
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)13559-1
10.1016/j.heliyon.2024.e37528
e37528
Research Article
ZNF521 promotes acute myeloid leukemogenesis by suppressing the expression and acetylation of SMC3
Qin Rong a
Yang Tongshuo a
Jiang Hongchao hongchaojiang@aliyun.com
b⁎⁎
Yu Ming yuming@kmmu.edu.cn
a⁎
a Hematologic Malignancy Group, Academy of Biomedical Engineering Research, Kunming Medical University, Kunming, 650500, PR China
b Institute of Pediatrics, The Kunming Children's Hospital, Kunming, Yunnan, 650228, PR China
⁎ Corresponding author. yuming@kmmu.edu.cn
⁎⁎ Corresponding author. hongchaojiang@aliyun.com
05 9 2024
30 9 2024
05 9 2024
10 18 e3752820 6 2024
29 7 2024
4 9 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).
Zinc finger protein 521 (ZNF521) participates in the self-renewal of hematopoietic stem cells, and its abnormal expression has been implicated to promote leukemia. However, the specific role of ZNF521 in leukemia has not been fully understood. In this study, we aimed to further elucidate its role. Using acute leukemia cell line THP-1, we demonstrated that knocking down ZNF521 inhibited leukemia cell proliferation, promoted apoptosis, and induced cell arrest in G2/M phase. Interestingly, we also observed the upregulation of SMC3 expression and acetylation, as well as the downregulation of histone deacetylases 8 (HDAC8), CDK2, and CDK6. The proliferation inhibition was reversed by knocking down SMC3, suggesting the key role of SMC3 reduction in ZNF521 elevated proliferation. Conversely, ZNF521 overexpression in HL-60 cells resulted in enhanced proliferation and inhibited apoptosis. Furthermore, we discovered that ZNF521 can interact with HDAC8, which deacetylates SMC3, and the interaction promotes proliferation and suppresses apoptosis. Notably, when HDAC8 was knocked down or its activity was inhibited by a HDAC8 inhibitor, the previous observed trend was reversed. Consequently, ZNF521 plays a critical role in acute myeloid leukemogenesis by reducing the expression and acetylation of SMC3. Overall, this study sheds light on the potential for targeted treatment in highly ZNF521 expressed acute myeloid leukemia, providing a valuable clue for precise and effective therapeutic approaches.

Keywords

ZNF521
SMC3
Leukemia
HDAC8
Acetylation
==== Body
pmc1 Introduction

Proto-oncogene Zinc finger protein 521 (ZNF521) plays a crucial role in maintaining stem cell renewal and blocking cellular differentiation by regulating gene transcription, and it is involved in leukemogenesis process. ZNF521 was first identified as being activated by retroviral integration in mouse B-cell lymphoma [1]. It is highly expressed in acute myeloid leukemia [2,3], and is upregulated through the cooperation of HOXC13 and SPI1 [4]. Zfp521 enhances B-cell proliferation by activating cyclin D1 expression [5], maintains stem cell characteristics, and contributes to leukemogenesis [3,6]. It promotes acute myeloid leukemia (AML) in MLL-AF9 leukemia or E2A-HLF B-cell leukemia [2,7,8]. But the signal pathways involved remain unclear.

Structural maintenance of chromosome 3 (SMC3) is a subunit of cohesin complex [9]. Cohesin regulates the integration and segregation of sister chromatid during the cell cycle, with SMC3 promoting genomic integrity during DNA replication [10] and mediating DNA loop extrusion for chromatin remodeling in interphase cells [11]. SMC3 is also implicated in cancer progress. SMC3 downregulation promotes pancreatic cancer through inhibiting the expression of Rab27a, and its low expression suggests poor prognosis [12]. SMC3 is essential for hematopoiesis, with reduced expression impeding the maturation of myeloid cells [13]. In a Down syndrome leukemia model, Smc3 haploinsufficiency cooperates with GATA1 to enhance clonogenic potential and proliferation of acute megakaryocyte leukemia [14].

SMC3 acetylation is crucial for cell cycle regulation. It is deacetylated during G1 phase, with acetylation level increasing during S phase, and peaking in G2/M phase. SMC3 is deacetylated by histone deacetylases 8 (HDAC8) in G2/M phase to transition to the G1 phase, and the failure of the deacetylation arrests cells in G2/M phase [15,16]. Although ZNF521 interacts with HDAC3 to inhibit osteoblast maturation by suppressing Runx2 expression [17], it is not known whether ZNF521 interacts with HDAC8 to deacetylate SMC3 and regulate the cell cycle.

