
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)13730-9
10.1016/j.heliyon.2024.e37699
e37699
Research Article
Boosting immunotherapy efficacy: Empowering the Potency of Dendritic cells loaded with breast cancer lysates through CTLA-4 suppression
Bakhshivand Mohammad abc
Masoumi Javad a
Ghorbaninezhad Farid de
Aghebati-Maleki Leili a
Shanebandi Dariush a
Sandoghchian Shotorbani Siamak ab
Jadidi-Niaragh Farhad ab
Baghbanzadeh Amir a
Hemmat Nima a
Baghbani Elham a
Ghaffari Amir ae
Baradaran Behzad baradaranb@tbzmed.ac.ir
ab⁎
a Immunology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
b Department of Immunology, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran
c Student Research Committee, Tabriz University of Medical Sciences, Tabriz, Iran
d Cancer Immunology and Immunotherapy Research Center, Ardabil University of Medical Sciences, Iran
e School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
⁎ Corresponding author. Director of Immunology Research Center, Faculty of Medicine, Tabriz University of Medical Sciences, Iran. baradaranb@tbzmed.ac.ir
10 9 2024
30 9 2024
10 9 2024
10 18 e3769918 7 2024
6 9 2024
9 9 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).
Anticancer immunotherapies with a dendritic Cell (DC) basis are becoming more popular. However, it has been suggested that the tumor's immunosuppressive mechanisms, such as inhibitory immunological checkpoint molecules, reduce the effectiveness of anticancer immunogenicity mediated by DC. Thus, overcoming immune checkpoints and inducing effective antigen-specific T-cell responses uniquely produced with malignant cells represent the key challenges. Among the inhibitory immune checkpoints, DCs' ability to mature and present antigens is decreased by CTLA-4 expression. Consequently, we hypothesized that by expressing CTLA-4 cells on DCs, the T cells' activation against tumor antigens would be suppressed when confronted with these antigens presented by DCs. In this research, by loading cell lysate of breast cancer (BC) on DCs and the other hand by inhibiting the induction of CTLA-4 using small interfering RNA (siRNA), we assessed the functional activities and phenotypes of DCs, and also the responses associated with T-cells following co-culture DC/T cell. Our research has shown that the suppression of CTLA-4 enhanced the stimulating capabilities of DCs. Additionally, CTLA-4-suppressed BC cell lysate-loaded DCs produced more IL-4 and IFN-ϒ and increased T cell induction in contrast to DCs without CTLA-4 suppression. Together, our data point to CTLA-4-suppressed DCs loaded with BC cell lysate as a potentially effective treatment method. However, further research is required before employing this method in therapeutic contexts.

Keywords

Dendritic cell
Immune checkponits
CTLA-4
Breast cancer
SiRNA
Cancer immunotherapy
==== Body
pmc1 Introduction

According to 2019 WHO estimates, cancer is the leading or second leading cause of death before age 70 in 120 out of 190 countries [1,2]. Breast cancer, the most common cancer among women worldwide, is a genetically and clinically heterogeneous malignancy and a leading cause of death [[3], [4], [5], [6]]. Treatment strategies for BC contain radiation and surgery and systemic approaches such as anti-HER2 therapy, chemotherapy, hormonal therapy with raloxifene or tamoxifen [7], and immunotherapy [8]. However, potential challenges with these treatments include side effects like systemic toxicity, chemotherapy resistance, and potential cancer recurrence [7,9].

Advancements in understanding pathological mechanisms have led to the emergence of immunotherapy as an effective cancer treatment [10]. This approach enhances targeted immune responses against cancer cells by using Dendritic Cells (DCs) [11]. DCs, specific antigen-presenting cells (APCs), bridge adaptive and innate immunity by activating T cells against tumor antigens [12,13]. Current cancer immunotherapy strategies focus on harnessing DCs to tailor immune responses, particularly tumor-specific T-cell reactions [14,15]. In breast cancer, DCs can be primed in the lab with tumor antigens and then re-administered to patients, enhancing immune responses against tumor antigens [16,17]. Studies show that DCs can induce T lymphocyte responses to tumor antigens when pulsed with a tumor cell lysate [18,19]. This activation of T cells by DCs reduces tumor recurrence by increasing immunological memory and decreasing tumor volume [14,15]. Various studies have explored Dendritic Cell (DC) therapy for breast cancer, with several clinical trials currently ongoing, including NCT03387553, NCT04373031, NCT03384914, and NCT02491697.

Dendritic Cells (DCs) are crucial for transferring tumor-associated antigens (TAAs) to T lymphocytes in cancer immunotherapy, but their effectiveness is limited by immune regulatory checkpoint molecules, particularly CTLA-4 [20]. CTLA-4, an inhibitory molecule expressed on DCs and other immune cells, regulates their function and reduces DCs' development and antigen presentation activity [[21], [22], [23], [24]]. It has been shown in a study that CTLA-4 expression on moDCs decreases their maturity and antigen presentation capacity [25]. Also, according to reports, activated moDCs and LPS co-culturing of CTLA-4-positive breast cancer cells can reduce the maturation markers of DCs [26]. Ipilimumab, an anti-CTLA-4-blocking antibody, demonstrated notable therapeutic results and received approval by the FDA in 2011 to treat metastatic melanoma [27]. Furthermore, Son et al. have shown that in irradiated tumors, anti-CTLA-4 antibodies can boost immature DCs-mediated immune responses [28]. Other immune checkpoints like PD-1 are expressed on dendritic cells and can inhibit their function. Thus, its inhibition can improve the dendritic function. It has been reported that the combination of anti-PD-1 antibodies and the DC vaccine can suppress the expression of immunological checkpoints on DCs, keep DCs' capacity to presenting antigens and boost the immune responses of T lymphocytes specific to tumors [29].

Regarding the topics mentioned above, it appears that inhibition of CTLA-4 on DCs along with a tumor cell lysate-loaded in DCs augments activation of T cells more effectively, suggesting the practicable and applicable immunotherapy strategy against BC.

This study is aimed to investigate the impact of inhibiting CTLA-4 on dendritic cells (DCs) loaded with breast tumor lysate, specifically focusing on the enhancement of autologous T lymphocyte activity and cytokine production. Furthermore, the study seeks to ascertain whether inhibiting CTLA-4 on these DCs can boost the effectiveness of DC vaccination in cancer treatment.

