
==== Front
BMC Vet Res
BMC Vet Res
BMC Veterinary Research
1746-6148
BioMed Central London

4281
10.1186/s12917-024-04281-8
Research
Efficacy of zinc nanoparticle supplementation on ruminal environment in lambs
Petrič Daniel 1
Mikulová Klára 12
Bombárová Alexandra 12
Batťányi Dominika 1
Čobanová Klaudia 1
Kopel Pavel 3
Łukomska Anna 4
Pawlak Piotr 5
Sidoruk Pola 6
Kotwica Szymon 6
Cieslak Adam adam.cieslak@up.poznan.pl

6
Váradyová Zora varadyz@saske.sk

1
1 https://ror.org/05kar0v43 grid.424906.d 0000 0000 9858 6214 Centre of Biosciences of Slovak Academy of Sciences, Institute of Animal Physiology, Šoltésovej 4-6, Košice, 040 01 Slovak Republic
2 grid.412971.8 0000 0001 2234 6772 University of Veterinary Medicine and Pharmacy in Košice, Komenského 73, Košice, 041 81 Slovak Republic
3 https://ror.org/04qxnmv42 grid.10979.36 0000 0001 1245 3953 Department of Inorganic Chemistry, Faculty of Science, Palacky University, 17. Listopadu 12, Olomouc, 779 00 Czech Republic
4 https://ror.org/03tth1e03 grid.410688.3 0000 0001 2157 4669 Department of Preclinical Sciences and Infectious Diseases, Poznan University of Life Sciences, Wolynska 33, Poznan, 60-637 Poland
5 https://ror.org/03tth1e03 grid.410688.3 0000 0001 2157 4669 Department of Genetics and Animal Breeding, Poznań University of Life Sciences, Wołynska 33, Poznan, 60-637 Poland
6 https://ror.org/03tth1e03 grid.410688.3 0000 0001 2157 4669 Department of Animal Nutrition, Poznan University of Life Sciences, Wolynska 33, Poznan, 60-637 Poland
21 9 2024
21 9 2024
2024
20 4256 7 2024
11 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Zinc nanoparticles (NPs) are characterized by high bioavailability, small size, and high absorbability. The purpose of this experiment was to determine the effect of Zn-NP feed supplementation on ruminal fermentation, microbiota, and histopathology in lambs. In vitro (24 h), short-term (STE, 28 d), and long-term (LTE, 70 d) experiments were performed. The lambs in STE were fed a basal diet (BD) composed of 350 g/d ground barley and 700 g/d meadow hay (Control), BD enriched with ZnO-NPs (80 mg Zn/kg of diet, ZnO-NPs), and BD enriched with Zn phosphate-based NPs (80 mg Zn/kg of diet, ZnP-NP). The in vitro gas production technique was used in incubated rumen fluid from STE. The lambs in LTE were fed BD (Control), BD enriched with ZnO-NPs (40 mg Zn/kg of diet, ZnO-NP40), BD enriched with ZnO-NPs (80 mg Zn/kg of diet, ZnO-NP80) and BD enriched with ZnO (80 mg Zn/kg of diet, ZnO-80).

Results

After 24 h of incubation, dry matter digestibility was higher for ZnO-NP and ZnP-NP substrates than the control in an in vitro experiment (P < 0.001). The total bacterial population in the STE was lower (P < 0.001) in the ZnP-NP group than in the control and ZnO-NP groups, but the protozoan populations were not significantly different. The ammonia-N concentration in LTE was lowest in the ZnO-NP80 group (P = 0.002), but the activities of carboxymethyl cellulase (P < 0.001) and xylanase (P = 0.002) were higher in the ZnO-NP40, ZnO-NP80, and ZnO-80 groups than in the control group. Morphological observation after STE and LTE revealed histological changes (e.g. inflammation of the epithelium or edema of the connective tissue) in the rumen of lambs.

Conclusion

Zn-NP supplementation up to 70 d improved feed-use efficiency and influenced ammonia-N concentration and activities of hydrolases in the rumen. The active ruminal fermentation affected the health of the ruminal papillae and epithelium in the lambs, regardless of the application's form, dose, or duration. However, by affecting rumen microbial fermentation, Zn-NPs could alter fermentation patterns, thereby increasing the capacity of host rumen epithelial cells to transport short-chain fatty acids.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-024-04281-8.

Keywords

Ruminal microorganisms
Zinc nanoparticles
Fermentation
Ruminal histology
issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Zinc (Zn) plays catalytic, structural, and regulatory roles for enzymes, proteins, and transcription factors and improves immunological functions in ruminants [1, 2]. Zn in the diet of ruminants is usually supplemented as inorganic (e.g. ZnO and ZnSO4) or organic (e.g. complexes of Zn and amino acids) substances. The requirements and recommendations for the content of dietary Zn for ruminants are between 40 and 130 mg/kg dry weight of the complete diet [3], but the bioavailability of Zn depends on the chemical form, content, and interaction with other dietary components [4, 5]. The use of organic sources of Zn in the diet of ruminants improves mineral supply due to the higher bioavailability and lower interference with other minerals because the binding of organic ligands from the organic form of trace elements should be more resistant to interactions in the digestive tract [6–8]. The nutritional effects of Zn sources on ruminant performance could be affected by factors such as the physiological stage and type of the animal, amount of dietary Zn, purity of supplements, presence or absence of stressors, storage of Zn in the body, environment, and season [8, 9]. The trace element Zn can affect the ruminal microbiota by positively influencing ruminal fermentation by directly acting on the activities of microbial enzymes. However, too high a concentration of Zn (adding > 50 μg/mL Zn to in vitro incubation) tends to reduce microbial activity, leading to a sharp drop in ammonia concentrations [2].

Nanoparticle (NP) minerals, due to their smaller size and more accessible transport through the gastrointestinal tract, prolong the residence time of the minerals, thereby ensuring a more uniform distribution and improving absorption into mucosal tissues and cells [10]. In vitro results have indicated that the addition of 20–30 mg ZnO-NP/kg dry matter (DM) to the diet could reduce methane emissions and improve total antioxidant capacity, the production of microbial biomass, digestibility of DM, and the efficiency of ruminal fermentation [11, 12]. Similarly, positive effects of inorganic and organic forms of Zn-NPs on ruminal fermentation, the digestibility of nutrients, antioxidant capacity, growth performance, and immunomodulatory and antibacterial effects have been described in ruminants [13–16]. The use of ZnO-NPs (28 mg Zn/kg DM) can also increase the ferric-reducing antioxidant power in the rumen and blood and decrease the level of blood urea-N in sheep [17]. The majority of studies support the beneficial effects of Zn nanoparticles on animal health [15, 16]. Only some studies have found cytotoxicity and histopathological changes after the administration of Zn-NPs [18, 19].

Currently, there is an urgent need to take advantage of advances in molecular chemistry, such as encapsulation techniques, to avoid the degradation of various additives in the rumen (e.g., trace elements, phytochemicals) and to use their nanostructures to increase the biological activity and availability of main substances that are less soluble in water. The higher antimicrobial activity of nanoparticles is related to their size in the subcellular size range. This allows the penetration of the nanoparticle into the microbial cells and leads to increased activity. Due to their small size and high surface-to-volume ratio, Zn-NPs are characterized by high bioavailability, resulting in their high absorbability and surface reactivity.

Our recent study showed that the ability of Zn dietary supplements (70 mg/kg diet) to affect ruminal microbial fermentation in vitro was not confirmed in vivo in lambs [20]. The rumen is covered by a stratified epithelium consisting of leaf-like papillae that allow the selective uptake of nutrients generated by intraruminal microbial fermentation [21]. These nutrients come mostly from the ruminal fermentation of dietary carbohydrates and are absorbed through the rumen epithelium. Therefore, we hypothesized that different zinc NPs (i.e., ZnO and ZnP) and doses would affect the rumen environment during in vitro and short- and long-term experiments in lambs. The purpose of this experiment was to determine the effect of Zn-NP feed supplementation on rumen fermentation, microbiota, and histopathology in lambs. Our objectives were to determine (1) the 24-h in vitro effect of Zn-NPs on parameters of ruminal fermentation and the protozoan population and (2) the short-term (28 d) and long-term (70 d) effects of Zn-NP supplementation on ruminal fermentation, the microbiota and histopathology in lambs.

Results

Twenty-four-hour in vitro experiment

The in vitro dry matter digestibility (IVDMD) was significantly higher in the ZnO-NP and ZnP-NP groups than in the control (P < 0.001, Table 1). The other parameters (pH, ammonia-N concentration, total gas production, methane concentration, and the concentrations of short-chain fatty acids (SCFAs)) were not significantly affected by the various Zn-NPs (P > 0.05). The total number of ciliates was not affected (P > 0.05). Table 1 Parameters of in vitro ruminal fermentation (mean ± SEM, n = 9)

Parameter	Control	ZnO-NPs	ZnP-NPs	P	
pH	7.19 ± 0.04	7.19 ± 0.03	7.19 ± 0.03	0.990	
IVDMD (g/kg DM)	451 ± 10.1a	546 ± 10.3b	573 ± 6.47b	0.001	
Ammonia-N (mg/L)	113 ± 6.94	113 ± 10.5	120 ± 10.3	0.842	
Total gas production (mL/g DM)	184 ± 6.48	184 ± 6.48	180 ± 6.67	0.858	
Methane (mmoL)	2.61 ± 0.28	2.20 ± 0.22	2.19 ± 0.19	0.372	
Total SCFAs (mM/L)	33.5 ± 1.46	32.1 ± 0.72	32.9 ± 0.99	0.667	
Acetate (mol%)	68.6 ± 0.97	69.2 ± 1.06	68.0 ± 0.99	0.700	
Propionate (mol%)	15.5 ± 0.52	15.3 ± 0.60	15.1 ± 0.51	0.904	
n-Butyrate (mol%)	12.5 ± 0.26	12.2 ± 0.31	12.3 ± 0.29	0.799	
iso-Butyrate (mol%)	0.88 ± 0.11	0.89 ± 0.13	0.82 ± 0.08	0.855	
n-Valerate (mol%)	1.21 ± 0.09	1.21 ± 0.07	1.10 ± 0.06	0.526	
iso-Valerate (mol%)	1.58 ± 0.15	1.62 ± 0.17	1.52 ± 0.14	0.899	
n-Caproate (mol%)	0.15 ± 0.02	0.14 ± 0.01	0.12 ± 0.02	0.320	
Acetate:propionate	4.47 ± 0.22	4.58 ± 0.27	4.62 ± 0.21	0.899	
Total number of protozoa (103/mL)	6.81 ± 3.44	6.48 ± 3.43	6.24 ± 3.84	0.285	
SEM standard error of the mean, NPs nanoparticles, IVDMD in vitro dry matter digestibility, SCFAs short-chain fatty acids

a,b: different letters within a row indicate significant differences at P < 0.05

Short-term effect on ruminal fermentation and the microbiota in lambs

Ammonia-N and total SCFA concentrations and the molar proportions of individual SCFAs did not differ significantly in the treated lambs (P > 0.05, Table 2). pH varied numerically between the groups but did not differ significantly. The total bacterial population was affected (P < 0.001) and was significantly lower in the ZnP-NP group than in the control and ZnO-NP groups. The protozoan population did not differ significantly between the groups (P > 0.05). The specific enzymatic activities of α-amylase, carboxymethyl cellulase (CM-cellulase), and xylanase of the ruminal microorganisms were not affected (P > 0.05). Table 2 Effect of STE on ruminal fermentation and the microbiota (mean ± SD, n = 9)

