicate late in S phase.13 In conjunction with 53BP1, RIF1 promotes non-homologous end joining while repressing homologous recombination.14 RIF1 was originally identified as a telomere-binding protein that inhibits telomere elongation in the budding yeast, but this function is not conserved in multi-cellular organisms.15 The regulation of RIF1 activity is not well understood.13

In this study, we show that Ewing sarcoma depends on secreted SMPD1, a ceramide-generating enzyme, and GPR64, a ceramide-responsive receptor. We show that ceramide induces the cleavage of the C-terminal intracellular domain (ICD) of GPR64, which translocates to the nucleus, degrades RIF1, and maintains Ewing sarcoma proliferation.

RESULTS

Ewing sarcoma depends on SMPD1, a ceramide-generating enzyme

To assess how EWS-FLI1 impacts the Ewing sarcoma secretome, we compared the proteins secreted from EWS-FLI1-silenced A673 Ewing sarcoma cells and those from control A673 cells.16 This analysis identified 7.6-fold reduced protein levels of SMPD1 in the A673 cell secretome upon EWS-FLI1 silencing (Figures 1A and 1B).16 SMPD1 is an enzyme that converts sphingomyelin to ceramide.4 It is secreted and also located in lysosomes.4 We found that SMPD1 transcript levels are also reduced upon EWS-FLI1 silencing (Figure 1C). Conversely, lentiviral expression of EWS-FLI1 in human mesenchymal stem cells, putative cells of origin of Ewing sarcoma,1-3 induced SMPD1 mRNA and protein levels (Figure 1D). By using chromatin immunoprecipitation (ChIP), we were able to show that endogenous EWS-FLI1 in A673 cells binds to the SMPD1 gene promoter (Figure 1E). A previous ChIP sequencing (ChIP-seq) analysis also identified SMPD1 as one of 1,785 high-confidence EWS-FLI1-binding sites in A673 and SK-N-MC Ewing sarcoma cells.17 Two additional ChIP-seq studies identified EWS-FLI1-binding sites near the SMPD1 gene in Ewing sarcoma cells.18,19 These results suggest that SMPD1 is a transcriptional target of EWS-FLI1. Consistent with this, SMPD1 is highly expressed in Ewing sarcoma tumors, patient-derived xenograft (PDX) tumors, and cell lines compared with human mesenchymal stem cells (Figure 1F).

Small interfering RNA (siRNA)-mediated SMPD1 knockdown in A673, TC32, and TC71 Ewing sarcoma cell lines arrested cell proliferation (Figure 1G; Dharmacon SMPD1 SMARTpool siRNAs; proliferation assessed by the IncuCyte live-cell imaging system). To complement the established cell lines, we also dissociated an Ewing sarcoma PDX tumor (NCH-EWS-1) and derived tumor cells,16 which we termed PDX1. SMPD1 knockdown also arrested proliferation of PDX1 tumor cells (Figure 1G). SMPD1 knockdown did not affect 293T or HeLa cell proliferation (Figure 1G). SMPD1 knockdown did not induce neuronal differentiation or apoptosis in Ewing sarcoma cells as judged by the levels of neuronal marker (β3 tubulin and neurofilament) induction and caspase-3 and PARP cleavage (Figure S1A). SMPD1 knockdown by short hairpin RNAs (shRNAs) also inhibited anchorage-independent growth and xenograft tumorigenicity of Ewing sarcoma cells (Figures 1H and 1I). Importantly, growth arrest of Ewing sarcoma cells upon SMPD1 knockdown was rescued by adding recombinant purified SMPD1 protein (R&D Systems, #5348-PD) to the culture medium (Figure 1J), indicating that Ewing sarcoma depends on extracellular SMPD1.

The enzymatic activity of SMPD1 can be inhibited by different anti-depressants.20-22 One of these, fluoxetine/Prozac was recently shown to potently kill glioblastoma tumors in mice, which depend on lysosomal SMPD1 to achieve proper membrane lipid dynamics for high EGFR signaling and survival.20 We found that fluoxetine inhibits A673 and PDX1 Ewing sarcoma cell proliferation, albeit at relatively high concentrations of 15–20 μM (Figure S2A), which were also required to inhibit glioblastoma cell proliferation.20 Fluoxetine did not affect 293T cell proliferation (Figure S2A), suggesting its selective toxicity against Ewing sarcoma. We found that another FDA-approved anti-depressant, paroxetine, more efficiently inhibits Ewing sarcoma proliferation (Figure S2B) without affecting 293T cell proliferation (Figure S2B). These results suggest the potential utility of anti-depressants as SMPD1-targeted therapy after careful evaluation of their off-target effects and potency.

GPR64 responds to ceramide and is a critical dependency in Ewing sarcoma

SMPD1 generates ceramide from sphingomyelin. Growth arrest of Ewing sarcoma cells induced by SMPD1 silencing was efficiently rescued by adding C18 ceramide, but not C16 or C24 ceramide, to the culture medium (Figures 2A and S3A), indicating that Ewing sarcoma depends on extracellular ceramide. We then searched for a ceramide receptor in Ewing sarcoma. A673 cell homogenate was incubated with biotinylated ceramide or biotin, and proteins binding to biotin-ceramide or biotin were isolated by streptavidin agarose pull-down and identified by mass spectrometry. This analysis revealed specific binding of GPR64/ADGRG2 to biotin-ceramide but not to biotin (Figure 2B; Tables S1 and S2). No other GPCRs were identified by this analysis (Tables S1 and S2). We found that SMPD1 knockdown and GPR64 knockdown cause similar gene expression changes in Ewing sarcoma cells (Figures 2C and S4; Table S3), suggesting that SMPD1 and GPR64 function in the same pathway.

To assess ceramide binding to GPR64, we performed biotin-ceramide pull-down, which showed ceramide binding to endogenous GPR64 in A673 cells (Figure 2D) and transfected GPR64-HA in 293T cells (Figure 2E). GPCR signaling often alters cAMP levels, which results in altered cAMP-dependent protein kinase (PKA)-mediated phosphorylation of CREB. GPR64 was previously shown to activate cAMP signaling.23,24 We found that ceramide robustly induces cAMP and CREB phosphorylation in A673 cells, which was abolished by GPR64 knockdown (Figure 2F). 293T cells express only low levels of GPR64 (Figure 4D), and ceramide did not affect cAMP or CREB phosphorylation in these cells (Figure 2G). However, transfection of GPR64-HA made 293T cells respond to ceramide by increasing cAMP and CREB phosphorylation (Figure 2G). These results suggest that GPR64 functions as the ceramide-responsive receptor.

SMPD1 converts sphingomyelin to ceramide. Ceramide can be converted to glucosylceramide by glucosylceramide synthase. Ceramide also derives from dihydroceramide by the action of dihydroceramide desaturase. We tested the activities of these sphingolipids in GPR64 signaling. We found that sphingomyelin, glucosylceramide, and dihydroceramide do not rescue growth arrest induced by SMPD1 knockdown in A673 and PDX1 cells (Figures S5A and S5B). These sphingolipids did not induce cAMP or CREB phosphorylation in A673 cells or in 293T cells transfected with GPR64-HA (Figures S5C and S5D).

The mass spectrometry-based lipidomic analysis of A673 cells determined that SMPD1 knockdown results in reduced ceramide species and the accumulation of sphingomyelin species (Table S4), consistent with the conversion of sphingomyelin to ceramide by SMPD1. The lipidomic analysis of cell culture medium in the presence or absence of A673 cells determined that a complete growth medium (DMEM/10% fetal bovine serum) contains approximately 4.8 μM of total sphingomyelin and 56 nM of total ceramide (Table S5). 24 h culture with A673 cells slightly reduced total sphingomyelin and total ceramide to 4.2 μM and 52 nM, respectively (Table S5). Ceramide secretion from A673 cells to the culture medium was not detected by this method, which may be because ceramide produced by secreted SMPD1 stays closely associated with the plasma membrane.

SMPD1 knockdown did not affect GPR64 protein levels and GPR64 knockdown did not affect SMPD1 protein levels in A673 cells (Figure S5G), suggesting that these two proteins, while acting in the same pathway, do not affect each other’s expression levels.

Like other adhesion GPCRs, GPR64 undergoes self-cleavage in the GPCR autoproteolysis-inducing (GAIN) domain to generate two non-covalently associated subunits: an N-terminal domain (α subunit) and a C-terminal domain (β subunit). We found that biotin-ceramide binds to the C-terminal domain (β subunit), but not the N-terminal domain (α subunit), of GPR64 (Figure 3A; note that the GPR64 C-terminal domain is ubiquitinated and migrates as a smear,24 which is also observed in other adhesion GPCRs25). Further deletion mapping experiments demonstrated that while TM1–5 and TM1–4 are able to bind ceramide, the deletion of TM1–3 and TM1–2 abolishes ceramide binding (Figure 3B), suggesting that ceramide binds to the N-terminal portion of the seven transmembrane domain. GPR64/ADGRG2 belongs to the G subfamily of adhesion GPCRs. The paralogs in the same subfamily, GPR97/ADGRG3 and GPR126/ADGRG6, were recently proposed as the receptors for glucocorticoids and progesterone, respectively,26,27 with the ligand binding sites in the seven transmembrane domains. We found that biotin-ceramide does not bind to full-length GPR97 and GPR126 or their C-terminal domains (β subunits) (Figure 3C). A recent study identified a putative ligand-binding pocket in the seven transmembrane domain of GPR64 and proposed steroids such as dehydroepiandrosterone (DHEA) as possible GPR64 ligands,28 although the relatively high ED50 (2–11 μM) and lack of biological effects left some uncertainty about the proposed steroid ligands for GPR64.29 We found that 50-fold molar excess of DHEA does not affect ceramide binding to GPR64 (Figure 3D), suggesting that the ceramide-binding region in GPR64 is distinct from the DHEA-binding pocket. Unlike ceramide, DHEA did not rescue growth arrest induced by SMPD1 knockdown in Ewing sarcoma cells (Figure S6).