2 Methods

2.1 Materials

Complete Medium (CM) inclusive of RPMI 1640 (Gibco, USA, NY), comprises 100 IU/ml penicillin (Sigma-Aldrich, Mannheim, Germany), Fetal Bovine Serum (FBS10 %) (Cayman Chemical, Michigan, USA), 2-mercaptoethanol (2 ME) (Sigma Chemical, Munich, Germany) streptomycin 100 μg/ml (Sigma-Aldrich, Mannheim, Germany), L-glutamine (2 mmol/L) was ordered from Santa Cruz (CA, USA). Lipopolysaccharide (LPS), recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF), and recombinant human interleukin-4 (IL-4) were ordered from Cayman Chemical (Michigan, USA). Ficoll and Carboxyfluorescein succinimidyl ester (CFSE) cell labeling kits were bought from Santa Cruz (CA, USA). The Human Pan T cell isolation Kit and Bradford protein assay kit were ordered from Santa Cruz (CA, USA). Antibodies employed for phenotypic characterization of the cells were anti-CD11c-FITC, anti-CD40-CF blue, and anti-HLA-DR-APC, anti-CD86− PerCP-cy5.5, and anti-CD14-FITC from Gibco (USA, NY).

2.2 Tumor cell lysate preparation

Pasteur Institute (the National Cell Bank of Iran) provided the MCF-7, MDA-MB-231, and MDA-MB-468 human BC cell lines for this study. These cells were transferred to CM and then kept at 37 °C and humidity with CO2 5 %. After the confluence of cultivate cells gained 85 %, they were harvested utilizing Trypsin, washed with serum (twice), and suspended in sterile PBS buffer (concentration: 1 × 107 cells/mL). Cells underwent 6 rapid freeze-thaw cycles in liquid nitrogen and a 37 °C water bath to produce lysates of tumor cells. The created lysate was next subjected to a 15-s sonication process to generate maximum tumour antigens from cancer cell lysates. The lysates of tumor cells were centrifuged at 1500 rpm to remove cell debris (15 min at 4 °C). A 0.2-mm filter was used to filter the obtained supernatant. The Bradford assay was applied to measure how much protein was present in the lysates. All lysates were refrigerated at −80 °C Until they were used.

2.3 Isolation of peripheral mononuclear cell (PBMC) and production of DCs

Heparin-containing sterile falcons were used to collect fresh peripheral blood (PB) from three healthy volunteers. These samples were then fractionated along Ficoll gradients to extract the PBMCs. Monocytes were separated from PBMCs using the plastic adherence method. In 6-well plates, PBMCs were cultivated in RPMI-1640 medium (5 × 107 cells/mL concentration) for this purpose. After incubation (2h, 37 °C), suspended cells were eliminated by washing and the adherent cells were cultivated in CM supplemented (50 μM of 2 ME, 20 ng/mL of IL-4, 40 ng/mL of GM-CSF). The cultivated cells were nourished by deleting 0/5 of the medium and adding fresh CM comprising GM-CSF and IL-4 (days 2 and 4). On day 6, immature DCs (iDCs) were collected, and the culture medium was then supplemented with 80 μg/mL of mixed lysate of cell lines of human BC. CM was nourished with 100 ng/mL of LPS after 5 h at 37 °C incubation. Following one-day incubation, mature DCs (mDCs) loaded with tumor cell lysate were generated.

2.4 Phenotypical and morphological specification of DCs

Using the inverted light microscope (Olympus Corporation, Tokyo, Japan), we looked at the morphologic specification of monocytes and DCs and took pictures of the results. To examine the phenotype of mDCs, CTLA-4-blocked mDCs, and iDCs, particular surface markers to these cells, such as CD40 (anti-CD40-CF-blue), CD86 (anti-CD86-PerCP-cy5.5), HLA-DR (anti-HLA-DR-APC), and CD11c (anti-CD11c-FITC) were stained. The cells were assessed by the flow cytometry assay and FlowJo software version 10.5.3 and MACSQuant cytometer (Miltenyi Biotec, Auburn, CA, USA).

2.5 Preparation of siRNA and transferring to DCs

The transfection reagent and CTLA-4-siRNA were purchased from Sigma-Aldrich (Mannheim, Germany). The sorted sequence of CTLA-4-siRNA is indicated in Table 1. The mDCs were collected and then by using Gene Pulser Xcell (Bio-Rad, USA) placed with several pulse voltages (160, 180, and 200 V) in order to find the optimal pulse voltage for CTLA-4-siRNA transfection. With FITC-labeled control siRNA (Cayman Chemical, Michigan, USA), the effectiveness of siRNA transfection at various pulse voltages was assessed. Next, different CTLA-4-siRNA (40, 60, and 80 ƿmol) concentrations were transfected into mDCs after detecting the suitable voltage (160 V) for transfecting siRNA. Subsequently, mDCs were placed into a 6-well plate comprising a complete medium. After 48 and 72 h of incubation, the level of CTLA-4 was examined utilizing qRT-PCR. The optimal pulse voltage and siRNA dose were acquired for subsequent tests based on the obtained data.Table 1 List of primer sequences and siRNA.

Table 1Gene	Forward/Reverse	Sequence	
CTLA-4-siRNA	sense	GUAUCUGAGUUGACUUGACAGAACA	
Antisense	UGUCUGUCAAGUCAACUCAGAUACCA	
CTLA-4	F	TCAGTCCTTGGATAGTGAGGTTC	
R	TCAGTCCTTGGATAGTGAGGTTC	
T-bet	F	TCTCCTCTCCTACCCAACCAG	
R	CATGCTGACTGCTCGAAACTCA	
IL-10	F	AGGAAGAGAAACCAGGGAGC	
R	GAATCCCTCCGAGACACTGG	
GATA3	F	GCATCCAGACCAGAAACCGAA	
R	TCGCGTTTAGGCTTCATGATACT	
FOXP-3	F	CAGCCAGTCTATGCAAACC	
R	GTCTTGTGTCAGTTTGAGGGTC	
18S	F	5′ CTACGTCCCTGCCCTTTGTACA-3′	
R	5′ -ACACTTCACCGGACCATTCAA-3′	

2.6 Separation of CD3+ T-cell and CFSE labeling

By the manufacturer's guide, autologous CD3+ T cells from the same people who produced the DCs were isolated from PBMCs, applying a human Pan T Cell separation Kit employing magnetically activated cell sorting (MACS). After the PBMCs had been extracted, the suspension of cells was centrifuged (400g −15 min). The supernatant was eliminated, and then Pan T cell biotin Ab cocktail (10 μL) and 40 μl of MACS buffer were poured per 1 × 107 total cells. After 5 min of incubation at 2–8 °C, 15 μL of Pan T Cell Micro bead cocktail and 30 μL of MACS buffer were combined per 1 × 107 total cells. Following incubation (2-8°C-10 min), the cells were washed with MACS buffer (3 mL) and re-mixed with it (500 μL). Cell suspension was added to the MACS column and placed in the MACS magnetic field isolator. Unlabeled cells are referred to as negatively selected CD3+ T-cells. Following the manufacturer's recommended procedure, isolated CD3+ T cells were CFSE-labeled.