Parameter	Control	ZnO-NPs	ZnP-NPs	P	
pH	6.82 ± 0.27	6.90 ± 0.06	6.71 ± 0.21	0.540	
Ammonia-N (mg/L)	92.0 ± 21.2	68.4 ± 15.5	61.4 ± 10.1	0.130	
Total SCFAs (mM/L)	56.9 ± 16.5	40.9 ± 4.28	53.7 ± 10.1	0.272	
Acetate (mol%)	72.3 ± 2.79	70.4 ± 0.20	69.3 ± 3.14	0.374	
Propionate (mol%)	13.3 ± 1.09	14.8 ± 1.34	16.8 ± 4.27	0.346	
n-Butyrate (mol%)	11.6 ± 0.74	11.4 ± 1.01	11.0 ± 1.72	0.808	
iso-Butyrate (mol%)	0.78 ± 0.35	1.08 ± 0.29	0.85 ± 0.23	0.471	
n-Valerate (mol%)	0.63 ± 0.12	0.67 ± 0.08	0.81 ± 0.28	0.465	
iso-Valerate (mol%)	1.11 ± 0.50	1.32 ± 0.25	1.01 ± 0.14	0.545	
Caproate (mol%)	0.25 ± 0.05	0.22 ± 0.05	0.30 ± 0.06	0.240	
Acetate:propionate	5.46 ± 0.69	4.77 ± 0.43	4.32 ± 1.16	0.301	
Total bacteria (108/mL)	2.69 ± 0.23b	2.63 ± 0.45b	2.35 ± 0.34a	0.001	
Archaea (107/mL)	7.75 ± 0.20	7.66 ± 0.24	7.93 ± 2.38	0.867	
Methanobacteriales (107/mL)	2.76 ± 0.50	2.67 ± 0.51	2.77 ± 0.52	0.595	
Methanomicrobiales (107/mL)	2.67 ± 0.53	2.77 ± 0.52	2.78 ± 0.53	0.562	
Total protozoa (105/g wRC)	29.0 ± 2.01	27.4 ± 1.67	27.0 ± 1.96	0.060	
Holotricha (103/g wRC)	0.57 ± 0.21	0.74 ± 0.34	0.61 ± 0.27	0.352	
Entodiniomorpha (103/g wRC)	28.2 ± 3.42	26.8 ± 7.10	26.0 ± 4.45	0.457	
Specific enzymatic activities of the ruminal microorganisms (µcat/g protein)	
α-Amylase	1.66 ± 0.80	1.23 ± 0.63	1.86 ± 0.57	0.126	
Carboxymethyl cellulase	1.13 ± 0.43	1.45 ± 0.99	1.02 ± 0.55	0.302	
Xylanase	179 ± 24.2	189 ± 26.2	202 ± 35.8	0.144	
STE short-term experiment, NPs nanoparticles, wRC count per gram wet ruminal content, SCFAs short-chain fatty acids. Different letters within a row indicate significant differences at P < 0.05

Short-term effect on ruminal histology

Medium-sized warts, connective-tissue edema, and organisms with the morphology of Balantidium coli were observed (P = 0.032, Table 3). The epithelial keratinocyte layer differed mainly between the ZnO-NP and ZnP-NP groups (P = 0.008). The connective tissue of the papillae was inflamed in all sheep. Damage to homogeneous papillae and erosion of the hyperplastic stratum corneum did not differ significantly between the groups (P > 0.05). Table 3 Effect of STE on the histopathology of ruminal tissues (mean ± SD, n = 9)

Parameter (%)	Control	ZnO-NPs	ZnP-NPs	P	
Medium-sized warts	89 ± 33.3	100 ± 0.0	100 ± 0.0	0.032	
Homogenous papillae	89 ± 33.3	33 ± 50.0	89 ± 33.3	0.282	
Inflammation of connective tissue of papillae	100 ± 0.0	100 ± 0.0	100 ± 0.0	–	
Connective-tissue edema	100 ± 0.0	89 ± 33.3	100 ± 0.0	0.032	
Epithelium (keratinocyte layer)	89 ± 33.3ab	33 ± 50.0a	100 ± 0.0b	0.008	
Erosion of hyperplastic stratum corneum	33 ± 50.0	0 ± 0.0	33 ± 50.0	0.157	
Other (Balantidium coli)	100 ± 0.0	89 ± 33.3	100 ± 0.0	0.032	
STE short-term experiment, NPs nanoparticles, SD standard deviation

a,b: different letters within a row indicate significant differences at P < 0.05

Long-term effect on ruminal fermentation and the microbiota

The concentration of ammonia-N was significantly lower in the ZnO-NP80 group than the other groups (P = 0.002), and the molar proportion of n-valerate was significantly lower in the ZnO-NP80 group than the control group (P = 0.015, Table 4). The molar proportion of caproate differed significantly between the ZnO-NP40 and ZnO-80 groups (P = 0.030). The activities of CM-cellulase (P < 0.001) and xylanase (P = 0.002) were significantly higher in all three experimental groups than in the control group. The protozoan population did not differ significantly between the groups (P > 0.05). The populations of Butyrivibrio proteoclasticus, B. fibrisolvens, Fibrobacter succinogenes, Prevotella spp., Ruminococcus albus, R. flavefaciens, Streptococcus bovis and Total methanogens were not affected (P > 0.05, Fig. 1). Table 4 Effect of LTE on ruminal fermentation and microbiota in lambs (mean ± SD, n = 7)

Parameter	Control	ZnO-NP40	ZnO-NP80	ZnO-80	P	
pH	6.41 ± 0.34	6.50 ± 0.44	6.37 ± 0.29	6.33 ± 0.22	0.124	
Ammonia-N (mg/L)	70.1 ± 22.0b	54.5 ± 28.7b	27.4 ± 11.0a	69.1 ± 29.5b	0.002	
Total SCFAs (mM/L)	61.1 ± 11.3	50.1 ± 14.5	52.3 ± 6.60	51.4 ± 4.49	0.204	
Acetate (mol%)	67.6 ± 3.19	67.8 ± 4.24	68.6 ± 2.09	68.8 ± 2.47	0.875	
Propionate (mol%)	17.0 ± 1.44	17.9 ± 2.32	17.4 ± 1.78	17.4 ± 2.34	0.889	
n-Butyrate (mol%)	13.2 ± 1.62	12.1 ± 2.64	12.2 ± 1.48	11.8 ± 0.618	0.534	
iso-Butyrate (mol%)	0.52 ± 0.41	0.54 ± 0.23	0.41 ± 0.14	0.31 ± 0.10	0.376	
n-Valerate (mol%)	1.22 ± 0.16b	1.11 ± 0.11ab	0.92 ± 0.12a	1.06 ± 0.23ab	0.015	
iso-Valerate (mol%)	0.39 ± 0.26	0.57 ± 0.17	0.39 ± 0.27	0.51 ± 0.34	0.491	
Caproate (mol%)	0.11 ± 0.10ab	0.06 ± 0.06a	0.10 ± 0.04ab	0.18 ± 0.04b	0.030	
Acetate:propionate	4.01 ± 0.46	3.86 ± 0.63	3.98 ± 0.51	4.02 ± 0.61	0.954	
Total protozoa (105/g wRC)	20.9 ± 3.56	17.5 ± 5.72	20.7 ± 5.19	17.9 ± 5.82	0.175	
Specific enzymatic activities of the ruminal microorganisms (µcat/g protein)	
α-Amylase	1.10 ± 0.85	1.75 ± 1.48	1.24 ± 0.94	0.92 ± 0.56	0.210	
Carboxymethyl cellulase	0.42 ± 0.22a	1.06 ± 0.37b	0.83 ± 0.20b	0.80 ± 0.32b	0.001	
Xylanase	37.2 ± 8.90a	67.4 ± 17.2b	64.8 ± 15.6b	58.8 ± 26.3b	0.002	
LTE long-term experiment, SCFAs short-chain fatty acids, wRC count per gram wet ruminal content, NPs nanoparticles, SD standard deviation

a,b: different letters within a row indicate significant differences at P < 0.05

Fig. 1 Effect of the control and experimental groups on the relative abundance of the 16S rRNA gene (expressed relative to the total abundance of bacterial genes) of the ruminal bacterial population for Butyrivibrio proteoclasticus, Butyrivibrio fibrisolvens, Fibrobacter succinogenes, Prevotella spp., Ruminococcus albus, Ruminococcus flavefaciens, Streptococcus bovis, and Total methanogens. Data are described as specific gene copy number per 16 s rRNA gene copy number ± SEM (P > 0.05)

Effects of long-term supplementation of Zn on ruminal histology

The size of the ruminal papillae varied in all sheep (i.e. short and thick, long and thin, and medium length and width, Table 5). The epithelial keratinocyte layer differed mainly between the ZnO-NP40 and ZnO-NP80 groups (P = 0.038), but connective-tissue edema occurred primarily in the control group (P = 0.009). The flat and thin or rough layer of desquamating and ballooning keratinocytes particularly characterized the histopathological changes to the ruminal epithelium (i.e., epithelium and lamina propria inflammation with infiltrates of inflammatory cells, mainly lymphocytes). Organisms with B. coli morphology were present in almost all groups. The histological changes are shown in Fig. 2a and b. Table 5 Effect of LTE on histopathology of ruminal tissues (means ± SD, n = 7)

Histological change (%)	Control	ZnO-NP40	ZnO-NP80	ZnO-80	P	
Size of ruminal papillae	100 ± 0.0	100 ± 0.0	100 ± 0.0	100 ± 0.0	-	
Epithelium (keratinocyte layer)	57 ± 53.5ab	100 ± 0.0b	29 ± 48.8a	43 ± 53.5ab	0.038	
Inflammation of lamina propria	100 ± 0.0	100 ± 0.0	100 ± 0.0	100 ± 0.0	-	
Epithelial inflammation	43 ± 53.5	71 ± 48.8	86 ± 37.8	86 ± 37.8	0.264	
Connective-tissue edema	100 ± 0.0b	86 ± 37.8ab	29 ± 48.8a	43 ± 53.5a	0.009	
Other (Balantidium coli)	86 ± 37.8	100 ± 0.0	100 ± 0.0	100 ± 0.0	0.410	
LTE long-term experiment, NPs nanoparticles, SD standard deviation. Different letters within a row indicate significant differences at P < 0.05

