
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00848-4
10.1016/j.psj.2024.104269
104269
IMMUNOLOGY, HEALTH AND DISEASE
N-myc and STAT interactor degrades interferon regulatory factor 7 mediated type I interferon signaling to promote duck Tembusu virus replication
Luo Wanshuang *†‡
Cai Wenjun *†‡
Cheng Anchun *†‡
Wang Mingshu *†‡
Chen Shun *†‡
Huang Juan *†‡
Yang Qiao *†‡
Wu Ying *†‡
Sun Di *†‡
Zhu Dekang *†‡
Liu Mafeng *†‡
Zhao Xinxin *†‡
Zhang Shaqiu *†‡
Ou Xumin *†‡
Tian Bin *‡
Yin Zhongqiong ‡
Jia Renyong jiary@sicau.edu.cn
*†‡1
⁎ Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University, Chengdu, Sichuan, 611130, China
† Engineering Research Center of Southwest Animal Disease Prevention and Control Technology, Ministry of Education, Chengdu, Sichuan, 611130, China
‡ Key Laboratory of Animal Disease and Human Health of Sichuan Province, Chengdu, Sichuan, 611130, China
1 Corresponding author: jiary@sicau.edu.cn
28 8 2024
12 2024
28 8 2024
103 12 1042695 6 2024
22 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
N-myc and STAT interactor (NMI) is an interferon-induced protein, which plays a variety of biological functions by participating in signal transduction and transcriptional activation, it has been reported to regulate antiviral response of different viruses in many species. However, the role of NMI in ducks during Duck Tembusu Virus (DTMUV) infection is completely unknown. In order to reveal whether duck NMI (duNMI) is involved in the antiviral response in the process of DTMUV infection and its role, we cloned and identified duNMI gene, and conducted sequence analysis of duNMI, the open reading frame region of duNMI gene is 1,137 bp, encoding 378 amino acid residues (aa), including 3 domains, Coiled-coil domain (22-126aa), NMI/IFP 35 domain 1 (NID1) domain (174-261aa) and NMI/IFP 35 domain 2 (NID2) domain (272-360aa). Analysis of tissue distribution of duNMI in 7-day-old ducks shows that the expression of duNMI is the highest in harderian gland, followed by small intestine and pancreas. Subsequently, we found that mRNA level of duNMI increases significantly after DTMUV stimulation, and overexpression of duNMI inhibits DTMUV replication in a dose-dependent manner. Besides, duNMI inhibits the transcriptional activity of IFN-I related cytokines. Specifically, we confirmed that duNMI interacts with duck regulatory factor 7 (duIRF7) through NID1 and NID2 domains and inhibit its expression and activated-IFN-β. These results support that duNMI is an inhibitor of antiviral innate immune response in the process of DTMUV infection, which will provide a theoretical basis for the prevention of DTMUV infection.

Key words

DTMUV
duck IRF7
duck NMI
type I interferon signaling
viral replication
==== Body
pmcINTRODUCTION

Duck farming occupies an important position in Chinese traditional breeding industry, and duck also plays an important role in the Chinese dinner table. Duck Tembusu Virus (DTMUV) is an emerging flavivirus that was discovered in farms in China in 2010 (Cao et al., 2011; Yan et al., 2017). DTMUV has an open reading frame that translated and processed into 3 structural proteins and 7 nonstructural proteins, in which the structural protein E is a symbol of forming a complete virion (Li et al., 2015; Wang et al., 2016; Zhang et al., 2017). Because the diseased ducks infected with DTMUV have a severe decrease in egg production and neurological symptoms., it has a huge impact on agricultural economy (Liu et al., 2013).

After virus invades body, innate immune system monitors the presence of pathogenic and make adaptive immune response. Pattern recognition receptors (PRR) act a vital part of the innate immune system, which recognize virus and active signaling pathways, induce the production of type 1 interferons (IFN, mainly IFN α/β) and release cytokines, etc. (Chen and Jiang, 2013). PRRs includes Toll-like receptor, Nod-like receptor, RIG-I like receptor (RLR) and DNA receptor, each of which exists in different cellular structures and make a difference (Kumar et al., 2011). RIG-I as a member of RLRs recognizes RNA virus and actives downstream mitochondrial antiviral signal protein through CARD domain (Wu and Hur, 2015), thus activates TRAF3 recruiting TBK1 and regulatory factor 7 (IRF7). IRF7 is one of the interferon stimulated genes (ISG), can further induce the production of IFNs (Chang, 2021). It has been ascertained that RIG-I signaling pathway have an effect on the immune response against flaviviruses (Guo et al., 2018), and related studies have also confirmed that it participates in the immune response of ducks infected with DTMUV (Wu et al., 2022).