In summary, pure T cells were suspended again in PBS and exposed to 5 mM CFSE for incubated 5 min in the dark. Through mixing an RPMI-1640 medium (25 % FBS), the continuation of the reaction was prevented. All cells were placed in a warm cell culture medium following the final washing process.

2.7 Investigating the growth of CD3+ T cells

The rate of mDCs and CTLA-4-blocked-mDCs to promote the growth of autologous T cells was assessed by T/DCs co-culture. The mDCs and CTLA-4-blocked-mDCs as stimulator cells and CFSE-labeled autologous CD3+ T cells as responder cells were co-seeded in a 96-well plate (1:10 and1:5). As a positive control, Phytohemagglutinin (PHA) (5 %) (Cayman Chemical, Michigan, USA) was employed to stimulate T cells. In contrast, the unstimulated group included co-cultured iDCs and T cells. After incubation under dark circumstances (4 days), the growth of the CFSE-labeled T cells was evaluated via flow cytometry.

2.8 Assessment of cytokines

The cells were seeded at a ratio of 1:5 on a 24-well plate in order to assess the ability of CTLA-4-blocked-mDCs and mDCs to induce release of cytokine from autologous T cells, which is extracted from CD3+ T cells. After the co-cultures were stimulated with DCs (48 h), the cells were gathered, and the rate of IFN-ϒ, TGF-β, and IL-4 were determined utilizing ELISA kits (Thermo Fisher Scientific, USA). Using ELISA kits, the amounts of IL-10 and IL-12 in CTLA-4-silenced-mDCs and mDCs' culture supernatants were also measured.

2.9 Isolation of RNA and qRT-PCR

The TRIzol reagent (Tonk Bioscience LLC, USA) was used to isolate total cellular RNA by the manufacturer's instructions. Then, using a spectrophotometer, the amount of RNA was determined. The RNA in this study was kept at −80 °C. Applying RT-PCR (BioFACT 2step 2X) Pre-Mix (Taq) complementary DNA (cDNA) was synthesized, and the level of all genes was examined utilizing the Applied Biosystems StepOnePlusTM RT-PCR System (Life Technologies, USA). After each experiment, the amount of the target and relative mRNAs was normalized using the 2-ΔΔCt technique.

2.10 Statistical analysis

GraphPad Prism v8.1.2 (California, USA) was used to analyze the raw data. Obtained data were compared using Mann–Whitney (the nonparametric version of Student's t-test) and the Kruskal Wallis (the nonparametric version of ANOVA). Data were obtained from biologically independent samples, and each parameter was assessed in triplicate. Each group's data were reported as mean ± SD with the significance cut-off of p-value ≤0.05 (ns: not significant; *: P ≤ 0.05; **: P ≤ 0.01; ***: P ≤ 0.001; and ****: P ≤ 0.0001), and Each parameter was assessed three times.

3 Results

3.1 CTLA-4 gene was dramatically decreased after transfection of siRNA in mDCs

Various pulse voltages were used to transfect mDCs to determine the optimum voltage for transfection (160, 180, and 200 V). The transfection rate was revealed to be close to 90 % in all of them and did not significantly differ between the specified voltages. Therefore, to reduce the stress on the cells during pulsing, the least voltage (160V) was chosen (Fig. 1A). Furthermore, qRT-PCR was applied to assess the efficiency of siRNA in gene silencing after CTLA-4-siRNA was transfected into mDCs at different concentrations. As a comparison to the control group of untransfected mDCs, CTLA-4-siRNA (60 pmol) lowered expression of CTLA-4 mRNA level in transfected cells more significantly than 40 and 80 pmol (Fig. 1B, P value: 0.0001) and subsequent tests were performed with an ideal CTLA-4-siRNA concentration of 60 pmol and an ideal transfection voltage of 160 V.Fig. 1 The CTLA-4 gene was effectively suppressed in mDCs by siRNA transfection. (a) Efficiency of mDCs transfection across different pulse voltages. The optimal voltage was found to be 160 V, with over 93 % of the mDCs successfully transfected using FITC-labeled control siRNA. The Trypan blue exclusion test revealed that all transfected and untransfected DCs had more than 90 % viability. (b) Compared to untransfected mDCs, the expression of CTLA-4 mRNA was inhibited in mDCs that had been transfected with 60 pmol of CTLA-4 siRNA compared to the control group (**P ≤ 0.01 and ****P ≤ 0.0001). mDCs, Tumor cell lysate-loaded mature dendritic cells; CTLA-4, Cytotoxic T-lymphocyte-associated protein-4.

Fig. 1

3.2 CTLA-4 deletion significantly improved the activation and maturation of DCs

Microscopically examination of adherent monocytes and differentiated DCs in vitro culture indicated morphological changes (Fig. 2A). As explained before, upregulating maturation and antigen presentation evaluated the phenotypic characteristics of different dendritic cells (including CTLA-4-silenced-mDCs, iDCs, and mDCs). According to flow cytometry evaluations, the most critical surface markers expressed by these cells include CD40, CD86, HLA-DR, and CD11c (Fig. 2B). Then, the difference in expression of these markers' surface depending on the median fluorescence intensity (MFI) between these DCs was investigated. Based on the findings of the analysis, CTLA-4 silenced mDCs compared to iDCs, these markers expression levels increased significantly in CD40 (P ≤ 0.0001), CD86 (P ≤ 0.01), HLA-DR (P ≤ 0.0001), and CD11c (P value ≤ 0.01) (Fig. 2C). Furthermore, compared to mDCs, CTLA-4 silencing con siderably enhanced the level of CD40 (P ≤ 0.01), HLA-DR (P ≤ 0.05), and CD86 (P ≤ 0.01), but this increase was not significant in CD11c (Fig. 2C). Moreover, it has been demonstrated that stimulated DCs can generate pro-inflammatory cytokines. The amount of IL-12 and IL-10 were determined by ELISA to describe the impact of CTLA-4 silencing. Also, IL-10 and TNF-α mRNA level was measured by qRT-PCR. Findings revealed that suppression of CTLA-4 decreased the IL-10 expression (Fig. 3A–P≤0.01), but contrary to expectation, this suppression also decreased the TNF-α level (Fig. 3A–P ≤ 0.0001). Additionally, after CTLA-4 suppression, IL-12 amounts were enhanced compared to mDCs in the cell culture supernatants (Fig. 3B–P ≤ 0.01). Also, our data indicated no significant difference in IL-10 mRNA expression in the supernatant of CTLA-4-blocked mDCs compared to mDCs (Fig. 3B).Fig. 2 Characterization of DCs' morphological and phenotypical. (a) Changes in morphology during adherent monocyte and differentiated DC culture in vitro. DCs with normal morphology and sharp dendrites are indicated by arrows. (b) iDC, mDC, and CTLA-4-silenced mDC phenotypic characterization were measured using flow cytometry to express surface markers like CD11c, HLA-DR, CD86, and CD40. The data are presented as a percent of the cells stained with various markers (Figures A and B supplied as representative of all samples). (c) The expression of CD11c, HLA-DR, CD86, and CD40 is displayed as MFI among iDCs, mDCs, and CTLA-4-silenced-mDCs (ns: not significant, *P value ≤ 0.05, **P value ≤ 0.01, and ****P value ≤ 0.0001). DCs, dendritic cells; CTLA-4, Cytotoxic T-lymphocyte-associated protein-4; siRNA-mDCs, CTLA-4-silenced mDCs; mDCs, Tumor cell lysate-loaded mature dendritic cells; iDCs, Immature dendritic cells; HLA-DR, Human leukocyte antigen-DR isotype; MFI, Median fluorescence intensity.

