
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00850-2
10.1016/j.psj.2024.104271
104271
PHYSIOLOGY AND REPRODUCTION
Comparison of selenium-mediated regulation of heat shock protein and inflammation in-vitro and in-ovo for heat resistance enhancement in broiler
Ban Junseok *1
Jung Jonghyun †1
Shim Kwanseob ‡§
Kang Darae drkang@jbnu.ac.kr
‡║2
⁎ Department of Animal Resources and Biotechnology, College of Agriculture Life Science, Jeonbuk National University, Jeonju 54896, Republic of Korea
† Jung P&C Institute Inc., Yongin 16951, Republic of Korea
‡ Department of Animal Biotechnology, Jeonbuk National University, Jeonju 54896, Republic of Korea
§ Department of Agricultural Convergence Technology, Jeonbuk National University, Jeonju 54896, Republic of Korea
║ Institute of Agricultural Science and Technology, Jeonbuk 54896, Republic of Korea
2 Corresponding author: drkang@jbnu.ac.kr
1 These authors have made equivalent contributions to this work.

27 8 2024
12 2024
27 8 2024
103 12 1042713 6 2024
22 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Selenium is a heat-stress-reducing substance that improves heat resistance and is being studied for its effective application in the broiler industry. However, research on feed additives is labor-intensive and time-consuming because of the need for feeding experiments. We aimed to compare the effects of selenium under heat stress in vitro and in ovo, specifically examining the gene expression of heat shock proteins (HSP) and inflammatory markers. Two groups were included in the in-vitro study: in-vitro control (TC; selenium 0 μg/ml) and in-vitro selenium (TS; selenium 5 μg/ml). The satellite cells were cultured at 42°C for 48 h after selenium treatment. The in-ovo study comprised 4 groups: in-ovo control and in-ovo selenium 1-3 (OC, OS1, OS2, and OS3; selenium 2.5, 5, and 10 μg/egg, respectively). Selenium was injected on the 18th day after hatching, and heat treatment was performed at 32–34°C from the 14th to the 21st day after hatching, and the leg muscles of the chicks were collected on the 21st day. The gene expression of heat shock proteins (HSP), caspase3, nuclear factor kappa light-chain enhancer of activated B cells (NF-kB), and IL-8 was analyzed in in-vitro and in-ovo experiments, respectively. In-vitro results showed significant increases in HSP90, HSP60, and HSP40 in TS compared to TC, with a significant decrease in HSP70. In the in-ovo study, HSP70, caspase3, NF-kB and IL-8 were significantly increased in OS1. HSP90, HSP60, HSP40, HSP27 and NF-kB were significantly decreased in in-ovo OS2 compared to in-vitro TS, implying a trend in ratio compared to control. Selenium appeared to enhance heat resistance in-vitro and in-ovo by modulating HSPs and inflammation. However, differences in mRNA expression were observed depending on the concentration of selenium. These findings suggest that selenium modulates heat resistance through different mechanisms in-vitro and in-ovo, likely due to the complexity of whole-organism interactions in-ovo compared to the single-cell-type environment in-vitro. Therefore, to directly apply in-vitro results to in-ovo, a concentration comparison study for each additive is necessary.

Key words

selenium
in-vitro
in-ovo
heat resistance
broiler
==== Body
pmcINTRODUCTION

Currently, the poultry industry plays an important role in meat production. However, rising average temperatures due to global warming are among the most prominent challenges the poultry industry is facing (Gregory, 2010). Chickens, which are covered with feathers and lack sweat glands, face difficulties in regulating body heat, making them vulnerable to heat stress. Exposure to heat leads to the overproduction of reactive oxygen species, causing functional errors in the antioxidant systems and adversely affecting proteins, lipids, and immune functions (Teyssier et al., 2023; Yang et al., 2010). Furthermore, the promotion of cell death and other inflammatory responses via the upregulation of caspase3 can lead to tissue damage (Liu et al., 2022; Ma et al., 2022). These adverse effects result in negative outcomes, including negative growth and mortality rates, affecting the performance and productivity of poultry (Liu et al., 2020). Because these problems threaten the sustainability of the broiler industry, extensive research is underway to develop strategies to improve heat resistance (Attia et al., 2017; Lin et al., 2006; Sifa et al., 2018).

Heat shock protein (HSP) play a crucial role in maintaining the survival and stability of cells and are present in all organisms (Li et al., 2003). HSPs are rapidly induced upon exposure to heat stress as a strategic system to protect the body and activate protective functions (Belhadj Slimen et al., 2016; Sreedhar et al., 2004). In addition, HSPs repackage or degrade damaged proteins to preserve cellular functions and create a normal environment (Maloyan et al., 1999). Therefore, upregulation of HSPs may help in the recovery and stabilization of damaged cells, leading to improved heat resistance (Gouda et al., 2024). In a previous study, when acute heat stress (40°C, 5 h at 35 d) was applied, HSP70 expression increased in response to heat stress. (Kang et al., 2021). In addition, (Siddiqui et al., 2020; Vinoth et al., 2015) reported upregulation of HSP expression in broilers exposed to chronic heat stress. Additionally, (Yu et al., 2008) reported that HSP60, HSP70, and HSP90 were significantly increased when broilers were exposed to heat stress for 2 h, which may be involved in maintaining the structural integrity of damaged cells.

