
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00847-2
10.1016/j.psj.2024.104268
104268
GENETICS AND MOLECULAR BIOLOGY
Mechanism of fatty acid transposase (CD36) promoting fat accumulation in mule ducks
Hu Ying-Xiu
Liang QiuYang
Li Ang
Bai Ding-Ping bdpnx@fafu.edu.cn
1
Fujian Key Laboratory of Traditional Chinese Veterinary Medicine and Animal Health, College of Animal Sciences, Fujian Agricultural and Forestry University, Fuzhou 350002, China
1 Corresponding author: bdpnx@fafu.edu.cn
28 8 2024
12 2024
28 8 2024
103 12 1042688 7 2024
22 8 2024
© 2024 Published by Elsevier Inc. on behalf of Poultry Science Association Inc.
2024

https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Mule ducks accumulate a large amount of fat in their livers when fed high-energy feed, which is predominantly used for producing fatty livers. Nevertheless, there is limited research on the molecular mechanisms underlying the formation of fatty liver in mule ducks. Fatty acid translocase (CD36) is a sensor for fatty acids and lipid metabolism regulator, which may play a crucial role in the accumulation of fat in the liver of mule ducks. In this study, Overexpression and CD36 gene interference for 24 h was followed by induction of liver cells with 400 µmol/L palmitic acid (PA) for 24 h. The results demonstrated that CD36 overexpression increased hepatic triglyceride content, lipid droplet deposition, oxidative stress, and cell apoptosis. However, interference with CD36 had the opposite effect. CD36 overexpression suppressed the expression of AMPK and CPT-1A genes but enhanced the expression of ACC1 and LKB1 genes, with interference yielding contrasting results. Additionally, the expression of CD36 inhibited the AMPK pathway, reduced AMPK phosphorylation, downregulated AMPK protein expression, and upregulated SREBP1 protein expression. This promoted palmitic acid-induced hepatocyte fat accumulation. In summary, CD36 promotes palmitic acid-induced fat accumulation in primary mule duck liver cells through the AMPK signaling pathway.

Key words

D36
hepatocyte
fat accumulation
AMPK signaling pathway
==== Body
pmcINTRODUCTION

Mule ducks have a remarkable ability to deposit liver fat and are primarily used for fatty liver production (Geng et al., 2015). Waterfowl consumes a significant amount of high-energy feed within a short time frame. This is absorbed as glucose after digestion (Luo et al., 2023). Glucose is further converted into acetyl coenzyme A through the pentose phosphate and glycolysis pathways. This ultimately leads to fatty acid synthesis in hepatocytes (Wang et al., 2019). These fatty acids combine with α-glycerophosphate to form triglycerides (TG), which accumulate in hepatocytes (Hong et al., 2023). Under normal circumstances, TG combines with apolipoproteins to form very low-density lipoproteins that are transported to other tissues via the blood circulation (Titov et al., 2018). However, during feeding, the production of TG by the liver surpasses the transport capacity of apolipoproteins. The rate of fatty acid β-oxidation degradation is significantly lower than its generation rate, resulting in substantial fat accumulation in hepatocytes (Fernandez et al., 2019). This ultimately culminates in fatty liver formation. Before 2010, the European Union (EU) Animal Rights Organization explicitly stated that the countries that became EU members must discontinue the practice of force-feeding geese for fatty liver production (Liang et al., 2018). However, with economic advancements, the demand for goose fatty liver continues to increase (Pepino et al., 2014). Hence, there is a significant opportunity to breed a mule duck strain that exhibits high fatty liver formation capabilities while requiring minimal feeding.