Fig. 2

Fig. 3 Cytokine secretion and expression profiles in mDCs and CTLA-4-silenced-mDCs (a) qRT-PCR was used to measure the expression levels of TNF- α and IL-10. (b) Using ELISA in the cell culture supernatants, the amounts of IL-12 and IL-10 were assessed (ns: not significant, **P ≤ 0.01, and ****P ≤ 0.001). qRT-PCR, Quantitative Real-time polymerase chain reaction; mDCs, Tumor cell lysate-loaded mature dendritic cells; CTLA-4, Cytotoxic T-lymphocyte-associated protein-4; siRNA mDCs, CTLA-4-silenced mDCs; ELISA, Enzyme-linked immunosorbent assay.

Fig. 3

3.3 CTLA-4 suppression in DCs increases the activity of T cells

In this study, after suppressing CTLA-4 in mDCs, its inhibitory effect on antitumor responses of T cells and cytokine generation by these cells was investigated. For this purpose, a co-culture experiment was performed to assess proliferation utilizing mDCs and CTLA-4-silenced-mDCs as a stimulator and CFSE-labeled autologous CD3+ T cells as a responder in a 1:10 and 1:5 ratio. The findings revealed that all groups showed higher T cell growth at a ratio of 1:5, compared to 1:10 (Fig. 4A and B). Moreover, CD3+ T cell proliferation enhancement was observed following the suppression of CTLA-4 expression in mDCs in a ratio of 1:5 (Fig. 4A and B). However, it is interesting to know that despite the enhanced ability to induce the growth of CD3+ T cells through CTLA-4-blocked-mDCs, in the 1:10 ratio, this increase was not significant. Also, to evaluate the T cells' antitumor activity, the amount of TGF-β, IL-4, and IFN-ϒ in T and DC cells was measured. The obtained results demonstrated that the induction rate of IL-4 and IFN-ϒ in the CTLA-4-silenced mDCs and T cells significantly increased significantly than in T cell/mDC co-culture (Fig. 5A) that was caused by an increment in CD3+ T cell growth. Furthermore, no dramatic difference was observed in the TGF-β level in the co-culture supernatant of CTLA-4-silenced-mDCs and T cells compared to the mDCs and T cells co-culture (Fig. 5A). In contrast to mDCs/T cells co-culture, our result illustrated that T cells obtained from the CTLA4-silenced-mDCs/T cells exhibited enhanced amounts of T-bet, IFN-ϒ, GATA3, and IL-10 mRNA expression (Fig. 5B). In addition, as opposed to mDCs/T cell co-culture, FOXP3 mRNA in T cells isolated from the CTLA-4-blocked-mDCs/T cells was significantly dropped (Fig. 5B).Fig. 4 CTLA-4-silenced-mDCs significantly increase CD3+ T cell proliferation. (a) The percent of CFSE-labeled autologous CD3+ T cells activated by mDCs and CTLA-4-silenced-mDCs at a 1:5 and 1:10 DC/T cell ratio was evaluated by FACS by quantifying the CFSE loss. (b) After CTLA-4 knockdown, the ability of mDC to proliferate T cells was improved (ns: not significant, *P value ≤ 0.05, **P value ≤ 0.01, and ***P value ≤ 0.001). mDCs, Tumor cell lysate-loaded mature dendritic cells; siRNA-mDCs, CTLA-4-silenced mDCs; CTLA-4, Cytotoxic T-lymphocyte-associated protein-4; FACS, Fluorescent activated cell sorting.

Fig. 4

Fig. 5 CTLA-4 silencing improved T cell-mediated effector activities in mDCs. After co-culture with mDCs and CTLA-4-silenced-mDCs, T cells produce cytokines. (a) IFN-ϒ, IL-4, and TGF-β secretion by CD3+ T cells were assessed in supernatants of DC/T cell co-culture by ELISA. (b) qRT-PCR was used to analyze the expression of T cell-mediated transcription factors, including GATA3, T-bet, IFN-ϒ, IL-10, and FOXP3, by CD3+ T cells after co-culture with mDCs and CTLA-4-silenced-mDCs; (*P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001). DC, dendritic cell; mDCs, Tumor cell lysate-loaded mature dendritic cells; siRNA-mDCs, CTLA-4-silenced mDCs; CTLA-4, Cytotoxic T-lymphocyte-associated protein-4; ELISA, Enzyme-linked immunosorbent assay; GATA3, GATA binding protein 3; T-bet, T-box protein expressed in T cells; FOXP3, Forkhead box P3; qRT-PCR, Quantitative reverse transcription polymerase chain reaction.