Selenium (Se) is an essential trace mineral involved in the regulation of various biochemical processes in the body and contributes to immune functions (Rayman, 2000). Selenium is a key component of glutathione peroxidase, thioredoxin reductase, and selenoproteins, contributing collectively to the antioxidant defense system (Tapiero et al., 2003). Therefore, Se is widely utilized in livestock as a heat stress-reducing material that enhances heat resistance (Zheng et al., 2022). Selenium supplementation to broiler diets resulted in significant increases in body weight and a trend toward improved feed conversion ratio (FCR). It also resulted in significantly higher crude protein content in meat and markedly improved meat tenderness. (Ibrahim et al., 2011). These improvements are attributed to the role of selenium in enhancing nutrient utilization and antioxidant properties, which contribute to improved overall growth and meat quality under heat conditions. Furthermore, the addition of selenium has been observed to enhance antioxidant and immune functions as well as increase resistance to heat stress in several studies. Selenium supplementation significantly improves antibody responses in heat-stressed broilers and optimizes overall immune function by improving antioxidant defense. In addition, it promotes improvement in lipid metabolism by lowering LDL cholesterol levels and increasing HDL cholesterol levels under heat stress and causes beneficial changes in blood parameters. (Habibian et al., 2014; Liao et al., 2012; Mahmoud et al., 2003; Shakeri et al., 2020).

Previous studies on feed additives have been based on experimental nutritional studies, which require considerable time, labor, and the sacrifice of experimental animals. To alleviate this problem, many in-vitro methods have been used. Previous studies have provided evidence that ferulic acid protects against oxidative damage caused by heat stress, and melatonin emphasized the potential of melatonin to alleviate heat stress by reducing oxidative damage and protecting mitochondrial function (He et al., 2016; Li et al., 2015; Puthpongsiriporn et al., 2001). This effectively demonstrated that various additives have beneficial effects in alleviating the adverse effects of heat stress, suggesting that in-vitro experiments can be an effective model for managing heat stress. Moreover, research is underway to conveniently apply feed additives through in-ovo experiments For example, (Goel et al., 2022) investigated the effects of temperature regulation and gamma-aminobutyric acid injection on growth performance and stress-related gene expression in broiler chicks after hatching, (Han et al., 2020) investigated the effects of in-ovo l-leucine injection on body weight gain and thermoregulation in broiler chicks, and (Slawinska et al., 2020) investigated the effects of in-ovo injection of GOS on performance and welfare of birds under heat stress (HS) conditions. However, there is a lack of heat stress studies comparing in-vitro and in-ovo methods. Therefore, our study is conducted in 2 stages: in-vitro and in-ovo. Experiment 1, the in-vitro study, we evaluate the effect of selenium by applying it to cells exposed heat stress. Experiment 2, in-ovo study, we inject the appropriate concentration of selenium, determined from the experiment 1 (in-vitro) results, into the eggs and then conduct animal experiment under heat stress to evaluate the effects. If this study is successful, broiler feeding experiments can be simplified using in-vitro results.

MATERIALS AND METHODS

Animal Ethics

Approval for the animal experiments conducted in this study was granted by the Animal Ethics Committee of Jeonbuk National University, Republic of Korea, with the approval number “JBNU 2022-091.”

Summary of Experimental Procedures

In this study, we utilized sodium selenite (Se; S5261, Sigma-Aldrich, St. Louis, MO), performed preliminary studies to select the optimal selenium concentration, and evaluated cell viability. The selected selenium concentrations were applied in both in-vitro and in-ovo experiments, and an overview of the experimental procedures is shown in Figure 1.Figure 1 Flow and summary of this study. Experiment 2: A total of 15 chicks in each treatment groups were injected with selenium in-ovo, and a total of 8 chicks were selected for each treatment groups. Abbreviations: HSPs, Heat shock proteins; Inflammation: including caspase3, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB), and IL-8; E0,18 d: embryo days; 0 to 21 d: after hatching day

Figure 1

Selection of Selenium Concentration and Satellite Cell Isolation

Satellite cells (SC) were isolated from the leg muscles of 18-day-old embryo of the Arbor Acres. The isolation method did not deviate significantly from those described by previous (Park et al., 2021; Siddiqui et al., 2021). Briefly, the leg muscles were dissected and enzymatically digested using collagenase D and dispase ‖. The resulting cell suspension was filtered through a cell strainer to remove debris and centrifuged to remove the separated supernatant. The SCs were then resuspended in a growth medium and plated for further experimental procedures. The SCs were stabilized under culture conditions at 37°C in 5% CO2. After 24 h, Se was added to the medium at concentrations of 0, 2.5, 5, 10, 20, and 50 μg/ml. All groups were then incubated at heat treatment (42°C) and 5% CO2 conditions for 48 h.

Cell Viability Assessment

Thereafter, cell viability was assessed using the Cell Counting Kit (CCK-8; CK04-11, Dojindo Laboratories, Kumamoto) and proceeded according to the manufacturer's instructions. Briefly, SCs were cultured in 96-well plates at 37°C, 5% CO2. After 24 h, the medium was replaced with medium containing various concentrations of Se (0, 5, 10, 20, 50, and 100 μg/mL). Afterwards, the culture was performed at 42°C for 48 h under 5% CO2 conditions. After 48 h, CCK-8 solution was added to each well, and the culture was performed for 4 h. The absorbance was measured at 450 nm using a Spectrophotometer (Multiskan Go, N10588, Thermo Fisher Scientific, Waltham, MA, USA). Cell viability (%) was calculated as “(Sample-Blank/Control-Blank) × 100”.

