
==== Front
BMC Vet Res
BMC Vet Res
BMC Veterinary Research
1746-6148
BioMed Central London

4282
10.1186/s12917-024-04282-7
Case Report
A case of mortality in a re-introduced European bison associated with severe pneumonia caused by Dictyocaulus viviparus
Cârstolovean Andrada-Silvia andrada-silvia.carstolovean@usamvcluj.ro

1
Taulescu Marian 2
Hodor Dragoș 2
Cotuțiu Vlad-Dan 1
Aldea Adrian Mihai 3
Șerban Călin Constantin 3
Cazan Cristina Daniela 1
Gherman Călin Mircea 1
Mihalca Andrei Daniel 1
1 https://ror.org/05hak1h47 grid.413013.4 0000 0001 1012 5390 Department of Parasitology and Parasitic Diseases, University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca, Calea Mănăștur 3-5, Cluj-Napoca, 400372 Romania
2 https://ror.org/05hak1h47 grid.413013.4 0000 0001 1012 5390 Department of Veterinary Pathology, University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca, Calea Mănăștur 3-5, Cluj-Napoca, 400372 Romania
3 Foundation Conservation Carpathia, Calea Feldioarei 27A, Brașov, 500450 Romania
21 9 2024
21 9 2024
2024
20 42330 5 2024
11 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Dictyocaulosis is a parasitic disease caused by pulmonary nematodes from genus Dictyocaulus affecting various ungulate hosts. It can cause verminous bronchopneumonia and for heavily infected individuals, fatal outcomes can occur.

Case presentation

The study describes the case of a male European bison which died three months after relocation from Slovakia to one of the reintroduction areas in Nucșoara village, Făgăraș Mountains, Romania. Necropsy revealed the presence of pulmonary nematodes in the respiratory tract. Morphology and molecular diagnosis was performed and Dictyocaulus viviparus was identified.

Conclusion

Rigorous health monitoring is essential to assure the success of reintroduction programs, understanding and preventing infectious diseases and limiting their impact on population health.

Keywords

European bison
Bison bonasus
Reintroduction
Dictyocaulosis
Dictyocaulus viviparus
issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Following the First World War, the European bison (Bison bonasus) became extinct in the wild across Europe. Through dedicated reintroduction programs initiated in Poland and continued in other European countries [1], its population was restored from only 17 founders [2]. These individuals, having survived in zoos until recently, now total 10,236 European bison, with 8,225 living freely, 585 in semi-free conditions, and 1,727 remaining in captivity [3]. Based on the IUCN (International Union for Conservation of Nature) Red List of Threatened Species, the conservation status of the European bison was reclassified from “Vulnerable” to “Near Threatened” in 2019. In Romania, the reintroduction efforts began in the early 2010s, and now include three main sites: Vânători-Neamț Natural Park [4], Făgăraș Mountains [5] and Țarcu Mountains [6], with over 200 European bison estimated in the wild [1]. Despite the success of reintroduction efforts, research on pathogen diversity and its impact on clinical disease or mortality in Romania remains severely limited [7–9]. However, due to inbreeding and low genetic variability [10], the European bison remains more susceptible to diseases, among which those caused by parasites play an important role [11–13].

An estimated 88 parasite species are reported to affect the European bison, 43 of which are nematodes [14, 15]. Furthermore, several parasitic diseases were reported in farmed or free-ranging European bison including: fasciolosis caused by Fasciola hepatica [16], thelaziosis (Thelazia gulosa, Thelazia rhodesi and Thelazia skrjabini) [17, 18], and gastrointestinal trichostrongylidosis (Ashworthius sidemi and Haemonchus contortus) [1, 13, 19]. Dictyocaulosis is a parasitic disease caused by pulmonary nematodes from genus Dictyocaulus affecting various ungulate hosts [20, 21]. Clinical signs primarily consist of bronchitis, though severe infections can lead to fatal outcomes. Calves are usually more susceptible during their first grazing season. However, lack of exposure to the parasite can result in significant clinical disease in adult cattle due to inadequate immunity. In Romania, parasite diversity and its clinical implications, has not been investigated this far [13, 22, 23].

