
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00826-5
10.1016/j.psj.2024.104247
104247
METABOLISM AND NUTRITION
Effects of hesperidin, thymol, rosmarinic acid and their combined effect on growth performance, intestinal barrier function and cecal microbiota in broilers
Liu Ruixue
Ding Xuedong
Dang Miaomiao
Wang Jing jwang8@njau.edu.cn
1
Zhu Weiyun
National Center for International Research on Animal Gut Nutrition, Laboratory of Gastrointestinal Microbiology, National Experimental Teaching Demonstration Center of Animal Science, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, China
1 Corresponding author: jwang8@njau.edu.cn
27 8 2024
12 2024
27 8 2024
103 12 10424720 5 2024
18 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
This study aims to investigate the effects of hesperidin (Hes), thymol (Thy), rosmarinic acid (RA) and their combined effect on broiler growth performance, intestinal barrier function, and cecal microbiota. A total of 240 newly hatched Arbor Acres broiler chicks were randomly divided into 5 treatments with 6 replicates of 8 chickens. The birds were fed a basal diet (Con group), a basal diet supplemented with 40 mg/kg Hes (Hes group), a basal diet supplemented with 40 mg/kg Thy (Thy group), a basal diet supplemented with 20 mg/kg RA (RA group), or a basal diet supplemented with 40 mg/kg Hes + 40 mg/kg Thy + 20 mg/kg RA (HTR group) for 42 d. The results indicated that dietary Hes and HTR supplementation enhanced average daily gain, final body weight, and eviscerated yield of broilers compared with the Con group (P < 0.05). Notably, the HTR treatment showed a decrease in abdominal fat yield and ratio of feed to weight gain (P < 0.05). HTR treatment increased ileal villus height, villus height/crypt depth, and number of goblet cells, decreased the crypt depth (P < 0.05), up-regulated the mRNA expression of tight junction proteins (ZO-1, Claudin-1, Occludin) and MUC2 (P < 0.05). Hes, Thy, RA, HTR treatment decreased the concentrations of pro-inflammatory factors (IL-8, IFN-γ and TNF-α), and down-regulated the mRNA expression of TLR4/MyD88/NF-κB (P < 0.05). Importantly, the supplementation of HTR increased the relative abundance of beneficial bacteria (Parabacteroides, Lachnosiraceae NK4A136 and Turicbacter) and significantly decreased the relative abundance of opportunistic pathogenic bacteria such as Colidextribacter (P < 0.05). Additionally, the concentrations of propionate and butyrate in the cecum were elevated in the HTR group (P < 0.05). These findings indicate that the diet supplemented with HTR improved the growth performance and intestinal barrier function in broilers by modulating the cecal microbiota and its metabolites.

Key words

hesperidin
thymol
rosmarinic acid
broiler
intestinal barrier
==== Body
pmcINTRODUCTION

Chicken meat holds its position as the primary meat in both production and consumption worldwide, with a substantial 70% coming from white feather broilers. The surge in intensive farming has increased chickens' susceptibility to stressors like feed dust, trampling, and excremental contamination (Gržinić et al., 2023). Such stressors disrupt chickens' internal environment, damaging their intestinal barriers and rendering them prone to pathogenic microorganisms and bacterial toxins, leading to intestinal diseases. Consequently, diseases such as inflammatory enteritis arise, leading to a decline in their growth performance (Salim and Soderholm, 2011; Sun and Jia, 2018). In response, antibiotics have been widely added to chicken feed as feed additives (Davies and Davies, 2010). However, their use has been linked to adverse environmental impacts and the development of drug-resistant bacteria (Ferri et al., 2017; Hammerum et al., 2010). Consequently, the ban on antibiotics has underscored the critical need for safe and sustainable alternatives, such as plant extracts, prebiotics, and organic acids (Dai et al., 2022; Li et al., 2022a; Xie et al., 2019).

Hesperidin (Hes), a bioflavonoid, is abundantly present in citrus fruit epidermis (Fernando et al., 2022). As demonstrated in previous studies, Hes acts as a reactive oxygen scavenger, protecting against damages caused by hydrogen peroxide during stressful conditions (Lim et al., 2022). In addition, Hes inhibited the inflammation of the colon in Dextran Sulfate Sodium (DSS)-induced mice by increasing the number of Treg (Guo et al., 2019). Thymol (Thy), known as a muscimol, is a monomeric substance found in various parts of plants belonging to the Lamiaceae family such as the bark, roots, wood, leaves, and fruits (Macku et al., 2022). Thy can protect against Aspergillus fumigatus keratitis by reducing the aggregation of inflammatory cells and down-regulating the expression of TLR4/MyD88 signaling pathway (Wang et al., 2023). Additionally, Thy impedes harmful bacteria like Escherichia coli and Salmonella while preserving beneficial ones like Lactobacillus (Du et al., 2015). Rosmarinic acid (RA) is a water-soluble phenolic acid compound commonly present in plants of the Lamiaceae, Cucurbitaceae, and Boraginaceae families in nature (Sanchez-Camargo and Herrero, 2017. Research indicates that RA influences DNA replication by changing cell membrane permeability and inhibiting DNA polymerase activity. Additionally, it inhibited the growth of Escherichia coli and Salmonella (Rocha et al., 2015). Previous research has consistently demonstrated that RA can improve intestinal inflammation and mitigate intestinal microbiota disorders associated with diarrhea (Zhao et al., 2018). Furthermore, studies have shown that Hes, Thy and RA may exhibit synergistic effects when combined with other plant extracts. For instance, Chen et al. (2023) discovered that the combination of gallic acid and Hes plant extracts could synergistically offer a protection against colorectal cancer. Moreover, citrus fruit extracts containing carvacrol and Thy have been found to have synergistic antibacterial effects on Escherichia coli, Salmonella typhimurium, and Listeria monocytogenes (Chung et al., 2018). When combined with carvacrol and eugenol, Thy can achieve a synergistic antibacterial effect. This interaction occurs through hydrophobic and hydrogen bonding with membrane proteins, ultimately leading to the breakdown of the bacterial membrane (Miladi et al., 2017). Prior research in our laboratory has revealed a synergistic effect of Thy and RA, demonstrating efficacy in mitigating intestinal inflammation and revivied the intestinal morphological structure in mice subjected to LPS toxicity (Li et al., 2022b). At the same time, the combined application of Hes and RA has shown potential in enhancing growth and strengthen intestinal health in fattening pigs (Zhao et al., 2023). To our knowledge, there are limited studies investigating the effects of Hes, Thy, and RA supplementation on gut health in broilers individually and in combination. This study aims to explore the impact of the combination of Hes, Thy, and RA on broiler growth, intestinal barrier function, and cecal microbiota profiles. Additionally, we evaluated the ileal morphology, barrier function, inflammatory response, and cecal microbiota of broiler chickens in this study.

MATERIALS AND METHODS

Animals and Experimental Protocol

A total of two hundred and forty one-day-old Arbor Acres broiler chickens were divided into 5 treatments based on body weight in a completely randomized design, with 6 replicates per treatment and 8 chickens per replicate. The dietary treatments were the Con group: a basal diet; Hes group: a basal diet with 40 mg/kg Hes; Thy group: a basal diet with 40 mg/kg Thy; RA group: a basal diet with 20 mg/kg RA; Combination (HTR) group: a basal diet with 40 mg/kg Hes, 40 mg/kg Thy, and 20 mg/kg RA. The basal diet used in this experiment was a corn-soybean meal type diet formulated according to the nutritional requirement standards (NRC, 1994). The proximate composition, which includes crude protein, total phosphorus and calcium, was evaluated according to the method of the Association of Official Analytical Chemists (AOAC, 2010). The composition and nutrient levels of the basal diets are shown in Table 1. Hes (98%), Thy (98%), and RA (98%) were purchased from Shanxi Yuning Biotechnology Co., Ltd (Shanxi, China). The AA broiler chickens were purchased from Nanjing Special Power Planting Co., Ltd (Jiangsu, China).Table 1 The composition and nutrient levels of the basal diet (% as fed basis).