While studies have investigated ZNF521 and SMC3 respectively, their association remains unclear. In this study, we will explore whether ZNF521 collaborates with HDAC8 to downregulate SMC3, and examine its impact on leukemia.

2 Materials and methods

2.1 Cell culture

The cell lines of THP-1, HL-60, and HEK 293T were obtained from Procell life science & technology (China). These cells had been verified to be free of mycoplasma and authenticated through STR profiling. THP-1 (RRID:CVCL_0006) cells were maintained in RMPI 1640 medium (BI, USA) with 10 % fetal bovine serum (FBS) (Thermo Fisher, USA) and 0.05 mM β-mercaptoethanol (Sigma, USA) at 37 °C under 5 % CO2. HL-60 (RRID:CVCL_0002) cells were cultured in IMDM medium (BI, USA) with 20 % FBS at 37 °C under 5 % CO2. 293T (RRID:CVCL_0063) cells were cultured in high glucose DMEM (BI, USA), containing 10 % FBS at 37 °C and 5 % CO2.

2.2 Plasmid constructs

Plasmids of lenti-shZNF521 and lenti-ZNF521 were purchased from Origene (USA). The sequence of shSMC3 was inserted into Lenti-LV3 vector (Jima, China).

The sequence of shMSC3 is as follow:

shSMC3: CAGCGGTTGGCTTTATTGC.

2.3 Transfection

Cells (5 × 105) were seeded in a 6-well plate and cultured overnight before transfection with siRNA using Lipofectamine RNAiMAX (Thermo fisher) according to protocol. Briefly, 10 μM siRNA and 10 μl RNAiMAX were separately incubated with 100 μl optical-medium (Thermo fisher) at the temperature of 22–25 °C (Room temperature, RT) for 5 min. The solutions were then mixed and incubated at RT for additional 10 min the mixture was added to the cells, and after incubation at 37 °C 5 % CO2 for 48 h, the cells were collected for further analysis. The siHDAC8 sequence is as follow:

SiHDAC8:GCTGGGAGCUGACACAAUA.

2.4 Lentiviral production and transduction

293T cells (5 × 106) were transfected with the 15 μg backbone plasmid (lenti-shZNF521 or lenti-ZNF521), 10 μg PsPAX2 and 5 μg pMD2G using lipofectamine (Invitrogen, USA) after cultured in 10 cm dish for 24 h. The medium was harvested by centrifugation at 5,000 g for 10 min at 4 °C after additional 48 h–72 h of culture. The lentiviral supernatant was collected by centrifugation at 3,000 g for 10 min for transduction or stored at −80 °C.

THP-1 or HL-60 cells (5 × 105) were seeded in a 6-well plate and cultured overnight. They were then incubated with lentiviral supernatant and 4 μg of polybrene for 72 h before further analysis.

2.5 Quantitative RT-PCR

Total RNA was extracted using RNeasy purification kit (Qiagen, USA) after the cells were collected by centrifugation at, 90g for 10 min at 4 °C. cDNA was synthesized using reverse transcriptase III (Thermo fisher, USA). Quantitative PCR was performed with FastStart Essential DNA Green Master (Roche, USA). Relative gene expression was analyzed using the 2−ΔΔCt method with GAPDH as a reference. The primers were as follow:

HDAC8-F:TCGCTGGTCCCGGTTTATATC

HDAC8-R:TACTGGCCCGTTTGGGGAT

SMC3-F: AACATAATGTGATTGTGGGCAGA

SMC3-R: TCCTTTTTGGCACCAATAACTCT

CDK2-F: CCAGGAGTTACTTCTATGCCTGA

CDK2-R: TTCATCCAGGGGAGGTACAAC

CDK6-F: GCTGACCAGCAGTACGAATG

CDK6-R: GCACACATCAAACAACCTGACC

GAPDH-F:GGAGCGAGATCCCTCCAAAAT

GAPDH-R:GGCTGTTGTCATACTTCTCATGG.

2.6 CCK-8 assay

To evaluate cell viability, 5 × 103 cells per well were seeded into a 96-well plate and incubated at 37 °C, 5 % CO2 for 0, 24, 48, 72, 96 and 120 h the cells subjected to a cell counting kit-8 assay by adding 10 μl of CCK-8 solution (Beyotime, China) and further incubating 3 h, the absorbance was measured at 450 nm.