N-myc and STAT interactor (NMI) belongs to ISG and mainly exists in the cytoplasm. NMI is homologous to interferon-induced protein 35 (IFP35) and consists of Coiled-coil domain and 2 NMI/IFP 35 domain (NID) domains (Lee et al., 1999). NMI exerts a variety of biological functions by participating in signal transduction and transcriptional activation (Hou et al., 2017). It can bind to breast cancer type 1 susceptibility protein (BRCA1) and c-Myc to form a complex, which has potential effect on inhibiting the proliferation of cancer cells (Pruitt et al., 2016). During Sendai virus (SeV) infection, NMI targets IRF7 and mediates its ubiquitin and proteasome pathway degradation (Wang et al., 2013). NMI has also been proved to interact with IFP35 in fish and reduce the IFN-I mRNA level, and facilitate Siniperca chuatsi Rhabdo Virus (SCRV) replication (Li et al., 2023). In addition, NMI has been confirmed as a suppressor of IFN-I signaling and antiviral immunity with Influenza A virus (IAV) intrusion (Ouyang et al., 2021).

In this paper, NMI homologous of duck (duNMI) was cloned and identified, and we explored the effect on DTMUV innate immune response and its mechanism. We investigated that duNMI mRNA is widely distributed in healthy duck tissues and has a tissue-specific expression pattern. DuNMI can be induced and regulated antiviral immune response after DTMUV infection. NMI impairs duck regulatory factor 7 (duIRF7) mediated IFN-I signaling pathway, probably through its NIDs functional domains, ultimately increasing DTMUV replication. Therefore, our study reveals an important mechanism by which duNMI mediates innate immune escape and promotes DTMUV activity, which will provide a thoracal basis for studying duNMI function and preventing DTMUV infection.

MATERIALS AND METHODS

Ethics Statement

This study was approved by the Committee of Experiment Operational Guidelines and Animal Welfare of Sichuan Agricultural University. Experiments were conducted in accordance with approved guidelines.

Cells and Virus

Primary duck embryo fibroblasts (DEF) were obtained from duck embryos aged 9 to 12 d, cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% newborn calf serum (NBS). Each duck embryo produced about 30 mL of cell medium mixture, which was cultured at 37°C and 5% CO2. Human embryonic kidney (HEK) 293T cells were cultivated in RPMI 1640 supplemented with 10% fetal bovine serum (FBS) at 37°C with 5% CO2. The DTMUV CQW1 strain (GenBank: KM233707.1), 50% tissue culture infective dose (TCID50) = 10−5.78/mL was provided by the Institute of Research Center of Avian Disease at Sichuan Agricultural University (Zhu et al., 2015).

Reagents

Anti-beta-actin mouse monoclonal antibody (60004-1-Ig); Anti-Myc mouse monoclonal antibody (60003-2-Ig); Anti-His rabbit antibody (10001-O-AP); Anti-His mouse monolonal antibody (66005-1-Ig); HRP goat anti-mouse IgG antibody (SA00001-1) and HRP goat anti-rabbit IgG antibody (SA00001-1) were purchased from Proteintech (Wuhan, China); Anti-Flag mouse monoclonal antibody (M185-3L) was purchased from MBL (USA); Anti-Myc rabbit monoclonal antibody (71D10); Anti-Flag rabbit monoclonal antibody (D6M5B) were purchased from CST (USA); Anti-E mouse monoclonal antibody was obtained from our laboratory; PrimeSTAR Max DNA Polymerase (R045Q, Takara, Japan); TB Green Premix Ex Taq II (RR820Q, Takara, Japan); Lipofectamine 3000 (Invitrogen).

Sequence Amplification and Plasmid Construction

The primers for amplification of duNMI and its mutants were designed according to the predicted sequence of duNMI (NCBI accession No. XP_038038282.1) (Table 1). The template for amplification duNMI was cDNA which reversed transcription by total RNA of DEFs. The PCR production was cloned into the pMD19-T vector (pMD19-T Vector Cloning Kit, Takara, Japan), and then used pCAGGS-duNMI-F and pCAGGS-duNMI-R as primers subcloned into the pCAGGS vector between the multiple cloning sites Xho I and Bgl II (Takara, Japan). The recombinant plasmids were verified by restriction enzyme digestion and confirmed by sequencing (Sangon Biotech, China). pCAGGS-IRF7-Myc, pCAGGS-RIG-I-Flag, pCAGGS-MAVS-Flag, pCAGGS-TRAF3-Flag, pCAGGS-TBK1-Flag, pCAGGS-IRF7-Flag were provided by the Institute of Research Center of Avian Disease, College of Veterinary Medicine, Sichuan Agricultural University.Table 1 Primers used to amplify the duck NMI.

Table 1Primer	Sequence (5′–3′)	
pCAGGS-duNMI-Flag F	GACGATAAGCTCGAGGCCACCATGGATTTATCACTG	
pCAGGS-duNMI-Flag R	TTGGCAGAGGGAAAAAGATCTCTAAGCCTCCTCCTC	
pCAGGS-duNMI-His F	GACGATAAGCTCGAGGCCACCATGGATTTATCACTG	
pCAGGS-duNMI-His R	TTGGCAGAGGGAAAAAGATCTTCAGTGGTGATGGTGATGATGAGCCTCCTCCTC	
pCAGGS-duNMI-ΔNID1-Flag F	CTGAATCAAAACCAGGGAGGAGGAGGAAGCGGAGGAGGAGAGGAAGCGGAGGAGGAGGAAGCAATGTAAAATATGAC	
pCAGGS-duNMI-ΔNID1-Flag R	GTCATATTTTACATTGCTTCCTCCTCCTCCGCTTCCTCCTCCTCCGCTTCCTCCTCCTCCCTGGTTTTGATTCAG	
	