Table 1Ingredient	Growing phase	
1–21 d	22–42 d	
Corn	52.88	61.12	
Fish meal, 60.2% CP	3.00	0	
Expanded soybean meal, 44.3% CP	27.13	21.51	
Corn gluten meal, 53.2% CP	8.00	9.00	
Soybean oil	5.35	4.45	
L-Lys, 78.5%	0.02	0.30	
DL-Met, 99.0%	0.12	0.05	
L-Try, 98.0%	0.02	0.05	
L-Thr, 98.5%	0.03	0.09	
NaCl	0.30	0.30	
Limestone	1.16	1.34	
CaHPO4	1.49	1.29	
Vitamin and mineral premix1	0.50	0.50	
Total	100	100	
Nutrient levels2		
Metabolizable energy, Kcal/kg	3,195.84	3,195.84	
Crude protein	22.69	19.74	
Calcium	0.97	0.88	
Total phosphorus	0.73	0.61	
Available phosphorus	0.45	0.35	
Lysine	1.09	1.05	
Methionine	0.54	0.42	
Tryptophan	0.26	0.24	
Threonine	0.89	0.83	
1 The vitamin-mineral premix provided the following per kilogram of diet from 1 to 21 d of age (supplied per kilogram of feed): vitamin A 15,000 IU; vitamin D3 4500 IU; vitamin E 58.5 mg; vitamin K3 3.0 mg; niacin 60 mg; calcium pantothenate 12.0 mg; biotin 0.24 mg; choline 600 mg; folic acid 1.2 mg; thiamine 3.0 mg; vitamin B6 4.5 mg; vitamin B12 0.03 mg; riboflavin 7.0 mg; Fe 80 mg; Cu 8 mg; Mn 80 mg; Zn 60 mg; I 0.40 mg; Se 0.20 mg.

The vitamin-mineral premix provided the following per kilogram of diet from 22 to 42 d of age (supplied per kilogram of feed): vitamin A 12,500 IU; vitamin D3 3800 IU; vitamin E 45.5 mg; vitamin K3 2.5 mg; niacin 50 mg; calcium pantothenate 10.0 mg; biotin 0.2 mg; choline 480 mg; folic acid 1.0 mg; thiamine 2.5 mg; Vitamin B6 4.0 mg; Vitamin B12 0.025 mg; riboflavin 6.0 mg; Fe 80 mg; Cu 8 mg; Mn 80 mg; Zn 60 mg; I 0.40 mg; Se 0.20 mg.

2 Protein, calcium, and total phosphorus were analyzed values, while the other nutrient levels were calculated values.

The broilers were housed in 3-tier cages (17.54 kg/m2 or 8 birds/m2), fed ad libitum with adequate drinking water, and vaccinated according to the normal immunization program. This trial was approved by the Institutional Animal Care and Use Committee of Nanjing Agricultural University (Jiangsu, China), and the trial procedure was in accordance with the Chinese Animal Welfare Guidelines

Sample Collection

On the 42nd day of the trial period, after 12 h of fasting (free to drink), 1 broiler near the average body weight was slaughtered and sampled from each replicate, and the contents of the cecum were squeezed out and packed in a 2 mL lyophilized tube; after rinsing the ileum tissue with saline, 3 to 4 cm of ileal mid-section tissue was collected and fixed in 4% paraformaldehyde solution; a slide was used to scrape the ileal mucosa and packed in a 2 mL lyophilized tube, and the lyophilized tube was placed in liquid nitrogen and stored for analysis.

Growth and Slaughter Performance

Body weight (BW) and feed intake (FI) of broilers were measured on d 21 and 42 of the trial to calculate feed conversion ratio (feed:gain, F/G), average daily gain (ADG), and average daily feed intake (ADFI). At the end of the trial period, 1 broiler near the average body weight was euthanized after 12 h of fasting and weighed for carcass weight, live weight, eviscerated weight, and abdominal fat weight to calculate the carcass yield, eviscerated yield, and abdominal fat yield. The carcass yield = carcass weight/live weight × 100%, eviscerated yield = eviscerated weight/live weight × 100%, abdominal fat yield = abdominal fat weight/live weight × 100%.

Histological Analysis

The ileal tissue samples fixed in 4% paraformaldehyde were dehydrated with aqueous ethanol solutions of different concentration gradients, then the alcohol was washed off with xylene, and finally the tissue blocks were embedded in wax. The embedded wax blocks were then cut into 5 μm-thick slices for hematoxylin and eosin (H&E) staining and periodic acid-schiff (PAS) staining. The ileal slices were examined by an optical binocular microscope (Olympus BX5) with a camera (Nikon H550L) for the tissue morphology. Five intact and well-aligned villi were selected for each section for HE staining, and 5 villi of each section were stained with PAS staining, and the number of cupped cells was observed by measuring the intestinal villi height (VH) and crypt depth (CD) of the neatly arranged villi in each section. All measurements were performed using Image-J software.

Enzyme-Linked Immunosorbent Assay

After taking out the ileal mucosa from liquid nitrogen, each intestinal mucosa was weighed, and diluted with 0.9 % normal saline at a mass-to-volume ratio of 1/9. The mucosa was homogenized at 4°C to make a 10% tissue homogenate, and after the centrifugation, the supernatant was collected into a 1.5 mL Eppendorf tube and stored at 4°C until cytokine analysis. The levels of inflammatory factors including interleukin 6 (IL-6), interleukin 8 (IL-8), interleukin 10 (IL-10), interferon gamma (IFN-γ), and tumor necrosis factor alpha (TNF-α) in ileal tissue were measured using an enzyme-linked immunosorbent assay (Elisa). All kits were purchased from Shanghai Enzyme-linked Biotechnology Technology Co., Ltd. All of the procedures were performed in strict accordance with the kit instructions.

Extraction of RNA and Real-time PCR Analysis

Total RNA was extracted from ileal mucosa using the Trizol method, and total RNA concentration was measured using a microspectrophotometer. The RNA was then reversely transcribed to DNA using the HiScript III RT SuperMix (Vazyme, NO. R333) kit. Finally, the ZO-1, Ocludin, Claudin-1, MUC 2, TLR4, MyD88, NF-κB, TRIF, and IRF7 genes were quantified. Primers for the target genes were obtained from the NCBI official website. The expression of all target genes was calculated using 2 −ΔΔCt with β-actin as the reference gene (Livak and Schmittgen, 2001). The primer sequences are shown in Table 2.Table 2 Primer sequences for quantitative real-time PCR analysis.

Table 2Gene	Prime sequences (5′–3′)	Serial number	
β-actin	F: CCAGCCATGTATGTAGCCATCCAG	NM_205518.1	
R: GGTAACACCATCACCAGAGTCCATC	
MUC2	F: AATGCTGAGTTCTTGCCTAA	XM_001234581	
R: TGTTGCAGTTCATATCCTGGT	
ZO-1	F: CTTCAGGTGTTTCTCTTCCTCCTC	XM_015278981.2	
R: CTGTGGTTTCATGGCTGGATC	
Occludin	F: CGTCATGCTCATCGCCTCCATC	NM 205128.1	
R: TTGAGGTAGGTGCTGCCGTAGG	
Claudin-1	F: GACCAGGTGAAGAAGATGCGGATG	NM_001013611.2	
R: CGAGCCACTCTGTTGCCATACC	
TLR4	F: AGGCACCTGAGCTTTTCCTC	NM_001030683	
R: TACCAACGTGAGGTTGAGCC	
MyD88	F: TGATGCCTTCATCTGCTACTG	NM_001030962.4	
R: TCCCTCCGACACCTTCTTTCTA	
NF-κB	F: GTGTGAAGAAACGGGAACTG	NM_205129	
R: GGCACGGTTGTCATAGATGG	
TRIF	F: CATCAGGCCAGCACTACACA	NM_001081506.1	
R: AGGCTATTAGGCCCCAGTGA	
IRF7	F: TTGGGCTGGTTTCACCGTTA	NM_205372.1	
R: GTGCAGTCAGAGGAAAGGCT	

Bacterial DNA Extraction and 16S rRNA Gene Sequencing

DNA was extracted from the contents of the cecum using the cetyltrimethylammonium bromide (CTAB) method. The V3-V4 high variant region of the bacterial 16S rRNA gene was amplified using primers 338 F (5′-ACTCCTACGGGAGGCAGCA-3′) and 806 R (5′-ACTCCTACGGGAGGCAGCA- 3′). Each PCR product was then quantified using a fluorometer (Qubit 3.0), and the quantified amplicons were sequenced using the Illumina PE250 platform at Shanghai Lingen Biotechnology Co., Ltd.