Fig. 5

4 Discussion

Breast cancer is a prevalent and potentially fatal disease affecting women globally. Research and awareness are crucial for early detection, improved treatments, and prevention, ultimately reducing its strain on individuals and healthcare systems [30,31]. Among its various subtypes, studying triple-negative (TNBC) and HER2-negative breast cancer holds significant importance due to their unique challenges. The aggressive nature of TNBC, coupled with its propensity to grow and spread rapidly, underscores the urgency for timely and effective treatments [32]. The primary treatment for TNBC, aggressive chemotherapy, is riddled with side effects, often diminishing the patient's quality of life and may also pose economic challenges for some patients. This highlights the need for research that can pave the way for cost-effective and efficient therapeutic interventions. Thus, treatment approaches based on immunotherapy appear to be the most potent alternatives with fewer side effects [32,33]. In this context, the study of breast cell lines, specifically TNBC is considered. In the present study, we studied MCF-7, MDA-MB-231, and MDA-MB-468 cell lines. MDA-MB-231 and MDA-MB-468 are employed to address the challenges of treating Triple-negative breast cancer (TNBC) [34] and MCF-7 is used as HER2 negative cell line [35]. Each of these cell lines has its distinct genetic and molecular landscape, making them suitable for different types of research studies for the development of immunotherapy.

Dendritic cells can be divided into different types including type 1 conventional DCs (cDC1), type 2 conventional DCs (cDC2), myeloid DCs (mDCs), lymphatic DCs (pDCs), regulatory DCs (regDCs). In humans cDC1 have markers such as CD141, XCR1, CLEC9A, and CADM1 and cDC2s express CD1c, CD11c, and SIRPa [36]. MoDCs are identified in humans using HLA-DR, CD11c, BDCA1, CD1a, FceRI, CD206, CD172a, CD14, and CD11b in addition to M-CSFR and ZBTB46. These cells stimulate the responses of CD4+ and CD8+ T cells and developed under inflammatory conditions are involved in inducing and regulating immune responses [36]. pDCs expresses CD11c, IRF8, and MHC-II molecules. The capacity of this cell to generate a significant quantity of type I interferons is its most notable characteristic [37]. Human regulatory DCs, when compared to their normal counterparts, showed deficient low levels of costimulatory molecules (such as CD40, CD80, and CD86), but high expression levels of MHC [38].

In cancer immunotherapy, using dendritic cells to activate antitumor responses of CD8+ and CD4+ T cells has been considered. Dendritic cells pulsed with lysate are more potent in inducing T-cells; However, tumor cells employ a range of immunoregulation mechanisms that disrupt the performance of these dendritic cells and compromise the efficacy of treatments related to dendritic cells, and allow cancerous cells to evade immune surveillance. Immune checkpoint molecules are pivotal in shaping the tumor microenvironment [39]. CTLA-4 plays a crucial role in blocking antitumor T cells. CTLA-4 can bind to CD86 and CD80, interfering with the CD28-mediated signaling in T cells and inhibiting T cell induction [40]. The interaction between CD28 and CD80/CD86 is augmented, thereby promoting the immune responses of CD8+/CD4+ cells [41,42]. CTLA-4 can be expressed in other cells, such as DCs, and have immunoregulatory impacts on these cells [21,24]. The presence of CTLA-4 in these cells decreases their maturation by reducing the expression of CD83, as well as these cells have a low ability to present antigens to T cells [24].

Many studies have tried to use tumor lysate-pulsed DCs [[43], [44], [45]] or prevent immune checkpoints [46,47] in DCs to enhance the effectiveness of treatment based on dendritic cells. Nonetheless, no study has simultaneously evaluated tumor antigen delivery on DCs and the effect of CTLA-4 blockage in cancer therapy. Because of the expression of CTLA-4 on dendritic cells and having a negative impact on their activity, we inhibited the CTLA-4 in BC cell lysate-pulsed DCs through the delivery of siRNA to raise the effectiveness of dendritic cell therapy. To reduce the CTLA-4 level in BC cell lysate-loaded DCs, duplex CTLA-4 siRNA with high specificity, longevity, and stability were used. In our research, following transfection using CTLA-4 siRNA (60 pmol), the level of CTLA-4 genes significantly decreased in transfected mDCs compared to normal mDCs. Following determining the effective and optimal concentration and voltage for the delivery of siRNA, we evaluated the influence of CTLA-4 inhibition on mDCs by measuring cytokine secretion characteristics and surface molecule expression patterns. Thus, despite no significant increase in CD11c expression, CTLA-4 inhibition in these cells could dramatically amplify the CD40, CD86, and HLA-DR expressions, indicating the capability of CTLA-4-blocked mDCs in stimulating T cells. Cytokines released by DCs are another crucial factor for the stimulation of T-cells. Whereas the production of IL-10 is related to tolerogenic DCs, induced DCs generate IL-12 and TNF-α cytokines [48]. We found that after CTLA-4 silencing in mDCs, there was a reduction in the TNF-α and IL-10 expression. Also, by suppressing CTLA-4, the amount of IL-12 secretion dramatically rose, while the level of IL-10 remained unchanged. Furthermore, we evaluated the effectiveness of CTLA-4-blocked mDCs on T-cells, and our data showed that these DCs induced T-cell responses. Inhibition of CTLA-4 and loading of BC cell lysate in DCs caused a dramatic enhancement in the growth of CD3+ T cells by the method of autologous co-culture in comparison to DCs loaded with BC cell lysate. We also determined the secretion of cytokines through T cells due to the suppression of CTLA-4 in DCs. Inhibition of CTLA-4 leads to an enhancement in the generation of IL-4 and IFN-γ, cytokines linked to Th2 and Th1, respectively. Nonetheless, the reduction in TGF-β (a marker of Treg) was not changed. In addition, the level of transcription markers related to responses of T cells was assessed. Our result demonstrated that mRNA expression of T-bet (Th1 marker) and GATA3 (Th2 marker) increased dramatically after treatment with CTLA-4-blocked -mDCs, while FOXP3 mRNA (Treg marker) decreased in these cells in CD3+ T cells.

In DC therapy, various studies have attempted to separately block immune checkpoint molecules or load tumor cell lysates on dendritic cells, including CTLA-4. To support our data, Dea Suk Kim et al. indicated thatDC vaccination utilizing DCs comprising tumor antigens can cause tumor inhibition in melanoma patients [49]. Aerts et al., through producing IFN-γ in a mesothelioma-mouse model, showed that the response of T-cells increased after using DCs loaded with tumor lysate, which is in line with our findings [45]. Consistent with our data, the generation and increase of IFN-γ from T cells increased by stimulating cancer cell-loaded DCs [50]. Consistent with our findings, in patients who suffer from ovarian cancer and melanoma, the use of a type of CTLA-4 blocking antibody (MDX-CTLA4) caused promising tumor regression and antitumor immunity [51]. Van Den Bergh and colleagues demonstrated that PD-L1/L2-blocked dendritic cells enhanced TNF-α generation and T-cell proliferation compared to control DCs, confirming our result [46]. Cedric Menard et al.'s findings revealed that blocking CTLA-4 in melanoma patients increases treatment success by increasing memory T cells [52]. Vonderheide RH et al. proved that utilizing antibodies against CTLA-4 (Tremelimumab) increased the activation of CD8+ cells to BC by increasing ICOS+ T cells [53]. Oh, SA and colleagues' findings indicated that inhibition of PD-L1 in dendritic cells improved anticancer responses of CD8+ T-cells [54]. In high stimulatory conditions, such as stimulation with CD3 or exposure to mature autologous DCs, CD4+ T cells obtain inhibitory characteristics, such as expression of FOXP3 genes as well as producing IL-10, IL-4, IL-2, and IFN-γ cytokines [55,56].