Fig. 2 a Histological changes to ruminal tissue in LTE: Ruminal papillae with the desquamation of keratinocytes. b Histological changes to ruminal tissue in LTE: Focal aggregates of inflammatory cells with a predominance of neutrophils in the epithelium of the ruminal papilla

Discussion

Our previous in vitro results indicated that the fermentation of 25 mg of organic Zn in the ruminal fluid collected from lambs fed for 70 d with a diet containing Zn at a dose of 70 mg/kg DM decreased gas production and IVDMD [20]. The present study using a technique of 24-h in vitro gas production (IVGPT), however, did not detect any adverse effects of the Zn-NPs on ruminal fermentation or the protozoan population. Instead, microbial populations and parameters of ruminant fermentation could probably be beneficially modified by Zn-NP supplementation [22], and therefore IVDMD was increased. Our findings are similar to those observed with diets containing 20–60 mg/kg ZnO-NPs using 24-h IVGPT [23]. However, inconsistent with the present study, some previous studies reported that a dose of 20–80 mg/kg of ZnO-NP DM was sufficient to improve ruminal fermentation and reduce the concentration of methane released in vitro [23, 24]. In vitro measurements after 24 h have indicated that methane concentration and total protozoan population tend to decrease more in incubations with Zn-NPs than with other sources of Zn (e.g. ZnO) [23], consistent with our results. The toxicity of the ZnO-NPs caused by dissolved metal ions on ciliated ruminal protozoa, however, probably decreases after 24 h of exposure due to protozoan adaptation [25]. The microbial population and the concentration of fermentation gases, however, probably decrease greatly after 72 h of in vitro incubation with higher doses of ZnO-NPs (500–1000 mg/kg) [26]. The dietary substrates containing ZnO-NPs and ZnP-NPs at doses of 80 mg/kg DM in our experiment, however, had the potential to increase substrate IVDMD. Other studies have also described a positive effect on the increase in IVDMD by supplementing diets with ZnO-NPs [12, 27], consistent with our results. Supplementation with ZnO-NPs at the dose of 30–40 mg Zn/kg DM increased DM digestibility in the rumen [28] as ZnO-NPs have better bioavailability, enhance microbial population and increase substrate breakdown thereby improving dry matter digestibility of feedstuffs [29]. The dose of 90–180 mg/kg DM, however, gradually decreased IVDMD, probably due to the antibacterial activity of the ZnO-NPs and the suppression of the growth of the ruminal microbial population [12]. The effect on digestibility and the microbiota clearly depended mainly on the dose of Zn-NPs.

In vitro measurements can predict the parameters of ruminal fermentation with reasonable accuracy, but we needed to identify the effect of the Zn-NPs in the rumen in vivo. STE with Zn-NP supplementation did not affect the parameters of fermentation or specific microbial enzymatic activity. The total bacterial population decreased, and the protozoan population tended to decrease mainly with dietary ZnP-NP supplementation, despite the unchanged fermentation profile. Likewise, in an in vivo study, ZnP-NPs may directly affect bacterial activity in the rumen during short-term supplementation while the group with ZnO-NPs showed no effect on bacterial population. ZnP-NPs could probably alter microbial populations due to adaptation to a diet without adverse effects on fermentation [23]. Moreover, in the case of protozoa, both ZnP-NPs and ZnO-NPs showed no effect on their population. ZnP-NP supplementation can have a short-term effect on the growth of bacteria in the rumen, with subsequent impacts on the formation of microbial proteins and the use of energy. The production of proteins by ruminal microbes, however, is probably inefficient, mostly due to maintenance functions, decreasing bacterial population [12], and the accumulation of reserve saccharides by protozoa [30].

The optimal level of ammonia-N in the rumen (20–100 mg/L) [31] was not exceeded in LTE. Ammonia-N is normally the most abundant source of N required for microbial growth, and its lower concentration in the rumen may be due to the higher consumption of ammonia-N by microorganisms, the presence of low-level rumen degradable protein, and optimum pH in the rumen [2]. The decrease in ammonia-N concentration in the ZnO-NP80 group was not correlated with the significant changes to the ruminal microbiota, although its decrease may have been due to the higher use of ammonia-N by the microbial population. If ruminal microorganisms have access to a readily available source of energy, they increase their synthesis of proteins using amino acids as a microbial source of energy [32]. The lack of significant differences in the microbiotas in the experimental groups may have been due to the different forms of Zn used than in our previous study [20]. The relatively high standard deviations of the means of the bacteria in the experimental groups indicated a potentially different effect between lambs, suggesting that different forms and doses could also have different antibacterial and anti-methanogenic effects and may promote fermentation in the rumen to reduce the concentration of methane released in the long term [24] (e.g. by Total methanogens, Fig. 1). The LTE diets containing ZnO-NPs and ZnO did not significantly affect total SCFA concentration or the microbiotas in the rumens of the lambs. Similarly, the metabolism of dietary saccharides was probably unaffected; the concentrations of individual SCFAs changed only slightly (a slight effect on n-valerate and caproate). Zn in the diet, however, can substantially affect ruminal fermentation [33, 34], although probably weakly at low doses (20–70 mg Zn/kg diet) [35, 36]. Higher doses (250–1100 mg Zn/kg diet) can affect the population of ruminal protozoa and protein degradation [37]. ZnO supplementation at a dose of 10–50 mg Zn/kg DM increased the concentration of total SCFAs, despite the likely low solubility of ZnO in the rumen [38]. Only a small part of the Zn supplement is probably solubilized during fermentation; ZnO is poorly assimilated by ruminal bacteria, and ruminal protozoa preferably assimilate highly soluble Zn [38], which may indicate a shift in saccharide fermentation by the protozoal population at the expense of bacterial fermenters [39], which our experiment did not detect.

Finally, supplementation with ZnO-NPs (30–40 mg Zn/kg DM) in the pre- and post-partum periods in sheep can increase the total SCFA concentration in the rumen [28]. This finding may also indicate an improvement in the activities of digestive enzymes, especially protease, amylase, and lipase, leading to higher starch digestibility and thus higher SCFA concentrations [40]. Too much or too little Zn in the diet of ruminants, however, probably has the opposite effect [41, 42]. LTE in our study did not affect the ruminal microbiota, unlike STE. This finding probably indicates a gradual adaptation of the microbiota to the zinc diets during LTE [43]. Ruminal microbiotas, however, have different sensitivities to Zn, and the currently recommended levels of Zn intake are defined to meet the needs of the animal, not the requirements of the ruminal microbiota [23, 38]. Our results suggest that the effects of Zn on ruminal fermentation and the microbiota also strongly depend on the duration of Zn supplementation. The different forms of Zn applied, such as NPs or ZnO, had very similar effects during LTE. The lack of an apparent inhibition or improvement of the parameters of ruminal fermentation, though, suggests that the ruminal microbiota may have too low a requirement for Zn supplementation [38]. The increased specific enzymatic activities of the ruminal microorganisms, especially cellulase and xylanase, however, indicated that Zn is incorporated into enzymes throughout the body and is crucial for most metabolic processes in ruminants [44]. Zn is therefore involved in a wide range of physiological processes, such as the digestion of nutrients, which can be affected by long-term Zn supplementation. The ruminal microbiotas of the Zn groups in our experiment were probably more than the control associated with cellulase and xylanase activities that accelerated biodegradation during the ruminal processing of substrates [45]. Zn likely supports the efficient digestion of complex substrates in the rumen, which requires the coordinated action of many enzymes that can act individually and synergistically, or individual enzymes could assemble into multienzyme complexes [46].

The ruminal papillae in STE were homogeneous and associated with inflammation of the connective tissue in almost all lambs. The keratinocyte layer of the epithelium was badly damaged in the ZnP-NP group, which may have negatively affected the epithelium because the outer layer of keratinized cells of the ruminal epithelium is an absorption barrier for the transport of molecules from the rumen to the blood [47]. Almost all lambs in STE had connective-tissue edema, which in LTE was mainly in the control group. The ruminal papillae in LTE were short and thick, long and thin, medium long, and wide, but inflammation of the lamina propria was present in all lambs. Other damage (e.g. inflammation and connective-tissue edema) was probably caused by dystrophic epithelial changes that led to cellular degeneration and the infiltration of leukocytes. These lesions can affect absorption capacity and stimulate inflammation and secondary ruminal infection by the resident microbial population [48]. Butyrate stimulates the development of ruminal papillae [49], but the molar proportion of butyrate was not affected in our experiments. The growth and development of the ruminal papillae therefore probably depended mainly on the type of feed consumed. However, the end products of ruminal fermentation such as butyrate production rather than the nature of the feed, stimulate the development of ruminal papillae [50]. The inconsistent results for valerate in LTE may therefore indicate increased surface area and epithelial thickness associated with an increased absorptive capacity for valerate with diffuse uptake [51]. SCFAs in the rumen are absorbed through the ruminal epithelium, and the rate of absorption is primarily influenced by their concentration, the surface area of the papillae in the rumen, and the availability of transport proteins [52, 53]. SCFAs, as products of ruminal fermentation, generally induce morphofunctional changes to the ruminal papillae [54] and probably moderate the effect on the keratinocyte layer of the epithelium and connective-tissue edema in some lambs, but further studies are needed.

Conclusion

Our research pointed out the potential of the Zn-NP supplementation to improve feed-use efficiency in the LTE up to 70 d. The ability of long-term Zn-NP supplementation to affect ruminal fermentation parameters was supported by its effect on ammonia-N concentration and microbial hydrolase activity. The active microbial fermentation in the rumen was likely to affect the health of the ruminal papillae and epithelium in the lambs, regardless of the application's form, dose, or duration. However, by affecting rumen microbial fermentation, Zn-NPs could alter fermentation patterns, thereby increasing the capacity of host rumen epithelial cells to transport SCFAs.

Methods

Ethical study

This study was conducted following the guidelines of the Declaration of Helsinki and national legislation in the Slovak Republic (G.R. 377/2012; Law 39/2007) for the care and use of research animals. The experimental protocol was approved by the Ethical Committee of the Institute of Animal Physiology, Centre of Biosciences of the Slovak Academy of Sciences on 07 March 2023 (protocol code 1046/2023).