Experiment 1: in-vitro

The process of SC extraction and stabilization was the same as that used in the selection of selenium concentration experiment. The groups were divided into in-vitro control (TC; selenium 0 μg/ml) and in-vitro selenium (TS; selenium 5 μg/ml) depending on whether selenium treatment was performed that concentration was chosen based on the results of a selenium concentration selection experiment. All groups were then incubated at 42°C in 5% CO2 for 48 h. Cells were collected for subsequent analysis. After gently washing with Dulbecco's phosphate-buffered saline (Cat.14190-136, Gibco, Grand Island, NY), 0.25% trypsin-EDTA (Cat.25200-072, Gibco, Grand Island, NY) was added to the wells and incubated for 2 min. Trypsin-EDTA was mixed with a 2:1 ratio of media consisting of DMEM/F12 supplemented with 10% fetal bovine serum (Cat.16000044, Gibco, Grand Island, NY), 1% penicillin-streptomycin (Cat.15140122, Gibco, Grand Island, NY) and 1% L-glutamine (Cat.25030-081, Gibco, Grand Island, NY) to neutralize. After neutralization, centrifugation was performed at 1100 rpm for 15 min at 4°C and the supernatant was removed. The cell pellet was washed with DPBS, centrifuged, and the supernatant was removed. The collected cell pellets were then stored at −80°C until analysis.

Experiment 2: in-ovo

Total of 60 eggs of Arbor Acres breed (Iksan, Republic of Korea) were incubated for 21 d at 37±5°C with a relative humidity of 57±2%. On d 8, primary candling was performed to remove infertile eggs and those showing developmental arrest. On d 18 after secondary candling, the eggs were randomly separated into 4 groups. Selenium injections were administered into the air sac part of the blunt end of each egg. Before injection, the eggs were disinfected with 70% ethyl alcohol. Using a sterile 1 ml syringe with a 23G needle, the prepared solution was injected into the eggs with slow speed to minimize air inflow to avoid generating negative pressure. Depending on the injected selenium concentration, the groups were in-ovo control (OC;100 μl saline/egg), in-ovo selenium 1 (OS1; selenium 2.5 μg/100 μl saline/egg), in-ovo selenium 2 (OS2; selenium 5 μg/100 μl saline/egg), in-ovo selenium 3 (OS3; selenium 10 μg/100 μl saline /egg). Immediately After hatching, separate wing tags were prepared for each treatment group and attached to the right wings of the chicks for easy identification. Care was also taken to ensure that the tags did not restrict the movement of the chicks or cause discomfort. A total of 15 chicks per treatment group were transferred to the rearing facility. The chicks in the facility were reared in a temperature-controlled environment with adequate ventilation. The stocking density was 2,333 cm2/bird to ensure sufficient space and animal welfare. The chicks were reared at 34°C from d 1 to 2, 32°C from d 3 to 4, 30°C from d 5 to 7, and 28°C from d 7 to 14 based on the Korean Poultry Feeding Standards. Water and feed were provided ad libitum. The composition of feed ingredients is presented in Supplementary Table S1. From d 14 onwards, heat treatment (32-34°C) was maintained until d 21. The relative humidity was maintained at approximately 50%. To assess growth performance, body weight (BW) was measured at 3-d intervals throughout the experimental period, with additional BW measurements taken at the end of the experiment, and body weight gain (BWG) was calculated as BW. On d 21, 8 birds per group were randomly selected and euthanized by cervical dislocation. Leg muscles of the birds were then collected and immediately frozen in liquid nitrogen. These were then stored at −80°C until analysis.

mRNA Expression

Total mRNA was extracted from the cell and muscle samples using TRIzol Reagent (15596026, Invitrogen, Waltham, MA, USA) and detailed methods are provided in the TRIzol Reagent User Guide (Pub.No. MAN0001271 C.0, Thermo Fisher).The concentration and purity of the total mRNA were measured using μDropTM Plate (N12391, Thermo Fisher Scientific, Waltham, MA). One microliter of sample was injected into the μDrop Plate and the absorbance was measured at 260 and 260/280 nm using a spectrophotometer. The quantified mRNA was reverse-transcribed using AccuPower CycleScript RT PreMix (dT20)(K-2044, Bioneer, Daejeon, Republic of Korea) according to the manufacturer's instructions. The synthesized cDNA was stored at -80°C until PCR analysis. cDNA, primers (forward and reversed), and AccuPower 2X Greenstar qPCR Master Mix (K-6253, Bioneer, Daejeon, Republic of Korea) were mixed according to the manufacturer's instructions to prepare a total 20 µl. Real-time PCR was performed using the CFX Real-Time Detection System (Bio-Rad Laboratories). Glyceraldehyde-3-phosphate dehydrogenase was used as the housekeeping gene for normalization, and all data were analyzed using the 2-ΔΔCt method (Schmittgen et al., 2008). In brief, the critical cycle (Ct) values for the housekeeping gene and the target gene are determined and the ΔCt for each sample is calculated by subtracting the ct value of the target gene from the ct value of the housekeeping gene. The ΔCt of the treatment sample is then compared to the control sample to obtain the ΔΔCt. Primers were designed using the National Center for Biotechnology Information (NCBI) Primer-BLAST and included HSP and inflammatory genes for assessing heat stress and are listed in Table 1.Table 1 Primer sequences used in real-time PCR.

Table 1Gene name	Accession number	F/R	Sequence (5’→3’)	Product size (bp)	
GAPDH	NM_204305.2	F	GACGTGCAGCAGGAACACTA	112	
R	CTTGGACTTTGCCAGAGAGG	
HSP90AA1	NM_001109785.2	F	CAAGCCTATTTGGACCAGGA	94	
R	CAAGTGGTCCTCCCAGTCAT	
HSP70	NM_001006685.2	F	ATTCTTGCGTGGGTGTCTTC	133	
R	ACTTGGTTCTTGGCAGCATC	
HSP60	NM_001012916.3	F	AGAAGAAGGACAGAGTTACC	112	
R	GCGTCTAATGCTGGAATG	
HSP40JA1	NM_001012945.2	F	AGGCTGGAGCTGTTCAGAAA	125	
R	CACCTTCTCCATTGCAGTCA	
HSP27	XM_046936397.1	F	ACTGAGCAGAAGAGGGAAA	166	
R	GTGCTGTGCTTTGATCAGGA	
Caspase3	XM_015276122.4	F	CTGGTCCACTGTCTGCTTCA	83	
R	AGCAGGGAAACCCAAACTCT	
NF-kB	XM_046915552.1	F	AGAGGATGCTTCGTTGTGCT	77	
R	TCTCCAGGAACAGACCATCC	
IL8L1	NM_205018.2	F	CAAGGCACCTCACAAGGTT	80	
R	GCACATACTGCAGGCAAGAA	
Genes reflecting physiological functions such as stress response to heat stress (HSP90AA1, HSP70, HSP60, HSP40JA1, HSP27), inflammation (NF-kB, IL8L1), and apoptosis (Caspase3). Abbreviations: F/R, forward and reverse primers; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; HSP, heat shock protein; NF-kB, nuclear factor kappa-light-chain-enhancer of activated B cells; IL8L1, interleukin 8-like 1.