For the 16S rRNA gene analysis, quality control of the raw sequences was performed using QIIME2 (https://qiime2.org/), which removed low-quality sequences and potential contaminants. The SILVA database was then selected as a reference for alignment, and a 97% sequence similarity threshold was used to determine operational taxonomic units (OTU). Alpha diversity of the microbial community was estimated using Chao1, Ace and Shannon, and indices in QIIME2. Beta diversity was assessed using principal coordinate analysis (PCoA). Differences in relative bacterial abundance were analyzed using nonparametric Kruskal-Wallis sum-rank test. Bacterial biomarkers that differentiated all groups of microbial communities were further identified through linear discriminant analysis (LDA) effect size (LEfSe) (LDA > 3, P < 0.05). The co-occurrence of microbial communities was analyzed among the top 35 genera based on the significant Spearman correlations (P  <  0.05).

Short-Chain Fatty Acids Concentration Measurement

100 mg of cecal chyme was weighed into a 1.50 mL centrifuge tube, followed by the addition of 1 mL of double-distilled water, which was then thoroughly mixed. The mixture was centrifuged at 12,000 r/min and 4°C for 10 minutes. Then, 0.70 mL of the supernatant was taken and 0.14 mL of a 25% crotonic acid metaphosphate solution was added. The mixture was thoroughly mixed and stored at -20°C overnight. On the second day, the solution which had been thawed and centrifuged was filtered through a 0.22 μm membrane. Subsequently, 0.60 μL of the filtrate was injected into the gas chromatograph under the following parameters condition: capillary column (Column length is 30 m, inner diameter is 0.32 mm, film thickness is 0.25 μm.), column temperature is 140°C, hydrogen flame ionization detector temperature is 220°C, and the pressure of Nitrogen carrier gas is 86 kPa.

Statistical Analysis

All data were analyzed using SPSS 23.0 statistical software. Shapiro-Wilk and Levene's tests were used to assess the normal distribution of the data and the homogeneity of variance. One-way analysis of variance (ANOVA) and Tukey's posthoc test were employed to determine the significance of mean differences. The results were expressed as mean ± SEM, and a significant difference was set as P < 0.05.

RESULTS

Growth and Slaughter Performance

Compared with the Con group, an increased ADFI was observed in the Hes and HTR groups, and an increased ADG was found in the Hes and Thy groups during d 1 to 21 (P < 0.05, Table 3). During d 22 to 42, the ADFI was increased in the Hes group and was accompanied by a lower F/G in the RA and HTR group than that in the Con group (P < 0.05). During d 1 to 42, the ADFI was higher in the Hes group, the ADG was higher in the Hes and HTR groups, and the F/G was decreased in the HTR group compared with the Con group (P < 0.05). The F/G of the HTR group was significantly lower than that of the Hes and HTR groups during d 1 to 42 (P < 0.05). However, no significant differences in ADG during 22-42 d and F/G during 1-21 d (P > 0.05). The Hes and HTR groups exhibited a higher eviscerated yield than that of the Con group, while the HTR group exhibited a lower abdominal fat yield than that of the Con group (P < 0.05). In addition, there were no significant differences in the carcass yield among groups (P > 0.05).Table 3 Effect of dietary supplementation with Hes, Thy, RA and their combination on growth performance and slaughter performance of broilers.

Table 3	Treatment1			
Items2	Con	Hes	Thy	RA	HTR	SEM	P-value	
ADFI, g/d								
1–21 d	40.17c	44.17a	41.92bc	40.58c	42.56ab	0.08	<0.001	
22–42 d	121.84b	130.64a	122.04b	121.83b	119.96b	0.33	<0.001	
1–42 d	81.00b	87.41a	81.98b	81.21b	81.26b	0.93	<0.010	
ADG, g/d								
1–21 d	28.07b	30.09a	30.07a	27.92b	29.49ab	0.25	<0.001	
22–42 d	67.44	74.07	69.50	71.14	73.17	0.25	0.127	
1–42 d	47.76b	52.08a	49.78ab	49.53ab	51.34a	0.47	0.021	
F/G, g feed/g gain								
1–21 d	1.43	1.47	1.40	1.46	1.44	0.11	0.029	
22–42 d	1.80a	1.76ab	1.76ab	1.71bc	1.64c	0.12	<0.001	
1–42 d	1.70a	1.68a	1.65ab	1.70a	1.58b	0.11	<0.001	
Carcass yield, %	92.83	93.56	92.86	93.35	93.83	0.27	0.757	
Eviscerated yield, %	72.34b	74.39a	73.68ab	73.12ab	74.42a	0.25	0.022	
Abdominal fat yield, %	2.33a	2.00ab	2.17ab	2.05ab	1.98b	0.04	0.026	
a-b Means in a row with no common superscript differs significantly (n = 6; P < 0.05).

1 Con: feed with the corn-soybean basic diet; Hes: feed with basic diet and 40 mg/kg hesperidin; Thy: feed with basic diet and 40 mg/kg thymol; RA: feed with basic diet and 20 mg/kg rosmarinic acid; HTR: feed with basic diet and 40 mg/kg hesperidin, 40 mg/kg thymol and 20 mg/kg rosmarinic acid.

2 ADFI, average daily feed intake; ADG, average daily gain; BW, body weight; F/G, ratio of feed to weight gain.

Ileal Morphology and the Number of Goblet Cells

The effect of dietary supplementation with Hes, Thy, RA and their combination on intestinal morphology and the number of goblet cells is presented in Figure 1. The VH of the ileum notably increased in the Hes, Thy, RA and HTR groups, the CD of the ileum was decreased significantly in the HTR group compared with the Con group, and the villus to crypt ratio (V/C) of the ileum was increased significantly in the HTR group (P < 0.05, Figures 1A, C-E). Additionally, the VH and V/C of the ileum in the HTR group were significantly higher than those of the experimental groups, while the CD of the ileum was significantly lower (P < 0.05, Figures 1C-E). Furthermore, the number of ileal goblet cells showed an increase in the HTR group, and accompanied by up-regulated relative mRNA expression of MUC2 in the Hes, Thy, RA, and HTR groups compared to the Con group (P < 0.05, Figures 1B, F, G). The mRNA expression level of MUC2 in the HTR group was significantly higher than that in both the Thy and RA groups (P < 0.05, Figure 1G).Figure 1 Effect of dietary supplementation with Hes, Thy, RA and their combination on ileal morphology and the number of goblet cells of broilers. (A) Representative image of the ileal morphological structure, which was observed at 40× magnification. (B) Representative image of goblet cells in the ileum, which was observed at 200× magnification. (C) The villus height of ileum. (D) The crypt depth of ileum. (E) The villus to crypt ratio of ileum. (F) The ileal goblet cell count. (G) The relative mRNA expression of MUC2. Con: feed with the corn-soybean basic diet; Hes: feed with basic diet and 40 mg/kg hesperidin; Thy: feed with basic diet and 40 mg/kg thymol; RA: feed with basic diet and 20 mg/kg rosmarinic acid; HTR: feed with basic diet and 40 mg/kg hesperidin, 40 mg/kg thymol and 20 mg/kg rosmarinic acid. Values at the same index with no common superscript differ significantly (n = 6; P  <  0.05).