Animals, diets, and design of STE

Twenty-seven lambs (5–6-month-old rams, Improved Valachian) were housed in separate pens for 30 days for acclimatization with free access to water. The number of animals used in the experiment was assigned according to VICH GL13 guidelines proposed by the European Medicines Agency. The lambs were obtained from a commercial farm (PD Ružín–Ružín farm, Kysak, Slovakia) and were housed at the Research Centre of the Institute of Animal Physiology of Centre of Biosciences of Slovak Academy of Sciences. No criteria for inclusion and exclusion of animals were used during the experiment. The confounders were not controlled. After acclimatization the lambs with body weights of 21.2 ± 1.1 kg (mean ± standard error of the mean) were fed an experimental diet in three groups (n = 9/group): (a) a basal diet (BD) composed of 350 g/d ground barley and 700 g/d meadow hay, (b) BD enriched with ZnO-NPs (80 mg Zn/kg of diet, ZnO-NPs) and (c) BD enriched with Zn phosphate-based NPs (80 mg Zn/kg of diet, ZnP-NP). The ZnO-NPs were a commercial product (zinc oxide nanopowder, < 100 nm particle size, Sigma-Aldrich, Saint-Louis, USA). The ZnP-NPs were chemically synthesized (Department of Inorganic Chemistry, Palacky University, Olomouc, Czech Republic) following the published method described in detail [55]. ZnP-NPs were characterized (particle size and shape, structural analysis) by scanning electron microscopy, transmission electron microscopy, and X-ray diffraction (unpublished data). The study design is experimental and includes compared groups of animals including control groups. For the treatment groups, aliquots of zinc supplements were mixed directly with the feed concentrate (ground barley) for each meal to provide an additional zinc diet. The experimental period was 28 d and the lambs were euthanized following the rules of the European Commission (Council Regulation 1099/2009) [56]. Twenty-seven lambs were killed over three consecutive days and the rumen fluid for in vitro experiments was pooled. All lambs with an average body weight of 24 kg were euthanized by using an overdose of 96 mg/kg of pentobarbital (Dolethal, Vetoquinol, UK, Ltd.) on 28 d of the experiment (abattoir of the Centre of Biosciences of SAS, Institute of Animal Physiology, Košice, Slovakia, No. SK U 06018). Pentobarbital overdose had a negligible effect on the estimated parameters of the ruminal environment in lambs. The carcasses were sent to the Department of Pathological Anatomy and Pathological Physiology, University of Veterinary Medicine and Pharmacy in Košice in the Slovak Republic.

Twenty-four-hour in vitro experiment

The Zn-NPs were incubated in vitro in the ruminal fluid (RF) to assess their effect on the parameters of ruminal fermentation (pH, ammonia-N concentration, gas production, methane concentration, and SCFA concentrations). RF was collected from the ruminal contents of slaughtered lambs at the end of STE. RF was obtained before morning feeding, strained through four layers of gauze into thermal flasks, and immediately transported to the laboratory to exclude external factors that may affect the estimated parameters. RF was mixed at a 1:2 ratio with McDougallʼs buffer [57], and purged with CO2. The RF inoculum was dispensed in volumes of 35 mL into serum bottles (120 mL) containing 0.25 g of substrate. Ground barley without (Control) or with Zn-NPs (80 mg Zn/kg DM, ZnO-NPs or ZnP-NPs) and meadow hay (350:700, w/w) were used as substrates for the in vitro experiment and fermented with buffered RF. ZnO-NPs (zinc oxide nanopowder, < 100 nm particle size, Sigma-Aldrich, Saint-Louis, USA) and ZnP-NPs (Department of Inorganic Chemistry, Palacky University, Olomouc, Czech Republic) were used. The serum bottles with buffered ruminal fluid and substrate were filled with CO2, closed with rubber stoppers and sealed with aluminum cups. Then the bottles were incubated in an incubator (Galaxy 170R, Eppendorf North America Inc., Hauppauge, NY) for 24 h at a temperature of 39 ˚C in an anaerobic condition with periodical mixing of the contents. The experimental design used the in vitro gas production technique as a relatively simple method to evaluate feedstuffs in ruminants. Three replicates (three incubation serum bottles) were prepared for each substrate (i.e., Control, ZnO-NPs, ZnP-NPs), and the experiment was conducted three times within three consecutive days (n = 3 × 3). Three replicate bottles were also used for the blank (ruminal inoculum, no substrate).

Animals, diets, and design of LTE

Twenty-eight male lambs (4 months of age, Improved Valachian) were housed in common stalls for 30 days for acclimatization with free access to water. The number of animals used in the experiment was assigned according to VICH GL13 guidelines proposed by the European Medicines Agency. The lambs were obtained from a commercial farm (PD Oľšavica-Brutovce, Slovakia) and were housed at the Research Centre of the Institute of Animal Physiology of the Centre of Biosciences of Slovak Academy of Sciences. No criteria for inclusion and exclusion of animals were used during the experiment and the confounders were not controlled. After acclimatization the lambs (body weights of 20.19 ± 0.50 kg) were fed an experimental diet in four groups (n = 7/group): (a) BD composed of 350 g/d ground barley and 700 g/d meadow hay, (b) BD enriched with ZnO-NP (40 mg Zn/kg of diet, ZnO-NP40, SkySpring Nanomaterials, Inc., Houston, USA), (c) BD enriched with ZnO-NPs (80 mg Zn/kg of diet, ZnO-NP80, SkySpring Nanomaterials, Inc., Houston, USA), and (d) BD enriched with ZnO (80 mg Zn/kg of diet, ZnO-80, Sigma-Aldrich, Saint-Louis, USA). The experimental period of LTE was 70 d. The study design was experimental and included compared groups of animals including control groups. For the treatment groups, aliquots of zinc supplements were mixed directly with the feed concentrate (ground barley) for each meal to provide an additional zinc diet. All sheep with an average body weight of 35 kg were euthanized using an overdose of 140 mg/kg of pentobarbital (Dolethal, Vetoquinol, UK, Ltd.) at the end of the experiment at the abattoir as described in STE. Pentobarbital overdose had a negligible effect on the estimated parameters of the ruminal environment in lambs. The carcasses were sent to the Department of Pathological Anatomy and Pathological Physiology, University of Veterinary Medicine and Pharmacy in Košice in the Slovak Republic.

Measurements and chemical analysis

The dietary substrates were analyzed in triplicate using standard procedures [58]. The DM content was obtained by drying the samples at 105 °C for at least 24 h in an oven (method no. 930.15). The total ash content of the samples was determined by ashing overnight at 550 °C (method no. 942.05) in a muffle furnace. Nitrogen content (method no. 968.06) was determined using a FLASH 4000 analyzer (Thermo Fisher Scientific, Cambridge, UK). Crude-protein (CP) content was calculated by multiplying the total N content by 6.25 (method no. 990.03). The acid-detergent and neutral-detergent fiber contents were analyzed as described previously [59] using an ANKOM 2000 analyzer (ANKOM Technology, Macedon, USA) with heat-stable α-amylase. The chemical compositions of the dietary substrates are provided in Table 6. Table 6 Chemical composition of the dietary substrates (g/kg DM)

	STE	LTE	
Substrate	MH	BG	ZnO-NPs	ZnP-NPs	MH	BG	ZnO-NP40	ZnO-NP80	ZnO-80	
DM (g/kg)	884	879	882	881	896	880	879	877	878	
NDF	691	266	275	265	716	327	292	305	307	
ADF	365	85	90	91	351	103	108	109	127	
CP	44	130	124	125	41	112	114	113	106	
N	10	21	20	20	7	18	18	18	17	
Ash	43	38	39	41	52	29	34	34	37	
STE short-term experiment, LTE long-term experiment, MH meadow hay, BG ground barley, NPs nanoparticles, DM dry matter, NDF neutral-detergent fiber, ADF acidic-detergent fiber, CP crude protein, N nitrogen. The aliquots of the Zn supplements were directly mixed with the BG for each meal to provide a Zn diet (i.e., ZnO-NPs, ZnP-NPs, ZnO-NP40, ZnO-NP80 and ZnO-80, respectively)

pH was measured using a pH meter (InoLab pH Level 1, Weilheim, Germany). IVDMD was estimated as the difference in substrate weights before and after incubation [60]. The concentration of ammonia-N in the ruminal fluid was determined using the phenol-hypochlorite method [61]. The volume of accumulated gas/pressure released by IVGPT after 24 h of in vitro fermentation was determined using a mechanical manometer fitted to a transducer (Premagas, Stará Turá, Slovak Republic) [62].

The SCFA and methane concentrations were analyzed using a Clarus 500 gas chromatograph (Perkin Elmer, Inc., Shelton, USA) [63]. The chromatograph was equipped with a flame ionization detection system for estimating the SCFA and methane concentrations. The SCFAs were separated using a stainless-steel packed column (2 m × 2 mm i.d.) with a phase composition of 10% Carbowax 20 M-TPA + 1% H3PO4 on a 100/120 Supelcoport support (Supelco, Bellefonte, USA). The methane concentration was analyzed using a 10% Squalane Chrom P mesh side 80/100 packed column, 2 m × 2 mm i.d. (Supelco, Bellefonte, USA), and a peak was observed at 0.33 min. The column oven temperature was programmed at 150 °C. Injector and detector temperatures were programmed at 230 °C. The rates of gas flow were 40 mL/min for hydrogen and 400 mL/min for air in both analyses. The average flow of nitrogen carrier gas was set at 36 psi for SCFA and 14 psi for methane.

Specific enzymatic activities

The specific enzymatic activities of the ruminal microorganisms were determined by preparing a cell-free homogenate from the ruminal content of the lambs [64]. Activity was expressed in units of specific catalytic activity (cat/g of protein). The activity of α-amylase was determined using 0.2% (w/v) maize starch (Merck KGaA, Darmstadt, Germany) resuspended in 0.05 M phosphate-citrate buffer. The activity of CM-cellulase was determined using 1% (w/v) carboxymethyl cellulose (Merck KGaA, Darmstadt, Germany). Xylanase activity was determined using 1% (w/v) Beechwood xylan (Merck KGaA, Darmstadt, Germany) resuspended in the same phosphate-citrate buffer. Enzymatic activities were determined by measuring the amount of reducing sugars released from cell-free samples of ruminal homogenate after 15 min at 39 °C.