Adenylate-activated protein kinase (AMPK) plays a pivotal role in the maintenance of cellular metabolic homeostasis and redox balance (Yang et al., 2018). Research indicates that sterol regulatory element-binding protein 1 (SREBP1), a key downstream protein of AMPK, serves as the primary transcription factor for genes involved in adipogenesis. SREBP1 inhibition has been demonstrated to delay the onset of diet-induced steatosis in the liver of obese mice. The inhibition of the AMPK/SREBP1 signaling pathway increases lipid synthesis in nonalcoholic fatty liver disease (NAFLD) (Li et al., 2022b). Acetyl CoA carboxylase (ACC), a downstream target of AMPK, plays a pivotal role in lipid metabolism (Foretz et al., 2018). AMPK phosphorylation triggers ACC phosphorylation, subsequently diminishing the expression of FASN, SREBP1, and SCD1, and ultimately suppressing lipid synthesis (Bort et al., 2020). This underscores the significance of AMPK in maintaining lipid metabolic homeostasis. It implies that AMPK activators may serve as potential targets for managing liver fat accumulation in mule ducks. Extensive research has established CD36 as a biomarker for diverse health conditions, including diabetes, atherosclerosis, nonalcoholic fatty liver disease, and liver injury (Glatz et al., 2024; Li et al., 2022a). CD36 facilitates the transportation of long-chain fatty acids into cells, thereby enhancing muscle lipid utilization, fat energy storage, and intestinal fat absorption (Daquinag et al., 2021). However, CD36 overexpression can contribute to TG accumulation in the liver (Lua et al., 2021). Consequently, targeting CD36 to activate the AMPK signaling pathway may represent a potential approach for promoting lipid accumulation in mule ducks.

The aim of this study was to elucidate the effect of CD36 on PA-induced lipid accumulation in primary mule duck liver cells and further explore whether the beneficial effects of CD36 are related to AMPK signaling pathway activation in liver cells.

MATERIALS AND METHODS

Material Sources

The Oil Red O staining kit, reactive oxygen species (ROS) kit, liposome 3000/lipo 3000, and PA were purchased from Solebo (Beijing, China). Mule duck eggs were purchased from Fujian Minwang Poultry Wholesale Co. Ltd. (Fuzhou, China). The malondialdehyde (MDA) kit was purchased from Biyuntian (Shanghai, China). TG, aspartate aminotransferase (AST), alanine aminotransferase (ALT), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) kits were purchased from Nanjing Jiancheng Biological Company (Nanjing, China). The Cell Counting Kit-8 was obtained from the Tongren Institute of Chemistry (Shanghai, China). FastKing 1-step cDNA first-strand synthesis premixed kits were purchased from Beijing Tiangen (Beijing, China).

Isolation, Culture, and Treatment of Primary Mule Duck Hepatocytes

Cells were isolated and cultured according to the method described by Hu et al. (Hu et al., 2024).

The CD36 (NCBI number: XM-038183702.1) sequence of Anas platyrhynchos (mallard) from mallard ducks was designed and synthesized by Shanghai Jima Biotechnology Co., Ltd. The interference (NC) and overexpression negative control (pEX-2) were provided by the company. Among them, the interference target 5′–3′ sequence is depicted in the table below (Table 1).Table 1 The 5′–3′ sequence of interference target.

Table 1Interference target	Sequence (5′–3′)	
siRNA-659	CACATACAGGGTGCGATATTT	
siRNA-969	GGAGTCTTCTACCCGTATAAT	
siRNA-1375	CAGCTGGAGTCCTAGATATTA	
siRNA-1745	CGCATTCCTGGGTTCTTATTT	

Herein, 70–80% of cells are cultured on plates, and after 4 h of starvation (serum-free medium) treatment, according to the instructions of liposome 3000, CD36 gene was interfered and overexpressed for 24 h, and 400 μmol/L PA were added for 24 h for the next experiment.

Determination of Cell Viability

Cell inoculation was conducted in a 96-well plate at a density of approximately 1 × 105 cells/well. Six replicates were performed in each group. After 24 h of CD36 gene interference and overexpression, 400 μmol/L of PA was added to induce 24 h. The absorbance was measured and cell survival rate was computed according to the instructions in the CCK-8 reagent kit.

Oil Red O Staining

Cell inoculation was conducted on a 24-well plate with a density of approximately 1 × 105 per well. After 24 h of interference and overexpression of the CD36 gene, 400 μmol/L of PA was added to induce 24 h. The lipid droplets were stained and photographed under an inverted microscope according to the instructions for the Oil Red O staining kit. The ImageJ software was used to quantitatively evaluate the lipid droplets.