This report highlights the case of an adult European bison bull found dead in one of the reintroduction sites from Romania. Upon examination, massive lung infection along with severe pulmonary lesions, associated with the presence of D. viviparus, was detected. Consequently, the study underscores the critical importance of comprehensive health monitoring and effective disease management in wildlife reintroduction programs [24, 25]. It also serves as a warning about the potential risks that parasitic infections pose to the success and sustainability of conservation efforts. Ensuring the health of reintroduced animals through rigorous health protocols is essential to prevent similar fatalities and secure the long-term success of conservation initiatives.

Case presentation

On 1st of October 2022, a five-year male European bison along with six other bison was translocated from a facility in Tribeč, Slovakia to the Făgăraș Mountains specifically to one of the reintroduction areas on the outskirts of Nucșoara village (45.339882, 24.780907). As part of the routine preventive protocol, a deworming treatment was administrated prior to relocation, although no additional information regarding the protocol or the medication administrated was provided. No information on faecal analysis prior to translocation was available. Following translocation, the European bison was kept in the quarantine area, located in the acclimatization area, for three months (Fig. 1). The area designed for this purpose is in close proximity to the feeding zone (where rangers provide supplement food for the European bison). All seven animals were kept together, and contact with local livestock (mainly sheep, goats and cattle) was minimal. On January 19th 2023, following this phase, the entire group of European bison was released from quarantine, but kept in the acclimatization area (an electric fenced area of 76.7954 ha and perimeter of approximatively 4225 m used for rewilding purposes) (Fig. 1). Fifteen days after release (February 2nd 2023), the bull was found dead, park rangers observing signs of lethargy and anorexia during routine examination. The other European bison did not present any clinical signs. Mapping was done using the ArcGIS software, version 3.2.2 (Esri INC., Canada), using available data provided by the Foundation Conservation Carpathia Romania.

Fig. 1 The reintroduction site layout, situated in the Făgăraș Mountains. Access and release gates for both the acclimatization area (Access_gate_A, Release_gate_A) and quarantine area (Acess_gate_Q, Release_gate_Q) are marked, along with the two feeders, contention area and the dead bison location. CRS: Stereo 1970; Scale 1:6000; Imagery Basemap (Esri)

The carcass was transported to the Department of Anatomic Pathology at the University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca, for post-mortem examination. Once completely defrosted, on February 9th 2023, the carcass was examined.

Upon initial evaluation, the animal was attributed a body score of 1 out of 4 [25]. The post-mortem examination revealed consolidated foci (atelectasis) in the caudal lung lobes, along with large amounts of serous fluid (oedema), mucus (catarrhal bronchitis) and numerous nematodes in the trachea and the large bronchi (Fig. 2a, b). Pericardial effusion and severe serous atrophy of the adipose tissue at the base of the heart (associated to severe cachexia) were also identified. No other pathologies were observed within the cardiopulmonary system.

Tissue samples from the lungs were collected and evaluated by histopathology. They were fixed in 10% buffered neutral formalin and routinely embedded in paraffin. Multiple 3 μm sections were stained with haematoxylin-eosin (H&E). All samples were evaluated using an Olympus BX-42 light microscope. Photomicrographs were captured using an Olympus UC30 digital camera and Stream Basic imaging software (Olympus Corporation, Tokyo, Japan). Histopathological examination revealed pulmonary atelectasis, congestion, and oedema. Rare embryonated eggs and larvae were identified within the bronchi, bronchioles, and alveoli. The bronchiolar lumen contained a variable amount of mucus, and the wall was multifocally infiltrated with lymphocytes, macrophages and eosinophils. (Fig. 2c, d).