Figure 1

Ileal Mucosa Inflammatory Responses

The ileal mucosal inflammatory factors, TLR4 signaling pathways, and intestinal barrier markers are shown in Figure 2. Compared with the Con group, the concentrations of IL-8 and IFN-γ were decreased significantly in the Hes, RA and HTR groups, and the concentrations of TNF-α was decreased significantly in the RA and HTR groups (P < 0.05, Figure 2). The concentrations of IL-8 and IFN-γ in the HTR group were significantly lower than those in the Thy group (P < 0.05, Figures 2C, D). Interestingly, there were no differences of IL-1β and IL-6 concentrations between the groups (P > 0.05, Figures 2A, B). Furthermore, the mRNA expression level of TLR4 was significantly down-regulated in the Hes, Thy, RA and HTR groups, the mRNA expression level of MyD88 was decreased significantly in Hes, Thy and HTR groups, and the mRNA expression level of NF-κB was down-regulated significantly in the Thy and HTR groups compared with the Con group (P < 0.05, Figure 2G). The mRNA expression level of TLR4 in the HTR group was significantly lower than that in the Hes group (P < 0.05, Figure 2G). There was no significant difference of the mRNA expression level of TRIF and IRF3 among the other 5 groups. (P > 0.05, Figure 2G). This suggests that the HTR group relieved the intestinal inflammatory response by inhibiting the TLR4 signaling pathway.Figure 2 Effect of dietary supplementation with Hes, Thy, RA and their combination on ileal barrier function and inflammatory response of broilers. (A) The content of interleukin 1β (IL-1β) in the ileal mucosa. (B) The content of interleukin 6 (IL-6) in the ileal mucosa. (C) The content of interleukin 8 (IL-8) in the ileal mucosa. (D) The content of interferon gamma (IFN-γ) in the ileal mucosa. (E) The content of tumor necrosis factor alpha (TNF-α) in the ileal mucosa. (F) The mRNA expression levels of tight junction. (G) TLR4 signaling pathway-related genes. Con: feed with the corn-soybean basic diet; Hes: feed with basic diet and 40 mg/kg hesperidin; Thy: feed with basic diet and 40 mg/kg thymol; RA: feed with basic diet and 20 mg/kg rosmarinic acid; HTR: feed with basic diet and 40 mg/kg hesperidin, 40 mg/kg thymol and 20 mg/kg rosmarinic acid. Values at the same index with no common superscript differ significantly (n = 6; P  <  0.05).

Figure 2

Moreover, the expression of tight junction proteins, such as ZO-1, was notably elevated in the HTR group compared to the Con group. The mRNA expression level of Occludin showed a significant increase in the Hes and HTR groups, while the mRNA expression level of Claudin-1 was significantly upregulated in the Thy and HTR groups (P < 0.05, Figure 2F). The HTR treatment had significantly elevated ZO-1 mRNA levels compared to the Hes group, and higher Occludin mRNA levels than the Thy group (P < 0.05, Figure 2F).

Cecal Microbiota Composition and SCFA Concentration

The composition of the microbial community in the cecal chyme using 16s rRNA amplicon sequencing is shown in Figure 3. The Venn diagram (Figure 3A) shows that 5 groups contained a total of 330 shared OTU, while the Con, Hes, Thy, RA and HTR groups had 121, 49, 64, 25 and 134 unique OTUs, respectively. The ACE index and Chao 1 index in the alpha diversity of the Thy and HTR groups were significantly higher than those of the Con group (P < 0.05, Figure 3C, D). The PCoA by Bray-Curtis distance indicated that the Con group was separated from the other groups (P < 0.05, Figure 3B).Figure 3 Effect of dietary supplementation with Hes, Thy, RA and their combination on diversity of the cecal microbiota in broilers. (A) A Venn diagram based on the OTU level. (B) Principal coordinate analysis (PCoA) based on Bray-Curtis. The alpha diversity indices observed species (C) Ace index, (D) Chao 1 index, (E) Shannon index. Con: feed with the corn-soybean basic diet; Hes: feed with basic diet and 40 mg/kg hesperidin; Thy: feed with basic diet and 40 mg/kg thymol; RA: feed with basic diet and 20 mg/kg rosmarinic acid; HTR: feed with basic diet and 40 mg/kg hesperidin, 40 mg/kg thymol and 20 mg/kg rosmarinic acid. Values at the same index with no common superscript differ significantly (n = 6; P  <  0.05).

Figure 3

Additionally, Firmicutes and Bacteroidetes were the major phylum species across all groups (Figure 4A). The ratio of Firmicutes/Bacteroidetes (F/B) in Thy and HTR groups was significantly higher than that in the Con group (P < 0.05, Figure 4B). Bacteroides, Alistipes, Ruminococcus torques group, Clostridia vadinBB60 group_norank and Lachnospiraceae_uncultured were dominant genera across all groups (Figure 4C). Further analysis of the genus composition of the top 35 ranked groups showed that a total of 9 differential bacteria were identified in each group, with a significant increase in the relative abundance of Parabacteroides, Lachnospiraceae NK4A136 group and Turicibacter in the HTR group, and a significant decrease in the relative abundance of Lachnospiraceae_uncultured, Ruminococcaeae_unculture, Lachnoclostridium and Colidextribacter (P < 0.05, Figure 4D). Furthermore, bacteria as biomarkers were identified to distinguish microbiota of all groups by the Linear discriminant analysis (LDA) effect size (LEfSe). The results showed that Lachnospiraceae and Colidextribacter were enriched significantly in the Con group. In the Thy group, Parabacteroides, Tannerellaceae, and Papillibacter were detected to be enriched significantly. In the Hes group, Rikenellaceae, Alistipes, and UCG_010 were enriched significantly. In the RA group, Butyricicoccaceae, Butyricicoccus, and Phyllobacterium were enriched significantly. In the HTR group, Lactobacillales, Akkermansiaceae, Verrucomicrobiales, Lachnospiraceae_NK4A136_group, and Turicibacter were enriched significantly (P < 0.05, Figure 5).Figure 4 Effect of dietary supplementation with Hes, Thy, RA and their combination on the cecal microbiota of broilers. (A) Microbial composition at the phylum level. (B) The ratio of Firmicutes / Bacteroidetes. (C) Microbial composition at the genus level. (D) The changes of the intestinal microbiota at the genus level. Con: feed with the corn-soybean basic diet; Hes: feed with basic diet and 40 mg/kg hesperidin; Thy: feed with basic diet and 40 mg/kg thymol; RA: feed with basic diet and 20 mg/kg rosmarinic acid; HTR: feed with basic diet and 40 mg/kg hesperidin, 40 mg/kg thymol and 20 mg/kg rosmarinic acid. Values at the same index with no common superscript differ significantly (n = 6; P  <  0.05).

Figure 4

Figure 5 Linear discriminant analysis effect (LEfSe) size of intestinal microbiota (LDA > 3, P < 0.05). Con: feed with the corn-soybean basic diet; Hes: feed with basic diet and 40 mg/kg hesperidin; Thy: feed with basic diet and 40 mg/kg thymol; RA: feed with basic diet and 20 mg/kg rosmarinic acid; HTR: feed with basic diet and 40 mg/kg hesperidin, 40 mg/kg thymol and 20 mg/kg rosmarinic acid.

Figure 5

The changes in cecal microbiota could affect the production of microbial metabolites, prompting us to examine the concentrations of short-chain fatty acids (SCFA) across different groups. Compared with the Hes group, the concentrations of propionate and butyrate exhibited significant increase in the HTR group (P < 0.05, Table 4).Table 4 Effect of dietary supplementation with Hes, Thy, RA on the cecal SCFA concentration of broilers (μmol/g digrsta).

Table 4	Dietary treatment1			
Item	Con	Hes	Thy	RA	HTR	SEM	P-value	
Acetate	43.86	44.50	46.75	43.93	48.39	0.61	0.057	
Propionate	13.11b	13.23b	13.53b	15.92ab	17.47a	0.57	0.036	
Isobutyrate	4.17	4.07	3.68	4.68	5.03	0.18	0.138	
Butyrate	14.41ab	13.41b	15.22ab	16.79ab	19.98a	0.73	0.028	
Isovalerate	4.89	5.86	4.77	4.99	5.11	0.20	0.462	
Valerate	5.33	4.77	4.95	5.71	5.78	0.17	0.256	
a-b Means in a row with no common superscript differs significantly (n = 6; P < 0.05).