Microbial analyses and quantification

Samples for counting ciliate protozoa (i.e., in vitro, STE, LTE) were fixed in equal volumes of 8% formaldehyde, and the protozoa were counted and identified microscopically [65]. In the STE experiment total bacteria, Archaea, Methanobacteriales, and Methanomicrobiales were quantified using fluorescence in situ hybridization [66]. In the LTE study, samples were isolated by PureLink Microbiome DNA Purification Kit (Invitrogen, Thermo Fisher) according to manufacturer protocol. The concentration of DNA was measured using Nanodrop 1C. Quantitative PCR was performed on Roche Light Cycler 480 II using standard curves for absolute quantification of specific taxa and total bacteria by 16S subunit gene amplification. The primers used are summarized in Table 7. Data are presented as a copy number of specific amplicon per total bacteria in the sample. Data are described as specific gene copy numbers per 16 s rRNA gene copy number ± SEM. Table 7 The sequences of primers specific to the analyzed bacteria species

Species	Primer sequences	Reference	
Ruminococcus flavefaciens	F – 5’ CGAACGGAGATAATTTGAGTTTACTTAGG 3’

R – 5’ CGGTCTCTGTATGTTATGAGGTATTACC 3’

	[67]	
Fibrobacter succinogenes	F – 5’ GTTCGGAATTACTGGGCGTAAA 3’

R –5’ CGCCTGCCCCTGAACTATC 3’

	[68]	
Streptococcus bovis	F – 5’ TTCCTAGAGATAGGAAGTTTCTTCGG 3’

R – 5’ ATGATGGCAACTAACAATAGGGGT 3’

	[69]	
Butyrivibrio proteoclasticus	F – 5’ TCCTAGTGTAGCGGTGAAATG 3’

R –5’ TTAGCGACGGCACTGAATGCCTA 3’

	[70]	
Ruminococcus albus	F – 5’ CCCTAAAAGCAGTCTTAGTTCG 3’

R – 5’ CCTCCTTGCGGTTAGAACA 3’

	[71]	
Butyrivibrio fibrisolvens	F – 5’ ACACACCGCCCGTCACA 3’

R – 5’ TCCTTACGGTTGGGTCACAGA 3’

	[72]	
Prevotella spp.	F – 5’ GAAGGTCCCCCACATTG 3’

R – 5’ CAATCGGAGTTCTTCGTG 3’

	[69]	
Total methanogens	F – 5’ GAGGAAGGAGTGGACGACGGTA 3’	[73]	
R – 5’ ACGGGCGGTGTGTGCAAG 3’	
16 S V4	F – 5’ TATGGTAATTGTGTGNCAGCMGCCGCGGTAA 3’	[74]	
R – 5’ AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT 3’	

Histology

Histological examinations were performed on samples of fresh ruminal tissues washed in a phosphate buffer (0.1 M, pH 7.4), put in plastic containers, and fixed in a 10% buffered formalin solution as pieces of tissue spread on flat polystyrene [20]. The fixed material was processed using a series of reagents and embedded in Paraplast PLUS paraffin blocks (Leica, Buffalo Grove, USA), which were then cut using a rotary microtome into Sects. 3.5 μm thick. Slides with a paraffin section were automatically stained with hematoxylin and eosin (Varistain Gemini Thermo Scientific, Runcorn, UK). An Axio Lab. 1 microscope (Carl Zeiss, Jena, Germany) equipped with a Zeiss Axiocam ERc5s digital camera and Imager.M2 Axio (Carl Zeiss, Jena, Germany) was used for histological evaluation. Photographs were analyzed and recorded using ZEN 2.3 (blue edition) software (Carl Zeiss Microscopy GmbH, 2011).

Statistical analysis

The data were analyzed using one-way ANOVAs (GraphPad Prism 9.2.0 (332) 2021; GraphPad Software, Inc., San Diego, USA). Individual differences were determined using Tukey’s multiple-comparison post hoc test and were considered to be significant at P < 0.05. The microbial population data were evaluated using the nonparametric Kruskal–Wallis method.

Supplementary Information

Supplementary Material 1.

Abbreviations

ADF Acid detergent fiber

ANOVA Analysis of variance

BD Basal diet

CP Crude protein

CM-cellulase Carboxymethyl cellulose

DM Dry matter

IVDMD in vitro Dry matter digestibility

IVGPT in vitro Gas production technique

LTE Long-term experiment

MH Meadow hay

N Nitrogen

NDF Neutral-detergent fiber

NPs Nanoparticles

NS Not significant

RF Ruminal fluid

SCFA Short-chain fatty acids

SEM Standard error of the mean

SD Standard deviation

STE Short-term experiment

Zn Zinc

Acknowledgements

The authors are grateful to Valéria Venglovská, Renáta Geročová, and Peter Jerga for laboratory and technical assistance. The publication was financed by the Polish Minister of Science and Higher Education as part of the Strategy of the Poznan University of Life Sciences for 2024-2026 in the field of improving scientific research and development work in priority research areas.

Authors’ contributions

D.P., K.M., S.K. and A.B. performed the formal and statistical analyses. D.B. performed the in vitro analyses. K.Č. designed the study protocol and supervised the research. P.K. prepared the phosphate-based Zn nanoparticles. A.L. performed the histological analyses. P.P. and P.S. performed the microbial analyses. A.C. reviewed the ethical application dossier and reviewed the manuscript. Z.V. interpreted the data and wrote the manuscript. All authors read and approved the final manuscript.

Funding

This research was funded by the Slovak Research and Development Agency, grant numbers APVV-21–0301 and APVV-SK-PL-23–0004, and by EU NextGenerationEU of the Recovery and Resilience Plan for Slovakia under project No. 09I03-03-V02-00020. This research was also partially funded by the Faculty of Veterinary Medicine and Animal Science, Poznan University of Life Sciences, Poland, by the Department of Animal Nutrition (no. 506.533.04.00). The funders had no role in designing the study; collecting, analyzing, or interpreting the data, or writing the manuscript.

Availability of data and materials

>The data sets used and/or analyzed are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

Animal use and study design were conducted following the guidelines of the Declaration of Helsinki and national legislation in the Slovak Republic (G.R. 377/2012; Law 39/2007) for the care and use of research animals. The experimental protocol was approved by the Ethical Committee of the Institute of Animal Physiology, Centre of Biosciences of the Slovak Academy of Sciences on 07 March 2023 (protocol code 1046/2023).