Statistical Analysis

All data analyses were conducted using SAS 9.4 (SAS Institute Inc.). The t-test was used to analyze the gene expression parameters between the TC and TS groups. Additionally, to identify differences between specific groups in-vitro and in-ovo, t-tests were applied individually to each pair (TS-OS1, TS-OS2, TS-OS3). In addition, in-ovo results including multiple treatment groups and BW and BWG were analyzed using 1-way analysis of variance (ANOVA), followed by post hoc comparison using Duncan's multiple range test to determine significant differences between groups. Gene expression parameters were calculated by normalizing each control (TC and OC) to 1. All statistical significance performed in the study was set at P < 0.01 and P < 0.05.

RESULTS

Cell Viability of SC According to Selenium Concentration

The influence of Se on the viability of SC under heat stress conditions is shown in Figure 2. Selenium concentrations of 5 µg/ml and 10 µg/ml exhibited significantly higher cell viability compared to the others (P < 0.001). However, a significantly lower cell viability was observed at 50 µg selenium/ml. Considering the significant differences and economic factors, this study proceeded with 5 µg/ml as the reference concentration.Figure 2 Cell survival rate according to selenium concentration of muscle-derived satellite cells cultured at 42°C for 48 h. a-c Means significant difference among the selenium concentrations (P < 0.001).

Figure 2

Growth Performance of Broilers Injected With Selenium in-ovo

The hatching rates of chicks were 65.45%, 63.64%, 61.82%, and 58.18%, and there was no significant difference among the treatment groups. The growth performance of chicks injected with selenium in-ovo, categorized by concentration, is shown in Figure 3. The BW of the chicks to increase similarly across all treatment groups. In particular, the BW on d 7 was significantly higher in the OS3 group (P < 0.05) (Figure 3A). BWG showed a steady increase, but declined after exposure to heat stress. BWG was significantly increased in the OS1 and OS3 groups compared to that in the other groups on d 4–7 (P < 0.01) (Figure 3B).Figure 3 Effect of in-ovo injection of selenium concentration on body weight and body weight gain of broilers. BW and BWG were measured in 15 birds per treatment groups. (A) BW measured at 3 d intervals from 1 d to 21 d of age, (B) BWG at 3 d intervals from 1 d to 21 d of age. The graph shows the average of each treatment groups. The heat stress treatment lasted for 14-21 d. *, ** Indicate significant differences among the groups within the same day (P < 0.05, P < 0.01, respectively). Abbreviations: BW, body weight; BWG, body weight gain.

Figure 3

The mRNA Expression Levels of HSP in-vitro and in-ovo in Response to Selenium Application Under Heat Stress

The extent of HSP mRNA expression in-vitro and in-ovo under heat stress due to Se exposure is shown in Figure 4. HSP90, HSP60, and HSP40 levels were higher in TS than in TC (P < 0.05). However, HSP70 expression was lower in the TS group than in the TC group (P < 0.05). In-ovo, HSP70 expression was increased in the OS1 group compared to that in the other groups (P < 0.05). HSP90, HSP60, and HSP27 were decreased only in OS2 compared to those in TS (P < 0.05). However, HSP40 expression was higher in the TS group than in all the of in-ovo groups (P < 0.01).Figure 4 Effect of selenium on the expression levels of (A) HSP90, (B) HSP70, (C) HSP60, (D) HSP40, and (E) HSP27 in-vitro and in-ovo under heat stress environment. Data calculated by normalizing each control to 1. *, ** Indicates significant difference between in-vitro groups (P < 0.05 and P < 0.01, respectively). a-bIndicates significant differences among the in-ovo groups (P < 0.05). # Indicates significant differences between in-vitro and in-ovo selenium treatment groups (P < 0.05). Abbreviation: HSP, heat shock protein.

Figure 4

The mRNA Expression Levels of Inflammatory Factors in-vitro and in-ovo in Response to Selenium Application Under Heat Stress Conditions

The mRNA expression levels of inflammatory factors in response to selenium in-vitro and in-ovo under heat stress are shown in Figure 5. There were no differences in the mRNA expression levels of the inflammatory factors in-vitro. However, in-ovo, caspase3, nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) and IL-8 increased in OS1 compared to other groups (P < 0.01). Caspase3 increased in the OS1 and OS3 groups than in the TS group (P < 0.01). However, NF-kB decreased in OS2 and OS3 compared to TS (P < 0.05). IL-8 levels were higher in OS1, OS2, and OS3 than in TS (P < 0.05).Figure 5 Effect of selenium on the expression levels of (A) caspase3, (B) NF-kB, and (C) IL-8 in in-vitro and in-ovo under heat stress environment. Data has been calculated by normalizing each control to 1. a-b Indicates significant differences among the in-ovo groups (P < 0.01). # Indicates significant differences between in-vitro and in-ovo selenium treatment groups (P < 0.05). Abbreviations: NF-kB, nuclear factor kappa-light-chain-enhancer of activated B cells.