pCAGGS-duNMI-ΔNID2-Flag F	GACGATAAGCTCGAGGCCACCATGGATTTATCACTG	
pCAGGS-duNMI-ΔNID2-Flag R	TTGGCAGAGGGAAAAAGATCTCTATCCAGGTTTGAGGAA	
pCAGGS-duNMI-ΔCoiled-coil-Flag F	GACGATAAGCTCGAGGCCACCATGGCACTGCTTGCT	
pCAGGS-duNMI-ΔCoiled-coil-Flag R	TTGGCAGAGGGAAAAAGATCTCTAAGCCTCCTCCTC	
pCAGGS-duNMI-Coiled-coil-Flag F	GACGATAAGCTCGAGGCCACCATGGATTTATCACTG	
pCAGGS-duNMI-Coiled-coil-Flag R	TTGGCAGAGGGAAAAAGATCTCTAATCCCATGAAAGCTC	

Bioinformatics Analysis

The amino acid sequences of duNMI of each species were obtained from NCBI online database (http://www.ncbi.nlm.nih.gov/). The amino acid sequence of duNMI was analyzed using tools on the SMART website (http://smart.embl-heidelberg.de/). MEGA7.0, Gene.doc and BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) were used for homology comparison and phylogenetic tree construction.

Quantitative Real-Time PCR

Isolation of total RNA using Trizol reagent (Invitrogen, CA). Purity of all RNA samples were detected by analyzing the A260/A280 ration using a Nano drop ND-1000 spectrophotometer (Nano drop Technologies), which was expected to be 1.8 ∼ 2.0. First-strand cDNA was obtained from extracted RNA reverse transcribed by PrimeScript RT Reagent kit (TAKARA). Quantitative real-time PCR (Q-RT-PCR) was performed using SYBR Green real-time PCR assay (CFX96 Bio-Rad, Hercules, CA). The Q-RT-PCR reaction was set up in a total volume of 20 µL containing 2 µL of cDNA, 10 µL of SYBR Premix (Tli RNaseH Plus), 1 µL of forward/reverse primer and 6 µL of ddH2O. The duck β-actin gene were used as internal control gene to normalize the targeted gene expression value. The quantity mRNA was calculated by the 2−ΔΔCt method and represented as the mean ± SEM (n = 3). Primers employed are listed in Table 2.Table 2 Q-RT-PCR primers used in the study.

Table 2Primer	Sequence (5′–3′)	
β-actin F	GATCACAGCCCTGGCACC	
β-actin R	CGGATTCATCATACTCCTGCTT	
duNMI F	TCCTCAAACCTGGAGTAGCAAATGG	
duNMI R	TTGGAGACACATGAAGCCTGTACTG	
IRF7 F	CGCCACCCGCCTGAAGAAGT	
IRF7 R	CTGCCCGAAGCAGAGGAAGAT	
IFN-β F	CGCCTGGACACGCTAATA	
IFN-β R	AGCTGGTGCCTCTTGCTC	
Mx F	CCTAAGGGAGAAAGGACACT	
Mx R	GACCACGACACTTCACAACC	
DTMUV E F	AATGGCTGTGGCTTGTTTGG	
DTMUV E R	GGGCGTTATCACGAATCTA	

Co-Immunoprecipitation and Western Blot Analysis

Specific plasmids were co-transfected into HEK293T cells or DEFs for 36 h. After harvesting cells, the cells were lysed with IP lysis buffer (Thermo Fisher Scientific). For the immunoprecipitation test, add 0.5 mg of designated Ab to 0.55 mL of the lysate and incubate for 12 to 24 h at 4°C. After incubation, add protein G magnetic beads (MCE) to pulldown at 4°C for 4 to 6 h and wash 3 times with precooled PBST. Next, perform SDS-PAGE to separate the equal amount of cell samples, transfer the separated protein to a polyvinylidene fluoride membrane, and then incubate the primary antibody and secondary antibody sequentially, and use ECL reagent (Bio-Rad) analysis to visualize the target protein.

Indirect Immunofluorescence Assay

DEFs were seeded on coverslips that were placed in 6-well plates. When the cells reached 60% confluence, they were transfected with indicated plasmids. After 48 h post-transfection, cells were fixed in 4% paraformaldehyde, permeabilized with 0.25% Triton X-100, and blocked with sheep serum albumin. And then incubated with primary Abs, washed, incubated with secondary Abs, washed, followed by treatment with 49,6-diamidino-2-phenylindole (DAPI). Visualized using a confocal microscope (80i, Nikon, Japan).

Tissue Culture Infectious Dose 50 Assay

Virus yield in culture medium of DTMUV-infected cells was determined by measuring TCID50 in DEFs. In brief, DEFs were seeded in 96-well plates at a density of 2 × 104 cells per well. After 24 h, cells were infected with virus, which was serially diluted in 10-fold using serum free medium. The virus and cells were incubated at 37 °C for 5 d. The cytopathic effect of cells was observed using light microscopy. TCID50 was calculated by the Reed-Muench method.