Previous studies have attempted to individually load tumor cell lysates onto DCs or silence inhibitory immune checkpoints, such as PD-L1/PD-L2, to develop effective DC-based cell therapy. A study demonstrated that using dendritic cells loaded with human gastric tumor lysates, the expression of dendritic cell surface molecules, including CD80, CD83, CD86, and human leukocyte antigen-DR (HLA -DR) and cytokine production by both DC and DC/T cell cultures (i.e., interleukin IL-12:IL-10 and interferon IFN-γ:IL-4 ratio) increased [57]. Also, in another study on patients with metastatic melanoma, it has been reported that vaccinating these patients using dendritic cells loaded with tumor cell lysis has improved antitumor immunity responses [58]. In addition, GN Shi et al. have shown that using dendritic cells loaded with tumor cell lysates improved antitumor immune responses, increased serum levels of IFN-γ and IL-4, and prevented tumor growth in melanoma mice [59]. Furthermore, in a similar study, it was shown that antigen-loaded dendritic cells stimulated T-cell proliferation and induced the production of high concentrations of IL-12 and IFN-γ but only low levels of IL-10 and cause a strong antitumor immune response in-vivo [60]. Q Peng et al. reported that PD-L1 on dendritic cells limits T-cell responses, and harnessing of PD-L1 in DCs invigorates antitumor immune responses [61]. In another study, in a human breast tumor-bearing SCID model, Ge et al. demonstrated that silencing PD-L1 signaling could enhance DC maturation, proliferation, and IL-12 secretion and potentiate DC primary T-cell responses [62]. In these studies, DCs were loaded individually with tumor lysate or blocked for inhibitory immune checkpoints such as PD-L1/PD-L2; however, there is no study regarding the simultaneous silencing of CTLA-4 and tumor cell lysate loading on DCs to boost the effectiveness of DC-based immunotherapy. In our study, we used the combination of breast tumor lysate and immune checkpoint suppression to increase the efficacy of dendritic cells, and based on our findings, CTLA-4 blockage in DCs loaded with breast cancer cell lysates increases dendritic cell efficacy and autologous T cell activation and cytokine secretion, indicating an appropriate therapeutic technique for the following clinical and preclinical research (Fig. 6).Fig. 6 CTLA-4 molecules suppression in tumor-lysate-pulsed-DCs improves autologous CD3+ T-cell responses. Silencing of CTLA-4 gene in mDCs via using siRNA enhances their stimulatory properties. Thus, Co-culture of CTLA-4-silencing mDCs with autologous CD3+ T cells augments T-cell mediated responses. CTLA-4, Cytotoxic T-lymphocyte-associated protein-4; DC, dendritic cell; mDC: tumor-lysate-pulsed mature dendritic cell; LPS: Lipopolysaccharide; siRNA, small interfering RNA.

Fig. 6

5 Conclusion

In this research, for the first time, we indicated that blocking CTLA-4 enhanced the stimulatory activity and maturation of DCs loaded with breast cancer cell lysate. Additionally, these modified DCs significantly increased the cytokine secretion and activation of co-cultured T-cells compared to normal DCs. Given these results, this anticancer therapeutic approach is looked into more thoroughly in preclinical studies to support this idea.

Data availability statement

The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.

Ethics statement

The study was reviewed and approved by the ethical committee of Tabriz University of Medical Sciences with the approval code of IR.TBZMED.REC.1399.10.46. The patients/participants provided written informed consent to participate in this study.

Funding

This study was supported by the Immunology Research Center, 10.13039/501100004366 Tabriz University of Medical Sciences, Tabriz, Iran (Grant number: 66131 ).

CRediT authorship contribution statement

Mohammad Bakhshivand: Writing – original draft, Methodology, Investigation, Conceptualization. Javad Masoumi: Methodology, Investigation. Farid Ghorbaninezhad: Methodology, Investigation. Leili Aghebati-Maleki: Formal analysis, Conceptualization. Dariush Shanebandi: Formal analysis, Conceptualization. Siamak Sandoghchian Shotorbani: Conceptualization. Farhad Jadidi-Niaragh: Conceptualization. Amir Baghbanzadeh: Writing – review & editing. Nima Hemmat: Writing – review & editing. Elham Baghbani: Visualization. Amir Ghaffari: Writing – review & editing. Behzad Baradaran: Validation, Supervision, Project administration.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
==== Refs
References