Determination of TG and MDA Contents

The cells were inoculated in a 12-well plate at a density of approximately 1 × 106 cells/well, and each treatment was repeated 5 times. After 24 h of interference and overexpression of the CD36 gene, 400 μmol/L of PA was added to induce 24 h. The protein supernatant was collected post cell fragmentation and centrifugation. We operated according to the instructions of the TG/MDA kit and measured the absorbance values of each group at a wavelength of 510 nm using an enzyme-linked immunosorbent assay (ELISA) reader; subsequently, we computed the TG and MDA content.

Determination of AST, ALT, HDL, and LDL Contents

Cells were inoculated in a 12-well plate at a density of approximately 1 × 106 cells per well, with 5 replicates per group. After 24 h of interference and overexpression of the CD36 gene, 400 μmol/L of PA was added to induce 24 h. Following manufacture protocol we collected AST, ALT, HDL, and LDL, cell precipitates and analyzed them to compute the corresponding AST, ALT, HDL, and LDL content in the cells.

Determination of Reactive Oxygen Species Content

The cells were inoculated in a 12-well plate at a density of approximately 1 × 106 cells/well, and each treatment was repeated 3 times. After 24 h of interference and overexpression of CD36 gene, 400 μmol/L of PA was added to induce for 24 h. Following the ROS manual, the experiment was conducted by diluting DCFH-DA with serum-free culture medium to a final concentration of 10 μM/L. The treated cells were incubated in a 37 °C incubator for 30 min, washed 5 times with phosphate-buffered saline, and images were captured under a fluorescence microscope. The fluorescence intensity was evaluated and computed using the ImageJ software.

Cell Apoptosis Detection

After 24 h of interference and overexpression of the CD36 gene, 400 μmol/L of PA was added to induce for 24 h. The culture medium was collected. After cell trypsinization, the collected culture medium was added and the sediment was left post centrifugation. According to the instructions of the cell apoptosis detection kit, the propidium iodide solution was added post-treatment and incubated in a 37 °C incubator for 30 min in darkness. Flow cytometry was used for the analysis and detection. The scattered light was detected simultaneously, and red light was detected at an excitation wavelength of 488 nm. The proportion of apoptotic cells was also analyzed.

AMPK Pathway Gene and Protein Expression

Cellular RNA was extracted using the TRIzol method. The integrity and concentration of RNA in the sample was ensured using an ELISA reader. cDNA was synthesized using the reverse transcription kit and reference reaction system of Hu et al. (2024). The primers were designed using Primer 6.0 software and sequenced (Table 2). Using cDNA as a template and β-actin and GAPDH as internal parameters, a real-time fluorescence quantitative PCR detection system was used to detect gene expression. Three biological and technical replicates were designed for each sample, and the gene expression level was computed using the 2- ΔΔ Ct method (Damgaard and Treebak, 2022).Table 2 The primers of real time qPCR.

Table 2NCBI number	Gene name	Sequence 5′–3′	Product size (bp)	
XM_017009624.2	AMPK-α-F	CGGCAAAGTCAAGGTTGGCAAAC	97	
AMPK-α-R	TCCTACAACATCAAGGCTGCGAATC	
XM_027457809.2	CPT-1A-F	CCGCCATCTGTTCTGCCTCTATG	98	
CPT-1A-R	TGTGTTGCTGTGGTGTCTGACTTG	
XM_038165892.1	ACC1-F	CACAGATCCAGAGCACAGCACTTC	99	
ACC1-R	GGCAGGCAGTATCCGTTCATCAC	
XM_038183702.1	CD36-F	TCGTTTCGCAGTTCCTCGTGAAG	100	
CD36-R	AGCTGTTGTGCAGTTCTGGGATATG	
XM_027446391.2	LPL-F	TGGACATTGGTGACCTGCTTATGC	101	
LPL-R	TCGCCTGACTTCACTCTGACTCTC	
NM_001310421.1	β-actin -F	CGCCAACACGGTGCTGTCTG	102	
β-actin -R	TGCTTGCTGATCCACATCTGCTG	
XM_038180584.1	GADPH-F	GGTAGTGAAGGCTGCTGCTGATG	103	
GADPH-R	GGAGGAATGGCTGTCACCGTTG	
XM_038187023.1	SREBP-1-F	CACTTCTGGAGACATCGCAAAC	112	
SREBP-1-R	ATGGTAGACAACAGCCGCATC	