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Ibrahim KS El-Sayed EM Potential role of nutrients on immunity Int Food Res J 2016 23 464 474
Ibrahim KS, El-Sayed EM. Potential role of nutrients on immunity. Int Food Res J. 2016;23:464–74.
2. Hilal EY Elkhairey MAE Osman AOA The role of zinc, manganese and copper in rumen metabolism and immune function: a review article Open J Anim Sci 2016 6 304 324 10.4236/ojas.2016.64035
Hilal EY, Elkhairey MAE, Osman AOA. The role of zinc, manganese and copper in rumen metabolism and immune function: a review article. Open J Anim Sci. 2016;6:304–24. 10.4236/ojas.2016.64035.
3. EFSA Scientific opinion on the potential reduction of the currently authorised maximum zinc content in complete feed EFSA J 2014 12 3668 10.2903/j.efsa.2014.3668
EFSA. Scientific opinion on the potential reduction of the currently authorised maximum zinc content in complete feed. EFSA J. 2014;12:3668-10.2903/j.efsa.2014.3668.
4. Spears JW Trace mineral bioavailability in ruminants J Nutr 2003 133 1506S 1509S 10.1093/jn/133.5.1506S 12730454
Spears JW. Trace mineral bioavailability in ruminants. J Nutr. 2003;133:1506S-1509S. 10.1093/jn/133.5.1506S.12730454
5. Grešáková Ľ Tokarčíková K Čobanová K Bioavailability of Dietary Zinc Sources and Their Effect on Mineral and Antioxidant Status in Lambs Agriculture 2021 11 11 1093 10.3390/agriculture11111093
Grešáková Ľ, Tokarčíková K, Čobanová K. Bioavailability of Dietary Zinc Sources and Their Effect on Mineral and Antioxidant Status in Lambs. Agriculture. 2021;11(11):1093. 10.3390/agriculture11111093.
6. López-Alonso M Trace minerals and livestock: not too much not too little ISRN Vet Sci 2012 2012 704825 10.5402/2012/704825 23762589
López-Alonso M. Trace minerals and livestock: not too much not too little. ISRN Vet Sci. 2012;2012: 704825. 10.5402/2012/704825.23762589
7. Goff JP Invited review: Mineral absorption mechanisms, mineral interactions that affect acid-base and antioxidant status, and diet considerations to improve mineral status J Dairy Sci 2018 101 4 2763 2813 10.3168/jds.2017-13112 29397180
Goff JP. Invited review: Mineral absorption mechanisms, mineral interactions that affect acid-base and antioxidant status, and diet considerations to improve mineral status. J Dairy Sci. 2018;101(4):2763–813. 10.3168/jds.2017-13112.29397180
8. Alimohamady R Aliarabi H Bruckmaier RM Christensen RG Effect of different sources of supplemental zinc on performance, nutrient digestibility, and antioxidant enzyme activities in lambs Biol Trace Elem Res 2019 189 75 84 10.1007/s12011-018-1448-1 30032401
Alimohamady R, Aliarabi H, Bruckmaier RM, Christensen RG. Effect of different sources of supplemental zinc on performance, nutrient digestibility, and antioxidant enzyme activities in lambs. Biol Trace Elem Res. 2019;189:75–84. 10.1007/s12011-018-1448-1.30032401
9. Nayeri A Upah NC Sucu E Sanz-Fernandez MV DeFrain JM Gorden PJ Baumgard LH Effect of the ratio of zinc amino acid complex to zinc sulfate on the performance of Holstein cows J Dairy Sci 2014 97 4392 4404 10.3168/jds.2013-7541 24819137
Nayeri A, Upah NC, Sucu E, Sanz-Fernandez MV, DeFrain JM, Gorden PJ, Baumgard LH. Effect of the ratio of zinc amino acid complex to zinc sulfate on the performance of Holstein cows. J Dairy Sci. 2014;97:4392–404. 10.3168/jds.2013-7541.24819137
10. Abdelnour SA Alagawany M Hashem NM Farag MR Alghamdi ES Hassan FU Bilal RM Elnesr SS Dawood MAO Nagadi SA Elwan HAM ALmasoudi AG Attia YA Nanominerals: fabrication methods, benefits and hazards, and their applications in ruminants with special reference to selenium and zinc nanoparticles Animals (Basel) 2021 11 1916 10.3390/ani11071916 34203158
Abdelnour SA, Alagawany M, Hashem NM, Farag MR, Alghamdi ES, Hassan FU, Bilal RM, Elnesr SS, Dawood MAO, Nagadi SA, Elwan HAM, ALmasoudi AG, Attia YA. Nanominerals: fabrication methods, benefits and hazards, and their applications in ruminants with special reference to selenium and zinc nanoparticles. Animals (Basel). 2021;11:1916. 10.3390/ani11071916.34203158
11. Vázquez-Armijo JF Martínez-Tinajero JJ López D Salem AF Rojo R In vitro gas production and dry matter degradability of diets consumed by goats with or without copper and zinc supplementation Biol Trace Elem Res 2011 144 1–3 580 587 10.1007/s12011-011-9113-y 21691797
Vázquez-Armijo JF, Martínez-Tinajero JJ, López D, Salem AF, Rojo R. In vitro gas production and dry matter degradability of diets consumed by goats with or without copper and zinc supplementation. Biol Trace Elem Res. 2011;144(1–3):580–7. 10.1007/s12011-011-9113-y.21691797
12. Youssef AM Azzaz HH Noha A Hassaan El-Nomeary YA Shakweer WME Facile green preparation of zinc oxide nanoparticles and its effects on in vitro feed degradation, ruminal fermentation, and total gas production Egypt J Chem 2023 66 363 369 10.21608/EJCHEM.2022.150103.6504
Youssef AM, Azzaz HH, Noha A, Hassaan El-Nomeary YA, Shakweer WME. Facile green preparation of zinc oxide nanoparticles and its effects on in vitro feed degradation, ruminal fermentation, and total gas production. Egypt J Chem. 2023;66:363–9. 10.21608/EJCHEM.2022.150103.6504.
13. Swain PS Rao SBN Rajendran D Dominic G Selvaraju S Nano zinc, an alternative to conventional zinc as animal feed supplement: A review Anim Nutr 2016 2 134 141 10.1016/j.aninu.2016.06.003 29767083
Swain PS, Rao SBN, Rajendran D, Dominic G, Selvaraju S. Nano zinc, an alternative to conventional zinc as animal feed supplement: A review. Anim Nutr. 2016;2:134–41. 10.1016/j.aninu.2016.06.003.29767083
14. Swain PS Rajendran D Rao SB Dominic G Preparation and effects of nano mineral particle feeding in livestock: A review Vet World 2015 8 888 891 10.14202/vetworld.2015.888-891 27047170
Swain PS, Rajendran D, Rao SB, Dominic G. Preparation and effects of nano mineral particle feeding in livestock: A review. Vet World. 2015;8:888–91. 10.14202/vetworld.2015.888-891.27047170
15. El Sabry MI McMillin KW Sabliov CM Nanotechnology considerations for poultry and livestock production systems: a review Ann Anim Sci 2018 18 319 334 10.1515/aoas-2017-0047
El Sabry MI, McMillin KW, Sabliov CM. Nanotechnology considerations for poultry and livestock production systems: a review. Ann Anim Sci. 2018;18:319–34. 10.1515/aoas-2017-0047.
16. Abdollahi M Rezaei J Fazaeli H Performance, rumen fermentation, blood minerals, leukocyte and antioxidant capacity of young Holstein calves receiving high-surface ZnO instead of common ZnO Arch Anim Nutr 2020 74 189 205 10.1080/1745039X.2019.1690389 31851525
Abdollahi M, Rezaei J, Fazaeli H. Performance, rumen fermentation, blood minerals, leukocyte and antioxidant capacity of young Holstein calves receiving high-surface ZnO instead of common ZnO. Arch Anim Nutr. 2020;74:189–205. 10.1080/1745039X.2019.1690389.31851525
17. Alijani K Rezaei J Rouzbehan Y Effect of nano-ZnO, compared to ZnO and Zn-methionine, on performance, nutrient status, rumen fermentation, blood enzymes, ferric reducing antioxidant power and immunoglobulin G in sheep Anim Feed Sci Technol 2020 267 114532 10.1016/j.anifeedsci.2020.114532
Alijani K, Rezaei J, Rouzbehan Y. Effect of nano-ZnO, compared to ZnO and Zn-methionine, on performance, nutrient status, rumen fermentation, blood enzymes, ferric reducing antioxidant power and immunoglobulin G in sheep. Anim Feed Sci Technol. 2020;267: 114532. 10.1016/j.anifeedsci.2020.114532.
18. Najafzadeh H Ghoreishi SM Mohammadian B Rahimi E Afzalzadeh MR Kazemivarnamkhasti M Ganjealidarani H Serum biochemical and histopathological changes in liver and kidney in lambs after zinc oxide nanoparticles administration Vet World 2013 6 534 537 10.5455/vetworld.2013.534-537
Najafzadeh H, Ghoreishi SM, Mohammadian B, Rahimi E, Afzalzadeh MR, Kazemivarnamkhasti M, Ganjealidarani H. Serum biochemical and histopathological changes in liver and kidney in lambs after zinc oxide nanoparticles administration. Vet World. 2013;6:534–7. 10.5455/vetworld.2013.534-537.
19. Pandurangan M Veerappan M Kim DH Cytotoxicity of zinc oxide nanoparticles on antioxidant enzyme activities and mRNA expression in the cocultured C2C12 and 3T3-L1 cells Appl Biochem Biotechnol 2015 175 1270 1280 10.1007/s12010-014-1351-y 25380643
Pandurangan M, Veerappan M, Kim DH. Cytotoxicity of zinc oxide nanoparticles on antioxidant enzyme activities and mRNA expression in the cocultured C2C12 and 3T3-L1 cells. Appl Biochem Biotechnol. 2015;175:1270–80. 10.1007/s12010-014-1351-y.25380643
20. Petrič D Mravčáková D Kucková K Kišidayová S Cieslak A Szumacher-Strabel M Huang H Kolodziejski P Lukomska A Slusarczyk S Čobanová K Váradyová Z Impact of zinc and/or herbal mixture on ruminal fermentation, microbiota, and histopathology in lambs Front Vet Sci 2021 8 630971 10.3389/fvets.2021.630971 33585621
Petrič D, Mravčáková D, Kucková K, Kišidayová S, Cieslak A, Szumacher-Strabel M, Huang H, Kolodziejski P, Lukomska A, Slusarczyk S, Čobanová K, Váradyová Z. Impact of zinc and/or herbal mixture on ruminal fermentation, microbiota, and histopathology in lambs. Front Vet Sci. 2021;8: 630971. 10.3389/fvets.2021.630971.33585621
21. Graham C Simmons NL Functional organization of the bovine rumen epithelium Am J Physiol Regul Integr Comp Physiol 2005 288 R173 181 10.1152/ajpregu.00425.2004 15319221
Graham C, Simmons NL. Functional organization of the bovine rumen epithelium. Am J Physiol Regul Integr Comp Physiol. 2005;288:R173-181. 10.1152/ajpregu.00425.2004.15319221
22. Rahman HS Othman HH Abdullah R Edin HYAS Al-Haj NA Beneficial and toxicological aspects of zinc oxide nanoparticles in animals Vet Med Sci 2022 8 1769 1779 10.1002/vms3.814 35588498
Rahman HS, Othman HH, Abdullah R, Edin HYAS, Al-Haj NA. Beneficial and toxicological aspects of zinc oxide nanoparticles in animals. Vet Med Sci. 2022;8:1769–79. 10.1002/vms3.814.35588498
23. Riazi H Rezaei J Rouzbehan Y Effects of supplementary nano-ZnO on in vitro ruminal fermentation, methane release, antioxidants, and microbial biomass Turk J Vet Anim Sci 2019 43 737 746 10.3906/vet-1905-48
Riazi H, Rezaei J, Rouzbehan Y. Effects of supplementary nano-ZnO on in vitro ruminal fermentation, methane release, antioxidants, and microbial biomass. Turk J Vet Anim Sci. 2019;43:737–46. 10.3906/vet-1905-48.
24. Palangi V Macit M Nadaroglu H Taghizadeh A Effects of green-synthesized CuO and ZnO nanoparticles on ruminal mitigation of methane emission to the enhancement of the cleaner environment Biomass Conv Bioref 2024 14 5447 5455 10.1007/s13399-022-02775-9
Palangi V, Macit M, Nadaroglu H, Taghizadeh A. Effects of green-synthesized CuO and ZnO nanoparticles on ruminal mitigation of methane emission to the enhancement of the cleaner environment. Biomass Conv Bioref. 2024;14:5447–55. 10.1007/s13399-022-02775-9.
25. Mortimer M Kasemets K Kahru A Toxicity of ZnO and CuO nanoparticles to ciliated protozoa Tetrahymena thermophila Toxicology 2010 269 182 189 10.1016/j.tox.2009.07.007 19622384