Figure 5

DISCUSSION

In the present study, we compared the effects of selenium under heat stress in-vitro and in-ovo on HSPs and inflammatory gene expression under heat stress in vitro and in ovo. This study confirmed the potential of applying in-vitro results to in-ovo for certain analytical parameters. However, more detailed analysis may be necessary for these approaches to be considered as viable alternatives to broiler feeding.

Early growth performance serves as the basis for assessing the impact of in-ovo injections. In the present study, BW increased in the OS3 group, and an increase in BWG was observed in the OS1 and OS3 groups from d 4 to 7. These findings are consistent with results indicating a positive impact of selenium in-ovo injections on early weight gain. (Krisnan et al., 2021). However, the increases in BW and BWG due to Se injection under heat treatment were marginal. This is similar to previous reports indicating that dietary Se does not significantly affect BW or BWG in broilers under heat stress conditions (Niu et al., 2009). In-ovo injection of Se improved the early growth performance of broilers, but its effects on growth performance under later heat stress conditions could not be determined.

HSP are important stress-regulatory proteins that are synthesized in response to various stressor such as exposure to heat (Stetler et al., 2010). In this study, TS (in-vitro) exposed to heat stress showed upregulated mRNA expression of HSP90, HSP60, and HSP40 compared with TC. Se improved HSP expression and mitigates oxidative stress (Yang et al., 2016). Upregulated HSPs may also serve as protective cellular responses (Rylander et al., 2006). Similarly, Se nanoparticles have been reported to significantly increase the expression of HSPs under heat stress (Sun et al., 2022). This could be attributed to Se upregulating HSPs, inducing additional glutathione synthesis, and thereby potentially exerting an antioxidant effect by reducing the proportion of reactive oxygen species in the body (Arteel et al., 2001; Li et al., 2022). The expression level of HSP70 serves as an indicator of the severity of heat stress (Sarkar et al., 2017). In-vitro, mRNA expression of HSP70 was downregulated. This is similar to the reported downregulation of HSP70 expression after exposure to heat stress, but after a certain period of selenium treatment (Liu et al., 2021). Furthermore, HSP expression is associated with heat resistance, and HSP70 is known to have the highest correlation among the HSPs (Li et al., 1989). This suggests that an improvement in the extent of selenium-induced HSP expression under heat conditions enhances resistance to heat, thereby negating the need for increased HSP70 expression (Rivera et al., 2005). In-ovo, the mRNA expression of HSP70 was significantly increased in the OS1 compared with that in the other groups. This suggests that selenium upregulated the expression of HSP70, potentially enabling cells to respond more effectively to stressful conditions for recovery (Rivera, 2004). The expressed HSP enhances heat tolerance during heat stress by preventing protein aggregation or misfolding and maintaining cellular homeostasis, thereby protecting against cellular damage (Shehata et al., 2020). Additionally, (Al-Zhgoul et al., 2013) reported that the overexpression of HSP70 in heat-exposed chicks is associated with the acquisition of heat resistance. However, in OS2 and OS3, the expression of HSP70 decreased compared to OS1. The expression of HSP70 is regulated as animals adapt to heat (Wang et al., 1998). In addition, the induction of HSP70 is a short-term response, and long-term exposure to heat may result in a decrease in HSP70 expression due to acclimation of birds (Mahmoud et al., 2005). Additionally, there are research findings that suggest the expression of HSP70 was downregulated in chicks with early heat exposure due to their adaptation to heat (Toplu et al., 2014). In-ovo, while it can be inferred that OS1 enabled cells to respond more effectively compared to the control, further study is needed to confirm that the selenium concentrations in OS2 and OS3 improved heat resistance.

Immunosuppression is a physiological side effect observed in poultry exposed to heat stress (Mashaly et al., 2004). Heat stress may upregulate the inflammatory gene expressions such as NF-kB and caspase3, potentially promoting inflammatory responses (Li et al., 2014; Zheng et al., 2022). Caspase3 is known as a member of the cysteine protease family and is directly associated with apoptosis, suggesting that the upregulation of caspase3 may promote apoptosis (Cohen, 1997). NF-kB functions as a modulator of inflammatory cytokines such as IL-8 and regulates inflammatory responses in interaction with caspase3 (Ravi et al., 1998). Increased expression of NF-kB induces apoptosis and tissue damage (Thoma et al., 2018). The inflammatory response caused by heat stress can be alleviated by Se (Calik et al., 2022; Duntas, 2009; Surai1 and Surai., 2009), whereas selenium deficiency induces inflammatory damage (Ji et al., 2024) However, in this study, there were no significant differences in the mRNA expression of caspase3, NF-kB, and IL-8 between the heat-stressed in-vitro TS and TC groups compared to HSP70. This may be associated with the decreased HSP70 expression. The decrease in HSP70 levels indicated an improvement in resistance to heat, potentially regulating inflammation. Ultimately, there is a possibility that heat resistance occurs with the selenium concentration in the TS. However, in-ovo, the mRNA expression of caspase3, NF-kB, and IL-8 was upregulated compared to OC, particularly at OS1, showing a trend similar to that of HSP70 mRNA expression in in-ovo. This contrasts with most studies reporting downregulation of caspase3, NF-kB, and IL-8 by selenium (Adedara et al., 2019; Ge et al., 2021; József et al., 2003). HSP70 has anti-apoptotic and antioxidant effects, and many studies are currently underway (Jacquier-Sarlin et al., 1994; Moghadamtousi et al., 2015). Upregulated HSPs may decrease the expression of inflammatory genes (Jacquier-Sarlin et al., 1994), which was not observed in the present study. Excessive expression of HSP induced by selenium induces heat resistance, and it is speculated that inflammatory genes were induced at OS1 before heat resistance was formed. However, further investigations are required to understand the temporal correlation between selenium-induced HSP and inflammatory gene expression.