Cells were digested using trypsin, and the supernatants were collected post-RIPA lysis. The protein concentration was measured using the BCA method, with 20 μg of sample per well. Proteins were separated by 10% SDS-PAGE and transferred onto a PVDF membrane. After blocking with 5% BSA, primary antibodies, such as GAPDH (60004-1-Ig, Protein), CD36 (# 381350, ZEN), P-AMPK (# 338164, ZEN), SREBP1 (# 347061, ZEN), and AMPK (# 380431, ZEN) were incubated overnight at 4°C. After washing the membrane with 1 × TBST solution, the appropriate horseradish peroxidase-conjugated secondary antibody (1:5000) was incubated in a dark box for 1 h. After washing with 1 × TBST, protein blotting was conducted using an electrochemiluminescence detection system. The protein expression levels were analyzed and computed using the ImageJ software.

RESULTS AND ANALYSIS

Primary Hepatocytes of Mule Duck Transfected With CD36

The negative (NC) and positive control (GAPDH) groups in the interference experiment demonstrated no significant difference compared to the blank control group. The overexpression control (pEX-2) group demonstrated no significant difference compared to the blank control group, which further verified the stability and reliability of the experimental conditions (Figure 1). Compared with the blank group, CD36-1745 expression in the interference group was significantly decreased. pEX-2-CD36 expression in the overexpression group was significantly increased. This was suitable for subsequent experiments.Figure 1 The expression of CD36 gene. After cell starvation (serum-free medium) treatment for 4 h, CD36 gene was interfered and overexpressed for 24 h. The transfection effect was analyzed by fluorescence quantitative RCR. The ns means no significant difference (P > 0.05), *indicates significant difference (P ≤0.05), **and above indicates very significant (P ≤ 0.01).

Figure 1

Effect of CD36 on the Apoptosis of Primary Mule Duck Adipose Liver Cells

After CD36 overexpression, the proportion of primary adipocytes from mule ducks in the early and late stages of apoptosis significantly increased (P < 0.01). Interference with CD36 significantly inhibited apoptosis (P < 0.01) (Figures 2A and 2B).Figure 2 Effect of CD36 on the apoptosis and activity of primary mule duck adipose liver cells. After the cells were subjected to starvation (serum-free medium) treatment for 4 h, CD36 was interfered and overexpressed for 24 h, and 400 μmol/L PA was added for 24 h. (A) Flow cytometry detection of cell apoptosis map; (B) determine the apoptosis rate using flow cytometry analysis; (C) detection of cell viability.

Figure 2

Effect of CD36 on the Activity of Primary Mule Duck Adipose Liver Cells

After overexpressing the CD36 gene, cell viability increased, whereas after overexpression of the CD36 gene, cell viability demonstrated the opposite result. However, there was no significant effect on cell viability. This may be because cell viability was affected by the transfection reagent (Figure 2C).

Effect of CD36 on Lipid Accumulation in Primary Mule Duck Adipose Liver Cells

After CD36 gene interference, the area of oil red staining in the cells decreased and the staining of oil red O became lighter. Quantitative analysis demonstrated that the accumulation of lipid droplets in cells decreased significantly compared to that in the control group, while the accumulation of lipid droplets in cells post-CD36 overexpression was significant (Figures 3A and 3B). As depicted in Figure 3C, the intracellular triglyceride content was significantly reduced post-CD36 knockdown. The TG content was significantly increased post-CD36 overexpression.Figure 3 Effects of CD36 on lipid accumulation and deposition of primary mule duck adipose liver cells. After the cells were subjected to starvation (serum-free medium) treatment for 4 h, CD36 was interfered and overexpressed for 24 h, and 400 μmol/L PA was added for 24 h. (A) Representative photomicrographs of Oil Red O staining (200 ×); (B) quantitative data of oil red O staining; (C) quantitative data of triglyceride (TG) content.