Mortimer M, Kasemets K, Kahru A. Toxicity of ZnO and CuO nanoparticles to ciliated protozoa Tetrahymena thermophila. Toxicology. 2010;269:182–9. 10.1016/j.tox.2009.07.007.19622384
26. Sarker NC Keomanivong F Borhan M Rahman S Swanson K In vitro evaluation of nano zinc oxide (nZnO) on mitigation of gaseous emissions J Anim Sci Technol 2018 60 27 10.1186/s40781-018-0185-5 30455973
Sarker NC, Keomanivong F, Borhan M, Rahman S, Swanson K. In vitro evaluation of nano zinc oxide (nZnO) on mitigation of gaseous emissions. J Anim Sci Technol. 2018;60:27. 10.1186/s40781-018-0185-5.30455973
27. Ghaffri Chanzanagh E Seifdavati J Gheshlagh FMA Benamar HA Sharifi RS Effect of ZnO nanoparticles on in vitro gas production of some animal and plant protein sources Kafkas Univ Vet Fak Derg 2018 24 25 32 10.9775/kvfd.2017.18187
Ghaffri Chanzanagh E, Seifdavati J, Gheshlagh FMA, Benamar HA, Sharifi RS. Effect of ZnO nanoparticles on in vitro gas production of some animal and plant protein sources. Kafkas Univ Vet Fak Derg. 2018;24:25–32. 10.9775/kvfd.2017.18187.
28. Hosseini-Vardanjani SF Rezaei J Karimi-Dehkordi S Rouzbehan Y Effect of feeding nano-ZnO on performance, rumen fermentation, leukocytes, antioxidant capacity, blood serum enzymes and minerals of ewes Small Rumin Res 2020 191 106170 10.1016/j.smallrumres.2020.106170
Hosseini-Vardanjani SF, Rezaei J, Karimi-Dehkordi S, Rouzbehan Y. Effect of feeding nano-ZnO on performance, rumen fermentation, leukocytes, antioxidant capacity, blood serum enzymes and minerals of ewes. Small Rumin Res. 2020;191: 106170. 10.1016/j.smallrumres.2020.106170.
29. Yusuf AO Adeyi TK Oni AO Owalabi AJ Sowande SO Nano zinc supplementation in ruminant’s livestock, influence on physiological, immune functions and oxidative stability of West African dwarf goat bucks Comp Clin Pathol 2023 32 629 643 10.1007/s00580-023-03471-4
Yusuf AO, Adeyi TK, Oni AO, Owalabi AJ, Sowande SO. Nano zinc supplementation in ruminant’s livestock, influence on physiological, immune functions and oxidative stability of West African dwarf goat bucks. Comp Clin Pathol. 2023;32:629–43. 10.1007/s00580-023-03471-4.
30. Hackmann TJ Firkins JL Maximizing efficiency of rumen microbial protein production Front Microbiol 2015 6 465 10.3389/fmicb.2015.00465 26029197
Hackmann TJ, Firkins JL. Maximizing efficiency of rumen microbial protein production. Front Microbiol. 2015;6:465. 10.3389/fmicb.2015.00465.26029197
31. Pisulewski PM Okorie AU Buttery PJ Haresign W Lewis D Ammonia concentration and protein synthesis in the rumen J Sci Food Agric 1981 32 759 766 10.1002/jsfa.2740320803 7289584
Pisulewski PM, Okorie AU, Buttery PJ, Haresign W, Lewis D. Ammonia concentration and protein synthesis in the rumen. J Sci Food Agric. 1981;32:759–66. 10.1002/jsfa.2740320803.7289584
32. Nocek JE Russell JB Protein and energy as an integrated system. Relationship of ruminal protein and carbohydrate availability for microbial synthesis and milk production J Dairy Sci. 1988 71 2070 2107 10.3168/jds.S0022-0302(88)79782-9
Nocek JE, Russell JB. Protein and energy as an integrated system. Relationship of ruminal protein and carbohydrate availability for microbial synthesis and milk production. J Dairy Sci. 1988;71:2070–107. 10.3168/jds.S0022-0302(88)79782-9.
33. Wang RL Liang JG Lu L Zhang LY Li SF Luo XG Effect of zinc source on performance, zinc status, immune response, and rumen fermentation of lactating cows Biol Trace Elem Res 2013 152 16 24 10.1007/s12011-012-9585-4 23279942
Wang RL, Liang JG, Lu L, Zhang LY, Li SF, Luo XG. Effect of zinc source on performance, zinc status, immune response, and rumen fermentation of lactating cows. Biol Trace Elem Res. 2013;152:16–24. 10.1007/s12011-012-9585-4.23279942
34. Chen M Xi Y Zhang L Zeng H Li Y Han Z Effects of zinc-bearing palygorskite on rumen fermentation in vitro Asian-Aust J Anim Sci 2019 32 63 71 10.5713/ajas.17.0920
Chen M, Xi Y, Zhang L, Zeng H, Li Y, Han Z. Effects of zinc-bearing palygorskite on rumen fermentation in vitro. Asian-Aust J Anim Sci. 2019;32:63–71. 10.5713/ajas.17.0920.
35. Váradyová Z Mravčáková D Holodová M Grešáková Ľ Pisarčíková J Barszcz M Taciak M Tuśnio A Kišidayová S Čobanová K Modulation of ruminal and intestinal fermentation by medicinal plants and zinc from different sources J Anim Physiol Anim Nutr (Berl) 2018 102 5 1131 1145 10.1111/jpn.12940 29901842
Váradyová Z, Mravčáková D, Holodová M, Grešáková Ľ, Pisarčíková J, Barszcz M, Taciak M, Tuśnio A, Kišidayová S, Čobanová K. Modulation of ruminal and intestinal fermentation by medicinal plants and zinc from different sources. J Anim Physiol Anim Nutr (Berl). 2018;102(5):1131–45. 10.1111/jpn.12940.29901842
36. Spears JW Schlegel P Seal MC Lloyd KE Bioavailability of zinc from zinc sulfate and different organic zinc sources and their effects on ruminal volatile fatty acid proportions Livest Prod Sci 2004 90 211 217 10.1016/j.livprodsci.2004.05.001
Spears JW, Schlegel P, Seal MC, Lloyd KE. Bioavailability of zinc from zinc sulfate and different organic zinc sources and their effects on ruminal volatile fatty acid proportions. Livest Prod Sci. 2004;90:211–7. 10.1016/j.livprodsci.2004.05.001.
37. Froetschel MA Martin AC Amos HE Evans JJ Effects of zinc sulfate concentration and feeding frequency on ruminal protozoal numbers, fermentation patterns and amino acid passage in steers J Anim Sci 1990 68 2874 2884 10.2527/1990.6892874x 2211417
Froetschel MA, Martin AC, Amos HE, Evans JJ. Effects of zinc sulfate concentration and feeding frequency on ruminal protozoal numbers, fermentation patterns and amino acid passage in steers. J Anim Sci. 1990;68:2874–84. 10.2527/1990.6892874x.2211417
38. Vigh A Criste A Gragnic K Moquet L Gerard C Ruminal solubility and bioavailability of inorganic trace mineral sources and effects on fermentation activity measured in vitro Agriculture 2023 13 879 10.3390/agriculture13040879
Vigh A, Criste A, Gragnic K, Moquet L, Gerard C. Ruminal solubility and bioavailability of inorganic trace mineral sources and effects on fermentation activity measured in vitro. Agriculture. 2023;13:879. 10.3390/agriculture13040879.
39. Van Houtert MFJ The production and metabolism of volatile fatty acids by ruminants fed roughages – A review Anim Feed Sci Technol 1993 43 189 225 10.1016/0377-8401(93)90078-X
Van Houtert MFJ. The production and metabolism of volatile fatty acids by ruminants fed roughages – A review. Anim Feed Sci Technol. 1993;43:189–225. 10.1016/0377-8401(93)90078-X.
40. Adegbeye MJ Elghandour MMMY Barbabosa-Pliego A Monroy JC Mellado M Ravi Kanth Reddy P Salem AZM Nanoparticles in equine nutrition: mechanism of action and application as feed additives J Equine Vet Sci 2019 78 29 37 10.1016/j.jevs.2019.04.001 31203981
Adegbeye MJ, Elghandour MMMY, Barbabosa-Pliego A, Monroy JC, Mellado M, Ravi Kanth Reddy P, Salem AZM. Nanoparticles in equine nutrition: mechanism of action and application as feed additives. J Equine Vet Sci. 2019;78:29–37. 10.1016/j.jevs.2019.04.001.31203981
41. Maret W Sandstead HH Zinc requirements and the risks and benefits of zinc supplementation J Trace Elem Med Biol 2006 20 3 18 10.1016/j.jtemb.2006.01.006 16632171
Maret W, Sandstead HH. Zinc requirements and the risks and benefits of zinc supplementation. J Trace Elem Med Biol. 2006;20:3–18. 10.1016/j.jtemb.2006.01.006.16632171
42. Maret W Zinc biochemistry: from a single zinc enzyme to a key element of life Adv Nutr 2013 4 82 91 10.3945/an.112.003038 23319127
Maret W. Zinc biochemistry: from a single zinc enzyme to a key element of life. Adv Nutr. 2013;4:82–91. 10.3945/an.112.003038.23319127
43. Ishaq SL Page CM Yeoman CJ Murphy TW Van Emon ML Stewart WC Zinc AA supplementation alters yearling ram rumen bacterial communities but zinc sulfate supplementation does not J Anim Sci 2019 97 687 697 10.1093/jas/sky456 30508094
Ishaq SL, Page CM, Yeoman CJ, Murphy TW, Van Emon ML, Stewart WC. Zinc AA supplementation alters yearling ram rumen bacterial communities but zinc sulfate supplementation does not. J Anim Sci. 2019;97:687–97. 10.1093/jas/sky456.30508094
44. VanValin KR Genther-Schroeder ON Carmichael RN Blank CP Deters EL Hartman SJ Niedermayer EK Laudert SB Hansen SL Influence of dietary zinc concentration and supplemental zinc source on nutrient digestibility, zinc absorption, and retention in sheep J Anim Sci 2018 96 5336 5344 10.1093/jas/sky384 30299509
VanValin KR, Genther-Schroeder ON, Carmichael RN, Blank CP, Deters EL, Hartman SJ, Niedermayer EK, Laudert SB, Hansen SL. Influence of dietary zinc concentration and supplemental zinc source on nutrient digestibility, zinc absorption, and retention in sheep. J Anim Sci. 2018;96:5336–44. 10.1093/jas/sky384.30299509
45. Takizawa S Asano R Fukuda Y Baba Y Tada C Nakai Y Shifts in xylanases and the microbial community associated with xylan biodegradation during treatment with rumen fluid Microb Biotechnol 2022 15 1729 1743 10.1111/1751-7915.13988 34964273
Takizawa S, Asano R, Fukuda Y, Baba Y, Tada C, Nakai Y. Shifts in xylanases and the microbial community associated with xylan biodegradation during treatment with rumen fluid. Microb Biotechnol. 2022;15:1729–43. 10.1111/1751-7915.13988.34964273
46. Selinger LB Forsberg CW Cheng KJ The rumen: a unique source of enzymes for enhancing livestock production Anaerobe 1996 2 263 284 10.1006/anae.1996.0036 16887555
Selinger LB, Forsberg CW, Cheng KJ. The rumen: a unique source of enzymes for enhancing livestock production. Anaerobe. 1996;2:263–84. 10.1006/anae.1996.0036.16887555
47. Dobson MJ Brown WCB Dobson A Phillipson AT A histological study of the organization of the rumen epithelium of sheep Quart J Exptl Physiol 1956 41 247 253 10.1113/expphysiol.1956.sp001186 13485339
Dobson MJ, Brown WCB, Dobson A, Phillipson AT. A histological study of the organization of the rumen epithelium of sheep. Quart J Exptl Physiol. 1956;41:247–53. 10.1113/expphysiol.1956.sp001186.13485339
48. Martín Martel S Morales M Morales I Jaber JR Rodríguez-Guisado F Tejedor-Junco MT Corbera JA Pathological changes of the rumen in small ruminants associated with indigestible foreign objects Ruminants 2021 1 118 126 10.3390/ruminants1020009
Martín Martel S, Morales M, Morales I, Jaber JR, Rodríguez-Guisado F, Tejedor-Junco MT, Corbera JA. Pathological changes of the rumen in small ruminants associated with indigestible foreign objects. Ruminants. 2021;1:118–26. 10.3390/ruminants1020009.
49. Mentschel J Leiser R Mülling C Pfarrer C Claus R Butyric acid stimulates rumen mucosa development in the calf mainly by a reduction of apoptosis Arch Tierernahr 2001 55 85 102 10.1080/17450390109386185 12068484
Mentschel J, Leiser R, Mülling C, Pfarrer C, Claus R. Butyric acid stimulates rumen mucosa development in the calf mainly by a reduction of apoptosis. Arch Tierernahr. 2001;55:85–102. 10.1080/17450390109386185.12068484
50. Flatt WP Warner RG Loosli JK Influence of purified materials on the development of the ruminant stomach J Dairy Sci 1958 41 1593 1600 10.3168/jds.S0022-0302(58)91138-X