1 Con: feed with the corn-soybean basic diet; Hes: feed with basic diet and 40 mg/kg hesperidin; Thy: feed with basic diet and 40 mg/kg thymol; RA: feed with basic diet and 20 mg/kg rosmarinic acid; HTR: feed with basic diet and 40 mg/kg hesperidin, 40 mg/kg thymol and 20 mg/kg rosmarinic acid.

Correlation Analysis

To explore the microbiota associated with intestinal inflammation, we analyzed the correlation between the bacterial relative abundance and phenotype. The relative abundance of Alistipes showed a significantly negative correlation with TLR4 and MyD88. The relative abundance of Butyricicoccus showed a significantly positive correlation with ZO-1 and a significantly negative correlation with IL-8 and NF-κB. However, the relative abundance of Lachoclostridium showed a significantly positive correlation with Occludin. The relative abundance of Lachnospiraceae_uncultured showed a significantly positive correlation with TNF-α. In addition, the relative abundance of Colidextribacter showed a significantly positive correlation with TNF-α and NF-κB. (P < 0.05, Figure 6).Figure 6 Effect of dietary supplementation with Hes, Thy, RA and their combination on the correlation analysis between intestinal microbiota and intestinal inflammatory indicators. Con: feed with the corn-soybean basic diet; Hes: feed with basic diet and 40 mg/kg hesperidin; Thy: feed with basic diet and 40 mg/kg thymol; RA: feed with basic diet and 20 mg/kg rosmarinic acid; HTR: feed with basic diet and 40 mg/kg hesperidin, 40 mg/kg thymol and 20 mg/kg rosmarinic acid. Significant correlations are noted by 0.01 ≤ P < 0.05 *, 0.001 ≤ P < 0.01**, and P < 0.001***; Values at the same index with no common superscript differs significantly (n = 6; P < 0.05).

Figure 6

DISCUSSION

The broiler industry has seen significantly economic benefits from the intensive feeding model. However, governmental regulations have banned the utilization of antibiotics as growth promoters in broiler production. As an alternative, plant extracts have emerged as enriched products of plant active substances, such as polyphenols, flavonoids, and plant polysaccharides, to promote growth and improve intestinal health in broiler chickens (Iqbal et al., 2020; Kamboh et al., 2018; Li et al., 2021).

Several studies have reported positive effects of plant extracts on broiler chickens in terms of growth performance and intestinal health (Goliomytis et al., 2015; Jekabsone et al., 2019; Liu et al., 2017). Yang et al. (2021) found that broilers supplemented with 50 mg/kg Hes had a higher ADG. In this study, we found that dietary Hes and HTR improved ADG and eviscerated yield, and HTR significantly reduced F/G and abdominal fat yield. This observation can be attributed to the capability of Hes to enhance the activity of protein synthesis enzymes in the liver, which in turn promotes protein synthesis (Jayapalan et al., 2020). Concurrently, Thy exhibits effective inhibition against enteric pathogenic microorganisms and mitigates the competitive interaction between bacterial and host nutrients (Li et al., 2023). Additionally, RA can modulate the composition of the gut microbiota, facilitating more efficient nutrient utilization (Alagawany et al., 2017). Therefore, HTR may enhance protein synthesis by increasing the utilization of nutritional substrates by the body. Intact intestinal morphology plays an important role in the maintenance of normal metabolism digestion and absorption in the intestine (Salim and Soderholm, 2011). Yamauchi et al. (2006) found a positive correlation between the increased VH in small intestine and the rate of nutrient absorption. This study showed an increased V/C in the ileum of the HTR groups, consistent with the observations of Cai et al. (2019). Their study highlighted that the increased VH and decreased CD provided a greater surface area for the digestion and absorption of nutrients. Therefore, the supplementation of HTR can partially explain the reason for the reduction in F/G of broilers by increasing V/C of intestinal morphology.

The intestinal barrier is crucial for resisting the invasion of external pathogenic microorganisms. The highly polarized columnar epithelial cells - goblet cells can respond to external stimuli and secrete mucus to regulate the intestinal microbial balance, nutrient transport, pathogenic microbial invasion and microbial-host immune response in poultry (Birchenough et al., 2015; Duangnumsawang et al., 2021). Previous research has demonstrated that Hes treatments at concentrations of 10, 20, and 40 mg/kg can mitigate the diminished protein expression of Occludin and ZO-1 in a DSS-induced colitis mouse model (Guo et al., 2019). Furthermore, a combined formulation consisting of citrus extract, Thy, and carvacrol has been shown to substantially augment the protein expression of Claudin-1 in Escherichia coli challenged piglets (Chang et al., 2022). Additionally, the introduction of perilla extract, with RA as its principal component, to HaCaT skin cells following a 3-h period, has been observed to elevate the protein expression of ZO-1 (Pressi et al., 2023). Consistent with these results, the current study found that individual plant extracts have limited effects on improving barrier function, while the dietary HTR improved intestinal barrier function by upregulating the mRNA expression of 3 tight junction proteins and mucins, and increasing the number of goblet cells. Studies have demonstrated that compromised intestinal barrier function can initiate intestinal inflammation by allowing intraluminal antigen uptake. Specifically, tight junction proteins (ZO-1, Claudin-1, and Occludin families) serve as targets for bacterial toxins and inflammatory factors. This breakdown increases paracellular permeability of the intestinal epithelium, consequently predisposing to local or systemic inflammation (Gasbarrini and Montalto, 1999; Schulzke et al., 2009). For the compounds we studied, Thy promoted the death of pathogenic microorganisms by changing the permeability of cell membranes, thereby exerting its antibacterial activity (Marchese et al., 2016). RA inhibited cell energy supply and disrupted cell structural integrity to exert antibacterial effects. This antibacterial activity may play an important role in alleviating intestinal inflammation and enhancing barrier function (Zhang et al., 2022a). The previous research indicates that Thy mitigated the Lipopolysaccharide(LPS)-induced elevation of IL-8 and TNF-α concentrations, while RA alleviated the increase of IFN-γ concentration induced by Trinitro-benzene-sulfonic acid (TNBS) (Formiga et al., 2020; Omonijo et al., 2019). Consistent with these findings, our results indicate that the dietary Hes, Thy, RA, and HTR all reduced the contents of IL-8, TNF-α, and IFN-γ in the ileum. The TLR4 signaling pathway, a major immune pathway in the intestine, acts as a primary player in modulating inflammatory reactions. It branches into 2 distinct downstream pathways. On 1 hand, the MyD88-dependent signaling pathway boosts inflammation through the modulation of NF-κB. On the other hand, the TRIF-dependent signaling pathway mitigates intestinal inflammation by curbing the MyD88-dependent pathway's actions (Jiang et al., 2022). In this study, the dietary Hes and Thy inhibited the downstream inflammatory response mediated by MyD88 and NF-κB signaling molecules through the inhibition of the TLR4 signaling pathway, while Hes and RA showed a trend in upregulating the downstream TRIF signaling molecules. The anti-inflammatory efficacy of the HTR treatment surpassed that of the single extract group. Notably, it not only attenuated MyD88-mediated inflammation but also upregulated the TRIF pathway while inhibiting the activation of the MyD88 pathway. These findings imply that dietary supplementation with HTR effectively suppressed the TLR4 signaling pathway, thereby mitigating intestinal inflammation and enhancing barrier function in broilers.