Figure 3

Effect of CD36 on Oxidative Stress in Primary Mule Duck Adipocytes

After CD36 interference, the levels of ROS and MDA in the steatotic liver model decreased significantly (Figure 4), reducing the damage to the cells and mitochondria, and significantly aggravating the postoverexpression damage.Figure 4 Effect of CD36 on oxidative stress and antioxidant gene expression of primary mule duck adipose liver cells. After the cells were subjected to starvation (serum-free medium) treatment for 4 h, CD36 was interfered and overexpressed for 24 h, and 400 μmol/L PA was added for 24 h. (A) Fluorescence diagram of reactive oxygen species detection (200 ×); (B) quantitative data of reactive oxygen species; (C) quantitative data of malondialdehyde (MDA) content.

Figure 4

Effect of CD36 on the Release of Liver Related Enzymes in Primary Mule Duck Adipocytes

After the addition of PA, hepatocytes were significantly damaged and the AST/ALT content in steatotic hepatocytes decreased post-CD36 interference. Post-CD36 overexpression, the AST/ALT content in steatotic hepatocytes increased significantly, suggesting that cell damage was aggravated. The HDL content in hepatocytes increased significantly after the addition of PA and CD36 overexpression (Table 3).Table 3 Biochemical analysis of liver cells (results indicate mean ± standard error).

Table 3Group	AST (U/gprot)	ALT (U/gprot)	HDL (mmol/gprot)	LDL (mmol/gprot)	
Blank	1.0948±0.0041B	0.2802±0.0010B	0.0132±0.0319B	0.0120±0.0003B	
PA	4.6214±0.4890Aa	0.8303±0.0143Aa	0.0427±0.0026Aa	0.0399±0.0021Aa	
CD36-1745+PA	3.8448±0.0335a	0.6673±0.0274b	0.0438±0.0009a	0.0363±0.0036a	
pEX2-CD36+PA	6.4730±0.1249b	0.9809±0.0134c	0.0641±0.0008c	0.0639±0.0061b	

Effect of CD36 on AMPK Signaling Pathway Gene and Protein Expression in Primary Mule Duck Adipocytes

After interfering with the CD36 gene and adding PA, AMPK-α was significantly upregulated (P < 0.01), whereas the expression of ACC1 and SREBP1 was significantly downregulated (P < 0.01). The other genes demonstrated no significant changes. Post-CD36 overexpression and PA addition, the expression of AMPK-α and CPT-1A was significantly downregulated (P < 0.01). ACC1 and LKB1 expression was significantly upregulated (P < 0.05; P < 0.01, respectively). There were no significant changes in the expression of the other genes (Figure 5A).Figure 5 The expression level of AMPK pathway related genes and protein after interference/overexpression of CD36 gene. Cells were treated with starvation (serum-free medium) for 4 h, and then transfected with CD36 gene for 24 h, and 400 μmol/L PA was added for 24 h. (A) Quantitative real-time PCR analysis of AMPK pathway genes; (B) immunoblot of P-AMPK,AMPK,SREBP1 and CD36; (C) Protein levels of P-AMPK,AMPK,SREBP1 and CD36. Results of 3 independent experiments are represented the means ± SD. The ns means no significant difference (P > 0.05), *indicates significant difference (P ≤ 0.05), **and above indicates very significant (P ≤ 0.01).

Figure 5

CD36 gene interference and PA addition decreased the expression of the SREBP1 protein, but the expression of the P-AMPK and AMPK proteins was significantly increased (Figures 5B and 5C). However, the results of CD36 gene overexpression and PA addition were opposite.