EWS-FLI1 knockdown in Ewing sarcoma cells resulted in reduced GPR64 RNA and protein expression (Figure 4A). Conversely, lentiviral expression of EWS-FLI1 in human mesenchymal stem cells induced GPR64 RNA and protein levels (Figure 4B). A ChIP analysis demonstrated that endogenous EWS-FLI1 binds to the GPR64 gene promoter in Ewing sarcoma cells (Figure 4C). A previous ChIP-seq analysis also identified GPR64 as one of 1,785 high-confidence EWS-FLI1-binding sites in A673 and SK-N-MC Ewing sarcoma cells.17 Two additional ChIP-seq studies identified EWS-FLI1-binding sites near the GPR64 gene in Ewing sarcoma cells.18,19 These results suggest that GPR64 is a transcriptional target of EWS-FLI1. Consistent with this, GPR64 is highly expressed in Ewing sarcoma tumors, PDX tumors, and cell lines compared with mesenchymal stem cells, rhabdomyosarcoma, synovial sarcoma, and other cancer cells (Figure 4D).

GPR64 siRNA knockdown arrested the proliferation of Ewing sarcoma cells (Figure 4E). GPR64 siRNA did not affect 293T or HeLa cell proliferation (Figure 4E). GPR64 knockdown did not induce neuronal differentiation or apoptosis in Ewing sarcoma cells as judged by the levels of neuronal marker induction and caspase-3 and PARP cleavage (Figure S1B). shRNA-mediated silencing of GPR64 strongly inhibited anchorage-independent growth and xenograft tumorigenicity of Ewing sarcoma cells (Figures 4F and 4G). These results indicate that Ewing sarcoma depends on the SMPD1-ceramide-GPR64 pathway (model in Figure 4H). Importantly, both SMPD1 and GPR64 are transcriptional targets of EWS-FLI1 and EWS-FLI1-induced cytokine-receptor dependencies in Ewing sarcoma.

Ceramide induces the cleavage of the C-terminal ICD of GPR64

A previous interactome proteomic study identified RIF1 as a GPR64 interactor.30 The interaction between a plasma membrane receptor, GPR64, and a nuclear protein, RIF1, led us to test the cleavage of the C-terminal ICD of GPR64. We found that the GPR64 C-terminal antibody detects small fragments of GPR64, which are silenced by GPR64 siRNAs and induced by ceramide treatment in Ewing sarcoma cells (Figures 5A, 5B, S3B, and S3C). Sphingomyelin, glucosylceramide, and dihydroceramide did not induce the GPR64 C-terminal fragments (Figure S5E). Ceramide also induced the C-terminal fragments of C-terminally FLAG-tagged GPR64 (residues 607–1017) transfected in 293T cells (Figure S7A). When the FLAG-tagged GPR64 ICD (residues 879–1017) was stably expressed in A673 cells using lentivirus, the FLAG-GPR64 ICD was located in the nucleus (Figure 5C) and co-immunoprecipitated with endogenous RIF1 (Figure 6G; the size of the exogenous FLAG-ICD was approximately 17 kDa, similar to the faster-migrating GPR64 C-terminal fragment detected by anti-GPR64 C-terminal antibody in Figures 5A, 5B, S3B, and S3C). The GPR64 C-terminal antibody also detected a nuclear signal in Ewing sarcoma cells, which was abolished by GPR64 siRNA knockdown (Figure 5D).

Importantly, stable expression of the GPR64 ICD rescued growth arrest induced by GPR64 knockdown and SMPD1 knockdown (Figures 5E and 5F), indicating the critical role for the GPR64 ICD in SMPD1-GPR64 signaling and Ewing sarcoma growth (note that the GPR64 cDNA clone used in this study is codon optimized and harbors many silent nucleotide substitutions and the ICD expressed from the GPR64 ICD clone is not silenced by GPR64 siRNA, as shown in Figures 5E and 5F). Consistent with the critical growth-promoting role for the GPR64 ICD, the GPR64 C-terminal domain containing the ICD, but lacking the N-terminal extracellular domain, rescued growth arrest induced by GPR64 knockdown (Figure S7B), while GPR64 lacking the ICD was unable to rescue GPR64-knockdown-induced growth arrest (Figure S7C). Furthermore, a GPR64 truncation mutant linked to the congenital bilateral absence of vas deferens that lacks the C-terminal portion of the ICD (residues 949–1017)31 could not rescue growth arrest induced by GPR64 knockdown (Figure S7D), suggesting a common mechanism of action for the GPR64 ICD in Ewing sarcoma growth and vas deferens development.

The generation of GPR64 C-terminal fragments was induced by forskolin, an activator of adenylate cyclase, and bromo-cAMP, a membrane-permeable cAMP analog (Figure 5G). Conversely, ceramide-induced generation of GPR64 C-terminal fragments was blocked by NKY80, an inhibitor of adenylate cyclase, and H-89, an inhibitor of PKA (Figure 5H). These results suggest the role of cAMP-PKA signaling in ceramide-induced cleavage of the C-terminal ICD of GPR64. Ceramide-induced GPR64 ICD cleavage was also blocked by a γ-secretase inhibitor, DAPT (Figure 5I), implicating γ-secretase in this process.

GPR64 ICD restrains the protein levels of RIF1

Stable expression of the GPR64 ICD in Ewing sarcoma cells reduced RIF1 (Figures 6A and S3D), while SMPD1 knockdown and GPR64 knockdown increased RIF1 (Figures 6B and S3E). Ceramide treatment of Ewing sarcoma cells also reduced RIF1 (Figures 6C and S3F), while sphingomyelin, glucosylceramide, and dihydroceramide did not reduce RIF1 (Figure S5F). These results suggest that SMPD1-ceramide-GPR64 signaling downregulates the protein levels of RIF1. Importantly, shRNA-mediated stable silencing of RIF1 in Ewing sarcoma cells rescued growth arrest induced by SMPD1 knockdown and GPR64 knockdown (Figures 6D, 6E, S3G, and S3H), suggesting that SMPD1-GPR64 signaling maintains Ewing sarcoma growth by restraining RIF1 protein levels.

Reduced RIF1 protein levels upon ceramide treatment were rescued by a proteasome inhibitor, MG-132, suggesting that ceramide induces proteasomal degradation of RIF1 (Figure 6F). We found a possible binding motif for SPOP, a substrate adaptor of the Cullin3-RING E3 ubiquitin ligase, at residues 924–928 within the GPR64 ICD (VSSSS, which conforms to the SPOP-binding motif consensus: V/A/P-X-S/T-S/T-S/T). The FLAG-GPR64 ICD stably expressed in A673 cells co-immunoprecipitated with RIF1 and SPOP (Figure 6G). FLAG-ICD harboring mutations of the SPOP-binding motif (VSSSS → VSAAA) did not co-immunoprecipitate with SPOP (Figure 6H). Furthermore, siRNA-mediated knockdown of SPOP abolished RIF1 degradation by the GPR64 ICD (Figures 6I and S3I) and ceramide (Figures 6J and S3J). The SPOP-binding motif is absent in GPR64 isoform 9, which lacks residues 906–956.32 We found that the GPR64 ICD harboring the equivalent deletion cannot rescue growth arrest induced by GPR64 knockdown (Figure 6K). Furthermore, the GPR64 ICD harboring mutations of the SPOP-binding motif (VSSSS → VSAAA) was similarly unable to rescue GPR64-knockdown-induced growth arrest (Figure 6L).

Collectively, these results suggest that ceramide induces the cleavage of the GPR64 ICD, which degrades RIF1 via a SPOP-dependent mechanism, thereby maintaining Ewing sarcoma growth (Figure 7).

DISCUSSION

In this study, we revealed a signaling pathway mediated by a ceramide-generating enzyme and a ceramide-responsive receptor, which controls Ewing sarcoma proliferation. Using secretome proteomics, we found that Ewing sarcoma abundantly secretes SMPD1 and depends on this enzyme (Figure 1). We identified GPR64 as the ceramide-responsive receptor and a critical dependency in Ewing sarcoma (Figures 2, 3, and 4). Regarding downstream signaling, we determined that ceramide induces the cleavage of the C-terminal ICD of GPR64, which translocates to the nucleus, binds RIF1, and degrades RIF1 in a manner dependent on SPOP, a substrate adaptor of the Cullin3-RING E3 ubiquitin ligase (Figures 5 and 6). We demonstrated that the restriction of RIF1 protein levels by the GPR64 ICD is critical for Ewing sarcoma growth (Figures 5 and 6).

While the GPR64 C-terminal antibody detected two GPR64 C-terminal fragments of approximately 17 and 33 kDa (Figures 5A, 5B, S3B, and S3C), the exogenously expressed GPR64 ICD (879–1017) migrated as a protein of approximately 17 kDa. The 33 kDa fragment may represent a post-translationally modified form of the ICD or a larger cleavage product that includes the ICD and part of the seven transmembrane domain. Our data indicate that cAMP-PKA signaling mediates ceramide-induced cleavage of the GPR64 ICD (Figures 5G and 5H). The precise mechanism of GPR64 ICD cleavage remains unclear, although the blockade of ICD cleavage by DAPT (Figure 5I) suggests the involvement of γ-secretase in this process.

We demonstrated that the critical function of the cleaved GPR64 ICD in maintaining Ewing sarcoma growth is to restrain the protein levels of RIF1. RIF1 is a multi-functional nuclear protein implicated in determining DNA replication timing and regulating DNA damage repair.13,14 Together with 53BP1, RIF1 stimulates non-homologous end joining while repressing homologous recombination.14 RIF1 also regulates DNA replication timing.13 RIF1 recruits PP1 to dephosphorylate MCM helicases, opposing MCM activation by a Dbf4-dependent kinase at late-replicating origins.13 It is possible that excess RIF1 caused by suppression of the SMPD1-ceramide-GPR64 pathway inhibits replication of late-replicating origins, leading to growth arrest.

We determined that the cleaved GPR64 ICD recruits SPOP to degrade RIF1, which is reminiscent of the E6 oncoprotein of the human papilloma virus recruiting E6-AP to degrade p5333,34. Our data suggest that an SPOP-binding motif (VSSSS) in the GPR64 ICD mediates interaction with SPOP. Interestingly, the SPOP-binding motif is spliced out in GPR64 isoform 9,32 and we found that the GPR64 ICD harboring the equivalent deletion does not rescue growth arrest induced by GPR64 knockdown (Figure 6K). This finding suggests that alternative splicing generates a GPR64 isoform incapable of mediating SPOP-dependent RIF1 degradation and potentially modulates GPR64-RIF1 signaling. It is possible that, in addition to RIF1, the GPR64 ICD regulates the levels of other proteins via a SPOP-dependent mechanism. The proteomic analysis of the GPR64 ICD interactors may generate useful insights in this regard.