Fig. 2 Pathological findings in the lungs: (a), (b) Numerous adults of Dictyocaulus viviparus (white arrows) admixed with foamy fluid and mucus, in a longitudinally opened large bronchus and cross-sectioned pulmonary parenchyma. (c) Microscopic examination of the lung showing a moderate amount of mucus within the bronchiolar lumen (arrow), and inflammatory infiltrate with lymphocytes, macrophages, and eosinophils (the inset, black arrows); Haematoxylin and Eosin stain, bar = 50 μm. (d) Presence of parasitic larvae (arrows) within the bronchiolar lumen and alveoli associated with pulmonary oedema and congestion; Haematoxylin and Eosin stain, bar = 20 μm

Based on the gross features identified, verminous bronchopneumonia, associated with severe pulmonary oedema and cachexia, was presumed at to be the most probable cause of death.

Adult nematodes were collected from the respiratory tract and morphologically identified as D. viviparus (Figs. 3 and 4) [26]. Parts of the lung tissue were also collected and examined by Baermann’s technique to reveal the larvae, which were also identified as of D. viviparus (Fig. 5) [27, 28].

Fig. 3 Posterior end of a Dictyocaulus viviparus adult male collected from European bison; (a) spicules equal, thickened, short, of nostril-like shape, with a small process near distal end; gubernaculum small, elongated (arrow), (b) dorsal (d) rays separated along entire length, divided distally at tips into 2 or 3 very short branches (arrow), externodorsal (ed) ray independent, posterolateral (pl) and mediolateral (ml) rays fused over entire length, anterolateral (al) ray independent, ventroventral (vv) and lateroventral (lv) rays split, with common base

Fig. 4 Dictyocaulus viviparus adult female collected from European bison: (a) anterior part, buccal aperture leads into small buccal cavity (b) vulvar region (arrow) which is present in the middle of the body. (c) posterior end with the anal opening (arrow), pointed tail and presence of eggs with larvae

Fig. 5 Larva of Dictyocaulus viviparus collected from European bison; with rounded head, absence of protruding protoplasmic knob, presence of intestinal granules and a bluntly pointed tail

To confirm species identification at the molecular level DNA was individually extracted from one adult female nematode using the ISOLATE II Genomic DNA Kit (Bioline Meridian Bioscience, Luckenwalde Germany), according to the manufacturer’s instructions. PCR amplification of internal transcribed spacer 2 of the rRNA gene (ITS2 ~500 bp) was performed in 25µl reaction volume, containing 12.5µl Red PCR Mastermix (Rovalab GmBH, Teltow, Germany), 6.5µl of ultra-pure water, 1µl (10 pmol/µl) of each of the two previously described primers NC1 (5’- ACGTCTGGTTCAGGGTTGTT − 3’) and NC2 (5’- TTAGTTTCTTTTCCTCCGCT − 3’) [29] and 4 µl of aliquot of the isolated DNA. One negative control consisting of ultra-pure water was included.

The PCR was performed using the T1000™ Thermal Cycler (Bio-Rad, London, UK) as follows: initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 45 s, annealing at 60 °C for 45 s and extension at 72 °C for 45 s, with a final extension at 72 °C for 5 min. The amplification products were visualized by electrophoresis on a 1.5% agarose gel stained with ECO Safe 20,000× Nucleic Acid Staining Solution (Pacific Image Electronics, New Taipei, Taiwan). Their molecular weight was assessed by comparison to a molecular marker (O’GeneRuler™ 100 bp DNA Ladder, Thermo Fisher Scientific Inc., Waltham, MA, USA). Amplicons were purified using the ISOLATE II PCR and Gel Kit (Bioline Meridian Bioscience, Luckenwalde Germany) and sequenced in both directions by Macrogen Europe (Amsterdam, Netherlands).

Sequences were analysed and edited using Geneious® 4.85 software [30], which was then compared to those available in GenBank™ database using the Basic Local Alignments Search Tool (BLAST).