RESULTS

Molecular Characteristic of DuNMI

To investigate the role of NMI in ducks, the complete coding sequence (CDS) of duNMI was cloned, which contains 1137 nucleotides (NCBI accession number: XP_038038282.1). The predicted duNMI protein consists of 378 amino acid residues (aa), including 3 domains, Colied-coil domain (22-126aa), NID1 domain (174-261aa) and NID2 domain (272-360aa) (Figure 1A). The predicted molecular weight of duNMI is about 43.4 kDa. Blast analysis revealed that the identity of duNMI to Aythya fuligula (tufted duck) was 96% (Table 3). Gene.doc software is used to align duNMI with several NMI sequences in other species, including Anser cygnoides, Egretta garzetta, Gallus gallus, Homo sapiens, Mus musculus, and Sus scrofa (Figure 1B). Phylogenetic trees were made using the Neighbor-Joining method with 1000 bootstraps by MEGA software (Figure 1C). These NMI homologs could be divided into 4 groups, consisting of Birds, Mammals, Fish and Frogs, duNMI gathers in the branches of the birds.Figure 1 Amino acid sequence analysis of duNMI. (A) Diagram of duNMI. (B) Multiple sequence alignment of NMI. The accession numbers are as follows: Anas platyrhynchos (XP_038038282.1), Anser cygnoides (XP_047936964.1), Egretta garzetta (XP_035754826.1), Gallus gallus (XP_046777966.1), Homo sapiens (AAC12949.1), Mus musculus (CAJ18568.1), Sus scrofa (XP_003359462.2). (C) The phylogenetic tree was constructed according to the alignment of amino acid sequences using the neighbor-jointing method within MEGA 7.0, with 1,000 bootstrap replications. The scale represents the numbers of substitutions per 1000 bases. The bootstrap values are indicated at the nodes of the tree. The GenBank accession number of each species is listed to the right of the species name.

Figure 1

Table 3 Comparison of duNMI with other NMI.

Table 3Species	NCBI accession number	Full-length sequence	
Identity	Similarity	
Aythya fuligula	XP 032045964.1	96%	97%	
Cygnus atratus	XP 035421962.1	87%	92%	
Anser cygnoides	XP 047936964.1	87%	92%	
Gallus gallus	XP 046777966.1	72%	83%	
Egretta garzetta	XP 035754826.1	60%	72%	
Rattus norvegicus	NP 001029320.1	42%	65%	
Homo sapiens	AAC12949.1	40%	66%	
Bos taurus	AAI33622.1	40%	65%	
Capra hircus	XP 005676212.1	40%	66%	
Mus musculus	CAJ18568.1	39%	63%	
Sus scrofa	XP 003359462.2	38%	63%	
Oncorhynchus mykiss	XP 036815218.1	36%	54%	
Ovis aries	XP 027820772.2	35%	57%	
Nibea albiflora	KAG8000999.1	34%	53%	
Xenopus laevis	NP 001088598.2	33%	57%	
Rana temporaria	XP 040213946.1	31%	53%	
Identity: The extent to which 2 (nucleotide or amino acid) sequences are invariant.

Similarity: The extent to which nucleotide or protein sequences are related. The extent of similarity between 2 sequences can be based on percent sequence identity and/or conservation. In BLAST similarity refers to a positive matrix score.

Tissue Distribution of DuNMI in vivo and Its Protein Expression in vitro

Using Q-RT-PCR to analyze the transcript levels of duNMI in different tissues from healthy ducklings, including blood, muscle, heart, liver, spleen, lung, kidney, harderian gland, small intestine, cecum, brain, pancreas (Figure 2A). DuNMI was distributed in all 12 examined tissues, chiefly in harderian gland (immune organs in birds) small intestine, pancreas and blood, while very little is distributed in the brain and muscle (Muller et al., 1991). To examine the expression of duNMI protein in vitro, HEK293T cells and DEFs were transfected with plasmids overexpression duNMI and empty vector and applied to western blot assay. According to requirements of experiment, we constructed duNMI eukaryotic expression plasmids (pCAGGS-duNMI-Flag and pCAGGS-duNMI-His) and successfully expressed duNMI in HEK293T cells and DEFs by western blot (Figures 2B–E). Comparing with the control, the specific band of ∼55 kDa were detected in the whole cell lysate.Figure 2 Tissue distribution of duNMI and its protein expression. (A) Tissue distribution of duNMI in 7-day-old health ducklings was performed by Q-RT-PCR, β-actin as an internal reference gene, calculation method was 2−ΔΔCt and data were normalized to the blood. (B–E) Protein expression of duNMI. pCAGGS-duNMI-Flag or pCAGGS-duNMI-His (2,500 ng/well) were transfected into DEFs and HEK293T cells, pCAGGS was used as control, the expression of duNMI protein was detected by western blot.