2.7 Apoptotic analysis

Apoptosis was detected using the Annexin V FITC apoptosis detection kit (BD biosciences). Cells were cultured in a 6-well plate at 2 × 105 per well overnight and then transduced with target shRNA or ZNF521 overexpression lentivirus for 48 h. The cells were collected by centrifugation at 90g for 10 min at 4 °C, washed three times with pre-chilled PBS, and incubated with 5 μl Annexin V FITC and 5 μl propidium iodide for 15 min before analysis.

2.8 Cell cycle analysis

The cells at the density of 2 × 105 per well were cultured in a 6-well plate for 48 h. The cells were then collected by centrifugation at 90g for 10 min at 4 °C. The pellet was washed with pre-chilled PBS, and fixed with 70 % ethanol at 4 °C overnight. Subsequently, the cells were then incubated with 65 μg/ml propidium iodide (BD Biosciences) and 50 μg/ml RNase A (Sigma, USA) for 30 min at 4 °C and analyzed by flow cytometry.

2.9 Immunoprecipitation

THP-1 cells (1 × 107) were collected by centrifugation at 90g for 10 min at 4 °C. The pellet was lysed using RIPA buffer (Sigma) containing a protein inhibitor cocktail (Roche) on ice for 30 min, and the lysate was collected by centrifugation at 13,000 g for 10 min at 4 °C, and the protein concentration was determined using BCA method. For immunoprecipitation, 600 μg of protein was incubated with 20 μl protein G magnetic beads (Thermo Fisher, USA) and 2 μg anti-ZNF521 antibodies (Cat No. TA319089, Origene, USA) at 4 °C overnight. The beads were washed three times using RIPA buffer, and then subjected to western blotting.

2.10 Western blotting

Cells were lysed using RIPA buffer containing protein inhibitor cocktail, and the protein concentration was determined by the BCA method. An aliquot of lysate of 50 μg was loaded onto SDS-PAGE gel, and transferred to PVDF membrane. The membrane was blocked with 5 % skimmed milk in TBST buffer at RT for 3 h, and then incubated overnight at 4 °C with primary antibodies against ZNF521 (cat no. TA319089, Origene, USA), HDAC8 (Cat No. TA809689, Origene, USA), SMC3 (Cat No. 14185-1-AP, Proteintech, China), ac-SMC3 (Cat No. MABE1073, Sigma, USA), and GAPDH (Cat No. 60004-1-Ig, Proteintech, China). After washing with TBST 3 times, the membrane was incubated with either goat anti-mouse IgG (Cat No. SA00001-1, Proteintech, China) or goat anti-rabbit IgG (Cat No. SA00001-2, Proteintech, China) for 3 h, followed by ECL detection, and was quantified using Image J (National Institutes of Health).

2.11 Immunofluorescence

THP-1 cells in logarithmic growth (2 × 106) were harvested by centrifugation at 90g for 10 min at 4 °C, and washed by pre-chilled PBS. The cells were then fixed by paraformaldehyde for 10 min at RT. The cells were then incubated with PBS containing 0.5 % Triton X-100 on ice for 10 min and blocked by PBS containing 3 % BSA for 30 min at RT. The cells were then incubated overnight at 4 °C with antibodies of rabbit anti-ZNF521 (Cat No. TA319089, Origene, USA), and mouse anti-HDAC8 (Cat No. CF809689, Origene, USA) at a dilution of 1:100. After washing three times by pre-chilled PBS, the cells were then incubated with Alexa Fluor 488 donkey anti-rabbit IgG (Cat No. ab150073, Abcam, USA) and Alexa Fluor 594 donkey anti-mouse IgG (Cat No. ab150108, Abcam, USA) at RT for 60 min, stained with 100 ng/mL DAPI (Sigma) for 10 min at RT, and finally observed under laser confocal fluorescence microscopy (Zeiss, Germany).

2.12 Protein interaction prediction

The protein sequences of ZNF521 and HDAC8 were obtained from Uniport website and imported to AlphaFold 3 for prediction. In the resulting figure, blue color indicates high prediction confidence, and orange color represents low prediction confidence.

2.13 Statistical analysis

The data are presented as the mean ± SD. Statistical analysis was performed using one-way ANOVA or two-way ANOVA followed by Bonferroni's post hoc test as appropriate.