In comparison to TS, OS2 showed a decrease in HSP90, HSP60, HSP40, HSP27 and NF-kB (P < 0.05). This result shows a trend in the ratio relative to the control for each experiment, suggesting that 5µg/ml Se may act more effectively in-ovo (5µg/egg) compared to in-vitro (5µg/ml), potentially enhancing heat resistance. Cell models and developed tissues can demonstrate differences in the mRNA expression levels of specific genes (Abdelmoez et al., 2020). This suggests that the same concentration of Se may act via different mechanisms in the cells and muscle tissues. Furthermore, although some genes show similar expression patterns, it is unreasonable to directly apply the results from in-vitro to in-ovo. Therefore, additional studies that compare the concentrations of each additive are necessary to identify the differences between the 2 experiments.

DISCLOSURES

The authors affirm that there are no conflicts of interest to declare.

Appendix Supplementary materials

Image, application 1

ACKNOWLEDGMENTS

We would like to thank Editage (www.editage.co.kr) for English language editing. This work was supported by the National Research Foundation of Korea (NRF) grant funded by Ministry of Education (Project No. 2020R1I1A3A04038058 ).

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.104271.
==== Refs
REFERENCES

Abdelmoez A.M. Sardón Puig L. Smith J.A. Gabriel B.M. Savikj M. Dollet L. Chibalin A.V. Krook A. Zierath J.R. Pillon N.J. Comparative profiling of skeletal muscle models reveals heterogeneity of transcriptome and metabolism Am. J. Physiol. Cell Physiol. 318 2020 C615 C626 31825657
Adedara I.A. Adebowale A.A. Atanda O.E. Fabunmi A.T. Ayenitaju A.C. Rocha J.B. Farombi E.O. Selenium abates reproductive dysfunction via attenuation of biometal accumulation, oxido-inflammatory stress and caspase-3 activation in male rats exposed to arsenic Environm. Pollut. 254 2019 113079
Al-Zhgoul M.-B. Abd Elhafeed S.D. Ababneh M.M. Jawasreh K.I. Al Busadah K.A. Ismail Z.B. Thermal manipulation during chicken embryogenesis results in enhanced Hsp70 gene expression and the acquisition of thermotolerance Res. Vet. Sci. 95 2013 502 507 23787299
Arteel G.E. Sies H. The biochemistry of selenium and the glutathione system Environm. Toxicol. Pharmacol. 10 2001 153 158
Attia Y.A. Al-Harthi M.A. El-Shafey A.S. Rehab Y.A. Kim W.K. Enhancing tolerance of broiler chickens to heat stress by supplementation with vitamin E, vitamin C and/or probiotics Ann. Anim. Sci. 17 2017 1155 1169
Belhadj Slimen I. Najar T. Ghram A. Abdrrabba M. Heat stress effects on livestock: molecular, cellular and metabolic aspects, a review J. Anim. Physiol. Anim. Nutr. 100 2016 401 412
Calik A. Emami N.K. Schyns G. White M.B. Walsh M.C. Romero L.F. Dalloul R.A. Influence of dietary vitamin E and selenium supplementation on broilers subjected to heat stress, Part II: oxidative stress, immune response, gut integrity, and intestinal microbiota Poult. Sci. 101 2022 101858
Cohen G.M. Caspases: The executioners of apoptosis Biochem.l J. 326 1997 1 16
Duntas L. Selenium and inflammation: underlying anti-inflammatory mechanisms Hormon. Metabol. Res. 41 2009 443 447
Ge J. Guo K. Zhang C. Talukder M. Lv M.-W. Li J.-Y. Li J.-L. Comparison of nanoparticle-selenium, selenium-enriched yeast and sodium selenite on the alleviation of cadmium-induced inflammation via NF-kB/IκB pathway in heart Sci. Total Environm. 773 2021 145442
Goel A. Ncho C.M. Jeong C.-M. Choi Y.-H. Embryonic thermal manipulation and in ovo gamma-aminobutyric acid supplementation regulating the chick weight and stress-related genes at hatch Front. Vet. Sci. 8 2022 807450
Gouda A. Tolba S. Mahrose K. Felemban S.G. Khafaga A.F. Khalifa N.E. Jaremko Ł. Moustafa M. Alshaharni M.O. Algopish U. Heat shock proteins as a key defense mechanism in poultry production under heat stress conditions Poult. Sci. 2024 103537
Gregory N. How climatic changes could affect meat quality Food Res. Int. 43 2010 1866 1873
Habibian M. Ghazi S. Moeini M.M. Abdolmohammadi A. Effects of dietary selenium and vitamin E on immune response and biological blood parameters of broilers reared under thermoneutral or heat stress conditions Int. J. Biometeorol. 58 2014 741 752 23525898
Han G. Ouchi Y. Hirota T. Haraguchi S. Miyazaki T. Arakawa T. Masuhara N. Mizunoya W. Tatsumi R. &Tashiro K. Effects of l-leucine in ovo feeding on thermotolerance, growth and amino acid metabolism under heat stress in broilers Animal 14 8 2020 1701 1709
He S. Liu F. Xu L. Yin P. Li D. Mei C. Jiang L. Ma Y. Xu J. Protective effects of ferulic acid against heat stress-induced intestinal epithelial barrier dysfunction in vitro and in vivo PLoS One 11 2016 e0145236
Ibrahim M. Eljack B. Fadlalla I. Selenium supplementation to broiler diets Anim. Sci. J 2 2011 12 17