Since EWS-FLI1 is the primary driver of Ewing sarcoma, EWS-FLI1 is a rational target to treat this cancer. Targeting EWS-FLI1 itself, however, has been unsuccessful. As an alternative, we propose targeting EWS-FLI1-induced cytokine-receptor dependencies, which are extracellular and thus more accessible for therapeutic targeting. We previously reported that Ewing sarcoma depends on GDF6-CD99,35 NELL2-ROBO3,16 and Slit2-ROBO1/2 cytokine-receptor signaling,36 which are all activated by EWS-FLI1.16,35,36 This study identified SMPD1-ceramide-GPR64 as EWS-FLI1-induced cytokine-receptor dependencies. It will now be important to evaluate the approaches to target these EWS-FLI1-induced cytokine-receptor dependencies in order to develop a much-needed targeted therapy.

Limitations of the study

While the current study revealed the SMPD1-ceramide-GPR64 pathway in Ewing sarcoma, the study is largely limited to cell culture models. The role of this pathway in Ewing sarcoma tumors in vivo needs to be further studied using mouse tumor models, although the lack of genetically engineered Ewing sarcoma tumor models in immunocompetent mice is a long-standing obstacle in the field. Since GPR64 is implicated in male fertility31,37,38 and also specifically expressed in chemosensory epithelial tuft cells,9 it will be important to address the role of the SMPD1-ceramide-GPR64 pathway in male fertility and tuft cells in vivo using relevant animal models and human tissue samples. Although the current study uncovered the outline of the SMPD1-ceramide-GPR64 pathway, some mechanistic details remain to be clarified, including the structure of ceramide-bound GPR64, how cAMP-PKA signaling induces the cleavage of the GPR64 ICD, the ICD cleavage site, the fate of the cleaved ICD, and ICD interactors other than RIF1 and SPOP.

STAR★METHODS

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Yuzuru Shiio (shiio@uthscsa.edu).

Materials availability

Plasmids generated in this study are available from the lead contact.

Data and code availability

The mass spectrometry proteomics data were deposited in the ProteomeXchange Consortium via MassIVE partner repository with the dataset identifier PXD048359 (MSV000093799). The RNA-sequencing data were deposited in the GEO database (the accession number: GSE252963). The lipidomics data were deposited in the MetaboLights database (the accession number: MTBLS10388). This paper does not report original code. Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Animals

Female 5–6 week old C.B.17SC scid−/− mice were used. All mice were housed in a pathogen-free vivarium in the University of Texas Health Science Center at San Antonio. Mice were randomly allocated to treatment groups. Blinding of the researcher measuring tumor size was employed. The animal research method was reviewed and approved for humaneness by the Institutional Animal Care and Use Committee of the University of Texas Health Science Center at San Antonio.

Cell lines

A673, SK-N-MC, U2OS, HCT116, 293T, and HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum. EW8, TC32, TC71, CHLA-9, ES-1, ES-2, ES-3, ES-4, ES-6, ES-7, and ES-8 cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum. SK-NEP-1 and SK-ES-1 cells were cultured in McCoy’s 5a medium supplemented with 15% fetal bovine serum. A673, SK-N-MC, SK-NEP-1, SK-ES-1, U2OS, HCT116, 293T, and HeLa cells were from ATCC. TC71 cells were obtained from the NIGMS Human Genetic Cell Repository at the Coriell Institute for Medical Research (GM11654). EW8, TC32, and CHLA-9 cells were from Dr. Patrick Grohar. The cell lines were STR-authenticated and were routinely tested for the absence of mycoplasma. Cord blood-derived human mesenchymal stem cells were purchased from Vitro Biopharma (Golden, CO) and were cultured in low-serum MSC-GRO following the manufacturer’s procedure. A patient-derived xenograft tumor (NCH-EWS-1) was washed and dissociated into single-cell suspensions using the tumor dissociation kit (Miltenyi Biotec 130–095-929) and gentleMACS Octo-dissociator (Miltenyi Biotec 130-096-427),16 following the manufacturer’s protocol. Dissociated cells (PDX1) were cultured in DMEM/F-12 medium supplemented with 10% FBS.16

METHOD DETAILS

Transfection and viral infection

Calcium phosphate co-precipitation was used for transfection of 293T cells. Lentiviruses were prepared by transfection in 293T cells following System Biosciences’ protocol, and the cells infected with lentiviruses were selected with 2 μg/mL puromycin for 48 h or 300 μg/mL hygromycin for 72 h. cDNAs for EWS-FLI1, GPR64 (codon optimized), GPR97, and GPR126 were cloned into pcDNA3 mammalian expression vector (Invitrogen/Thermo Fisher) or pCDH1-puro lentiviral expression vector (System Biosciences). The target sequences for shRNAs are as follows: FLI1 C terminus shRNA, AACGATCAGTAAGAATACAGAGC; luciferase shRNA, GCACTCT GATTGACAAATACGATTT; SMPD1 shRNA-1, CCCAATCTGCAAAGGTCTATT; and SMPD1 shRNA-2, CCGCCTCATCTCTCTCAA TAT; GPR64 shRNA-1, GCTAATTAAGGGCGATGATTA; GPR64 shRNA-2, GGTTCAGCTCTGTCGAATTAA; RIF1 shRNA, CCAGCAT ATCAGGTTGCTAAT; and control scrambled shRNA, CCTAAGGTTAAGTCGCCCTCG. The following siRNAs were used: human SMPD1 siRNA SMARTpool (M-006676-01; Dharmacon/Horizon Discovery), human GPR64 siRNA SMARTpool (M-003812-03; Dharmacon/Horizon Discovery), human SPOP siRNA SMARTpool (M-017919-02; Dharmacon/Horizon Discovery), and Non-Targeting siRNA Pool #2 (D-001206-14-05; Dharmacon/Horizon Discovery). siRNA transfection of cell lines was performed using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher).

Protein sample preparation and proteomic analysis

The preparation of secreted protein samples, mass spectrometry analysis, and proteomics data processing were described.16 To identify proteins interacting with biotin-ceramide, A673 cells were washed once with ice-cold PBS, harvested, and resuspended in 5 cell volumes of hypotonic buffer A (10 mM HEPES-KOH pH 7.9, 10 mM KCl, 1.5 mM MgCl2), followed by incubation on ice for 10 min. The cells were collected by centrifugation and resuspended in 2 cell volumes of buffer A containing protease inhibitors. The cell suspension was transferred to a Dounce homogenizer prechilled on ice. The cells were homogenized using a tight-fitting pestle by 10 repeated strokes. The homogenate was collected by centrifugation at 10,000g for 10 min at 4°C and the supernatant was saved. Equal amount of supernatant was incubated with 1 μM biotin-ceramide (Echelon Biosciences) or biotin for 4 h using a rotating tube mixer at 4°C. Streptavidin agarose beads were then added, and the sample was rotated overnight at 4°C. The beads were then washed three times using buffer A. The biotin-ceramide and biotin bound proteins were eluted using buffer A containing 10 mM biotin for 2 h. The eluted proteins were analyzed by mass spectrometry.

Aliquots of the pull-down eluates (25 μL) were mixed with a buffer containing 10% SDS/50 mM triethylammonium bicarbonate (TEAB), applied to S-Traps [micro (sample #1, biotin); mini (sample #2, ceramide-biotin); Protifi], reduced/alkylated with a mixture of tris(2-carboxyethyl)phosphine hydrochloride (TCEP) and 2-chloroacetamide and digested with trypsin (sequencing grade; Promega) in 50 mM triethylammonium bicarbonate (TEAB). Peptides were eluted from the S-Traps sequentially with 50 mM TEAB, 0.2% formic acid, and 0.2% formic acid in 50% aqueous acetonitrile The pooled eluates were dried by vacuum centrifugation and redissolved in 30 μL of starting mobile phase (see below). Equal volumes (5 μL of a 1:5 diluted solution) were analyzed by capillary HPLC-electrospray ionization tandem mass spectrometry on a Thermo Scientific Orbitrap Exploris 480 mass spectrometer. On-line separation was accomplished with a Vanquish Neo UHPLC system (Thermo Scientific): column, PepSep (Bruker; ReproSil C18, 15 cm × 150 μm, 1.9 μm beads); mobile phase A, 0.5% acetic acid (HAc)/0.005% trifluoroacetic acid (TFA) in water; mobile phase B, 90% acetonitrile/0.5% HAc/0.005% TFA/9.5% water; gradient 3 to 42% B in 120 min; flow rate, 0.4 μL/min. Precursor ions were acquired in the orbitrap in centroid mode at 120,000 resolution (m/z 200); EASY-IC mode, Run Start; data-dependent higher-energy collisional dissociation (HCD) spectra were subsequently acquired in the orbitrap for up to 20 precursors (normalized collision energy, 27%; resolution 15000). Other MS scan parameters included: m/z window for precursor ion selection, 1.2; charge states, 2–5; dynamic exclusion, 20 s (±10 ppm); intensity to trigger MS2, 50,000. Mascot (v2.8.3; Matrix Science) was used to search the spectra against a combination of the UniProt Human reference database [UniProt_Human_ref. 9606_20220216 (20,588 sequences; 11,394,277 residues)] plus a database of common contaminants (not including bovine proteins; 124 sequences; 62,564 residues). Search parameters included: peptide and fragment mass tolerances, ±10 ppm; fixed modification, carbamidomethylation (cysteine); variable modifications, acetylation (protein N terminus), oxidation (methionine) and deamidation (glutamine and asparagine); enzyme, trypsin with one missed cleavage allowed. The Mascot data files were post-processed in Scaffold (v5.3.1; Proteome Software). Peptide identifications were accepted based on > 91.0% posterior probability by the Percolator algorithm39 resulting in a 0.1% peptide FDR. Protein identifications were accepted with >99.0% probability to achieve a 0.8% protein FDR. A minimum of two identified peptides was required.