DISCUSSION

CD36 is a multifunctional membrane protein that plays a crucial role in maintaining cellular fatty acid homeostasis (Quintana-Castro et al., 2020). Studies have found that the expression level of the CD36 gene in normal liver is very low, but it is significantly increased in animal models and patients with fatty liver (Gao et al., 2016). Liver-specific overexpression of the CD36 gene in mice without a high-fat diet can also lead to hepatic steatosis. When liver specific CD36 gene knockout mice were fed a high-fat diet, their liver lipid content decreased (Wilson et al., 2016), consistent with the increased expression levels of CD36 in PA-induced primary adipose liver cells of mule ducks observed in our study. Abnormal cholesterol metabolism plays a crucial role in NAFLD pathogenesis, with the elevated levels of TG found in the liver and plasma of patients with NAFLD and HFD-fed mice (Zhang et al., 2021b). Herein, the PA-induced increase in TG in the primary liver cells of mule ducks was reversed by interfering with the CD36 gene. Thus, CD36 is involved in lipid metabolism and may play a crucial role in the development of fatty liver in mule ducks.

Excessive accumulation of free fatty acids leads to ROS production. An imbalance between ROS production and antioxidant activity leads to oxidative stress-induced DNA and tissue damage. Free fatty acids induce the expression of genes associated with fat production, which disrupts lipid homeostasis and NAFLD (Kim et al., 2020). ROS accumulation leads to liver cell dysfunction, apoptosis, and induces mitochondrial dysfunction, leading to liver injury and promoting NAFLD progression (Zhu et al., 2023). Recent research has indicated that antioxidants have a therapeutic effect on NAFLD as they regulate related signaling pathways to clear the ROS (Jiang et al., 2023). Furthermore, the antioxidant enzymes SOD and GPx alleviate ROS (Xiang et al., 2023). Our research suggests that interference with tge CD36 gene in mule duck liver cells reduces PA-induced ROS accumulation in primary mule duck liver cells due to increased antioxidant enzyme activity. MDA is an end-product of polyunsaturated fatty acid peroxidation, which can be induced by ROS (Taslim et al., 2023). The decrease in MDA content also reflected a reduction in ROS accumulation by CD36. Therefore, CD36 is a key regulatory factor for oxidative stress in mule duck fatty liver.

AMPK detects energy changes within cells. Studies have demonstrated that AMPK is downregulated in fatty livers (Zhang et al., 2021a), and dysregulation of AMPK signaling may lead to lipid accumulation and insulin resistance in skeletal muscles (Jaw Long Sun et al., 2024). This activates the AMPK signaling pathway and promotes nutrient absorption and catabolism (Scott et al., 2017). Activated AMPK in liver cells also upregulates CD36 expression, leading to fatty acid uptake, lipid accumulation in liver cells, and the development of fatty liver (Cong et al., 2022). This study found that adding PA to the culture medium reduced AMPK-α gene expression. CD36 gene expression leads to AMPK- α gene inhibition, and the downstream target genes ACC1 and SREBP1 expression of AMPK were also inhibited. Thus, suggesting that the CD36 gene may have activated the AMPK pathway. Therefore, CD36 may regulate PA-induced lipid metabolism disorders in mule duck adipocytes through the AMPK signaling pathway. However, the specific molecular mechanisms remain to be explored in subsequent studies.

CONCLUSION

In conclusion, this study verified that CD36 can cause lipid accumulation in the primary hepatocytes of mule ducks, aggravate cell oxidative stress, and cause apoptosis. CD36 gene regulates lipid metabolism in mule duck primary fatty liver cells by regulating the expression of genes related to the AMPK signaling pathway.

DISCLOSURES

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: Ying-Xiu Hu reports financial support was provided by Science and Technology Innovation Special Fund of Fujian Agriculture and Forestry University. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

ACKNOWLEDGMENTS

The research was supported by the Science and Technology Innovation Special Fund of Fujian Agriculture and Forestry University [grant number KFB23103A ].
==== Refs
REFERENCES