The diverse types of microorganisms present in the cecum of chickens hold a pivotal role in optimizing the biological utilization of nutrients, fostering the development of the immune system, and ensuring the integrity of the intestinal tract. The improvement of the intestinal barrier by plant-derived feed additives is primarily accomplished by regulating the balance of the microbiota or by increasing the relative abundance of the dominant microorganisms (Wu et al., 2020a). Therefore, we analyzed the cecal microbiota structure of broiler chickens using 16s rRNA amplicon sequencing (Chen et al., 2022). We found that supplementation of dietary HTR to the broiler's diet increased the α-diversity of the gut microbiota and exhibited significantly different β diversity. This suggests that adding HTR to the broiler's diet can enhance the diversity and richness of the intestinal microbiota. Wu et al. (2020b) showed that a short-term dietary shift from a high-fat diet to a balanced chow diet could restore the levels of a specific bacteria, Lachnospiraceae_NK4A136, suggesting its potential as a probiotic to reduce obesity. An increase in the abundance of Escherichia coli and Lachnoctodtridium is often linked to intestinal inflammation and microbial dysbiosis (Lloyd-Price et al., 2019). In this study, the dietary HTR raised the relative abundance of Lachnospiraceae NK4A136 in the cecum of broiler chickens, while reduced the relative abundance of the opportunistic pathogen, Colidextribacte. The decrease in the relative abundance of Colidextribacte and Lachnoctodtridium might be due to the combined antimicrobial actions of HTR through the 3 plant extracts. Furthermore, LEfSe analysis revealed that Lactobacillales, Akkermansiaceae, Verrucomicrobiales, Lachnospiraceae_NK4A136_group and Turicibacter acted as biomarkers for the dietary addition of HTR group (Iqbal and Zhu, 2009).

SCFAs have been shown to down-regulate the expression of pro-inflammatory cytokines to repair the intestinal mucus barrier and reduce intestinal inflammation (Zhang et al., 2022b; Zhou et al., 2014). Numerous studies have found that propionate and butyrate can be produced by the Bacteroidetes phylum (Li et al., 2020; Reichardt et al., 2014). Belonging to the Firmicutes phylum, Lachnospiraceae can produce acetate and butyrate, Clostridiaceae can generate butyrate, and Veillonellaceae can produce propionate (Belzer et al., 2017; Miguel et al., 2019; Reichardt et al., 2014). Consistent with these reports, we observed the increased concentrations of propionate and butyrate in the cecum of the HTR treatment broiler chickens. Besides serving as an energy source of intestinal epithelial cells, SCFAs inhibit the activation of TLR4 signaling pathway and suppress the production of pro-inflammatory cytokines (Diao et al., 2019; Tian et al., 2021; Zhang et al., 2022b). The present study found a significantly negative correlation between SCFAs, propionate and butyrate, and pro-inflammatory cytokines and the TLR4 signaling pathway. Therefore, the dietary supplementation with HTR modulated the cecal microbiota and increased the microbial metabolites such as SCFAs, thereby inhibiting the TLR4 signaling pathway and alleviating intestinal inflammation in broiler chickens.

The changed microbes and their metabolites were related to the intestinal barrier proteins and the intestinal inflammatory factors (Zhou et al., 2014). Spearman correlation analysis was used to explore the potential association of the changed microbes, the intestinal barrier proteins and the intestinal inflammatory factors. In this study, the dietary HTR and Thy significantly reduced the ratio of F/B. Notably, Lachnospiraceae_Unclassified, Lachnospiraceae_uncultured, Lachnoclostridium and Colidextribacter which belong to phylum Firmicutes, showed negative effects on the intestinal barrier and positive effects on intestinal inflammation. In contrast, Alistipes and Parabacteroides belonging to the phylum Bacteroidetes had opposite effects to the phylum Firmicutes. Recent studies show that Parabacteroides exhibited the ability to utilize carbohydrate fermentation and biotransform other steroids, thereby significantly enhancing their utilization by the organisms (Cui et al., 2022). The ratio of F/B was closely related to the gut microbial balance and the calories absorbed by the microbes (Toneatti et al., 2017). Therefore, the dietary Thy and HTR may be related to their efficient energy uptake. This may explain the reason for the reduction in F/G in both the Thy and HTR groups. Furthermore, in this study, propionate and butyrate exhibited a positive correlation with tight junction proteins in the ileal chyme and a negative association with intestinal inflammation. This indicates that propionate and butyrate could be pivotal in augmenting the anti-inflammatory response and improving intestinal barrier function. Accumulating evidences substantiate the role of SCFAs in restraining the production of pro-inflammatory cytokines, mitigating intestinal inflammatory responses, and fortifying the integrity of the intestinal epithelial barrier (Kobayashi et al., 2017; Liu et al., 2012). Our findings align seamlessly with the prior research, the dietary HTR inhibited the TLR4 signaling pathway, alleviated intestinal inflammation, and regulated the expression of barrier proteins. The dietary HTR increased the relative abundance of SCFA-producing bacteria, exerted anti-inflammatory effects, and promoted intestinal health in broiler chickens.

CONCLUSIONS

In summary, the diets supplemented with Hes, Thy and RA ameliorated intestinal inflammation and enhanced growth performance of broilers through modulating the gut microbiota and elevating SCFAs production to inhibit the TLR4 signaling pathway. The combined supplementation of Hes, Thy, and RA has a more pronounced effect than those provided by individual Hes, Thy, and RA supplementation.

DISCLOSURES

All authors have no conflicts of interest to disclose.

ACKNOWLEDGMENTS

This study was supported by the National Key R & D program of China (2017YFE0135200 ).
==== Refs
REFERENCES