Shotgun lipidomics

Ceramide and Sphingomyelin lipid species were analyzed using multidimensional mass spectrometry-based shotgun lipidomic analysis.40 In brief, each cell sample homogenate containing 0.3 mg of protein which was determined with a Pierce BCA assay was accurately transferred to a disposable glass culture test tube. 2 mL medium from each cell culture medium sample was used for lipid extraction. A premixture of lipid internal standards (IS) was added prior to conducting lipid extraction for quantification of the targeted lipid species. Lipid extraction was performed using a modified Bligh and Dyer procedure,41 and each lipid extract was reconstituted in chloroform:methanol (1:1, v/v) at a volume of 400 μL/mg protein. For shotgun lipidomics, lipid extract was further diluted to a final concentration of ~500 fmol total lipids per μL. Mass spectrometric analysis was performed on a triple quadrupole mass spectrometer (TSQ Altis, Thermo Fisher Scientific, San Jose, CA) which was equipped with an automated nanospray device (TriVersa NanoMate, Advion Bioscience Ltd., Ithaca, NY).42 Identification and quantification of lipid species were performed using an in-house automated software program. Data processing (e.g., ion peak selection, baseline correction, data transfer, peak intensity comparison and quantitation) was performed as in.43 The results were normalized to the protein content or medium volume (nmol lipid/mg protein or pmol lipid/ml medium).

RNA samples, real-time quantitative RT-PCR, and RNA-sequencing

De-identified Ewing sarcoma, rhabdomyosarcoma, and synovial sarcoma tumor RNA samples were obtained from the Cooperative Human Tissue Network. Total cellular RNA was isolated using TRIzol reagent (Invitrogen). Reverse transcription was performed using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) as per manufacturer’s instructions. Quantitative PCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher) on Applied Biosystems ViiA 7 Real-Time PCR System. Each sample was analyzed in triplicate. The following primers were used: EWS-FLI1 forward, 5′-GGCAGCAGAACCCTTCTTAT-3′, EWS-FLI1 reverse, 5′-GGCCGTTGCTCTGTATTCTTA-3’; SMPD1 forward, 5′-TGCCAGGTTACATCGCATAG-3′, SMPD1 reverse, 5′-AGGTTGATGGCGGTGAATAG-3’; GPR64 forward, 5′-CTGCAGGATCCCATTGTCTG-3′, GPR64 reverse, 5’ TGAAAGGGGTTGAATCTCCC-3’; and GAPDH forward, 5′-GGTGTGAACCATGAGAAGTATGA-3’, GAPDH reverse, GAGTCCTTCCACGATACCAAAG. RNA-sequencing was performed as in.44 Briefly, cDNA fragment libraries were synthesized using TruSeq stranded mRNA library preparation kit (Illumina). Samples were sequenced on the Illumina HiSeq 3000 platform (Illumina Inc.) using a 50 base-pair single-read (50SR) sequencing module. Sequence reads were aligned to hg19 genome build using TopHat2 with default parameters and quantified with HTSeq algorithm. Differential expression analysis was performed using DESeq (at least 2-fold changes with p value <0.05), followed by functional assessment using Database for Annotation, Visualization and Integrated Discovery (DAVID, http://david.abcc.ncifcrf.gov/) and Ingenuity Pathway Analysis (IPA, Ingenuity Systems, http://www.ingenuity.com).

Immunoblotting and immunoprecipitation

Twenty micrograms of whole-cell lysate was separated by SDS-PAGE and analyzed by immunoblotting.16 The following antibodies were used: sheep polyclonal anti-GPR64 (AF7977, R & D Systems); rabbit polyclonal anti-GPR64 C terminus (GTX70517, GeneTex); goat polyclonal anti-SMPD1 (AF5348, R & D Systems); mouse monoclonal anti-tubulin (DM1A, Thermo Fisher Scientific); mouse monoclonal anti-FLAG (F1804, Sigma-Aldrich); rabbit polyclonal anti-FLI1 (ab15289, Abcam), rabbit monoclonal anti-HA (3724, Cell Signaling Technology); rabbit monoclonal anti-Phospho-CREB (Ser133) (9198, Cell Signaling Technology); rabbit monoclonal anti-CREB (9197, Cell Signaling Technology); rabbit monoclonal anti-RIF1 (95558, Cell Signaling Technology); rabbit polyclonal anti-SPOP (16750-1-AP, Proteintech); mouse monoclonal anti-p21 (2946, Cell Signaling Technology); mouse monoclonal anti-p27 (sc-528, Santa Cruz Biotechnology); rabbit polyclonal antibody anti-p16 (sc-468, Santa Cruz Biotechnology); rabbit monoclonal anti-p73 (14620, Cell Signaling Technology); rabbit monoclonal anti-β3-Tubulin (5568, Cell Signaling Technology); rabbit monoclonal anti-Neurofilament-L (2837, Cell Signaling Technology); rabbit monoclonal anti-caspase-3 (9665, Cell Signaling Technology); mouse monoclonal anti-PARP1 (9542,Cell Signaling Technology); anti-rabbit IgG, HRP-linked antibody (7074, Cell Signaling Technology); anti-mouse IgG, HRP-linked antibody (7076, Cell Signaling Technology); rabbit anti-goat IgG HRP-linked antibody (HAF017, R & D Systems); and donkey anti-Sheep IgG HRP-linked antibody (HAF016, R & D Systems).

For immunoprecipitation, cells were lysed in TNE buffer (10 mM Tris [pH 7.4], 150 mM NaCl, 1% Nonidet P-40, 1 mM EDTA, and protease inhibitors).44 The following antibodies were used: mouse monoclonal anti-FLAG (F1804, Sigma-Aldrich), Mouse TrueBlot ULTRA: anti-mouse IgG HRP (18-8817-30, Rockland), and Rabbit TrueBlot: anti-rabbit IgG HRP (18-8816-31, Rockland).

Immunofluorescence

Cells grown on coverslips were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature, washed with PBS, and permeabilized with 0.3% pre-chilled Triton X-100/PBS for 5 min. The samples were blocked with 3% BSA for 1 h and incubated with the primary antibody overnight. The samples were washed three times with 0.2% Tween 20 in PBS, incubated with the secondary antibody for 2 h, and then washed three times with 0.2% Tween 20 in PBS. The following primary antibodies were used: mouse monoclonal anti-FLAG (F1804, Sigma-Aldrich) and rabbit polyclonal anti-GPR64 C terminus (GTX70517, GeneTex). The following secondary antibodies were used: Alexa Fluor 488, goat anti-mouse IgG (A-11029, Thermo Fisher Scientific) and Alexa Fluor 488, goat anti-rabbit IgG (A-32731, Thermo Fisher Scientific). Nuclei were stained with DAPI (D1306, Thermo Fisher Scientific). The images were collected with a FluoView FV3000 confocal laser scanning microscope (Olympus).

Chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP)45 was performed using rabbit polyclonal anti-FLI1 antibody (ab15289, Abcam) or control rabbit IgG (ab37415, Abcam). The primer sequences used for ChIP are as follows: SMPD1 forward, AAACTTTCCCTTCGCCCTC; SMPD1 reverse, ATTCCTCTTCCCCTCACTCC; GPR64 forward, AGGGGGGCAGTAAAATGAG; GPR64 reverse, GAGGTGGAGGG GGTATATAAAG NR0B1 forward, 5′-GTTTGTGCCTTCATGGGAAATGGTTATTC-3’; NR0B1 reverse, 5′-CTAGTGTCTTGTGTGTCCCTAGGG-3′; EZH2 forward, 5′-GACACGTGCTTAGAACTACGAACAG-3′; EZH2 reverse, 5′-TTTGGCTGGCCGAGCTT-3; CD133 forward, 5′-CGACCACAGCGGGAGTAG-3′; CD133 reverse, 5′-GCGAGAGGCTGGGAAGGT-3′; GAPDH forward, 5′-TCCTCCTGTTTCATCCAAGC-3′; and GAPDH reverse, 5′-TAGTAGCCGGGCCCTACTTT-3′.

Cell proliferation and xenograft tumorigenicity assays

Anchorage-dependent cell proliferation was assessed by the IncuCyte live-cell imaging system (Essen BioScience/Sartorius). The IncuCyte system monitors cell proliferation by analyzing the occupied area (% confluence) of cell images over time. At least four fields from five wells were assayed for each experimental condition. The cell seeding density was 2000 cells per well in a 96-well plate. For each assay, biological replicates were performed to confirm the reproducibility of results.

Anchorage-independent cell proliferation was evaluated by soft agar colony formation assays. A673 and PDX1 cells were infected with lentiviruses expressing shRNAs against SMPD1, GPR64, or control scrambled shRNA and were selected with 2 μg/mL puromycin. Four days after infection, 4×103 cells were plated in soft agar. The soft agar cultures were composed of two layers: a base layer [3 mL in a 60-mm dish; DMEM/10% fetal bovine serum/0.6% noble agar (A5431, MilliporeSigma)/penicillin/streptomycin] and a cell layer (2 mL in a 60-mm dish; DMEM/10% fetal bovine serum/0.3% noble agar/penicillin/streptomycin). Colonies were grown for three weeks and counted. Colonies (>50 cells) were scored by randomly counting nine fields per dish.

For xenograft tumorigenicity assays, cells were subcutaneously injected into the flanks of SCID mice (1.5×106 cells/injection, four mice/group for SMPD1 knockdown and five mice/group for GPR64 knockdown). Tumor growth was monitored weekly using a caliper. While it is not possible to predict the effect size, we chose the sample size of four and five mice per group based on our prior experience with xenograft experiments. Mice were randomly allocated to treatment groups. Blinding of the researcher measuring tumor size was employed. The animal research method was reviewed and approved for humaneness by the Institutional Animal Care and Use Committee of the University of Texas Health Science Center at San Antonio.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical analysis

Data are expressed as mean ± SEM. Two-tailed Student’s t tests were used to calculate the p-values. The results were considered significant when p < 0.05. The p-values are indicated in the figures. The number of replicates, independent samples, and animals is indicated in the figure legends.