The specimen consensus sequence (333 bp) showed a 98.14% similarity with other D. viviparus specimens from an unspecified host in Austria (KU891914) and 98.76% similarity with a specimen from European bison in Denmark (ON668047). The sequence was submitted to the GenBank database under the accession number PP808495.

Discussion and conclusions

The successful reintroduction of European bison into the wild has brought to light the critical importance of monitoring parasitic infections, which can severely impact the health and sustainability of these populations. According to the Bison Rewilding Plan 2014–2024 by Rewilding Europe, veterinary care is required during the acclimatization period. Due to the species susceptibility to both infectious and non-infectious diseases that affect domestic bovids, the medical and husbandry practices used for cattle are applicable to European bison as well. Additionally, necropsy records play a crucial role in identifying trends in mortality and morbidity, thereby enhancing the management of reintroduction programs. European legislation, primarily through Regulation (EU) 2016/429, Council Directive 92/43/EEC, Council Regulation (EC) No 338/97, and IUCN guidelines for reintroductions [24], ensures that wildlife and threatened species in the EU, receive appropriate veterinary care, particularly within the framework of conservation and reintroduction efforts.

Dictyocaulus viviparus has been reported on various occasions in European bison. In Denmark, a study revealed the presence of D. viviparus larvae in calves, while also uncovering a high parasitic load in a bull euthanized following severe weight loss [21]. Between 2008 and 2013, necropsies conducted on 234 European bison from Białowieża Primeval Forest, Poland revealed that in 45.3% of examined carcasses, pneumonia was the most common pathological finding, with D. viviparus identified in 32.9% of the cases. Consequently, the presence of D. viviparus was associated with pathological changes such as catarrhal-purulent pneumonia, emphysema, and lesions in the upper respiratory tract. These lesions were more common in animals younger than six months. Three other studies in Poland revealed low intensity infections with D. viviparus larvae in European bison, with no associated clinical signs [31–33]. Similarly, a 2015 study in Vologda, Russia, identified lungworms, including Dictyocaulus viviparus and Dictyocaulus filaria in a free-ranging European bison population of 57 animals, although the infestation levels and clinical signs were not specified [34]. However, none of these reports indicated D. viviparus as the cause of death. In our study, we detected bronchopneumonia associated with pulmonary oedema, which was very likely the cause of death. This finding underscores the important role of D. viviparus as a possible cause of concern in re-introduced farmed European bison [20].

Interestingly, a study in Poland (2017–2019) analysed 65 adult D. viviparus (30 male and 35 female) from 15 free-roaming European bison in Białowieża and Boreka Forests. The nematodes showed morphological differences from those in cattle, suggesting a possible new subspecies, Dictyocaulus viviparus bisontis [11]. Despite these findings, subsequent molecular analysis on European bison from the same region revealed that the sequences matched those of D. viviparus in cattle (KC771250) [35]. While our specimens matched the morphological features of D. viviparus, with molecular analysis confirming these findings (98.14–98.76% similarity), a larger sample size would provide much needed clarity on the matter.

Despite the success of the reintroduction programs and the restauration of the species, the European bison remains endangered, requiring vigilant monitoring for potential health threats [20]. Host bottlenecks are usually associated with loss of specific symbionts, including parasites, leaving space for newly acquired parasitic organisms from related hosts. Such parasites often have a more severe impact on non-natural hosts. The stress of transportation and relocation can considerably affect the adaptability of reintroduced animals weakening their immune system, and rendering them susceptible to infections. In addition, as in the case of European bison, inbreeding is responsible for decreased overall immunity [13].

This case highlights the importance of comprehensive health monitoring and effective disease management in wildlife reintroduction programs. Ensuring the health of reintroduced animals, both before and during relocation, is crucial for the success of these initiatives. Moreover, ensuring transparency and clarity from a veterinary standpoint, is vital for effectively monitoring critical points throughout the entire process, from local reservoir hosts to susceptible B. bonasus populations, as well as their subsequent impact on bison health.