Figure 2

DuNMI Facilitates DTMUV Proliferation

To clarify the potential relationship between duNMI and DTMUV, Q-RT-PCR was utilized to examine duNMI mRNA in DEFs after viral stimulation. that transcription level of duNMI increases significantly with time after infection and peaked at 36 h, viral level rises at the same time (Figures 3A and B), which potentially means duNMI possibly exert regulatory influence during DTMUV infection. Subsequently, we examined the viral load in the supernatants of cell cultures and cell cultures during duNMI overexpression. The results show that except for the first 24 h of the cell cultures group, the viral load of control group and experimental group was similar, the virus titer was significantly improved compared to the control group (Figures 3C and D). We then detected the expression of DTMUV E protein, a critical sign of DTMUV replication, as the duNMI transfection dose gradually increased (Figure 3E). Based on duNMI is a kind of ISGs related to innate immune signal pathway, we first wondered whether duNMI increases viral proliferation by regulating DTMUV induced immune signaling pathways. After overexpressing duNMI in DEFs and infecting DTMUV (MOI = 1), we monitored a range of key innate immune signaling molecules or interferon-related factors, including IFN-β, IRF7, Mx via Q-RT-PCR (Figures 3F–H). The results indicated that duNMI weakened the production of immune factors, suggesting that it may assist the immune escape of the virus by inhibiting the virus-induced immune signaling pathway, and ultimately promote viral replication.Figure 3 DuNMI overexpression promotes DTMUV replication. (A) DEFs were seeded in 8 single orifice plates (2 × 106 cells) 24 h before Infection with poison. The cells were infected with DTMUV at 1MOI. The cells were harvested at indicated time points post infection with DTMUV separately and used for RNA isolation. The relative NMI mRNA levels were examined by Q-RT-PCR, error bars represent standard deviations of triplicates, **P < 0.01, ***P < 0.001, ****P < 0.0001. (B) DEFs were seeded in 4 single orifice plates (2 × 106 cells) 24 h and cells were infected with DTMUV (MOI = 0.1). The viral copies at the indicated time points were determined by Q-RT-PCR. (C, D) pCAGGS (2,500 ng/well) or pCAGGS-duNMI-Flag (2,500 ng/well) were transfected into DEFs, after 24 h transfection, cells were infected with DTMUV (MOI =1). The virus titers in the supernatants of cell cultures (C) and in the cell cultures (D) at the indicated time point were determined by TCID50. (E) pCAGGS-duNMI-Flag was transfected into DEFs according to the concentration gradient (500, 1,000, 1,500 ng/well), pCAGGS was used as control DTMUV infected DEFs after 36 h transfection, the expression of DTMUV E protein was detected by western blot. (F–H) DEFs were transfected with pCAGGS or pCAGGS-duNMI-Flag and then cells were infected with DTMUV 24 h post-transfection. The transcription activities of IFN-related immune factors were detected at 36 h after infection by Q-RT-PCR. (F) IFN-β; (G) IRF7; (H) Mx. Statistical significance was analyzed by t-test, error bars represent standard deviations of triplicates, *P < 0.05.

Figure 3

DuNMI Targets and Degrades duIRF7

The RIG-I signaling pathway has previously been reported to play an integral role in the fight against viruses, especially RNA viruses (Guo et al., 2021), while NMI has been confirmed in different species to interact with IRF7, a key signal downstream of RIG-I, in response to viral infection. Due to the lack of reports on the connection between duNMI and duIRF7, we verified and confirmed the targeting relationship between them through CO-IP and western blotting analysis (Figure 4A). Moreover, indirect immunofluorescence assay was used to investigated that duNMI and duIRF7 is closer in space and co-localized in cytoplasm (Figure 4B). Subsequently, since duNMI targets duIRF7, the first thing we thought about was whether duNMI affects the protein stability of duIRF7. The eukaryotic expression plasmid of duNMI was transfected into HEK293T cells and DEFs, respectively. Comparing with the control, the expression of duIRF7 protein was down-regulated, which means duNMI probably achieve negative regulation of its downstream key factors by inhibiting duIRF7 (Figure 4C).Figure 4 DuNMI targets and degrades duIRF7. (A) Co-transfected pCAGGS-duNMI-Flag and pCAGGS, pCAGGS-duIRF7-Myc and pCAGGS, pCAGGS-duIRF7-Myc and pCAGGS-duNMI-Flag to HEK293T cells respectively for 24 h. Immunoprecipitation of cell lysates with anti-Myc, and then anti-Myc and anti-Flag for immunoblotting. (B) pCAGGS-duNMI-Flag (1000ng/well) and pCAGGS-duIRF7-Myc (1,500 ng/well) were transfected into HEK293T cells for 24 h followed by staining for anti-Flag (green) and anti-Myc (red) antibody and then used confocal microscopy to observe the co-location of duNMI and duIRF7. (C) HEK293T cells and DEFs were transfected pCAGGS (2,500 ng/well), pCAGGS-duNMI-Flag (2,500 ng/well), pCAGGS-duIRF7-Myc (2,500 ng/well), pCAGGS-duNMI-Flag (1,500 ng/well) and pCAGGS-duIRF7-Myc (1,000 ng/well) respectively for 30 h. The expression of protein was detected by western blot.