Supplementary Material

1

2

3

4

5

6

ACKNOWLEDGMENTS

We thank Robert Eisenman for helpful discussions and critical review of the manuscript. We thank Patrick Grohar for cell lines. We thank the Cooperative Human Tissue Network for tumor RNA samples. This work was supported by the National Cancer Institute, the National Institutes of Health (CA283414 to Y.S., CA165995 to P.J.H., and AG013319 and AG044271 to the Lipidomics Core [X.H.]), the Cancer Prevention and Research Institute of Texas (RP160487 and RP190385 to Y.S., RP160716 and RP220599 to P.J.H., and RP160732 to Y.C.), the Owens Medical Research Foundation (to Y.S.), the Mays Cancer Center P30 Cancer Center Support Grant from the National Cancer Institute (CA054174) for the mass spectrometry and next-generation sequencing shared resources, and the Greehey Children’s Cancer Research Institute Pilot Project Award (to Y.S.). Mass spectrometry analyses were conducted at the University of Texas Health Science Center at San Antonio Institutional Mass Spectrometry Laboratory, with the expert technical assistance of Sammy Pardo and Dana Molleur, supported in part by NIH grant P30 CA54174-23 (to S.T.W., Mays Cancer Center Mass Spectrometry Shared Resource) and NIH grant S10 OD030371-01A1 (to S.T.W.) for purchase of the Orbitrap Exploris 480 mass spectrometer.

Figure 1. Ewing sarcoma depends on SMPD1, a transcriptional target of EWS-FLI1

(A) shRNA-mediated knockdown of EWS-FLI1 in A673 Ewing sarcoma cells. Tubulin serves as a loading control.

(B) EWS-FLI1 knockdown resulted in 7.6-fold reduced protein levels of SMPD1 in the secretome. The quantification based on spectral counting by mass spectrometry is shown.

(C) EWS-FLI1 knockdown reduces SMPD1 RNA and protein levels in A673 cells. (Left) The quantitative real-time RT-PCR data (n = 3). (Right) The immunoblotting data.

(D) EWS-FLI1 induces SMPD1 RNA and protein expression in human mesenchymal stem cells (hMSCs), putative cells of origin of Ewing sarcoma. (Left) The quantitative real-time RT-PCR data (n = 3). (Right) The immunoblotting data.

(E) EWS-FLI1 binds to the SMPD1 gene promoter. Chromatin immunoprecipitation analysis for EWS-FLI1 binding to the promoter of SMPD1 and known EWS-FLI1 target genes (NR0B1, EZH2, and CD133) as well as control (GAPDH), with and without EWS-FLI1 silencing (n = 3).

(F) SMPD1 is highly expressed in Ewing sarcoma tumors and cell lines. SMPD1 RNA expression was analyzed by RT-qPCR and was normalized to the levels in hMSCs (n = 3). EWS, Ewing sarcoma; RMS, rhabdomyosarcoma; SS, synovial sarcoma.

(G) SMPD1 knockdown inhibits Ewing sarcoma proliferation. SMPD1 was silenced by siRNAs, and cell proliferation was assessed by the IncuCyte live-cell imaging system. SMPD1 knockdown barely affected proliferation of 293T and HeLa cells. (Top) SMPD1 knockdown was verified by immunoblotting.

(H) SMPD1 knockdown inhibits anchorage-independent growth of A673 and PDX1 cells. Scale bars: 100 μm (3 independent experiments; 9 fields each). (Top) shRNA-mediated silencing of SMPD1 was verified by immunoblotting.

(I) SMPD1 knockdown inhibits xenograft tumorigenicity of A673 cells (4 mice per group; p = 0.0001).

(J) Recombinant SMPD1 rescues proliferation arrest induced by SMPD1 knockdown. A673 and PDX1 cells were transfected with SMPD1 siRNAs or control siRNAs and treated with or without the indicated concentration of recombinant SMPD1. Cell proliferation was assessed by the IncuCyte.

Figure 2. GPR64 functions as the ceramide-responsive receptor

(A) Ceramide rescues proliferation arrest induced by SMPD1 knockdown. A673 cells were transfected with SMPD1 siRNAs or control siRNAs and left untreated or treated with 1 μM C16, C18, or C24 ceramide. Cell proliferation was assessed by the IncuCyte.

(B) A mass spectrometry analysis identified GPR64 as an interactor of biotin-ceramide.

(C) SMPD1 knockdown and GPR64 knockdown cause similar gene expression changes. The gene set enrichment analysis determined a positive normalized enrichment score of 1.84 (p = 0.00) from 150 upregulated genes upon SMPD1 knockdown and a negative normalized enrichment score of 2.13 (p = 0.00) from 101 downregulated genes upon SMPD1 knockdown. The list of genes used for the gene set enrichment analysis is shown in Table S3.

(D) Biotin-ceramide pulls down endogenous GPR64 from A673 cells. A673 cells were transfected with control siRNA or GPR64 siRNA. Cells were lysed by Dounce homogenization, and cell lysate was incubated with biotin-ceramide or biotin. The interacting proteins were isolated by streptavidin agarose pull-down and analyzed by anti-GPR64 immunoblotting.

(E) Biotin-ceramide pulls down transfected GPR64-HA from 293T cells. 293T cells were transfected with GPR64-HA. Cells were lysed by Dounce homogenization, and cell lysate was incubated with biotin-ceramide or biotin. The interacting proteins were isolated by streptavidin agarose pull-down and analyzed by anti-HA immunoblotting.

(F) Endogenous GPR64 mediates cAMP signaling by ceramide treatment in Ewing sarcoma cells. A673 cells were transfected with control siRNA or GPR64 siRNA and treated with 1 μM C18 ceramide for 20 min. (Left) The levels of cAMP were assessed by cAMP ELISA. (Right) The levels of phospho-CREB, total CREB, and GPR64 were assessed by immunoblotting.

(G) Transfected GPR64 mediates cAMP signaling by ceramide treatment in 293T cells. 293T cells were transfected with GPR64-HA or empty vector and treated with and without 1 μM C18 ceramide for 20 or 30 min. (Left) The levels of cAMP were assessed by cAMP ELISA. (Right) The levels of phospho-CREB, total CREB, and GPR64-HA were assessed by immunoblotting.

Figure 3. Ceramide binds GPR64

(A) Ceramide binds the C-terminal domain, but not the N-terminal domain, of GPR64. GPR64 N-terminal domain (residues 1–566 with a C-terminal HA tag) and GPR64 C-terminal domain (residues 607–1017 with an N-terminal signal peptide and a C-terminal FLAG tag) were transfected in 293T cells and used for biotin-ceramide/biotin pull-down assays.

(B) Ceramide binds the N-terminal portion of the seven transmembrane domain of GPR64. GPR64 TM3-C (residues 694–1017), TM4-C (residues 738–1017), TM1–4 (residues 629–789), and TM1–5 (residues 629–834) were transfected in 293T cells and used for biotin-ceramide/biotin pull-down assays (all deletion mutants with an N-terminal signal peptide and a C-terminal FLAG tag). While TM1–4 and TM1–5 displayed robust binding to biotin-ceramide, TM3-C and TM4-C did not detectably bind biotin-ceramide, suggesting that ceramide binds to the N-terminal portion of the seven transmembrane domain.

(C) GPR64 paralogs, GPR97/ADGRG3 and GPR126/ADGRG6, do not bind ceramide. The full-length or C-terminal domain of GPR97 and GPR126 (all with a C-terminal FLAG tag; the C-terminal domain with an N-terminal signal peptide) was transfected in 293T cells and used for biotin-ceramide/biotin pull-down assays.

(D) DHEA does not affect ceramide binding to GPR64. Endogenous GPR64 in A673 cells was pulled down with biotin-ceramide or biotin. 50-fold molar excess of DHEA did not affect biotin-ceramide pull-down of GPR64 (lane 4).

Figure 4. Ewing sarcoma depends on GPR64, a transcriptional target of EWS-FLI1

(A) EWS-FLI1 knockdown reduces GPR64 RNA and protein levels in A673 cells. (Top) The quantitative real-time RT-PCR data (n = 3). (Bottom) The immunoblotting data.

(B) EWS-FLI1 induces GPR64 RNA and protein expression in hMSCs. (Top) The quantitative real-time RT-PCR data (n = 3). (Bottom) The immunoblotting data.

(C) EWS-FLI1 binds to the GPR64 gene promoter. Chromatin immunoprecipitation analysis for EWS-FLI1 binding to the promoter of GPR64 and known EWS-FLI1 target genes (NR0B1, EZH2, and CD133), as well as control (GAPDH), with and without EWS-FLI1 silencing (n = 3). Note the data for NR0B1, EZH2, CD133, and GAPDH are the same as those in Figure 1E.

(D) GPR64 is highly expressed in Ewing sarcoma tumors and cell lines. GPR64 RNA expression was analyzed by RT-qPCR and normalized to the levels in hMSCs (n = 3).

(E) GPR64 knockdown inhibits Ewing sarcoma proliferation. GPR64 was silenced by siRNAs, and cell proliferation was assessed by the IncuCyte system. GPR64 knockdown barely affected the proliferation of 293T and HeLa cells. (Top) GPR64 knockdown was verified by immunoblotting.

(F) GPR64 knockdown inhibits anchorage-independent growth of A673 and PDX1 cells (3 independent experiments; 9 fields each). (Top) shRNA-mediated silencing of GPR64 was verified by immunoblotting.

(G) GPR64 knockdown inhibits xenograft tumorigenicity of A673 cells (5 mice per group; p = 0.0002).

(H) A model for the SMPD1-ceramide-GPR64 pathway in Ewing sarcoma. Created with BioRender.com.

Figure 5. Ceramide induces the cleavage of the C-terminal ICD of GPR64

(A) Anti-GPR64 C-terminal antibody detects GPR64 C-terminal fragments. A673 cells were transfected with control siRNA or GPR64 siRNA, and the protein levels of GPR64 were analyzed by immunoblotting. (Left) Anti-GPR64 N-terminal antibody immunoblotting. (Right) Anti-GPR64 C-terminal antibody immunoblotting, which detected approximately 33 and 17 kDa fragments, both silenced by GPR64 siRNA.

(B) Ceramide induces GPR64 C-terminal fragments. A673 cells were left untreated or treated with 1 μM C18 ceramide for 16 h. The levels of GPR64 C-terminal fragments were assessed by anti-GPR64 C-terminal antibody immunoblotting.

(C) Exogenously expressed GPR64 C-terminal intracellular domain (ICD) is located in the nucleus. A673 cells were infected with lentiviruses expressing the FLAG-tagged GPR64 ICD (879–1017) or empty vector, and the subcellular location of FLAG-ICD was examined by anti-FLAG immunofluorescence. The nuclei were stained with DAPI. Scale bars: 10 μm.