Bort A. Sánchez B.G. de Miguel I. Mateos-Gómez P.A. Diaz-Laviada I. Dysregulated lipid metabolism in hepatocellular carcinoma cancer stem cells Mol. Biol. Rep. 47 2020 2635 2647 32125560
Cong Y. Hong Y. Wang D. Cheng P. Wang Z. Xing C. Sun W. Xu G. 2, 3, 7, 8-Tetrachlorodibenzo-dioxin induces liver lipid metabolism disorder via the ROS/AMPK/CD36 signaling pathway Toxicol. Sci. 191 2022 276 284
Damgaard M.V. Treebak J.T. Protocol for qPCR analysis that corrects for cDNA amplification efficiency STAR Protocols 3 2022 101515
Daquinag A.C. Gao Z. Fussell C. Immaraj L. Pasqualini R. Arap W. Akimzhanov A.M. Febbraio M. Kolonin M.G. Fatty acid mobilization from adipose tissue is mediated by CD36 posttranslational modifications and intracellular trafficking JCI Insight 6 2021 e147057
Fernandez X. Lazzarotto V. Bernadet M.-D. Manse H. Comparison of the composition and sensory characteristics of goose fatty liver obtained by overfeeding and spontaneous fattening Poult. Sci. 98 2019 6149 6160 31162617
Foretz M. Even P. Viollet B. AMPK activation reduces hepatic lipid content by increasing fat oxidation in vivo Int. J. Mol. Sci. 19 2018 2826 30235785
Gao M. Ma Y. Alsaggar M. Liu D. Dual outcomes of rosiglitazone treatment on fatty liver AAPS J 18 2016 1023 1031 27125895
Geng T. Xia L. Li F. Xia J. Zhang Y. Wang Q. Yang B. Montgomery S. Cui H. Gong D. The role of endoplasmic reticulum stress and insulin resistance in the occurrence of goose fatty liver Biochem. Biophys. Res. Commun. 465 2015 83 87 26235878
Glatz J.F.C. Heather L.C. Joost CD36 as a gatekeeper of myocardial lipid metabolism and therapeutic target for metabolic disease Physiol. Rev. 104 2024 727 764 37882731
Hong L. Sun Z. Xu D. Li W. Cao N. Fu X. Huang Y. Tian Y. Li B. Transcriptome and lipidome integration unveils mechanisms of fatty liver formation in Shitou geese Poult. Sci. 103 2023 103280
Hu Y.-X. Zhang D.-D. Chen C. Li A. Bai D.-P. Mechanism of fibroblast growth factor 1 regulating fatty liver disorder in mule ducks Poult. Sci. 103 2024 103818
Jiang X. Li Y. Fu D. You T. Wu S. Xin J. Wen J. Huang Y. Hu C. Caveolin-1 ameliorates acetaminophen-aggravated inflammatory damage and lipid deposition in non-alcoholic fatty liver disease via the ROS/TXNIP/NLRP3 pathway Int. Immunopharmacol. 114 2023 109558
Kim M.H. Seong J.B. Huh J.-W. Bae Y.C. Lee H.-S. Lee D.-S. Peroxiredoxin 5 ameliorates obesity-induced non-alcoholic fatty liver disease through the regulation of oxidative stress and AMP-activated protein kinase signaling Redox Biol 28 2020 101315
Li Y. Huang X. Yang G. Xu K. Yin Y. Brecchia G. Yin J. CD36 favours fat sensing and transport to govern lipid metabolism Prog. Lipid Res. 88 2022 101193
Li R. Li Y. Yang X. Hu Y. Yu H. Li Y. Reducing VEGFB accelerates NAFLD and insulin resistance in mice via inhibiting AMPK signaling pathway J. Transl. Med. 20 2022 341 35907871
Liang Y. Han H. Liu L. Duan Y. Yang X. Ma C. Zhu Y. Han J. Li X. Chen Y. CD36 plays a critical role in proliferation, migration and tamoxifen-inhibited growth of ER-positive breast cancer cells Oncogenesis 7 2018 1 14 29367650
Lua I. Balog S. Yanagi A. Tateno C. Asahina K. Loss of lysophosphatidic acid receptor 1 in hepatocytes reduces steatosis via down-regulation of CD36 Prostag. Oth. Lipid. M. 156 2021 106577