1 Bray F. Laversanne M. Weiderpass E. Soerjomataram I. The ever-increasing importance of cancer as a leading cause of premature death worldwide Cancer 127 16 2021 3029 3030 34086348
2 Cause G.D. Age S. Country and by Region, 2000‐2019 2020 World Health Organization
3 Waks A.G. Winer E.P. Breast cancer treatment: a review JAMA 321 3 2019 288 300 30667505
4 Curtis C. Shah S.P. Chin S.F. Turashvili G. Rueda O.M. Dunning M.J. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups Nature 486 7403 2012 346 352 22522925
5 Waterworth A. Introducing the concept of breast cancer stem cells Breast Cancer Res. 6 1 2004 53 54 14680485
6 Gjerdrum C. Tiron C. Høiby T. Stefansson I. Haugen H. Sandal T. Axl is an essential epithelial-to-mesenchymal transition-induced regulator of breast cancer metastasis and patient survival Proceedings of the National Academy of Sciences of the United States of America 107 3 2010 1124 1129 20080645
7 Akram M. Iqbal M. Daniyal M. Khan A.U. Awareness and current knowledge of breast cancer Biol. Res. 50 1 2017 33 28969709
8 Harbeck N. Penault-Llorca F. Cortes J. Gnant M. Houssami N. Poortmans P. Breast cancer Nat. Rev. Dis. Prim. 5 1 2019 66 31548545
9 Nomiri S. Hoshyar R. Chamani E. Rezaei Z. Salmani F. Larki P. Prediction and validation of GUCA2B as the hub-gene in colorectal cancer based on co-expression network analysis: in-silico and in-vivo study Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 147 2022 112691
10 Carter B.W. Bhosale P.R. Yang W.T. Immunotherapy and the role of imaging Cancer 124 14 2018 2906 2922 29671876
11 Sadeghzadeh M. Bornehdeli S. Mohahammadrezakhani H. Abolghasemi M. Poursaei E. Asadi M. Dendritic cell therapy in cancer treatment; the state-of-the-art Life Sci. 254 2020 117580
12 Gardner A. de Mingo Pulido Á. Ruffell B. Dendritic cells and their role in immunotherapy Front. Immunol. 11 2020 924 2020 32508825
13 Shadbad M.A. Hajiasgharzadeh K. Derakhshani A. Silvestris N. Baghbanzadeh A. Racanelli V. From melanoma development to RNA-modified dendritic cell vaccines: highlighting the lessons from the past Front. Immunol. 12 2021 623639
14 Palucka K. Banchereau J. Cancer immunotherapy via dendritic cells Nat. Rev. Cancer 12 4 2012 265 277 22437871
15 Anguille S. Smits E.L. Lion E. van Tendeloo V.F. Berneman Z.N. Clinical use of dendritic cells for cancer therapy Lancet Oncol. 15 7 2014 e257 e267 24872109
16 Vasaturo A. Verdoes M. de Vries J. Torensma R. Figdor C.G. Restoring immunosurveillance by dendritic cell vaccines and manipulation of the tumor microenvironment Immunobiology 220 2 2015 243 248 25466585
17 Melief C.J. van der Burg S.H. Immunotherapy of established (pre)malignant disease by synthetic long peptide vaccines Nat. Rev. Cancer 8 5 2008 351 360 18418403
18 Delirezh N. Moazzeni S.M. Shokri F. Shokrgozar M.A. Atri M. Kokhaei P. Autologous dendritic cells loaded with apoptotic tumor cells induce T cell-mediated immune responses against breast cancer in vitro Cell. Immunol. 257 1–2 2009 23 31 19306994
19 Li Y.L. Wu Y.G. Wang Y.Q. Li Z. Wang R.C. Wang L. Bone marrow-derived dendritic cells pulsed with tumor lysates induce anti-tumor immunity against gastric cancer ex vivo World J. Gastroenterol. 14 46 2008 7127 7132 19084922
20 Veglia F. Gabrilovich D.I. Dendritic cells in cancer: the role revisited Curr. Opin. Immunol. 45 2017 43 51 28192720
21 Laurent S. Carrega P. Saverino D. Piccioli P. Camoriano M. Morabito A. CTLA-4 is expressed by human monocyte-derived dendritic cells and regulates their functions Hum. Immunol. 71 10 2010 934 941 20650297
22 Alegre M.L. Frauwirth K.A. Thompson C.B. T-cell regulation by CD28 and CTLA-4 Nat. Rev. Immunol. 1 3 2001 220 228 11905831
23 Rowshanravan B. Halliday N. Sansom D.M. CTLA-4: a moving target in immunotherapy Blood 131 1 2018 58 67 29118008
24 Wang X.B. Fan Z.Z. Anton D. Vollenhoven A.V. Ni Z.H. Chen X.F. CTLA4 is expressed on mature dendritic cells derived from human monocytes and influences their maturation and antigen presentation BMC Immunol. 12 2011 21 21414236
25 Wang X.B. Fan Z.Z. Anton D. Vollenhoven A.V. Ni Z.H. Chen X.F. CTLA4 is expressed on mature dendritic cells derived from human monocytes and influences their maturation and antigen presentation BMC Immunol. 12 2011 1 8 21194488
26 Chen X. Shao Q. Hao S. Zhao Z. Wang Y. Guo X. CTLA-4 positive breast cancer cells suppress dendritic cells maturation and function Oncotarget 8 8 2017 13703
27 Hodi F.S. O'day S.J. McDermott D.F. Weber R.W. Sosman J.A. Haanen J.B. Improved survival with ipilimumab in patients with metastatic melanoma N. Engl. J. Med. 363 8 2010 711 723 20525992
28 Son C.-H. Bae J.-H. Shin D.-Y. Lee H.-R. Choi Y.-J. Jo W.-S. CTLA-4 blockade enhances antitumor immunity of intratumoral injection of immature dendritic cells into irradiated tumor in a mouse colon cancer model J. Immunother. 37 1 2014 1 7 24316550
29 Jang G.-Y. Kim Y.S. Lee S.E. Lee J.W. Han H.D. Kang T.H. Improvement of DC-based vaccines using adjuvant TLR4-binding 60S acidic ribosomal protein P2 and immune checkpoint inhibitors Cancer Immunol. Immunother. 70 2021 1075 1088 33113002
30 Smolarz B. Nowak A.Z. Romanowicz H. Breast cancer-epidemiology, classification, pathogenesis and treatment (review of literature) Cancers 14 10 2022
31 Łukasiewicz S. Czeczelewski M. Forma A. Baj J. Sitarz R. Stanisławek A. Breast cancer-epidemiology, risk factors, classification, prognostic markers, and current treatment strategies-an updated review Cancers 13 17 2021
32 Yang R. Li Y. Wang H. Qin T. Yin X. Ma X. Therapeutic progress and challenges for triple negative breast cancer: targeted therapy and immunotherapy Molecular biomedicine 3 1 2022 8 35243562
33 Mahmoud R. Ordóñez-Morán P. Allegrucci C. Challenges for triple negative breast cancer treatment: defeating heterogeneity and cancer stemness Cancers 14 17 2022 4280 36077812
34 Chavez K.J. Garimella S.V. Lipkowitz S. Triple negative breast cancer cell lines: one tool in the search for better treatment of triple negative breast cancer Breast Dis. 32 1–2 2010 35 48 21778573