Abbreviations

DNA Deoxyribonucleic acid

PCR Polymerase chain reaction

rRNA ribosomal ribonucleic acid

Dv Dictyocaulus viviparus

Bp Base pair

Acknowledgements

The authors would like to thank Foundation Conservation Carpathia Romania for the collaboration.

Author contributions

ASC collected the nematodes, performed the morphological identification of the parasites and wrote the manuscript. MT and DH performed the necropsy and carried out the histopathology analysis. VDC generated the map and constructed the illustrations. AA and CS helped with the collection of the carcass. CDC performed the molecular analyses. CMG and VDC performed the morphological identification of the parasites and revised the manuscript. ADM coordinated the study and wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

The funding was supported by Foundation Conservation Carpathia and Department of Parasitology and Parasitic Diseases at University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca, Romania. The APC was partially funded by University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent of publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Olech W, Perzanowski K, editors. European Bison. Strategic Species Status Bison bonasus Review 2020. IUCN SSC Bison Specialist Group and European Bison Conservation Center Warsaw. 2022, Pp: 1-138.
2. Slatis HM An analysis of inbreeding in the European bison Genetics 1960 45 3 275 10.1093/genetics/45.3.275 17247924
Slatis HM. An analysis of inbreeding in the European bison. Genetics. 1960;45(3):275.17247924
3. Raczyński J European Bison Pedigree Book 2022 2023 Białowieża Białowieża National Park 8
Raczyński J. European Bison Pedigree Book 2022. Białowieża: Białowieża National Park; 2023. p. 8.
4. https://www.tinutulzimbrului.ro/ Accessed April 2024.
5. https://www.carpathia.org/12-bison-will-be-released-in-the-fagaras-mountains-from-a-new-reintroduction-point-in-the-dobroneagu-nucsoara-area/ Accessed 24 April 2024.
6. https://rewildingeurope.com/blog/free-roaming-bison-population-in-the-southern-carpathians-continues-to-thrive/ Accessed 24 April 2024.
7. Morariu S Bulacu A Morariu F Hãgãti A Dãrãbu G Suici T Ilie M Parasites-an important obstacle in acclimatization and conservation of the European bison (Bison bonasus bonasus) in Romanian armenis-plopu reserve Revista Română De Med Veterinara 2021 31 1 54 8
Morariu S, Bulacu A, Morariu F, Hãgãti A, Dãrãbu G, Suici T, Ilie M. Parasites-an important obstacle in acclimatization and conservation of the European bison (Bison bonasus bonasus) in Romanian armenis-plopu reserve. Revista Română De Med Veterinara. 2021;31(1):54–8.
8. Morariu S Bulacu A Dărăbuș G Ilie MEDERLEN Badea MS IMRE, M. preliminary research on the prevalence of Toxoplasma gondii infection in wisents (Bison bonasus) from Romanian Armenis-Plopu reserve. Frequency of staphylococci strains with antibiotic resistance isolated from animals Lucrări Științifice Medicină Veterinară 2016 XLIX 3 113
Morariu S, Bulacu A, Dărăbuș G, Ilie MEDERLEN, Badea MS. IMRE, M. preliminary research on the prevalence of Toxoplasma gondii infection in wisents (Bison bonasus) from Romanian Armenis-Plopu reserve. Frequency of staphylococci strains with antibiotic resistance isolated from animals. Lucrări Științifice Medicină Veterinară. 2016;XLIX(3):113.