(D) The GPR64 C-terminal antibody detects a nuclear signal in A673 cells, which is abolished by GPR64 siRNA knockdown. Scale bars: 10 μm.

(E) GPR64 ICD rescues growth arrest induced by GPR64 knockdown. A673 cells were infected with lentiviruses expressing FLAG-ICD or empty vector, followed by transfection with control siRNA or GPR64 siRNA. (Left) The protein levels of FLAG-ICD, endogenous full-length GPR64, and tubulin were assessed by immunoblotting. Note that the GPR64 cDNA clone is codon optimized and harbors numerous silent nucleotide substitutions, making the ICD expressed from GPR64 ICD cDNA resistant to silencing by GPR64 siRNA. (Right) Proliferation of cells was assessed by the IncuCyte.

(F) GPR64 ICD rescues growth arrest induced by SMPD1 knockdown. A673 cells were infected with lentiviruses expressing FLAG-ICD or empty vector, followed by transfection with control siRNA or SMPD1 siRNA. (Left) The protein levels of FLAG-ICD, SMPD1, and tubulin were assessed by immunoblotting. (Right) Proliferation of cells was assessed by the IncuCyte.

(G) Forskolin and bromo-cAMP induce the GPR64 C-terminal fragments. A673 cells were treated with the indicated concentration of forskolin or bromo-cAMP for 16 h, and the levels of GPR64 C-terminal fragments were assessed by anti-GPR64 C-terminal antibody immunoblotting.

(H) The suppression of cAMP-PKA signaling blocks the induction of the GPR64 C-terminal fragments by ceramide. A673 cells were treated with 1 μM C18 ceramide for 16 h, followed by treatment with the indicated concentration of NKY80 (adenylate cyclase inhibitor) or H-89 (PKA inhibitor) for 48 h. The levels of GPR64 C-terminal fragments were assessed by anti-GPR64 C-terminal antibody immunoblotting.

(I) A γ-secretase inhibitor, DAPT, blocks the induction of the GPR64 C-terminal fragments by ceramide. A673 cells were treated with 1 μM C18 ceramide for 16 h, followed by treatment with the indicated concentration of DAPT for 48 h. The levels of GPR64 C-terminal fragments were assessed by anti-GPR64 C-terminal antibody immunoblotting.

Figure 6. The GPR64 ICD restrains the protein levels of RIF1 in a manner dependent on SPOP

(A) Exogenous GPR64 ICD reduces the RIF1 protein levels in A673 cells. A673 cells were infected with lentiviruses expressing the FLAG-GPR64 ICD or empty vector, and the levels of FLAG-ICD, RIF1, and tubulin were assessed by immunoblotting.

(B) Knockdown of SMPD1 and GPR64 increases the RIF1 protein levels in A673 cells. A673 cells were transfected with SMPD1 siRNA, GPR64 siRNA, or control siRNA, and the protein levels of SMPD1, GPR64, RIF1, and tubulin were assessed by immunoblotting.

(C) Ceramide treatment reduces the RIF1 protein levels in A673 cells. A673 cells were treated with and without 1 μM C18 ceramide for 16 h, and the protein levels of RIF1 and tubulin were assessed by immunoblotting.

(D) RIF1 knockdown rescues growth arrest induced by GPR64 knockdown in A673 cells. A673 cells were infected with lentiviruses expressing RIF1 shRNA or control shRNA. The cells were subsequently transfected with GPR64 siRNA or control siRNA. (Left) The protein levels of GPR64, RIF1, and tubulin were assessed by immunoblotting. (Right) Cell proliferation was assessed by the IncuCyte.

(E) RIF1 knockdown rescues growth arrest induced by SMPD1 knockdown in A673 cells. A673 cells were infected with lentiviruses expressing RIF1 shRNA or control shRNA. The cells were subsequently transfected with SMPD1 siRNA or control siRNA. (Left) The protein levels of SMPD1, RIF1, and tubulin were assessed by immunoblotting. (Right) Cell proliferation was assessed by the IncuCyte.

(F) Ceramide-induced RIF1 degradation can be rescued by a proteasome inhibitor. A673 cells were treated with 1 μM C18 ceramide for 16 h, followed by the indicated concentration of MG-132 for 6 h. The protein levels of RIF1 and tubulin were assessed by immunoblotting.

(G) FLAG-GPR64 ICD co-immunoprecipitates with endogenous RIF1 and SPOP in A673 cells. A673 cells were infected with lentiviruses expressing FLAG-GPR64 ICD or empty vector. Cells were treated with 25 μM MG-132 for 6 h and cell lysates were immunoprecipitated with anti-FLAG antibody, followed by immunoblotting for FLAG, RIF1, and SPOP.

(H) FLAG-GPR64 ICD harboring mutations of the SPOP-binding motif does not co-immunoprecipitate with SPOP in A673 cells. A673 cells were infected with lentiviruses expressing the FLAG-GPR64 ICD, FLAG-GPR64 ICD with mutations of the SPOP-binding motif (3SA), or empty vector. Cells were treated with 25 μM MG-132 for 6 h, and cell lysates were immunoprecipitated with anti-FLAG antibody, followed by immunoblotting for FLAG and SPOP.

(I) SPOP knockdown blocks RIF1 degradation by GPR64 ICD. A673 cells were infected with lentiviruses expressing the FLAG-GPR64 ICD or empty vector, followed by transfection with SPOP siRNA or control siRNA. The protein levels of SPOP, FLAG-ICD, RIF1, and tubulin were assessed by immunoblotting.

(J) SPOP knockdown blocks RIF1 degradation by ceramide. A673 cells were transfected with SPOP siRNA or control siRNA and treated with 1 μM C18 ceramide for 16 h. The protein levels of SPOP, RIF1, and tubulin were assessed by immunoblotting.

(K) GPR64 ICD harboring a deletion of residues 906–956 does not rescue growth arrest induced by GPR64 knockdown. A673 cells were infected with lentiviruses expressing FLAG-ICD del lacking residues 906–956 or empty vector, followed by transfection with control siRNA or GPR64 siRNA. (Left) The protein levels of endogenous full-length GPR64, FLAG-ICD del, RIF1, and tubulin were assessed by immunoblotting. (Right) Proliferation of cells was assessed by the IncuCyte.

(L) GPR64 ICD harboring mutations of the SPOP-binding motif does not rescue growth arrest induced by GPR64 knockdown. A673 cells were infected with lentiviruses expressing FLAG-ICD 3SA with mutations of the SPOP-binding motif or empty vector, followed by transfection with control siRNA or GPR64 siRNA. (Left) The protein levels of endogenous full-length GPR64, FLAG-ICD 3SA, RIF1, and tubulin were assessed by immunoblotting. (Right) Proliferation of cells was assessed by the IncuCyte.

Figure 7. Ceramide induces the cleavage of the GPR64 ICD, which serves as a platform to degrade RIF1 via a SPOP-dependent mechanism

Created with BioRender.com.