Luo R. Chen C. Shi Y. Tao Q. Bai D. Li A. Effects of overfeeding on liver lipid metabolism in mule ducks based on transcriptomics and metabolomics Br. Poult. Sci. 64 2023 143 156 36880206
Pepino M.Y. Kuda O. Samovski D. Abumrad N.A. Structure-function of CD36 and importance of fatty acid signal transduction in fat metabolism Annu. Rev. Nutr. 34 2014 281 303 24850384
Quintana-Castro R. Aguirre-Maldonado I. Soto-Rodríguez I. Deschamps-Lago R.A. Gruber-Pagola P. Urbina de Larrea Y.K. Juárez-Rivera V.E. Ramos-Manuel L.E. Alexander-Aguilera A. Cd36 gene expression in adipose and hepatic tissue mediates the lipids accumulation in liver of obese rats with sucrose-induced hepatic steatosis Prostag. Oth. Lipid. M. 147 2020 106404
Scott J.W. Oakhill J.S. The sweet side of AMPK signaling: Regulation of GFAT1 Biochem. J. 474 2017 1289 1292 28336748
Sun J.L. Cho W. Oh H. Abd El-Aty A.M. Hong S.A. Jeong J.i H. Jung T.W. Interleukin-38 alleviates hepatic steatosis through AMPK/autophagy-mediated suppression of endoplasmic reticulum stress in obesity models J. Cell. Physiol. 239 2024 e31184 38197464
Taslim N.A. Sutisna N. Mayulu N. Qhabibi F.R. Kurniawan R. Mayulu N. Dietary supplementation of Muntingia calabura leaves ameliorates reactive oxygen species and malondialdehyde levels: clinical study on alloxan-induced hyperglycemic rats Clin. Nutr. 48 2023 87 96
Titov V.N. Rozhkova T.A. Aripovsky A.V. Amelyushkina V.A. Yu Karganov M. The becoming of reactions of lipolysis in phylogenesis. The palmitic and oleic triglycerides as substrates. Insulin, condition of normolipemia and formation of hyper lipoproteinemia type IIb, IV and V Klin. Lab. Diagn 63 2018 4 15 30550084
Wang T. Wei X. Chen T. Wang W. Xia X. Miao J. Yin S. Studies of the mechanism of fatty liver formation in Takifugu fasciatus following copper exposure Ecotox. Environ. Safe. 181 2019 353 361
Wilson C.G. Tran J.L. Erion D.M. Vera N.B. Febbraio M. Weiss E.J. Hepatocyte-specific disruption of CD36 attenuates fatty liver and improves insulin sensitivity in HFD-fed mice Endocrinology 157 2016 570 585 26650570
Xiang K. Wu H. Yu L. Sheng W. Li X. Yang B. Zhang Y. Ma L. Gao L. He L. Ni Q. Zhang L.J. MOF-derived bimetallic nanozyme to catalyze ROS scavenging for protection of myocardial injury Theranostics 13 2023 2721 2733 37215581
Yang L. He Z. Yao J. Tan R. Zhu Y. Li Z. Guo Q. Wei L. Regulation of AMPK-related glycolipid metabolism imbalances redox homeostasis and inhibits anchorage independent growth in human breast cancer cells Redox Biol 17 2018 180 191 29702405
Zhang Z. Wen H. Peng B. Weng J. Zeng F. CDKN2A deregulation in fatty liver disease and its accelerative role in the process of lipogenesis FASEB J. 35 2021 e21230 33769609
Zhang Y. Zhou X. Liu P. Chen X. Zhang J. Zhang H. Li S. Chen Y. Song X. Wang J. Zeng H. Zhang X. Tang C. Yu C. Li Y. Xu C. GCSF deficiency attenuates nonalcoholic fatty liver disease through regulating GCSFR-SOCS3-JAK-STAT3 pathway and immune cells infiltration. American journal of physiology. Gastrointestinal and liver physiology/American journal of physiology Am. J. Physiol. Gastr. L. 320 2021 G531 G542
Zhu Z. Hu X. Liu K. Li J. Fan K. Wang H. Wang L. He L. Ma Y. Guan R. Wang Z. E3 ubiquitin ligase Siah1 aggravates NAFLD through Scp2 ubiquitination Int. Immunopharmacol. 124 2023 110897