3 Results

3.1 ZNF521 promotes proliferation and suppresses apoptosis in leukemia cells

To investigate the effect of ZNF521 on leukemogenesis, we analyzed the impact of ZNF521 knockdown on proliferation, apoptosis, and cell cycle. Folling ZNF521 knockdown in THP-1 cells (Fig. S1A), we observed a decrease in proliferation (Fig. S1B) and an increase in apoptosis (Fig. S1C), and cell cycle arrest in the G2/M phase (Fig. S1D). The results indicate that ZNF521 knockdown inhibits cell proliferation, promotes apoptosis, and causes cell cycle arrest in G2/M phase.

3.2 ZNF521 suppresses the expression and acetylation of SMC3

Given that ZNF521 knockdown results in cell cycle arrest at the G2/M phase, we investigated whether ZNF521 is involved in cell cycle regulation. We analyzed the expression of key cell cycle proteins, including CDK2, CDK6, HDAC8, and SMC3 in THP-1 cells with ZNF521 knockdown using quantitative RT-PCR. The results showed a decrease in the expression of CDK2, CDK6 and HDAC8, while SMC3 expression increased (Fig. 1A–D). We focus on SMC3 as its upregulation causes cell arrest at G2/M phase, and on HDAC8 due to its involvement in the deacetylation of SMC3 for exiting G2 phase. Further analysis by western blotting confirmed that ZNF521 knockdown led to increased expression and acetylation of SMC3, and alongside a decrease in HDAC8 expression (Fig. 1E).Fig. 1 ZNF521 promotes HDAC8 expression, but suppresses SMC3 expression and acetylation. A-D:Quantitative RT-PCR analysis of CDK2 (A), CDK6 (B), HDAC8 (C), and SMC3 (D) were performed after THP-1 cells were transduced with shZNF521 for 72 h. E: western blotting analysis of SMC3 expression and acetylation and HDAC8 expression after THP-1 cells were transduced with shZNF521 for 72 h. Data are presented as the mean ± SD of three independent experiments. *: p < 0.05, **: p < 0.01; ***: p < 0.001, ****: p < 0.0001.

Fig. 1

3.3 SMC3 plays a key role in ZNF521 elevated proliferation

After we showed that ZNF521 knockdown increases SMC3 expression and acetylation, we considered that whether downregulating SMC3 could counteract the proliferation inhibition caused by ZNF521 knockdown. Our results demonstrated that SMC3 knockdown effectively reversed the proliferation inhibition observed in THP-1 cells with ZNF521 knockdown (Fig. 2A and B), suggesting that ZNF521 promotes proliferation by inhibiting SMC3. Further analysis revealed that SMC3 knockdown also mitigated the increase in apoptosis and G2/M arrest induced by ZNF521 knockdown (Fig. 2C and D). These findings indicate that ZNF521 indeed promotes proliferation and inhibits apoptosis through the suppression of SMC3.Fig. 2 SMC3 plays a key role in ZNF521 induced proliferation. A–D: SMC3 expression (A), proliferation (B), apoptosis (C), and cell cycle (D) were analyzed after THP-1 cells were transduced with shZNF521 and/or shSMC3 for 72 h. Data are presented as the mean ± SD of three independent experiments. Ns: not significant, *: p < 0.05, **: p < 0.01; ***: p < 0.001, ****: p < 0.0001.

Fig. 2

3.4 ZNF521 interacts with HDAC8 to inhibit SMC3

We have showed that HDAC8 was downregulated following ZNF521 knockdown (Fig. 1C and E). Since previous studies have reported interaction between ZNF521 and HDAC3 [17,18], we investigated whether ZNF521 also interacts with HDAC8. Immunoprecipitation assays confirmed that ZNF521 interacted with HDAC8 (Fig. 3A) and immunofluorescence microscopy further revealed their colocalization (Fig. 3B). Additionally, we utilized AlphaFold 3, an artificial intelligence tool for predicting protein interaction [19], which corroborated the interaction between ZNF51 and HDAC8 (Fig. 3C).Fig. 3 ZNF521 interacts with HDAC8. A: The interaction of ZNF521 and HDAC8 by immunoprecipitation in THP-1 cells. B: immunofluorescent analysis of ZNF521 and HDAC8 in THP-1 cells. C: the interaction of ZNF521 (blue) and HDAC8 (red) predicted by AlphaFold 3.