Figure 4

DuNMI NID Domains Interact With duIRF7

Whereafter, we further explored which domain in duNMI was responsible for interacting with duIRF7. According to amino acid composition, duNMI was predicted to be divided into 3 functional domains by SMART website (Figure 5A). We then constructed 4 missing mutants of NMI successively: NMI/IFP 35 domain 1 deficient mutants (ΔNID1), NMI/IFP 35 domain 2 deficient mutants (ΔNID2), Coiled-coil domain deficient mutants (ΔCoiled-coil), Coiled-coil domain mutants (Colied-coil) (Figure 5B). COIP was applied to verify the interaction of these deletion mutants with duIRF7, the result illustrated that duIRF7 interacts with ΔNID1, ΔNID2 and ΔCoiled-coil, whereas it doesn't interact with Coiled-coil, suggesting that NIDs domain are the functional domains of duNMI (Figure 5C) and they play a role in suppressing duIRF7 expression (Figure 5D). What's more, we further verified that the negative impact of NMI and its NIDs domains on IRF7-induced IFN-β production (Figure 5E).Figure 5 DuNMI NIDs domains interact with duIRF7. (A) Schematic map of deletion domain mutants. (B) pCAGGS, pCAGGS-duNMI-Flag, pCAGGS-duNMI-ΔNID1-Flag, pCAGGS-duNMI-ΔNID2-Flag pCAGGS-duNMI-ΔCoiled-coil-Flag and pCAGGS-Coiled-coil-Flag were respectively transfected into HEK293T cells at 2,500 ng per well, pCAGGS was used as control, the expression of deletion domain mutants proteins were detected by western blot. (C) pCAGGS-duNMI-Flag or its mutants (1,000 ng/well) and pCAGGS-duIRF7-Myc (1,500 ng/well) were individually transfected into HEK293T cells. The cell lysates were IP analyzed with an anti-Myc antibody and then IB analyzed with the anti-Flag and anti-Myc. (D) HEK293T cells and DEFs were transfected pCAGGS (2,500 ng/well), pCAGGS-duNMI-NIDs-Flag (2,500 ng/well), pCAGGS-duIRF7-Myc (2500ng/well), pCAGGS-duNMI-NIDs-Flag (1,500 ng/well) and pCAGGS-duIRF7-Myc (1,000 ng/well) respectively for 30 h. The expression of protein was detected by western blot. (E) DEFs were transfected with pCAGGS, pCAGGS-duNMI-Flag or pCAGGS-duNMI-NIDs-Flag and then cells were infected with DTMUV 24 h post-transfection. The transcription activities of IFN-β were detected at 36 h after infection by Q-RT-PCR.

Figure 5

DISCUSSION

DTMUV has brought enormous economic losses to the agriculture industry, and since most members of the flavivirus genus are zoonotic pathogens, there is a danger of further transmission to humans for DTMUV (Akinsulie et al., 2023; Li et al., 2020; Parry and Asgari, 2019). Therefore, it's necessary to explore and study the pathogenic mechanism and immune escape mechanism of DTMUV.

NMI is a gene identified by using a yeast genetic screen, that binds to N-myc and C-myc (Bao and Zervos, 1996). NMI has been reported as an IFN-inducible protein and interact with a variety of key transcription factors to participate in multiple signal pathways (Lebrun et al., 1998). For example, because of its homology with IFP35, it can bind with IFP35 through multiple sites to form macromolecular complexes to protect the sable existence of IFP35 in cells (Zhang et al., 2007; Zhou et al., 2000). NMI can also bind to STATs except STAT2 to regulate STAT-related transcription (Zhu et al., 1999). In addition, NMI has been confirmed to participate in regulating antiviral response through different roles and targets, such as Influenza H3N2 A viruses (H3N2), Hepatitis B virus (HBV), Foot-and-mouth disease virus (FMDV), etc. (Rao et al., 2020; Wang et al., 2012; Xiong et al., 2019). However, the exact function of duNMI in response to DTMUV infection remains unclear. In this study, we cloned and identified duNMI, and revealed its role in DTMUV infection. The results showed that duNMI was widely distributed in different tissues and organs of ducks, with the highest expression in Hadrian gland (immune-related organ in ducks) and the expression of duNMI increased after DTMUV infection, which means duNMI may be related to host innate immunity. Besides, we found that the overexpression of duNMI significantly inhibited the expression of IRF7, IFN-β and Mx, suggesting that duNMI may be a negative regulator of innate immune response. Then, we determined the regulatory effect of duNMI could inhibit the expression of DTMUV E protein in dose-dependent manner, which proved duNMI could promote DTMUV replication.

RLRs have been demonstrated to play a critical role in activating downstream signaling in response to RNA virus in ducks, especially the role of RIG-I receptor on flavivirus (Hertzog et al., 2018; Li et al., 2022). As a key signal molecule downstream of RIG-I immune signal pathway, IRF7 enters the nucleus after activation and initiates IFN-I transcription (Chen et al., 2019; Xia et al., 2023). In this study, we found that IRF7 targets duNMI directly and confirms it depends on NIDs domains of duNMI rather than Coiled-coil domain. Moreover, duNMI downregulates IRF7 mRNA and then inhibits the production of downstream ISGs, resulting in increased replication of DTMUV. Therefore, it is reasonable to speculate that this may be part of the immune escape mechanism of DTMUV.

CONCLUSION

In summary, we cloned and identified duNMI gene, and confirmed that DTMUV up-regulates duNMI transcript level. In addition, our study confirmed that NMI is an inhibitory factor of anti-viral innate immunity during viral infection, ultimately promoting DTMUV replication. Specifically, duNMI interacts with duIRF7 through NIDs domains and degrades the protein expression of duIRF7, subsequently inhibiting downstream immune factors. Our current work is the first time to explore the function of duNMI in the process of DTMUV infection, which will provide a theoretical basis for the prevention of DTMUV infection.