KEY RESOURCES TABLE

REAGENT or RESOURCE	SOURCE	IDENTIFIER	
Antibodies	
GPR64 Antibody	R & D Systems	AF7977; RRID:AB_2722556	
GPR64 C terminus antibody	GeneTex	GTX70517; RRID:AB_370852	
SMPD1	R & D Systems	AF5348; RRID:AB_2193396	
tubulin	Developmental Studies Hybridoma Bank	E7; RRID:AB_528499	
FLAG	Sigma-Aldrich	F1804; RRID:AB_262044	
FLI1	Abcam	ab15289, RRID:AB_301825	
HA-Tag	Cell Signaling Technology	3724; RRID:AB_1549585	
Phospho-CREB	Cell Signaling Technology	9198; RRID:AB_2561044	
CREB	Cell Signaling Technology	9197; RRID:AB_331277	
RIF1	Cell Signaling Technology	95558; RRID:AB_2800249	
ATM	Cell Signaling Technology	2873; RRID:AB_2062659	
SPOP	Proteintech	16750-1-AP; RRID:AB_2756394	
p21	Cell Signaling Technology	2946; RRID:AB_2260325	
p27	Santa Cruz Biotechnology	sc-528; RRID:AB_632129	
p16	Santa Cruz Biotechnology	sc-468; RRID:AB_632103	
p73	Cell Signaling Technology	14620; RRID:AB_2798542	
β3-tubulin	Cell Signaling Technology	5568; RRID:AB_10694505	
neurofilament-L	Cell Signaling Technology	2837; RRID:AB_823575	
Caspase-3	Cell Signaling Technology	9665, AB_2069872	
PARP	Cell Signaling Technology	9542; RRID:AB_2160739	
Anti-rabbit IgG, HRP-Antibody	Cell Signaling Technology	7074; RRID:AB_2099233	
Anti-mouse IgG, HRP- Antibody	Cell Signaling Technology	7076; RRID:AB_330924	
Rabbit Anti-Goat IgG HRP Antibody	R & D Systems	HAF017; RRID:AB_562588	
Donkey Anti-Sheep IgG HRP	R & D Systems	HAF016, RRID:AB_562591	
Alexa Fluor 488, goat anti-mouse IgM	Thermo Fisher Scientific	A-11029, RRID:AB_2534088	
Alexa Fluor 488, goat anti-rabbit IgG	Thermo Fisher Scientific	A32731, RRID:AB_2633280	
control rabbit IgG	Abcam	ab37415; RRID:AB_2631996	
Mouse TrueBlot® ULTRA: Anti-Mouse Ig HRP	Rockland Immunochemicals	18-8817-30; RRID:AB_2610849	
Rabbit TrueBlot: Anti-Rabbit IgG HRP	Rockland Immunochemicals	18-8816-31; RRID:AB_2610847	
Bacterial and virus strains	
DH10B	Thermo Fisher Scientific	12331013	
NEB® Stable Competent E. coli	New England Biolabs	C3040H	
Biological samples	
De-identified Ewing sarcoma, rhabdomyosarcoma, and synovial sarcoma tumor RNA samples	Cooperative Human Tissue Network	N/A	
Chemicals, peptides, and recombinant proteins	
Lipofectamine™ RNAiMAX Transfection Reagent	Thermo Fisher Scientific	13778150	
Recombinant Human SMPD1 Protein	R & D Systems	5348-PD-010	
puromycin dihydrochloride	MilliporeSigma	P8833	
MG-132	MilliporeSigma	474790	
Biotin-ceramide	Echelon Biosciences	S-300B	
C18 ceramide	Avanti Polar Lipids, Inc	860518	
C18 sphingomyelin	Cayman Chemical	24355	
C18 glucosylceramide	Avanti Polar Lipids, Inc	860547	
C18:1 dihydroceramide	Avanti Polar Lipids, Inc	860624	
Forskolin	Thermo Scientific	J63292.MA	
Paroxetine (hydrochloride)	Cayman Chemical	14998	
Fluoxetine (hydrochloride)	Cayman Chemical	14418	
NKY80	Cayman Chemical	17777	
8-bromo Cyclic AMP (sodium salt)	Cayman Chemical	14431	
Dehydroepiandrosterone	Cayman Chemical	15728	
Biotin	Sigma Aldrich	B4501	
Hygromycin B	Thermo Fisher Scientific	10687010	
DAPT	Cayman Chemical	13197	
H89	Cayman Chemical	10,010,556	
Pierce™ Protein G Agarose	Thermo Fisher Scientific	20398	
Pierce™ High Capacity Streptavidin Agarose	Thermo Fisher Scientific	20359	
Protein A Agarose/Salmon Sperm DNA	Thermo Fisher Scientific	16157	
DAPI (4′,6-Diamidino-2-Phenylindole, Dihydrochloride)	Thermo Fisher Scientific	D1306	
Applied Biosystems™ PowerUp™ SYBR™ Green Master Mix for qPCR	Thermo Fisher Scientific	A25742	
High-Capacity cDNA Reverse Transcription Kit	Thermo Fisher Scientific	4368814	
Critical commercial assays	
Cyclic AMP ELISA Kit	Cayman Chemical	581001	
Deposited data	
The RNA-sequencing data	the GEO database	GSE252963	
The mass spectrometry proteomics data	the MassIVE database	PXD048359	
The lipidomics data	The MetaboLights database	MTBLS10388	
Experimental models: Cell lines	
A673	ATCC	CRL-1598	
TC32	Dr. Patrick Grohar	N/A	
TC71	Coriell Institute	GM11654	
293T	ATCC	CRL-11268	
SK-NEP-1	ATCC	HTB-48	
SK-N-MC	ATCC	HTB-10	
EW8	Dr. Patrick Grohar	N/A	
CHLA-9	Dr. Patrick Grohar	N/A	
SK-ES-1	ATCC	HTB-86	
ES-1	Dr. Peter Houghton	N/A	
ES-2	Dr. Peter Houghton	N/A	
ES-3	Dr. Peter Houghton	N/A	
ES-4	Dr. Peter Houghton	N/A	
ES-6	Dr. Peter Houghton	N/A	
ES-7	Dr. Peter Houghton	N/A	
ES-8	Dr. Peter Houghton	N/A	
Cord blood-derived human mesenchymal stem cells	Vitro Biopharma	SC00A1	
Experimental models: Organisms/strains	
C.B.17SC scid−/− mice, 5–6 weeks old	Taconic Biosciences	CB17SC	
Recombinant DNA	
pcDNA3.1 vector	Invitrogen/Thermo Fisher Scientific	V79020	
pCDH1-MCS1-EF1-Puro vector	System Biosciences	CD510A-1	
Oligonucleotides	
GPR64 forward, CTGCAGGATCCCATTGTCTG	Thermo Fisher Scientific	N/A	
GPR64 reverse, TGAAAGGGGTTGAATCTCCC	Thermo Fisher Scientific	N/A	
SMPD1 forward, TGCCAGGTTACATCGCATAG	Thermo Fisher Scientific	N/A	
SMPD1 reverse, AGGTTGATGGCGGTGAATAG	Thermo Fisher Scientific	N/A	
EWS-FLI1 forward, 5′-GGCAGCAGAACCCTTCTTAT-3′;	Thermo Fisher Scientific	N/A	
EWS-FLI1 reverse, 5′-GGCCGTTGCTCTGTATTCTTA-3	Thermo Fisher Scientific	N/A	
NR0B1 Promoter forward, 5′-GTTTGTGCCTTCATGGGAAATGGTTATTC-3′	Thermo Fisher Scientific	N/A	
NR0B1 Promoter reverse, 5′-CTAGTGTCTTGTGTGTCCCTAGGG-3′	Thermo Fisher Scientific	N/A	
EZH2 Promoter forward, 5′-GACACGTGCTTAGAACTACGAACAG-3′;	Thermo Fisher Scientific	N/A	
EZH2 Promoter reverse, 5′-TTTGGCTGGCCGAGCTT-3	Thermo Fisher Scientific	N/A	
CD133 Promoter forward, 5′-CGACCACAGCGGGAGTAG-3′;	Thermo Fisher Scientific	N/A	
CD133 Promoter reverse, 5′-GCGAGAGGCTGGGAAGGT-3′	Thermo Fisher Scientific	N/A	
GAPDH Promoter forward, 5′-TCCTCCTGTTTCATCCAAGC-3′;	Thermo Fisher Scientific	N/A	
GAPDH Promoter reverse, 5′-TAGTAGCCGGGCCCTACTTT-3′	Thermo Fisher Scientific	N/A	
GPR64 Promoter forward, AGGGGGGCAGTAAAATGAG	Thermo Fisher Scientific	N/A	
GPR64 Promoter reverse, GAGGTGGAGGGGGTATATAAAG	Thermo Fisher Scientific	N/A	
SMPD1 Promoter forward, AAACTTTCCCTTCGCCCTC	Thermo Fisher Scientific	N/A	
SMPD1 Promoter reverse, ATTCCTCTTCCCCTCACTCC	Thermo Fisher Scientific	N/A	
Human GPR64 siRNA SMARTPool	Dharmacon	M-003812-00-00	
Human SMPD1 siRNA SMARTPool	Dharmacon	M-006676-00-00	
Human SPOP siRNA SMARTPool	Dharmacon	M-017919-00-00	
Non-Targeting siRNA Pool #2	Dharmacon	D-001206-14-05	

Highlights

Ewing sarcoma depends on secreted SMPD1, a ceramide-generating enzyme, and ceramide

GPR64 responds to ceramide and mediates critical growth signaling in Ewing sarcoma

Ceramide induces the cleavage of the C-terminal intracellular domain (ICD) of GPR64

GPR64 ICD restrains the protein levels of RIF1 via a SPOP-dependent mechanism

SUPPLEMENTAL INFORMATION

Supplemental information can be found online at https://doi.org/10.1016/j.celrep.2024.114497.