Fig. 3

Given that ZNF521 interacts with HDAC8, we examined that whether HDAC8 is involved in the downregulation of SMC3. HL-60 cells were infected with ZNF521 overexpression lentivirus and treated with either siHDAC8 or HDAC8 inhibitor PCI-34051. Our results showed that ZNF521 overexpression inhibited SMC3 expression and acetylation, but these effects were reversed by HDAC8 knockdown (siHDCA8) or PCI-34051 (HDCA8i) (Fig. 4A). This suggests that ZNF521 collaborates with HDAC8 to suppress SMC3 expression and acetylation.Fig. 4 The interaction of ZNF521 and HDAC8 promotes proliferation and inhibits apoptosis by suppressing SMC3. A: SMC3 expression and acetylation is inhibited by ZNF521 and HDAC8. Upper panel: the WB and down panel: graphic analysis of WB. B–E: proliferation (B and C) and apoptosis (D–E) were analyzed after HL-60 cells were transduced with ZNF521 overexpression plasmid, and treated with siHDAC8 or HDAC8 inhibitor, and siSMC3 for 72 h. Data are presented as the mean ± SD of three independent experiments. Ns: not significant, **: p < 0.01; ***: p < 0.001, ****: p < 0.0001.

Fig. 4

Furthermore, we analyzed the impact of HDAC8 on ZNF521-mediated proliferation and apoptosis. ZNF521 overexpression enhanced the proliferation of HL-60 cells, and reduced apoptosis. However, these effects were reversed by siHDAC8 or HDAC8i (Fig. 4B–E). SMC3 knockdown also restored the reversal caused by siHDAC8 or PCI-34051. These findings indicate that HDAC8 plays a crucial role in the proliferation of leukemia cells induced by ZNF521.

4 Discussion

ZNF521 plays a pivotal role in promoting leukemia development. Retroviral insertion-induced overexpression of ZNF521 has been linked to the emergence of lymphomas in mice [20]. Furthermore, the protein has been implicated in various malignancies including ovarian cancer [21], gastric cancer [22], and acute myeloid leukemia [7]. Despite extensive research, the precise mechanism underlying ZNF521's role in acute leukemia remains enigmatic. Our study reveals that ZNF521 not only fuels the proliferation of leukemia cells but also suppresses apoptosis. We discovered that knocking down ZNF521 leads to cell cycle arrest in G2/M phase in leukemia cells. This arrest is accompanied by an elevation in both the expression and acetylation of SMC3. It is indeed very interesting, given that failure to deacetylate SMC3 leads to cell cycle arrest in G2/M phase.

Our findings underscore that ZNF521 promotes the proliferation of acute leukemia cells by downregulating its expression and acetylation. SMC3, a component of the cohesin complex, is a critical player in the cell cycle regulation [16]. Its acetylation is essential for cells to progress into the G2 phase, while deacetylation is necessary for their exit from G2/M phase. Our study demonstrated that when ZNF521 is knocked down, cells are halted in the G2/M phase (Fig. S1D), and this halt is accompanied by an increase in both the expression and acetylation of SMC3 (Fig. 1D and E). Notably, the expression of HDAC8, an enzyme responsible for deacetylating SMC3 [15], is reduced following ZNF521 knockdown. This observation is particularly intriguing given the established link between low SMC3 expression and both hematopoiesis and leukemia progression. AML patients exhibiting low SMC3 expression often face a poorer prognosis, while other cohesin proteins do not exhibit such a correlation [23]. Smc3 haploinsufficiency has been shown to impede germinal center differentiation and foster lymphomagenesis [24], further implicating low SMC3 level in leukemia. But how ZNF521 inhibits SMC3 is to be elucidated.

Considering the involvement of HDAC8 in SMC3 deacetylation [15], we investigated its role in ZNF521-mediated SMC3 downregulation. Our results reveal a direct interaction between ZNF521 and HDAC8 (Fig. 3A and B). The interaction appears to be crucial, as the ZNF521-induced reduction in SMC3 expression and acetylation is abrogated by either by siRNA-mediated silence of HDAC8 or pharmacological inhibition of HDAC8 (Fig. 4A). HDAC8 has been implicated in acute leukemia, sustains the leukemia status by inhibiting p53 acetylation [25,26]. Notably, HDAC8 inhibition has been shown to halt leukemia progression [26,27]. Given that HDAC8 deacetylates SMC3 during the late G2 phase [15], and that ZNF521 knockdown leads to cell cycle arrest in the G2/M phase (Fig. S1D), it is conceivable that ZNF521 and HDAC8 collaborate to regulate SMC3 deacetylation. Further, our findings indicate that while HDAC8 inhibition reduces leukemia cell proliferation and induces apoptosis, these effects are reversed by SMC3 knockdown (Fig. 4D–F). This suggests that HDAC8 plays a pivotal role in both ZNF521-mediated SMC3 deacetylation and leukemia development.