DISCLOSURES

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

ACKNOWLEDGMENTS

This work was supported by the National Natural Science Foundation of China (32172833 ), the Program Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research System (CARS-SVDIP), the earmarked fund for China Agriculture Research System (CARS-42-17).
==== Refs
REFERENCES

Akinsulie O.C. Adesola R.O. Bakre A. Adebowale O.O. Adeleke R. Ogunleye S.C. Oladapo I.P. Usutu virus: An emerging flavivirus with potential threat to public health in Africa: Nigeria as a case study Front. Vet. Sci. 10 2023 1115501
Bao J. Zervos A.S. Isolation and characterization of NMI, a novel partner of Myc proteins Oncogene 12 1996 2171 2176 8668343
Cao Z. Zhang C. Liu Y. Ye W. Han J. Ma G. Zhang D. Xu F. Gao X. Tang Y. Shi S. Wan C. Zhang C. He B. Yang M. Lu X. Huang Y. Diao Y. Ma X. Zhang D. Tembusu virus in ducks China. Emerg Infect. Dis. 17 2011 1873 1875 22000358
Chang M.X. The negative regulation of retinoic acid-inducible gene I (RIG-I)-like receptors (RLRs) signaling pathway in fish Dev. Comp. Immunol. 119 2021 104038
Chen H. Jiang Z. The essential adaptors of innate immune signaling Protein. Cell. 4 2013 27 39 22996173
Chen S. Wang T. Liu P. Yang C. Wang M. Jia R. Zhu D. Liu M. Yang Q. Wu Y. Zhao X. Cheng A. Duck interferon regulatory factor 7 (IRF7) can control duck Tembusu virus (DTMUV) infection by triggering type I interferon production and its signal transduction pathway Cytokine 113 2019 31 38 29885990
Guo G. Gao M. Gao X. Zhu B. Huang J. Tu X. Kim W. Zhao F. Zhou Q. Zhu S. Wu Z. Yan Y. Zhang Y. Zeng X. Zhu Q. Yin P. Luo K. Sun J. Deng M. Lou Z. Reciprocal regulation of RIG-I and XRCC4 connects DNA repair with RIG-I immune signaling Nat. Commun. 12 2021 2187 33846346
Guo H.-Y. Zhang X.-C. Jia R.-Y. Toll-like receptors and RIG-I-Like receptors play important roles in resisting flavivirus J. Immunol. Res. 2018 6106582
Hertzog J. Dias A.G. Jr. Rigby R.E. Donald C.L. Mayer A. Sezgin E. Song C. Jin B. Hublitz P. Eggeling C. Kohl A. Rehwinkel J. Infection with a Brazilian isolate of Zika virus generates RIG-I stimulatory RNA and the viral NS5 protein blocks type I IFN induction and signaling Eur. J. Immunol. 48 2018 1120 1136 29572905
Hou J. Jiang S. Zhao J. Zhu D. Zhao X. Cai J.-c. Zhang S.Q. N-Myc-interacting protein negatively regulates TNF-α-induced NF-κB Transcriptional activity by sequestering NF-κB/p65 in the cytoplasm Sci. Rep. 7 2017 14579 29109532
Kumar H. Kawai T. Akira S. Pathogen Recognition by the Innate Immune System Int. Rev. Immunol. 30 2011 16 34 21235323
Lebrun S.J. Shpall R.L. Naumovski L. Interferon-induced upregulation and cytoplasmic localization of Myc-interacting protein NMI J. Interferon. Cytokine. Res. 18 1998 767 771 9781816
Lee N.D. Chen J. Shpall R.L. Naumovski L. Subcellular localization of interferon-inducible Myc/stat-interacting protein NMI is regulated by a novel IFP 35 homologous domain J. Interferon. Cytokine. Res. 19 1999 1245 1252 10574616
Li N. Wang Y. Li R. Liu J. Zhang J. Cai Y. Liu S. Chai T. Wei L. Immune responses of ducks infected with duck Tembusu virus Front. Microbiol. 6 2015 425 26005441
Li N. Zhao J. Yang Y. Zeng Y. Liu S. Innate immune responses to duck Tembusu virus infection Vet. Res. 51 2020 87 32641107
Li T. Ren Y. Zhang T. Zhai X. Wang X. Wang J. Xing B. Miao R. Li N. Wei L. Duck LGP2 downregulates RIG-I Signaling pathway-mediated innate immunity against Tembusu virus Front. Immunol. 13 2022 916350
Li L. Chen S.N. Wang K.L. Li N. Pang A.N. Liu L.H. Li B. Hou J. Wang S. Nie P. Interaction of NMI and IFP35 promotes mutual protein stabilization and IRF3 and IRF7 degradation to suppress type I IFN production in Teleost fish J. Immunol. 210 2023 1494 1507 37010945
Liu P. Lu H. Li S. Wu Y. Gao G.F. Su J. Duck egg drop syndrome virus: An emerging Tembusu-related flavivirus in China Sci. China. Life. Sci. 56 2013 701 710 23917842