9. Petrovici S Petrovici M The endoparasites of bisons (Bison bonasus) from the Vânători-Neamț Natural Park. Buletinul Universității De Științe Agricole și Medicină Veterinară Cluj-Napoca Seria Medicină Veterinară 2004 61 304
Petrovici S, Petrovici M. The endoparasites of bisons (Bison bonasus) from the Vânători-Neamț Natural Park. Buletinul Universității De Științe Agricole și Medicină Veterinară Cluj-Napoca. Seria Medicină Veterinară. 2004;61:304.
10. Machova K, Štruncová P, Calta J, Tichý L, Vostrý L. Genealogical analysis of European bison population revealed a growing up population despite very low genetic diversity. PLoS ONE, 2022, 17(11), e0277456.
11. Pyziel AM Laskowski Z Dolka I Kołodziej-Sobocińska M Nowakowska J Klich D Höglund J Large lungworms (Nematoda: Dictyocaulidae) recovered from the European bison may represent a new nematode subspecies Int J Parasitology: Parasites Wildl 2020 13 213 20 10.1016/j.ijppaw.2020.10.002
Pyziel AM, Laskowski Z, Dolka I, Kołodziej-Sobocińska M, Nowakowska J, Klich D, Höglund J. Large lungworms (Nematoda: Dictyocaulidae) recovered from the European bison may represent a new nematode subspecies. Int J Parasitology: Parasites Wildl. 2020;13:213–20. 10.1016/j.ijppaw.2020.10.002.
12. Demiaszkiewicz AW Pyziel AM Lachowicz J Kuligowska I Dictyocaulosis of European bison in Białowieża forest Eur Bison Conserv Newsl 2009 2 112 8
Demiaszkiewicz AW, Pyziel AM, Lachowicz J, Kuligowska I. Dictyocaulosis of European bison in Białowieża forest. Eur Bison Conserv Newsl. 2009;2:112–8.
13. Pyziel AM Björck S Wiklund R Skarin M Demiaszkiewicz AW Höglund J Gastrointestinal parasites of captive European bison Bison bonasus (L.) with a sign of reduced efficacy of Haemonchus contortus to Fenbendazole Parasitol Res 2018 117 1 295 302 10.1007/s00436-017-5663-z 29090320
Pyziel AM, Björck S, Wiklund R, Skarin M, Demiaszkiewicz AW, Höglund J. Gastrointestinal parasites of captive European bison Bison bonasus (L.) with a sign of reduced efficacy of Haemonchus contortus to Fenbendazole. Parasitol Res. 2018;117(1):295–302. 10.1007/s00436-017-5663-z.29090320
14. Karbowiak G Demiaszkiewicz A Pyziel A Wita I Moskwa B Werszko J Cabaj W The parasitic fauna of the European bison (Bison bonasus) (Linnaeus, 1758) and their impact on the conservation. Part 1 the summarising list of parasites noted Acta Parasitol 2014 59 3 363 71 10.2478/s11686-014-0252-0 25119348
Karbowiak G, Demiaszkiewicz A, Pyziel A, Wita I, Moskwa B, Werszko J, Cabaj W. The parasitic fauna of the European bison (Bison bonasus) (Linnaeus, 1758) and their impact on the conservation. Part 1 the summarising list of parasites noted. Acta Parasitol. 2014;59(3):363–71. 10.2478/s11686-014-0252-0.25119348
15. Karbowiak G Demiaszkiewicz A Pyziel A Wita I Moskwa B Werszko J Cabaj W The parasitic fauna of the European bison (Bison bonasus) (Linnaeus, 1758) and their impact on the conservation. Part 2 the structure and changes over time Acta Parasitol 2014 59 3 372 9 10.2478/s11686-014-0253-z 25119349
Karbowiak G, Demiaszkiewicz A, Pyziel A, Wita I, Moskwa B, Werszko J, Cabaj W. The parasitic fauna of the European bison (Bison bonasus) (Linnaeus, 1758) and their impact on the conservation. Part 2 the structure and changes over time. Acta Parasitol. 2014;59(3):372–9. 10.2478/s11686-014-0253-z.25119349