DECLARATION OF INTERESTS

The authors declare no competing interests.
==== Refs
REFERENCES

1. Lessnick SL , and Ladanyi M (2012). Molecular pathogenesis of Ewing sarcoma: new therapeutic and transcriptional targets. Annu. Rev. Pathol 7 , 145–159.21942527
2. Grunewald TGP , Cidre-Aranaz F , Surdez D , Tomazou EM , de Alava E , Kovar H , Sorensen PH , Delattre O , and Dirksen U (2018). Ewing sarcoma. Nat. Rev. Dis. Prim 4 , 5. 10.1038/s41572-018-0003-x.29977059
3. Riggi N , Suva ML , and Stamenkovic I (2021). Ewing’s Sarcoma. N. Engl. J. Med 384 , 154–164. 10.1056/NEJMra2028910.33497548
4. Hannun YA , and Obeid LM (2018). Sphingolipids and their metabolism in physiology and disease. Nat. Rev. Mol. Cell Biol 19 , 175–191. 10.1038/nrm.2017.107.29165427
5. Schuchman EH , and Desnick RJ (2017). Types A and B Niemann-Pick disease. Mol. Genet. Metabol 120 , 27–33. 10.1016/j.ymgme.2016.12.008.
6. Horinouchi K , Erlich S , Perl DP , Ferlinz K , Bisgaier CL , Sandhoff K , Desnick RJ , Stewart CL , and Schuchman EH (1995). Acid sphingomyelinase deficient mice: a model of types A and B Niemann-Pick disease. Nat. Genet 10 , 288–293. 10.1038/ng0795-288.7670466
7. Carpinteiro A , Becker KA , Japtok L , Hessler G , Keitsch S , Pozgajova M , Schmid KW , Adams C , Muller S , Kleuser B , (2015). Regulation of hematogenous tumor metastasis by acid sphingomyelinase. EMBO Mol. Med 7 , 714–734. 10.15252/emmm.201404571.25851537
8. Lala T , and Hall RA (2022). Adhesion G protein-coupled receptors: structure, signaling, physiology, and pathophysiology. Physiol. Rev 102 , 1587–1624. 10.1152/physrev.00027.2021.35468004
9. Grunddal KV , Tonack S , Egerod KL , Thompson JJ , Petersen N , Engelstoft MS , Vagne C , Keime C , Gradwohl G , Offermanns S , and Schwartz TW (2021). Adhesion receptor ADGRG2/GPR64 is in the GI-tract selectively expressed in mature intestinal tuft cells. Mol. Metabol 51 , 101231. 10.1016/j.molmet.2021.101231.
10. Richter GH , Fasan A , Hauer K , Grunewald TG , Berns C , Rossler S , Naumann I , Staege MS , Fulda S , Esposito I , and Burdach S (2013). G-Protein coupled receptor 64 promotes invasiveness and metastasis in Ewing sarcomas through PGF and MMP1. J. Pathol 230 , 70–81. 10.1002/path.4170.23338946
11. Nakamura K , Asanuma K , Okamoto T , Yoshida K , Matsuyama Y , Kita K , Hagi T , Nakamura T , and Sudo A (2022). GPR64, Screened from Ewing Sarcoma Cells, Is a Potential Target for Antibody-Based Therapy for Various Sarcomas. Cancers 14 , 814. 10.3390/cancers14030814.35159080
12. Holting TLB , Cidre-Aranaz F , Matzek D , Popper B , Jacobi SJ , Funk CM , Geyer FH , Li J , Piseddu I , Cadilha BL , (2022). Neomorphic DNA-binding enables tumor-specific therapeutic gene expression in fusion-addicted childhood sarcoma. Mol. Cancer 21 , 199. 10.1186/s12943-022-01641-6.36229873
13. Richards L , Das S , and Nordman JT (2022). Rif1-Dependent Control of Replication Timing. Genes 13 , 550. 10.3390/genes13030550.35328102
14. Blasiak J , Szczepanska J , Sobczuk A , Fila M , and Pawlowska E (2021). RIF1 Links Replication Timing with Fork Reactivation and DNA Double-Strand Break Repair. Int. J. Mol. Sci 22 , 11440. 10.3390/ijms222111440.34768871
15. Mattarocci S , Hafner L , Lezaja A , Shyian M , and Shore D (2016). Rif1: A Conserved Regulator of DNA Replication and Repair Hijacked by Telomeres in Yeasts. Front. Genet 7 , 45. 10.3389/fgene.2016.00045.27066066
16. Jayabal P , Zhou F , Lei X , Ma X , Blackman B , Weintraub ST , Houghton PJ , and Shiio Y (2021). NELL2-cdc42 signaling regulates BAF complexes and Ewing sarcoma cell growth. Cell Rep. 36 , 109254. 10.1016/j.celrep.2021.109254.34233189
17. Riggi N , Knoechel B , Gillespie SM , Rheinbay E , Boulay G , Suva ML , Rossetti NE , Boonseng WE , Oksuz O , Cook EB , (2014). EWS-FLI1 utilizes divergent chromatin remodeling mechanisms to directly activate or repress enhancer elements in Ewing sarcoma. Cancer Cell 26 , 668–681. 10.1016/j.ccell.2014.10.004.25453903
18. Patel M , Simon JM , Iglesia MD , Wu SB , McFadden AW , Lieb JD , and Davis IJ (2012). Tumor-specific retargeting of an oncogenic transcription factor chimera results in dysregulation of chromatin and transcription. Genome Res. 22 , 259–270. 10.1101/gr.125666.111.22086061
19. Bilke S , Schwentner R , Yang F , Kauer M , Jug G , Walker RL , Davis S , Zhu YJ , Pineda M , Meltzer PS , and Kovar H (2013). Oncogenic ETS fusions deregulate E2F3 target genes in Ewing sarcoma and prostate cancer. Genome Res. 23 , 1797–1809. 10.1101/gr.151340.112.23940108
20. Bi J , Khan A , Tang J , Armando AM , Wu S , Zhang W , Gimple RC , Reed A , Jing H , Koga T , (2021). Targeting glioblastoma signaling and metabolism with a re-purposed brain-penetrant drug. Cell Rep. 37 , 109957. 10.1016/j.celrep.2021.109957.34731610
21. Niziolek GM , Boudreau RM , Baker J , Friend LA , Makley AT , Edwards MJ , Gulbins E , and Goodman MD (2020). Acid Sphingomyelinase Inhibition Mitigates Histopathological and Behavioral Changes in a Murine Model of Traumatic Brain Injury. J. Neurotrauma 37 , 1902–1909. 10.1089/neu.2019.6436.32138594
22. Chung HY , Witt CJ , Hurtado-Oliveros J , Wickel J , Graler MH , Lupp A , and Claus RA (2018). Acid Sphingomyelinase Inhibition Stabilizes Hepatic Ceramide Content and Improves Hepatic Biotransformation Capacity in a Murine Model of Polymicrobial Sepsis. Int. J. Mol. Sci 19 , 3163. 10.3390/ijms19103163.30326559
23. Demberg LM , Rothemund S , Schoneberg T , and Liebscher I (2015). Identification of the tethered peptide agonist of the adhesion G protein-coupled receptor GPR64/ADGRG2. Biochem. Biophys. Res. Commun 464 , 743–747. 10.1016/j.bbrc.2015.07.020.26188515
24. Balenga N , Azimzadeh P , Hogue JA , Staats PN , Shi Y , Koh J , Dressman H , and Olson JA Jr. (2017). Orphan Adhesion GPCR GPR64/ADGRG2 Is Overexpressed in Parathyroid Tumors and Attenuates Calcium-Sensing Receptor-Mediated Signaling. J. Bone Miner. Res 32 , 654–666. 10.1002/jbmr.3023.27760455
25. Paavola KJ , Stephenson JR , Ritter SL , Alter SP , and Hall RA (2011). The N terminus of the adhesion G protein-coupled receptor GPR56 controls receptor signaling activity. J. Biol. Chem 286 , 28914–28921. 10.1074/jbc.M111.247973.21708946
26. Ping YQ , Mao C , Xiao P , Zhao RJ , Jiang Y , Yang Z , An WT , Shen DD , Yang F , Zhang H , (2021). Structures of the glucocorticoid-bound adhesion receptor GPR97-G(o) complex. Nature 589 , 620–626. 10.1038/s41586-020-03083-w.33408414
27. An W , Lin H , Ma L , Zhang C , Zheng Y , Cheng Q , Ma C , Wu X , Zhang Z , Zhong Y , (2022). Progesterone activates GPR126 to promote breast cancer development via the Gi pathway. Proc. Natl. Acad. Sci. USA 119 , e2117004119. 10.1073/pnas.2117004119.35394864
28. Lin H , Xiao P , Bu RQ , Guo S , Yang Z , Yuan D , Zhu ZL , Zhang CX , He QT , Zhang C , (2022). Structures of the ADGRG2-G(s) complex in apo and ligand-bound forms. Nat. Chem. Biol 18 , 1196–1203. 10.1038/s41589-022-01084-6.35982227
29. Seufert F , Chung YK , Hildebrand PW , and Langenhan T (2023). 7TM domain structures of adhesion GPCRs: what’s new and what’s missing? Trends Biochem. Sci 48 , 726–739. 10.1016/j.tibs.2023. 05.007.37349240
30. Huttlin EL , Bruckner RJ , Navarrete-Perea J , Cannon JR , Baltier K , Gebreab F , Gygi MP , Thornock A , Zarraga G , Tam S , (2021). Dual proteome-scale networks reveal cell-specific remodeling of the human interactome. Cell 184 , 3022–3040.e28. 10.1016/j.cell.2021.04.011.33961781
31. Patat O , Pagin A , Siegfried A , Mitchell V , Chassaing N , Faguer S , Monteil L , Gaston V , Bujan L , Courtade-Saidi M , (2016). Truncating Mutations in the Adhesion G Protein-Coupled Receptor G2 Gene ADGRG2 Cause an X-Linked Congenital Bilateral Absence of Vas Deferens. Am. J. Hum. Genet 99 , 437–442. 10.1016/j.ajhg.2016.06.012.27476656
32. Obermann H , Samalecos A , Osterhoff C , Schroder B , Heller R , and Kirchhoff C (2003). HE6, a two-subunit heptahelical receptor associated with apical membranes of efferent and epididymal duct epithelia. Mol. Reprod. Dev 64 , 13–26. 10.1002/mrd.10220.12420295
33. Huibregtse JM , Scheffner M , and Howley PM (1991). A cellular protein mediates association of p53 with the E6 oncoprotein of human papillomavirus types 16 or 18. EMBO J. 10 , 4129–4135. 10.1002/j.1460-2075.1991.tb04990.x.1661671
34. Scheffner M , Huibregtse JM , Vierstra RD , and Howley PM (1993). The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 75 , 495–505. 10.1016/0092-8674(93)90384-3.8221889
35. Zhou F , Elzi DJ , Jayabal P , Ma X , Chiu YC , Chen Y , Blackman B , Weintraub ST , Houghton PJ , and Shiio Y (2020). GDF6-CD99 Signaling Regulates Src and Ewing Sarcoma Growth. Cell Rep. 33 , 108332. 10.1016/j.celrep.2020.108332.33147457
36. Suvarna K , Jayabal P , Ma X , and Shiio Y (2022). Slit2 signaling stimulates Ewing sarcoma growth. Genes Cancer 13 , 88–99. 10.18632/genesandcancer.227.36533189
37. Davies B , Baumann C , Kirchhoff C , Ivell R , Nubbemeyer R , Habenicht UF , Theuring F , and Gottwald U (2004). Targeted deletion of the epididymal receptor HE6 results in fluid dysregulation and male infertility. Mol. Cell Biol 24 , 8642–8648. 10.1128/MCB.24.19.8642-8648.2004.15367682
38. Bieth E , Hamdi SM , and Mieusset R (2021). Genetics of the congenital absence of the vas deferens. Hum. Genet 140 , 59–76. 10.1007/s00439-020-02122-w.32025909
39. Kall L , Storey JD , and Noble WS (2008). Non-parametric estimation of posterior error probabilities associated with peptides identified by tandem mass spectrometry. Bioinformatics 24 , i42–i48. 10.1093/bioinformatics/btn294.18689838
40. Wang M , Wang C , Han RH , and Han X (2016). Novel advances in shotgun lipidomics for biology and medicine. Prog. Lipid Res 61 , 83–108. 10.1016/j.plipres.2015.12.002.26703190
41. Wang M , and Han X (2014). Multidimensional mass spectrometry-based shotgun lipidomics. Methods Mol. Biol 1198 , 203–220. 10.1007/978-1-4939-1258-2_13.25270931
42. Han X , Yang K , and Gross RW (2008). Microfluidics-based electrospray ionization enhances the intrasource separation of lipid classes and extends identification of individual molecular species through multidimensional mass spectrometry: development of an automated high-throughput platform for shotgun lipidomics. Rapid Commun. Mass Spectrom 22 , 2115–2124. 10.1002/rcm.3595.18523984
43. Yang K , Cheng H , Gross RW , and Han X (2009). Automated lipid identification and quantification by multidimensional mass spectrometry-based shotgun lipidomics. Anal. Chem 81 , 4356–4368. 10.1021/ac900241u.19408941
44. Jayabal P , Zhou F , Ma X , Bondra KM , Blackman B , Weintraub ST , Chen Y , Chevez-Barrios P , Houghton PJ , Gallie B , and Shiio Y (2023). Nitric oxide suppression by secreted frizzled-related protein 2 drives retinoblastoma. Cell Rep. 42 , 112103. 10.1016/j.cel-rep.2023.112103.36773293
45. Carey MF , Peterson CL , and Smale ST (2009). Chromatin immunoprecipitation (ChIP). Cold Spring Harb. Protoc 2009 , pdb prot5279. 10.1101/pdb.prot5279.20147264