Alagawany M. Abd El-Hack M.E. Farag M.R. Gopi M. Karthik K. Malik Y.S. and K.D. Rosmarinic acid: modes of action, medicinal values and health benefits Anim. Health Res. Rev. 18 2017 167 176 29110743
Aoac I. Official methods of analysis of AOAC international 18th ed 2010 AOAC Int. Arlington, VA
Belzer C. Chia L.W. Aalvink S. Chamlagain B. Piironen V. Knol J. de Vos W.M. Microbial metabolic networks at the mucus layer lead to diet-independent butyrate and vitamin B-12 production by intestinal symbionts MBio 8 2017 e00770-17
Birchenough G.M.H. Johansson M.E.V. Gustafsson J.K. Bergstrom J.H. Hansson G.C. New developments in goblet cell mucus secretion and function Mucosal. Immunol. 8 2015 712 719 25872481
Cai X. Yang F. Zhu L.H. Xia Y. Wu Q.Y. Xue H.Q. Lu Y.H. Rosmarinic acid, the main effective constituent of orthosiphon stamineus, inhibits intestinal epithelial apoptosis via regulation of the Nrf2 pathway in mice Molecules 24 2019 3027 31438521
Chang S.Y. Song M.H. Lee J.H. Oh H.J. Kim Y.J. An J.W. Go Y.B. Song D.C. Cho H.A. Cho S.Y. Kim D.J. Kim M.S. Kim H.B. Cho J.H. Phytogenic feed additives alleviate pathogenic Escherichia coli-induced intestinal damage through improving barrier integrity and inhibiting inflammation in weaned pigs J. Anim. Sci. Biotechnol. 13 2022 107 36050784
Chen J.M. Wang M.C. Zhang P. Li H. Qu K. Xu R.M. Guo N. Zhu H.B. Cordycepin alleviated metabolic inflammation in Western diet-fed mice by targeting intestinal barrier integrity and intestinal flora Pharmacol. Res. 178 2022 106191
Chen S.J. Lu J.H. Lin C.C. Zeng S.W. Chang J.F. Chung Y.C. Chang H. Hsu C.P. Synergistic chemopreventive effects of a novel combined plant extract comprising gallic acid and hesperidin on colorectal cancer Curr. Issues. Mol. Biol. 45 2023 4908 4922 37367061
Chung D. Cho T.J. Rhee M.S. Citrus fruit extracts with carvacrol and thymol eliminated 7-log acid-adapted Escherichia coli O157:H7, Salmonella typhimurium, andListeria monocytogenes: A potential of effective natural antibacterial agents Food Res. Int. 107 2018 578 588 29580522
Cui Y. Zhang L. Wang X. Yi Y. Shan Y. Liu B. Zhou Y. Lü X. Roles of intestinal Parabacteroides in human health and diseases FEMS Microbiol. Lett. 369 2022 fnac072 35945336
Dai D. Qi G.H. Wang J. Zhang H.J. Qiu K. Han Y.M. Wu Y.N. Wu S.G. Dietary organic acids ameliorate high stocking density stress-induced intestinal inflammation through the restoration of intestinal microbiota in broilers J. Anim. Sci. Biotechnol. 13 2022 124 36372893
Davies J. Davies D. Origins and evolution of antibiotic resistance Microbiol. Mol. Biol. Rev 74 2010 417 433 20805405
Diao H. Jiao A.R. Yu B. Mao X.B. Chen D.W. Gastric infusion of short-chain fatty acids can improve intestinal barrier function in weaned piglets Genes. Nutr. 14 2019 1 16 30651890
Du E.C. Gan L.P. Li Z.I. Wang W.W. Liu D. Guo Y.M. In vitro antibacterial activity of thymol and carvacrol and their effects on broiler chickens challenged with Clostridium perfringens J. Anim. Sci. Biotechnol. 6 2015 1 12 25838897
Duangnumsawang Y. Zentek J. Boroojeni F.G. Development and functional properties of intestinal mucus layer in poultry Front. Immunol 12 2021 745849
Fernando P. Piao M.J. Kang K.A. Zhen A.X. Herath H. Kang H.K. Choi Y.H. Hyun J.W. Hesperidin protects human HaCaT keratinocytes from particulate matter 2.5-induced apoptosis via the inhibition of oxidative stress and autophagy Antioxidants (Basel) 11 2022 1363 35883854
Ferri M. Ranucci E. Romagnoli P. Giaccone V. Antimicrobial resistance: A global emerging threat to public health systems Crit. Rev. Food Sci. Nutr. 57 2017 2857 2876 26464037
Formiga R.D. Alves E.B. Vasconcelos R.C. Guerra G.C.B. de Araujo A.A. de Carvalho T.G. Garcia V.B. de Araujo R.F. Gadelha F. Vieira G.C. Sobral M.V. Barbosa J.M. Spiller F. Batista L.M. p-Cymene and rosmarinic acid ameliorate TNBS-induced intestinal inflammation upkeeping ZO-1 and MUC-2: Role of antioxidant system and immunomodulation Int. J. Mol. Sci. 21 2020 5870 32824269
Gasbarrini G. Montalto M. Structure and function of tight junctions. Role in intestinal barrier Ital. J. Gastroenterol. Hepatol. 31 1999 481 488 10575567
Goliomytis M. Kartsonas N. Charismiadou M.A. Symeon G.K. Simitzis P.E. Deligeorgis S.G. The influence of naringin or hesperidin dietary supplementation on broiler meat quality and oxidative stability PloS One 10 2015 e0141652
Gržinić G. Piotrowicz-Cieślak A. Klimkowicz-Pawlas A. Górny R.L. Ławniczek-Wałczyk A. Piechowicz L. Olkowska E. Potrykus M. Tankiewicz M. Krupka M. Siebielec G. Wolska L. Intensive poultry farming: A review of the impact on the environment and human health Sci. Total Environ. 858 2023 160014
Guo K. Ren J.A. Gu G.S. Wang G.F. Gong W.B. Wu X.W. Ren H.J. Hong Z.W. Li J.S. Hesperidin protects against intestinal inflammation by restoring intestinal barrier function and up-regulating Treg cells Mol. Nutr. Food Res. 63 2019 1800975
Hammerum A.M. Lester C.H. Heuer O.E. Antimicrobial-resistant enterococci in animals and meat: a human health hazard? Foodborne Pathog. Dis. 7 2010 1137 1146 20578915
Iqbal M.F. Zhu W.Y. Bioactivation of flavonoid diglycosides by chicken cecal bacteria FEMS Microbiol. Lett. 295 2009 30 41 19473248
Iqbal Y. Cottrell J.J. Suleria H.A.R. Dunshea F.R. Gut microbiota-polyphenol interactions in chicken: A review Animals. 10 2020 1391 32796556
Jayapalan J.J. Subramanian P. Kani A. Hiji J. Najjar S.G. Abdul-Rahman P.S. Hashim O.H. Hesperidin modulates the rhythmic proteomic profiling in Drosophila melanogaster under oxidative stress Arch Insect. Biochem. Physiol 105 2020 e21738 32924199
Jekabsone A. Sile I. Cochis A. Makrecka-Kuka M. Laucaityte G. Makarova E. Rimondini L. Bernotiene R. Raudone L. Vedlugaite E. Baniene R. Smalinskiene A. Savickiene N. Dambrova M. Investigation of antibacterial and antiinflammatory activities of proanthocyanidins from pelargonium sidoides DC root extract Nutrients 11 2019 2829 31752295
Jiang J.L. Qi L.N. Wei Q.W. Shi F.X. Maternal stevioside supplementation improves intestinal immune function of chicken offspring potentially via modulating gut microbiota and down-regulating the promoter methylation level of suppressor of cytokine signaling 1 (SOCS1) Anim. Nutr. 10 2022 329 346 35919247
Kamboh A.A. Memon A.M. Mughal M.J. Memon J. Bakhetgul M. Dietary effects of soy and citrus flavonoid on antioxidation and microbial quality of meat in broilers J. Anim. Physiol. Anim. Nutr. (Berl.) 102 2018 235 240 28262989
Kobayashi M. Mikami D. Kimura H. Kamiyama K. Morikawa Y. Yokoi S. Kasuno K. Takahashi N. Taniguchi T. Iwano M. Short-chain fatty acids, GPR41 and GPR43 ligands, inhibit TNF-α-induced MCP-1 expression by modulating p38 and JNK signaling pathways in human renal cortical epithelial cells Biochem. Biophys. Res. Commun. 486 2017 499 505 28322790
Li L.Y. Chang L. Zhang X. Ning Z.B. Mayne J. Ye Y. Stintzi A. Liu J. Figeys D. Berberine and its structural analogs have differing effects on functional profiles of individual gut microbiomes Gut. Microbes 11 2020 1348 1361 32372706
Li X.J. Chen C. Leng A.J. Qu J.L. Advances in the extraction, purification, structural characteristics and biological activities of eleutherococcus senticosus polysaccharides: A promising medicinal and edible resource with development value Front. Pharmacol 12 2021 753007
Li C.L. Xie J.H. Wang J.H. Cao Y. Pu M. Gong Q.H. Lu Q. Therapeutic effects and mechanisms of plant-derived natural compounds against intestinal mucositis Front. Pharmacol 13 2022 969550
Li R.L. Zhao D.Y. Li P.P. Lei M.K. Wu J.Q. Wang J. Zhu W.Y. Effects of thymol and rosmarinic acid combination on growth performance,inflammatory response and intestinal health of lipopolysaccharide-challenged rats Chin. J. Anim. Nutr 34 2022 2009 2022