Jacquier-Sarlin M. Fuller K. Dinh-Xuan A. Richard M.-J. Polla B. Protective effects of hsp70 in inflammation Experientia 50 1994 1031 1038 7988662
Ji S.Y. Yin Z.C. Ma C.L. Bai J.X. Min J.Y. Wang B.Y. Gao M.L. Yang X.Y. Yang X.J. Lei X.G. Dietary selenium insufficiency induces cardiac inflammatory injury in chicks J. Nutr 154 2024 2315 2325 38763264
József L. Filep J.G. Selenium-containing compounds attenuate peroxynitrite-mediated NF-κB and AP-1 activation and interleukin-8 gene and protein expression in human leukocytes Free Radic. Biol. Med. 35 2003 1018 1027 14572605
Kang D. Shim K. Early heat exposure effect on the heat shock proteins in broilers under acute heat stress Poult. Sci. 100 2021 100964
Krisnan R. Retnani Y. Tangendjaja B. Mutia R. Jayanegara A. Wina E. The effect of different types of in ovo selenium injection on the immunity, villi surface area, and growth performance of local chickens Vet. World 14 2021 1109 34220110
Li G.C. Mak J.Y. Re-induction of hsp70 synthesis: An assay for thermotolerance Int. J. Hyperther. 5 1989 389 403
Li L. Tan H. Gu Z. Liu Z. Geng Y. Liu Y. Tong H. Tang Y. Qiu J. Su L. Heat stress induces apoptosis through a Ca2+-mediated mitochondrial apoptotic pathway in human umbilical vein endothelial cells PLoS One 9 2014 e111083
Li Y. Zhang Z. He C. Zhu K. Xu Z. Ma T. Tao J. Liu G. Melatonin protects porcine oocyte in vitro maturation from heat stress J. Pineal Res. 59 2015 365 375 26291611
Li L. Liu Z. Quan J. Lu J. Zhao G. Sun J. Metabonomics analysis reveals the protective effect of nano‑selenium against heat stress of rainbow trout (Oncorhynchus mykiss) J. Proteom. 259 2022 104545
Li Z. Srivastava P. Heat-shock proteins Curr. Protoc. Immunol. 58 2003 A. 1T. 1-A. 1T. 6
Liao X. Lu L. Li S. Liu S. Zhang L. Wang G. Li A. Luo X. Effects of selenium source and level on growth performance, tissue selenium concentrations, antioxidation, and immune functions of heat-stressed broilers Biolog. Trace Elem. Res. 150 2012 158 165
Lin H. Jiao H. Buyse J. Decuypere E. Strategies for preventing heat stress in poultry World's Poult. Sci. J. 62 2006 71 86
Liu L. Ren M. Ren K. Jin Y. Yan M. Heat stress impacts on broiler performance: a systematic review and meta-analysis Poult. Sci. 99 2020 6205 6211 33142538
Liu Y. He A. Tang J. Shah A.M. Jia G. Liu G. Tian G. Chen X. Cai J. Kang B. Selenium alleviates the negative effect of heat stress on myogenic differentiation of C2C12 cells with the response of selenogenome J. Thermal Biol. 97 2021 102874
Liu Y.-L. Ding K.-N. Shen X.-L. Liu H.-X. Zhang Y.-A. Liu Y.-Q. He Y.-M. Tang L.-P. Chronic heat stress promotes liver inflammation in broilers via enhancing NF-κB and NLRP3 signaling pathway BMC Vet. Res. 18 2022 289 35871002
Ma B. Xing T. Li J. Zhang L. Jiang Y. Gao F. Chronic heat stress causes liver damage via endoplasmic reticulum stress-induced apoptosis in broilers Poult. Sc. 101 2022 102063
Mahmoud K.Z. Edens F. Influence of selenium sources on age-related and mild heat stress-related changes of blood and liver glutathione redox cycle in broiler chickens (Gallus domesticus) Compar. Biochem. Physiol. Part B: Biochem. Mol. Biol. 136 2003 921 934
Mahmoud K.Z. Edens F. Influence of organic selenium on hsp70 response of heat-stressed and enteropathogenic Escherichia coli-challenged broiler chickens (Gallus gallus) Compar. Biochem. Physiol. Part C: Toxicol. Pharmacol. 141 2005 69 75
Maloyan A. Palmon A. Horowitz M. Heat acclimation increases the basal HSP72 level and alters its production dynamics during heat stress Am. J. Physiol. Regulat. Integrat. Compar. Physiol. 276 1999 R1506 R1515
Mashaly M. Hendricks G. 3rd Kalama M. Gehad A. Abbas A. Patterson P. Effect of heat stress on production parameters and immune responses of commercial laying hens Poult. Sci. 83 2004 889 894 15206614
Moghadamtousi S.Z. Rouhollahi E. Hajrezaie M. Karimian H. Abdulla M.A. Kadir H.A. Annona muricata leaves accelerate wound healing in rats via involvement of Hsp70 and antioxidant defence Int. J. Surg. 18 2015 110 117 25899210
Niu Z. Liu F. Yan Q. Li L. Effects of different levels of selenium on growth performance and immunocompetence of broilers under heat stress Arch. Anim. Nutr. 63 2009 56 65 19271551
Park J. Lee J. Song K.-D. Kim S.-J. Kim D.C. Lee S.C. Son Y.J. Choi H.W. Shim K. Growth factors improve the proliferation of Jeju black pig muscle cells by regulating myogenic differentiation 1 and growth-related genes Anim. Biosci. 34 2021 1392 33561926
Puthpongsiriporn U. Scheideler S. Sell J. Beck M. Effects of vitamin E and C supplementation on performance, in vitro lymphocyte proliferation, and antioxidant status of laying hens during heat stress Poult. Sci. 80 2001 1190 1200 11495472
Ravi R. Bedi A. Fuchs E.J. Bedi A. CD95 (Fas)-induced caspase-mediated proteolysis of NF-κB Cancer Res. 58 1998 882 886 9500443
Rayman M.P. The importance of selenium to human health The Lancet 356 2000 233 241