16. Kiziewicz B Natural infection with Fasciola hepatica (Linnaeus, 1758) in the European bison (Bison bonasus) in Białowieża National Park Pol Helminthologia 2013 50 167 71 10.2478/s11687-013-0127-1
Kiziewicz B. Natural infection with Fasciola hepatica (Linnaeus, 1758) in the European bison (Bison bonasus) in Białowieża National Park. Pol Helminthologia. 2013;50:167–71. 10.2478/s11687-013-0127-1.
17. Filip-Hutsch K Laskowski Z Myczka AW Czopowicz M Moskwa B Demiaszkiewicz AW The occurrence and molecular identification of Thelazia spp. in European bison (Bison bonasus) in the Bieszczady Mountains Sci Rep 2022 12 1 22508 10.1038/s41598-022-27191-x 36581768
Filip-Hutsch K, Laskowski Z, Myczka AW, Czopowicz M, Moskwa B, Demiaszkiewicz AW. The occurrence and molecular identification of Thelazia spp. in European bison (Bison bonasus) in the Bieszczady Mountains. Sci Rep. 2022;12(1):22508.36581768
18. Demiaszkiewicz AW Moskwa B Gralak A Laskowski Z Myczka AW Kołodziej-Sobocińska M Filip-Hutsch K The nematodes Thelazia Gulosa Railiet and Henry, 1910 and Thelazia Skrjabini Erschov, 1928 as a cause of blindness in European Bison (Bison bonasus) in Poland Acta Parasitol 2020 65 963 8 10.1007/s11686-020-00243-w 32613456
Demiaszkiewicz AW, Moskwa B, Gralak A, Laskowski Z, Myczka AW, Kołodziej-Sobocińska M, Filip-Hutsch K. The nematodes Thelazia Gulosa Railiet and Henry, 1910 and Thelazia Skrjabini Erschov, 1928 as a cause of blindness in European Bison (Bison bonasus) in Poland. Acta Parasitol. 2020;65:963–8.32613456
19. Osińska B Demiaszkiewicz AW Lachowicz J Pathological lesions in European bison (Bison bonasus) with infestation by Ashworthius Sidemi 2010 Trichostrongylidae Nematoda
Osińska B, Demiaszkiewicz AW, Lachowicz J. Pathological lesions in European bison (Bison bonasus) with infestation by Ashworthius Sidemi. Trichostrongylidae: Nematoda; 2010.
20. Krzysiak MK Dackiewicz J Kęsik-Maliszewska J Larska M Post-mortem evaluation of pathological lesions in European Bison (Bison bonasus) in the Białowieża Primeval Forest between 2008 and 2013 J Veterinary Res 2014 58 3 421 31 10.2478/bvip-2014-0065
Krzysiak MK, Dackiewicz J, Kęsik-Maliszewska J, Larska M. Post-mortem evaluation of pathological lesions in European Bison (Bison bonasus) in the Białowieża Primeval Forest between 2008 and 2013. J Veterinary Res. 2014;58(3):421–31. 10.2478/bvip-2014-0065.
21. Buchmann K Christiansen LL Kania PW Thamsborg SM Introduced European bison (Bison bonasus) in a confined forest district: a ten year parasitological survey Int J Parasitology: Parasites Wildl 2022 18 292 9 10.1016/j.ijppaw.2022.07.005
Buchmann K, Christiansen LL, Kania PW, Thamsborg SM. Introduced European bison (Bison bonasus) in a confined forest district: a ten year parasitological survey. Int J Parasitology: Parasites Wildl. 2022;18:292–9. 10.1016/j.ijppaw.2022.07.005.
22. Tokarska M Pertoldi C Kowalczyk R Perzanowski K Genetic status of the European bison Bison bonasus after extinction in the wild and subsequent recovery Mammal Rev 2011 41 2 151 62 10.1111/j.1365-2907.2010.00178.x
Tokarska M, Pertoldi C, Kowalczyk R, Perzanowski K. Genetic status of the European bison Bison bonasus after extinction in the wild and subsequent recovery. Mammal Rev. 2011;41(2):151–62. 10.1111/j.1365-2907.2010.00178.x.