Flatt WP, Warner RG, Loosli JK. Influence of purified materials on the development of the ruminant stomach. J Dairy Sci. 1958;41:1593–600. 10.3168/jds.S0022-0302(58)91138-X.
51. Malhi M Gui H Yao L Aschenbach JR Gäbel G Shen Z Increased papillae growth and enhanced short-chain fatty acid absorption in the rumen of goats are associated with transient increases in cyclin D1 expression after ruminal butyrate infusion J Dairy Sci 2013 96 7603 7616 10.3168/jds.2013-6700 24119813
Malhi M, Gui H, Yao L, Aschenbach JR, Gäbel G, Shen Z. Increased papillae growth and enhanced short-chain fatty acid absorption in the rumen of goats are associated with transient increases in cyclin D1 expression after ruminal butyrate infusion. J Dairy Sci. 2013;96:7603–16. 10.3168/jds.2013-6700.24119813
52. Bannink A France J Lopez S Gerrits WJ Kebreab E Tamminga S Dijkstra J Modeling the implications of feeding strategy on rumen fermentation and functioning of the rumen wall Anim Feed Sci Technol 2008 143 3 26 10.1016/j.anifeedsci.2007.05.002
Bannink A, France J, Lopez S, Gerrits WJ, Kebreab E, Tamminga S, Dijkstra J. Modeling the implications of feeding strategy on rumen fermentation and functioning of the rumen wall. Anim Feed Sci Technol. 2008;143:3–26. 10.1016/j.anifeedsci.2007.05.002.
53. Melo LQ Costa SF Lopes F Guerreiro MC Armentano LE Pereira MN Rumen morphometrics and the effect of digesta pH and volume on volatile fatty acid absorption J Anim Sci 2013 91 1775 1783 10.2527/jas.2011-4999 23345561
Melo LQ, Costa SF, Lopes F, Guerreiro MC, Armentano LE, Pereira MN. Rumen morphometrics and the effect of digesta pH and volume on volatile fatty acid absorption. J Anim Sci. 2013;91:1775–83. 10.2527/jas.2011-4999.23345561
54. Gäbel G Vogler S Martens H Short-chain fatty acids and CO2 as regulators of Na+ and Cl− absorption in isolated sheep rumen mucosa J Comp Physiol B 1991 161 419 426 10.1007/BF00260803 1939746
Gäbel G, Vogler S, Martens H. Short-chain fatty acids and CO2 as regulators of Na+ and Cl− absorption in isolated sheep rumen mucosa. J Comp Physiol B. 1991;161:419–26. 10.1007/BF00260803.1939746
55. Horky P Skalickova S Urbankova L Baholet D Kociova S Bytesnikova Z Kabourkova E Lackova Z Cernei N Gagic M Milosavljevic V Smolikova V Vaclavkova E Nevrkla P Knot P Krystofova O Hynek D Kopel P Skladanka J Adam V Smerkova K Zinc phosphate-based nanoparticles as a novel antibacterial agent: in vivo study on rats after dietary exposure J Anim Sci Biotechnol 2019 10 17 10.1186/s40104-019-0319-8 30805185
Horky P, Skalickova S, Urbankova L, Baholet D, Kociova S, Bytesnikova Z, Kabourkova E, Lackova Z, Cernei N, Gagic M, Milosavljevic V, Smolikova V, Vaclavkova E, Nevrkla P, Knot P, Krystofova O, Hynek D, Kopel P, Skladanka J, Adam V, Smerkova K. Zinc phosphate-based nanoparticles as a novel antibacterial agent: in vivo study on rats after dietary exposure. J Anim Sci Biotechnol. 2019;10:17. 10.1186/s40104-019-0319-8.30805185
56. European Commission (EC). Council Regulation (EC) 1099/2009 of 24 September 2009 on the Protection of Animals at the Time of Killing. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/?uri=celex:32009R1099.
57. McDougall EI Studies on ruminant saliva I The composition and output of sheep’s saliva Biochem J. 1948 43 99 109 10.1042/bj0430099 18889874
McDougall EI. Studies on ruminant saliva. I. The composition and output of sheep’s saliva. Biochem J. 1948;43:99–109. 10.1042/bj0430099.18889874
58. Horwitz W Official Methods of AOAC International 2000 17 Gaithersburg; Washington, DC Association of Official Analytical Chemists (AOAC) International
Horwitz W. Official Methods of AOAC International. 17th ed. Gaithersburg; Washington, DC: Association of Official Analytical Chemists (AOAC) International; 2000.
59. Van Soest PJ Robertson JB Lewis BA Methods for dietary fiber neutral detergent fiber, and non-starch polysaccharides in relation to animal nutrition J Dairy Sci 1991 74 3583 3597 10.3168/jds.S0022-0302(91)78551-2 1660498
Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber neutral detergent fiber, and non-starch polysaccharides in relation to animal nutrition. J Dairy Sci. 1991;74:3583–97. 10.3168/jds.S0022-0302(91)78551-2.1660498
60. Mellenberger RW Satter LD Millett MA Baker AJ An in vitro technique for estimating digestibility of treated and untreated wood J Anim Sci 1970 30 1005 1011 10.2527/jas1970.3061005x
Mellenberger RW, Satter LD, Millett MA, Baker AJ. An in vitro technique for estimating digestibility of treated and untreated wood. J Anim Sci. 1970;30:1005–11. 10.2527/jas1970.3061005x.
61. Broderick GA Kang JH Automated simultaneous determination of ammonia and total amino acids in ruminal fluid and in vitro media J Dairy Sci 1980 63 64 75 10.3168/jds.S0022-0302(80)82888-8 7372898
Broderick GA, Kang JH. Automated simultaneous determination of ammonia and total amino acids in ruminal fluid and in vitro media. J Dairy Sci. 1980;63:64–75. 10.3168/jds.S0022-0302(80)82888-8.7372898
62. Váradyová Z Baran M Zeleňák I Comparison of two in vitro fermentation gas production methods using both rumen fluid and faecal inoculum from sheep Anim Feed Sci Technol 2005 123–124 81 94 10.1016/j.anifeedsci.2005.04.030
Váradyová Z, Baran M, Zeleňák I. Comparison of two in vitro fermentation gas production methods using both rumen fluid and faecal inoculum from sheep. Anim Feed Sci Technol. 2005;123–124:81–94. 10.1016/j.anifeedsci.2005.04.030.
63. Váradyová Z Kišidayová S Čobanová K Grešáková L Babják M Königová A Urda Dolinská M Várady M The impact of a mixture of medicinal herbs on ruminal fermentation, parasitological status and hematological parameters of the lambs experimentally infected with Haemonchus contortus Small Rumin Res 2017 151 124 132 10.1016/j.smallrumres.2017.04.023
Váradyová Z, Kišidayová S, Čobanová K, Grešáková L, Babják M, Königová A, Urda Dolinská M, Várady M. The impact of a mixture of medicinal herbs on ruminal fermentation, parasitological status and hematological parameters of the lambs experimentally infected with Haemonchus contortus. Small Rumin Res. 2017;151:124–32. 10.1016/j.smallrumres.2017.04.023.
64. Mikulová K Petrič D Komáromyová M Batťányi D Kozłowska M Cieslak A Ślusarczyk S Várady M Váradyová Z Growth performance and ruminal fermentation in lambs with endoparasites and in vitro effect of medicinal plants Agriculture 2023 13 1826 10.3390/agriculture13091826
Mikulová K, Petrič D, Komáromyová M, Batťányi D, Kozłowska M, Cieslak A, Ślusarczyk S, Várady M, Váradyová Z. Growth performance and ruminal fermentation in lambs with endoparasites and in vitro effect of medicinal plants. Agriculture. 2023;13:1826. 10.3390/agriculture13091826.
65. Williams AG Coleman GS The Rumen Protozoa 1992 1 New York Springer 1 425
Williams AG, Coleman GS. The Rumen Protozoa. 1st ed. New York: Springer; 1992. p. 1–425.
66. Szulc P Mravčáková D Szumacher-Strabel M Váradyová Z Várady M Čobanová K Syahrulawal L Patra AK Cieslak A Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures PLoS ONE 2020 15 e0231516 10.1371/journal.pone.0231516 32298315
Szulc P, Mravčáková D, Szumacher-Strabel M, Váradyová Z, Várady M, Čobanová K, Syahrulawal L, Patra AK, Cieslak A. Ruminal fermentation, microbial population and lipid metabolism in gastrointestinal nematode-infected lambs fed a diet supplemented with herbal mixtures. PLoS ONE. 2020;15: e0231516. 10.1371/journal.pone.0231516.32298315
67. Zeng J Bian Y Xing P Wu QL Macrophyte species drive the variation of bacterioplankton community composition in a shallow freshwater lake Appl Environ Microbiol 2012 78 177 184 10.1128/AEM.05117-11 22038598
Zeng J, Bian Y, Xing P, Wu QL. Macrophyte species drive the variation of bacterioplankton community composition in a shallow freshwater lake. Appl Environ Microbiol. 2012;78:177–84. 10.1128/AEM.05117-11.22038598
68. Denman SE McSweeney CS Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen FEMS Microbiol Ecol 2006 58 572 582 10.1111/j.1574-6941.2006.00190.x 17117998
Denman SE, McSweeney CS. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol Ecol. 2006;58:572–82. 10.1111/j.1574-6941.2006.00190.x.17117998
69. Yu Y Lee C Kim J Hwang S Group-specific primer and probe sets to detect methanogenic communities using quantitative real-time polymerase chain reaction Biotechnol Bioeng 2005 89 670 679 10.1002/bit.20347 15696537
Yu Y, Lee C, Kim J, Hwang S. Group-specific primer and probe sets to detect methanogenic communities using quantitative real-time polymerase chain reaction. Biotechnol Bioeng. 2005;89:670–9. 10.1002/bit.20347.15696537
70. Potu RB AbuGhazaleh AA Hastings D Jones K Ibrahim SA The effect of lipid supplements on ruminal bacteria in continuous culture fermenters varies with the fatty acid composition J Microbiol 2011 49 216 223 10.1007/s12275-011-0365-1 21538241
Potu RB, AbuGhazaleh AA, Hastings D, Jones K, Ibrahim SA. The effect of lipid supplements on ruminal bacteria in continuous culture fermenters varies with the fatty acid composition. J Microbiol. 2011;49:216–23. 10.1007/s12275-011-0365-1.21538241
71. Wang RF Cao WW Cerniglia CE PCR detection of Ruminococcus spp. in human and animal faecal samples Mol Cell Probes. 1997 11 259 265 10.1006/mcpr.1997.0111 9281411
Wang RF, Cao WW, Cerniglia CE. PCR detection of Ruminococcus spp. in human and animal faecal samples. Mol Cell Probes. 1997;11:259–65. 10.1006/mcpr.1997.0111.9281411
72. Li M Penner GB Hernandez-Sanabria E Oba M Guan LL Effects of sampling location and time, and host animal on assessment of bacterial diversity and fermentation parameters in the bovine rumen J Appl Microbiol 2009 107 1924 1934 10.1111/j.1365-2672.2009.04376.x 19508296
Li M, Penner GB, Hernandez-Sanabria E, Oba M, Guan LL. Effects of sampling location and time, and host animal on assessment of bacterial diversity and fermentation parameters in the bovine rumen. J Appl Microbiol. 2009;107:1924–34. 10.1111/j.1365-2672.2009.04376.x.19508296
73. Koike S Ueno M Miura H Saegusa A Inouchi K Inabu Y Sugino T Guan LL Oba M Kobayashi Y Rumen microbiota and its relation to fermentation in lactose-fed calves J Dairy Sci 2021 104 10744 10752 10.3168/jds.2021-20225 34218911
Koike S, Ueno M, Miura H, Saegusa A, Inouchi K, Inabu Y, Sugino T, Guan LL, Oba M, Kobayashi Y. Rumen microbiota and its relation to fermentation in lactose-fed calves. J Dairy Sci. 2021;104:10744–52. 10.3168/jds.2021-20225.34218911
74. Poeker SA Geirnaert A Berchtold L Greppi A Krych L Steinert RE de Wouters T Lacroix C Understanding the prebiotic potential of different dietary fibers using an in vitro continuous adult fermentation model (PolyFermS) Sci Rep 2018 8 1 4318 10.1038/s41598-018-22438-y 29531228
Poeker SA, Geirnaert A, Berchtold L, Greppi A, Krych L, Steinert RE, de Wouters T, Lacroix C. Understanding the prebiotic potential of different dietary fibers using an in vitro continuous adult fermentation model (PolyFermS). Sci Rep. 2018;8(1):4318. 10.1038/s41598-018-22438-y.29531228