Muller W. Gieldanowski J. Firsching R. Blaszczyk B. Russel bodies-containing cells in the Harderian gland of the chicken in relation to different immune conditions Arch. Immunol. Ther. Exp. 39 1991 1 5
Ouyang W. Cen M. Yang L. Zhang W. Xia J. Xu F. NMI facilitates influenza A virus infection by promoting degradation of IRF7 through TRIM21 Am. J. Respir. Cell. Mol. Biol. 65 2021 30 40 33761305
Parry R. Asgari S. Discovery of novel crustacean and cephalopod flaviviruses: insights into the evolution and circulation of flaviviruses between marine invertebrate and vertebrate hosts J. Virol. 93 2019 e00432-19
Pruitt H.C. Devine D.J. Samant R.S. Roles of N-Myc and STAT interactor in cancer: From initiation to dissemination Int. J. Cancer. 139 2016 491 500 26874464
Rao S. Martin J. Ahearn M.A. Osborne C. Moss A. Dempsey A. Dominguez S.R. Weinberg A. Messacar K.B. Neurologic manifestations of influenza A(H3N2) infection in children during the 2016-2017 season J. Pediatric. Infect. Dis. Soc. 9 2020 71 74 30590598
Wang J. Wang Y. Liu J. Ding L. Zhang Q. Li X. Cao H. Tang J. Zheng S.J. A critical role of N-myc and STAT interactor (NMI) in foot-and-mouth disease virus (FMDV) 2C-induced apoptosis Virus. Res. 170 2012 59 65 22974759
Wang J. Yang B. Hu Y. Zheng Y. Zhou H. Wang Y. Ma Y. Mao K. Yang L. Lin G. Ji Y. Wu X. Sun B. Negative regulation of Nmi on virus-triggered type I IFN production by targeting IRF7 J. Immunol. 191 2013 3393 3399 23956435
Wang J. Lei C.-Q. Ji Y. Zhou H. Ren Y. Peng Q. Zeng Y. Jia Y. Ge J. Zhong B. Li Y. Wei J. Shu H.-B. Zhu Q. Duck Tembusu virus nonstructural protein 1 antagonizes IFN-β signaling pathways by targeting VISA J. Immunol. 197 2016 4704 4713 27821666
Wu B. Hur S. How RIG-I like receptors activate MAVS Curr. Opin. Virol. 12 2015 91 98 25942693
Wu X. Pan Y. Huang J. Huang S. Wang M. Chen S. Liu M. Zhu D. Zhao X. Wu Y. Yang Q. Zhang S. Ou X. Zhang L. Liu Y. Yu Y. Gao Q. Mao S. Sun D. Tian B. Yin Z. Jing B. Cheng A. Jia R. The substitution at residue 218 of the NS5 protein methyltransferase domain of Tembusu virus impairs viral replication and translation and may triggers RIG-I-like receptor signaling Poult. Sci. 101 2022 102017
Xia X. Cheng A. Wang M. Ou X. Sun D. Zhang S. Mao S. Yang Q. Tian B. Wu Y. Huang J. Gao Q. Jia R. Chen S. Liu M. Zhao X.-X. Zhu D. Yu Y. Zhang L. DHAV 3CD targets IRF7 and RIG-I proteins to block the type I interferon upstream signaling pathway Vet. Res. 54 2023 5 36703166
Xiong L. Du Y. Zhou T. Du B. Visalath P. Lin L. Bao S. Cai W. N-myc and STAT interactor correlates with severity and prognosis in acute-on-chronic liver failure of hepatitis B virus J. Gastroenterol. Hepatol. 34 2019 1800 1808 30771232
Yan Z. Shen H. Wang Z. Lin W. Xie Q. Bi Y. Chen F. Isolation and characterization of a novel Tembusu virus circulating in Muscovy ducks in South China Transbound. Emerg. Dis. 64 2017 E15 E17 27291976
Zhang L. Tang Y. Tie Y. Tian C. Wang J. Dong Y. Sun Z. He F. The PH domain containing protein CKIP-1 binds to IFP35 and NMI and is involved in cytokine signaling Cell. Signal. 19 2007 932 944 17197158
Zhang W. Chen S. Mahalingam S. Wang M. Cheng A. An updated review of avian-origin Tembusu virus: A newly emerging avian Flavivirus J. Gen. Virol. 98 2017 2413 2420 28874226
Zhou X. Liao J. Meyerdierks A. Feng L. Naumovski L. Bottger E.C. Omary M.B. Interferon-alpha induces nmi-IFP35 heterodimeric complex formation that is affected by the phosphorylation of IFP35 J. Biol. Chem. 275 2000 21364 21371 10779520
Zhu K. Huang J. Jia R. Zhang B. Wang M. Zhu D. Chen S. Liu M. Yin Z. Cheng A. Identification and molecular characterization of a novel duck Tembusu virus isolate from Southwest China Arch. Virol. 160 2015 2781 2790 26303137
Zhu M. John S. Berg M. Leonard W.J. Functional association of NMI with Stat5 and Stat1 in IL-2- and IFN gamma-mediated signaling Cell 96 1999 121 130 9989503