23. https://iucn.org Accessed 24 April 2024.
24. IUCN Guidelines for re-introductions. Prepared by the IUCN/SSC re-introductions specialist Group. IUCN, Gland, Switzerland and Cmabridge, UK, 1998.
25. van de Vlasakker J Rewilding Europe Bison Rewilding Plan, 2014–2024 2014 Nijmegen, The Netherlands Publication by Rewilding Europe
van de Vlasakker J. Rewilding Europe Bison Rewilding Plan, 2014–2024. Nijmegen, The Netherlands: Publication by Rewilding Europe; 2014.
26. Skryabin KI, Shikahobalova NP, Schulz RS, Popova TI, Boev SN, Delyamure SL. 1992. Key to Parasitic Nematodes. Vol 3 Strongylata. Edited by Academician K.I. Skryabin, pp. 578–587.
27. Deplazes P, Eckert J, Mathis A, von Samson-Himmelstjerna G, Zahner H. Parasitology in veterinary medicine. Parasitology in Veterinary Medicine. Wageningen Academic; 2016. pp. 303–11.
28. https://www.rvc.ac.uk/review/parasitology/LungwormCattle/Dictyocaulus.htm Accessed 24 April 2024.
29. Gasser RB Chilton NB Hoste H Beveridge I Rapid sequencing of rDNA from single worms and eggs of parasitic helminths Nucleic Acids Res 1993 21 10 2525 6 10.1093/nar/21.10.2525 8506152
Gasser RB, Chilton NB, Hoste H, Beveridge I. Rapid sequencing of rDNA from single worms and eggs of parasitic helminths. Nucleic Acids Res. 1993;21(10):2525–6.8506152
30. Kearse M Moir R Wilson A Stones-Havas S Cheung M Sturrock S Geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data Bioinformatics 2012 28 12 1647 9 10.1093/bioinformatics/bts199 22543367
Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, et al. Geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28(12):1647–9.22543367
31. Demiaszkiewicz AW, Pyziel AM, Filip-Hutsch K, Januszczak M, Olech W. Parasitological monitoring of European bison in the Bieszczady Mountains. 2020, 10.21521/mw.6363
32. Gałązka M Klich D Filip-Hutsch K Olech W Anusz K Pyziel AM Endoparasite loads and the efficacy of conventional anthelmintics against gastrointestinal nematodes in captive European bison Int J Parasitology: Parasites Wildl 2023 21 224 31 10.1016/j.ijppaw.2023.06.005
Gałązka M, Klich D, Filip-Hutsch K, Olech W, Anusz K, Pyziel AM. Endoparasite loads and the efficacy of conventional anthelmintics against gastrointestinal nematodes in captive European bison. Int J Parasitology: Parasites Wildl. 2023;21:224–31. 10.1016/j.ijppaw.2023.06.005.
33. Demiaszkiewicz AW, Filip-Hutsch K, Olech W. Parasitological monitoring of European bison in the West Pomeranian voivodeship on the basis of coproscopical examination. 2023, 10.21521/mw.6717
34. Novikova TV Ryzhakina TP Shestakova SV Ecological survey of helminth fauna in European bison living in freedom under the Vologda region conditions Eur Bison Conserv Newsl 2015 8 75 8
Novikova TV, Ryzhakina TP, Shestakova SV. Ecological survey of helminth fauna in European bison living in freedom under the Vologda region conditions. Eur Bison Conserv Newsl. 2015;8:75–8.
35. Pyziel AM Molecular analysis of lungworms from European bison (Bison bonasus) on the basis of small subunit ribosomal RNA gene (SSU) Acta Parasitol 2014 59 122 5 10.2478/s11686-014-0219-1 24570058
Pyziel AM. Molecular analysis of lungworms from European bison (Bison bonasus) on the basis of small subunit ribosomal RNA gene (SSU). Acta Parasitol. 2014;59:122–5. 10.2478/s11686-014-0219-1.24570058