35 Wei H.C. Mathematical modeling of tumor growth: the MCF-7 breast cancer cell line Math. Biosci. Eng. : MBE 16 6 2019 6512 6535 31698574
36 Dendritic cell subsets Macri C. Pang E.S. Patton T. O'Keeffe M. Seminars in Cell & Developmental Biology 2018 Elsevier
37 Reizis B. Plasmacytoid dendritic cells: development, regulation, and function Immunity 50 1 2019 37 50 30650380
38 Sato K. Uto T. Fukaya T. Takagi H. Regulatory dendritic cells Emerging Concepts Targeting Immune Checkpoints in Cancer and Autoimmunity 2017 47 71
39 Zhu S. Yang N. Wu J. Wang X. Wang W. Liu Y.J. Tumor microenvironment-related dendritic cell deficiency: a target to enhance tumor immunotherapy Pharmacol. Res. 159 2020 104980
40 Topalian S.L. Taube J.M. Anders R.A. Pardoll D.M. Mechanism-driven biomarkers to guide immune checkpoint blockade in cancer therapy Nat. Rev. Cancer 16 5 2016 275 287 27079802
41 Emens L.A. Ascierto P.A. Darcy P.K. Demaria S. Eggermont A.M.M. Redmond W.L. Cancer immunotherapy: opportunities and challenges in the rapidly evolving clinical landscape European journal of cancer (Oxford, England : 1990) 81 2017 116 129 28623775
42 Pardoll D.M. The blockade of immune checkpoints in cancer immunotherapy Nat. Rev. Cancer 12 4 2012 252 264 22437870
43 Ovali E. Dikmen T. Sonmez M. Yilmaz M. Unal A. Dalbasti T. Active immunotherapy for cancer patients using tumor lysate pulsed dendritic cell vaccine: a safety study Journal of experimental & clinical cancer research : CR 26 2 2007 209 214 17725100
44 Azadmehr A. Pourfathollah A.A. Amirghofran Z. Hassan Z.M. Moazzeni S.M. Immunotherapy with tumor cell lysate-pulsed CD8α+ dendritic cells modulates intra-tumor and spleen lymphocyte subpopulations Neoplasma 60 5 2013 525 532 23790171
45 Aerts J. de Goeje P.L. Cornelissen R. Kaijen-Lambers M.E.H. Bezemer K. van der Leest C.H. Autologous dendritic cells pulsed with allogeneic tumor cell lysate in mesothelioma: from mouse to human Clin. Cancer Res. : an official journal of the American Association for Cancer Research 24 4 2018 766 776
46 Van den Bergh J.M.J. Smits E. Berneman Z.N. Hutten T.J.A. De Reu H. Van Tendeloo V.F.I. Monocyte-Derived dendritic cells with silenced PD-1 ligands and transpresenting interleukin-15 stimulate strong tumor-reactive T-cell expansion Cancer Immunol. Res. 5 8 2017 710 715 28637876
47 Peng Q. Qiu X. Zhang Z. Zhang S. Zhang Y. Liang Y. PD-L1 on dendritic cells attenuates T cell activation and regulates response to immune checkpoint blockade Nat. Commun. 11 1 2020 4835 32973173
48 Nutt S.L. Chopin M. Transcriptional networks driving dendritic cell differentiation and function Immunity 52 6 2020 942 956 32553180
49 Kim D.S. Kim D.H. Goo B. Cho Y.H. Park J.M. Lee T.H. Immunotherapy of malignant melanoma with tumor lysate-pulsed autologous monocyte-derived dendritic cells Yonsei Med. J. 52 6 2011 990 998 22028165
50 Wu Y.G. Wu G.Z. Wang L. Zhang Y.Y. Li Z. Li D.C. Tumor cell lysate-pulsed dendritic cells induce a T cell response against colon cancer in vitro and in vivo Medical oncology (Northwood, London, England) 27 3 2010 736 742 19669608
51 Hodi F.S. Mihm M.C. Soiffer R.J. Haluska F.G. Butler M. Seiden M.V. Biologic activity of cytotoxic T lymphocyte-associated antigen 4 antibody blockade in previously vaccinated metastatic melanoma and ovarian carcinoma patients Proceedings of the National Academy of Sciences of the United States of America 100 8 2003 4712 4717 12682289
52 Ménard C. Ghiringhelli F. Roux S. Chaput N. Mateus C. Grohmann U. Ctla-4 blockade confers lymphocyte resistance to regulatory T-cells in advanced melanoma: surrogate marker of efficacy of tremelimumab? Clin. Cancer Res. : an official journal of the American Association for Cancer Research 14 16 2008 5242 5249
53 Vonderheide R.H. LoRusso P.M. Khalil M. Gartner E.M. Khaira D. Soulieres D. Tremelimumab in combination with exemestane in patients with advanced breast cancer and treatment-associated modulation of inducible costimulator expression on patient T cells Clin. Cancer Res. : an official journal of the American Association for Cancer Research 16 13 2010 3485 3494
54 Oh S.A. Wu D.C. Cheung J. Navarro A. Xiong H. Cubas R. PD-L1 expression by dendritic cells is a key regulator of T-cell immunity in cancer Nature cancer 1 7 2020 681 691 35122038
55 Cavatorta D.J. Erb H.N. Felippe M.J. Activation-induced FoxP3 expression regulates cytokine production in conventional T cells stimulated with autologous dendritic cells Clin. Vaccine Immunol. : CVI 19 10 2012 1583 1592 22855393
56 Paul A.G. van Kooten P.J. van Eden W. van der Zee R. Highly autoproliferative T cells specific for 60-kDa heat shock protein produce IL-4/IL-10 and IFN-gamma and are protective in adjuvant arthritis Journal of immunology (Baltimore, Md : 1950) 165 12 2000 7270 7277 11120861
57 Kohnepoushi C. Nejati V. Delirezh N. Biparva P. Poly lactic-co-glycolic acid nanoparticles containing human gastric tumor lysates as antigen delivery vehicles for dendritic cell-based antitumor immunotherapy Immunol. Invest. 48 8 2019 794 808 31094258
58 Salcedo M. Bercovici N. Taylor R. Vereecken P. Massicard S. Duriau D. Vaccination of melanoma patients using dendritic cells loaded with an allogeneic tumor cell lysate Cancer Immunol. Immunother. 55 2006 819 829 16187085
59 Shi G.-N. Zhang C.-N. Xu R. Niu J.-F. Song H.-J. Zhang X.-Y. Enhanced antitumor immunity by targeting dendritic cells with tumor cell lysate-loaded chitosan nanoparticles vaccine Biomaterials 113 2017 191 202 27816821
60 Rainone V. Martelli C. Ottobrini L. Biasin M. Borelli M. Lucignani G. Immunological characterization of whole tumour lysate-loaded dendritic cells for cancer immunotherapy PLoS One 11 1 2016 e0146622
61 Peng Q. Qiu X. Zhang Z. Zhang S. Zhang Y. Liang Y. PD-L1 on dendritic cells attenuates T cell activation and regulates response to immune checkpoint blockade Nat. Commun. 11 1 2020 4835 32973173
62 Ge Y. Xi H. Ju S. Zhang X. Blockade of PD-1/PD-L1 immune checkpoint during DC vaccination induces potent protective immunity against breast cancer in hu-SCID mice Cancer letters 336 2 2013 253 259 23523609