Rivera, R. E. (2004). The effect of selenium on heat shock protein 70 expression in Turkey embryos.
Rivera R.E. Christensen V. Edens F. Wineland M. Influence of selenium on heat shock protein 70 expression in heat stressed turkey embryos (Meleagris gallopavo) Compar. Biochem. Physiol. Part A: Mol. Integrat. Physiol. 142 2005 427 432
Rylander M.N. Feng Y. Bass J. Diller K.R. Thermally induced injury and heat-shock protein expression in cells and tissues Ann. New York Acad. Sci. 1066 2006 222 242
Sarkar S. Roy S. A mini review on heat shock proteins (HSPs): Special emphasis on heat shock protein70 (HSP70) BN Seal. J. Sci. 9 2017 130 139
Schmittgen T.D. Livak K.J. Analyzing real-time PCR data by the comparative CT method Nat. Protoc. 3 2008 1101 1108 18546601
Shakeri M. Oskoueian E. Le H.H. Shakeri M. Strategies to combat heat stress in broiler chickens: Unveiling the roles of selenium, vitamin E and vitamin C Vet. Sci. 7 2020 71 32492802
Shehata A.M. Saadeldin I.M. Tukur H.A. Habashy W.S. Modulation of heat-shock proteins mediates chicken cell survival against thermal stress Animals 10 2020 2407 33339245
Siddiqui S.H. Kang D. Park J. Khan M. Shim K. Chronic heat stress regulates the relation between heat shock protein and immunity in broiler small intestine Scient. Rep. 10 2020 18872
Siddiqui S.H. Subramaniyan S.A. Kang D. Park J. Khan M. Shim K. Modulatory effect of heat stress on viability of primary cultured chicken satellite cells and expression of heat shock proteins ex vivo Anim. Biotechnol. 32 2021 774 785 32340526
Sifa D. Bai X. Zhang D. Hu H. Wu X. Wen A. He S. Zhao L. Dietary glutamine improves meat quality, skeletal muscle antioxidant capacity and glutamine metabolism in broilers under acute heat stress J. Appl. Anim. Res. 46 2018 1412 1417
Slawinska A. Zampiga M. Sirri F. Meluzzi A. Bertocchi M. Tavaniello S. Maiorano G. Impact of galactooligosaccharides delivered in ovo on mitigating negative effects of heat stress on performance and welfare of broilers Poult. Sci. 99 2020 407 415 32416825
Sreedhar A.S. Csermely P. Heat shock proteins in the regulation of apoptosis: New strategies in tumor therapy: a comprehensive review Pharmacol. Therapeut. 101 2004 227 257
Stetler R.A. Gan Y. Zhang W. Liou A.K. Gao Y. Cao G. Chen J. Heat shock proteins: cellular and molecular mechanisms in the central nervous system Progress Neurobiol. 92 2010 184 211
Sun J. Liu Z. Quan J. Li L. Zhao G. Lu J. Protective effects of different concentrations of selenium nanoparticles on rainbow trout (Oncorhynchus mykiss) primary hepatocytes under heat stress Ecotoxicol. Environm. Saf. 230 2022 113121
Surai1, A., and P. F. Surai. 2009. Selenium and inflammation: An update, Selenium in ruminant nutrition and health. 10:475–531.
Tapiero H. Townsend D. Tew K. The antioxidant role of selenium and seleno-compounds Biomed. Pharmacother. 57 2003 134 144 12818475
Teyssier J. Cozannet P. Greene E. Dridi S. Rochell S. Influence of different heat stress models on nutrient digestibility and markers of stress, inflammation, lipid, and protein metabolism in broilers Poult. Sci. 102 2023 103048
Thoma A. Lightfoot A.P. NF-kB and inflammatory cytokine signalling: Role in skeletal muscle atrophy Muscle Atrop. 1088 2018 267 279
Toplu H.D.O. Tunca R. Aypak S.U. Coven F. Epikmen E.T. Karaarslan S. Yagin O. Effects of heat conditioning and dietary ascorbic acid supplementation on heat shock protein 70 expression, blood parameters and fear-related behavior in broilers subjected to heat stress Acta Scientiae Veterinariae 42 2014 1 8
Vinoth A. Thirunalasundari T. Tharian J.A. Shanmugam M. Rajkumar U. Effect of thermal manipulation during embryogenesis on liver heat shock protein expression in chronic heat stressed colored broiler chickens J. Thermal Biol. 53 2015 162 171
Wang S. Edens F. Heat conditioning induces heat shock proteins in broiler chickens and turkey poults Poult. Sci. 77 1998 1636 1645 9835337
Yang L. Tan G.-Y. Fu Y.-Q. Feng J.-H. Zhang M.-H. Effects of acute heat stress and subsequent stress removal on function of hepatic mitochondrial respiration, ROS production and lipid peroxidation in broiler chickens Compar. Biochem. Physiol. Part C: Toxicol. Pharmacol. 151 2010 204 208
Yang Z. Liu C. Zheng W. Teng X. Li S. The functions of antioxidants and heat shock proteins are altered in the immune organs of selenium-deficient broiler chickens Biolog. Trace Elem. Res. 169 2016 341 351
Yu J. Bao E. Yan J. Lei L. Expression and localization of Hsps in the heart and blood vessel of heat-stressed broilers Cell. Stress Chaper. 13 2008 327 335
Zheng Y. Xie T. Li S. Wang W. Wang Y. Cao Z. Yang H. Effects of selenium as a dietary source on performance, inflammation, cell damage, and reproduction of livestock induced by heat stress: A review Front. Immunol. 12 2022 820853