Li L. Chen X. Zhang K. Tian G. Ding X. Bai S. Zeng Q. Effects of Thymol and carvacrol eutectic on growth performance, serum biochemical parameters, and intestinal health in broiler chickens Animals (Basel) 13 2023 2242 37444040
Lim C. Zhen A.X. Ok S. Fernando P. Herath H. Piao M.J. Kang K.A. Hyun J.W. Hesperidin protects SH-SY5Y neuronal cells against high glucose-induced apoptosis via regulation of MAPK signaling Antioxidants (Basel) 11 2022 1707 36139782
Liu T.F. Li J. Liu Y.X. Xiao N. Suo H.T. Xie K. Yang C.L. Wu C. Short-chain fatty acids suppress lipopolysaccharide-induced production of nitric oxide and proinflammatory cytokines through inhibition of NF-κB pathway in RAW264.7 Cells Inflammation 35 2012 1676 1684 22669487
Liu Y.L. Yang X. Xin H.L. Chen S. Yang C.B. Duan Y.L. Yang X.J. Effects of a protected inclusion of organic acids and essential oils as antibiotic growth promoter alternative on growth performance, intestinal morphology and gut microflora in broilers Anim. Sci. J 88 2017 1414 1424 28317217
Livak K.J. Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method Methods 25 2001 402 408 11846609
Lloyd-Price J. Arze C. Ananthakrishnan A.N. Schirmer M. Avila-Pacheco J. Poon T.W. Andrews E. Ajami N.J. Bonham K.S. Brislawn C.J. Casero D. Courtney H. Gonzalez A. Graeber T.G. Hall A.B. Lake K. Landers C.J. Mallick H. Plichta D.R. Prasad M. Rahnavard G. Sauk J. Shungin D. Vázquez-Baeza Y. White R.A. Braun J. Denson L.A. Jansson J.K. Knight R. Kugathasan S. McGovern D.P.B. Petrosino J.F. Stappenbeck T.S. Winter H.S. Clish C.B. Franzosa E.A. Vlamakis H. Xavier R.J. Huttenhower C. Bishai J. Bullock K. Deik A. Dennis C. Kaplan J.L. Khalili H. McIver L.J. Moran C.J. Nguyen L. Pierce K.A. Schwager R. Sirota-Madi A. Stevens B.W. Tan W. ten Hoeve J.J. Weingart G. Wilson R.G. Yajnik V. I. Investigators Multi-omics of the gut microbial ecosystem in inflammatory bowel diseases Nature 569 2019 655 662 31142855
Macku J. Kubova K. Urbanova M. Muselik J. Franc A. Koutna G. Pavelkova M. Vetchy D. Masek J. Maskova E. Brus J. Rational design of self-emulsifying pellet formulation of thymol: technology development guided by molecular-level structure characterization and ex vivo testing Pharmaceutics 14 2022 1545 35893801
Marchese A. Orhan I.E. Daglia M. Barbieri R. Di Lorenzo A. Nabavi S.F.O. Gortzi M.I. Nabavi S.M. Antibacterial and antifungal activities of thymol: A brief review of the literature Food Chem. 210 2016 402 414 27211664
Miguel M.A. Lee S.S. Mamuad L.L. Choi Y.J. Jeong C.D. Son A.R. Cho K.K. Kim E.T. Kim S.B. Suk S. Enhancing butyrate production, ruminal fermentation and microbial population through supplementation with clostridium saccharobutylicum J. Microbiol. Biotechnol 29 2019 1083 1095 31216841
Miladi H. Zmantar T. Kouidhi B. Al Qurashi Y.M.A. Bakhrouf A. Chaabouni Y. Mahdouani K. Chaieb K. Synergistic effect of eugenol, carvacrol, thymol, p-cymene and γ-terpinene on inhibition of drug resistance and biofilm formation of oral bacteria Microb. Pathog 112 2017 156 163 28964825
NRC Nutrient requirements of poultry 9th rev. ed 1994 National Academy of Science Press Washington, DC
Omonijo F.A. Liu S.X. Hui Q.R. Zhang H. Lahaye L. Bodin J.C. Gong J.S. Nyachoti M. Yang C.B. Thymol improves barrier function and attenuates inflammatory responses in porcine intestinal epithelial cells during lipopolysaccharide (LPS)-induced inflammation J. Agric. Food Chem 67 2019 615 624 30567427
Pressi G. G.Rigillo P.G. Borgonetti V. Baini G. Rizzi R. Guarnerio C. Bertaiola O. Frigo M. Merlin M. Paltrinieri S. Zambonin R. Pandolfo S. Biagi M. A novel perilla frutescens (L.) britton cell-derived phytocomplex regulates keratinocytes inflammatory cascade and barrier function and preserves vaginal mucosal integrity in vivo Pharmaceutics 15 2023 240 36678869
Reichardt N. Duncan S.H. Young P. Belenguer A. Leitch C.M. Scott K.P. Flint H.J. Louis P. Phylogenetic distribution of three pathways for propionate production within the human gut microbiota ISME J 8 2014 1323 1335 24553467
Rocha J. Eduardo-Figueira M. Barateiro A. Fernandes A. Brites D. Bronze R. Duarte C.M.M. Serra A.T. Pinto R. Freitas M. Fernandes E. Silva-Lima B. Mota-Filipe H. Sepodes B. Anti-inflammatory effect of rosmarinic acid and an extract of rosmarinus officinalis in rat models of local and systemic inflammation Basic Clin. Pharmacol. Toxicol. 116 2015 398 413 25287116
Salim S.Y. Soderholm J.D. Importance of disrupted intestinal barrier in inflammatory bowel diseases Inflamm. Bowel. Dis 17 2011 362 381 20725949
Sanchez-Camargo A.D. Herrero M. Rosemary (Rosmarinus officinalis) as a functional ingredient: recent scientific evidence Curr. Opin. Food Sci. 14 2017 13 19
Schulzke J.D. Ploeger S. Amasheh M. Fromm A. Zeissig S. Troeger H. Richter J. Bojarski C. Schumann M. Fromm M. Epithelial Tight Junctions in Intestinal Inflammation Ann. N Y Acad. Sci. 1165 2009 294 300 19538319
Sun X.L. Jia Z.Q. Microbiome modulates intestinal homeostasis against inflammatory diseases Vet. Immunol. Immunopathol 205 2018 97 105 30459007
Tian B.M. Zhao J.H. Zhang M. Chen Z.F. Ma Q.Y. Liu H.C. Nie C.X. Zhang Z.Q. An W. Li J.X. Lycium ruthenicum anthocyanins attenuate high-fat diet-induced colonic barrier dysfunction and inflammation in mice by modulating the gut microbiota Mol. Nutr. Food Res. 65 2021 2000745
Toneatti D.M. Albarracin V.H. Flores M.R. Polerecky L. Farias M.E. Stratified bacterial diversity along physico-chemical gradients in high-altitude modern stromatolites Front. Microbiol 8 2017 235549
Wang L. Yan H. Chen X. Han L. Liu G. Yang H. Lu D. Liu W. Che C. Thymol ameliorates aspergillus fumigatus keratitis by downregulating the TLR4/MyD88/NF-kB/IL-1β signal expression and reducing necroptosis and pyroptosis J. Microbiol. Biotechnol 33 2023 43 36517045
Wu J.W. Wei Z.H. Cheng P. Qian C. Xu F.M. Yang Y. Wang A.Y. Chen W.X. Sun Z.G. Lu Y. Rhein modulates host purine metabolism in intestine through gut microbiota and ameliorates experimental colitis Theranostics 10 2020 10665 10679 32929373
Wu M.R. Chou T.S. Huang C.Y. Hsiao J.K. A potential probiotic- Lachnospiraceae NK4A136 group: Evidence from the restoration of the dietary pattern from a high-fat diet Research article 1 2020 1 24
Xie X.L. He Y.Q. Li H. Yu D. Na L. Sun T. Zhang D. Shi X.R. Xia Y.H. Jiang T. Rong S.K. Yang S.Q. Ma X.Q. Xu G.X. Effects of prebiotics on immunologic indicators and intestinal microbiota structure in perioperative colorectal cancer patients Nutrition 61 2019 132 142 30711862
Yamauchi K. Buwjoom T. Koge K. Ebashi T. Histological alterations of the intestinal villi and epithelial cells in chickens fed dietary sugar cane extract Br. Poult. Sci 47 2006 544 553 17050097
Yang J. Wang S., B. Lu M.Y. Zhu Y. Xu L. Effects of hesperidin on growth performance, muscle quality and intestinal morphology of broilers Chin. J. Anim. Nutr. 33 2021 297 307
Zhang J. Cui X. Zhang M. Bai B. Yang Y. Fan S. The antibacterial mechanism of perilla rosmarinic acid Biotechnol. Appl. Biochem. 69 2022 1757 1764 34490944
Zhang Z.Y. Yang P. Zhao J.B. Ferulic acid mediates prebiotic responses of cereal-derived arabinoxylans on host health Anim. Nutr. 9 2022 31 38 35949987
Zhao L. Zhang Y.L. Liu G.R. Hao S. Wang C.T. Wang Y. Black rice anthocyanin-rich extract and rosmarinic acid, alone and in combination, protect against DSS-induced colitis in mice Food Funct. 9 2018 2796 2808 29691532
Zhao W.X. Wu J.M. Dang M.M. Wang J. Zhu W.Y. Combination of hesperidin and rosmarinic acid affects cecal morphology, antioxidant function, microbiota structure, and barrier function of finishing pigs Acta Microbiol. Sin. 63 2023 4356 4371
Zhou X.L. Ruan Z. Huang X.L. Zhou Y. Liu S.Q. Yin Y.L. The prebiotic lactosucrose modulates gut metabolites and microbiota in intestinal inflammatory rats Food Sci. Biotechnol. 23 2014 157 163