In summary, our study established that ZNF521 promotes the development of hematological malignancies by interacting with HDAC8 to downregulate the expression and acetylation of SMC3 (Fig. 5).Fig. 5 The model of ZNF521interacting with HDAC8 to suppress the expression and acetylation of SMC3.

Fig. 5

Data availability

All data generated or analyzed during this study are included in this published article.

Funding

The study was supported by the Association Foundation Program of Yunnan Science and Technology Department and 10.13039/501100003996 Kunming Medical University (grant no. 202101AY070001-074 to MY, 202401AY070001-047 to HJ), the Innovative Research Team of Yunnan Province (202405AS350016 to MY), the 10.13039/501100001809 National Natural Science Foundation of China (grant no. 81960033 to HJ) and Experts training Project for the Academy and Technology in Yunnan province (202005AC160066 to HJ).

CRediT authorship contribution statement

Rong Qin: Formal analysis, Data curation. Tongshuo Yang: Formal analysis. Hongchao Jiang: Investigation, Funding acquisition. Ming Yu: Writing – review & editing, Writing – original draft, Supervision, Project administration, Investigation, Funding acquisition, Conceptualization.

Declaration of competing interest

The authors declare that they have no competing interests.

Appendix A Supplementary data

The following is the Supplementary data to this article:Supplementary Fig. 1 ZNF521 promotes proliferation and inhibits apoptosis in leukemia cells. A-D: ZNF521 expression (A), proliferation (B), apoptosis (C), and cell cycle (D) were analyzed after THP-1 cells were transduced with shZNF521 for 72 h. Data are presented as the mean ± SD of three independent experiments. **: p < 0.01; ***: p < 0.001.

Supplementary Fig. 1

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e37528.
==== Refs
References

1 Justice M.J. Morse H.C. 3rd Jenkins N.A. Copeland N.G. Identification of Evi-3, a novel common site of retroviral integration in mouse AKXD B-cell lymphomas J. Virol. 68 3 1994 1293 1300 8107195
2 Chiarella E. Aloisio A. Scicchitano S. Todoerti K. Cosentino E.G. Lico D. ZNF521 enhances MLL-AF9-dependent hematopoietic stem cell transformation in acute myeloid leukemias by altering the gene expression landscape Int. J. Mol. Sci. 22 19 2021
3 Garrison B.S. Rybak A.P. Beerman I. Heesters B. Mercier F.E. Scadden D.T. ZFP521 regulates murine hematopoietic stem cell function and facilitates MLL-AF9 leukemogenesis in mouse and human cells Blood 130 5 2017 619 624 28615219
4 Yu M. Al-Dallal S. Al-Haj L. Panjwani S. McCartney A.S. Edwards S.M. Transcriptional regulation of the proto-oncogene Zfp521 by SPI1 (PU.1) and HOXC13 Genesis 54 10 2016 519 533 27506447
5 Al Dallal S. Wolton K. Hentges K.E. Zfp521 promotes B-cell viability and cyclin D1 gene expression in a B cell culture system Leuk. Res. 46 2016 10 17 27107743
6 Li Z. Fu X. Wu W. Liu Z. Chen Z. Zhou C. Zfp521 is essential for the quiescence and maintenance of adult hematopoietic stem cells under stress iScience 24 2 2021 102039
7 Germano G. Morello G. Aveic S. Pinazza M. Minuzzo S. Frasson C. ZNF521 sustains the differentiation block in MLL-rearranged acute myeloid leukemia Oncotarget 8 16 2017 26129 26141 28412727
8 Yamasaki N. Miyazaki K. Nagamachi A. Koller R. Oda H. Miyazaki M. Identification of Zfp521/ZNF521 as a cooperative gene for E2A-HLF to develop acute B-lineage leukemia Oncogene 29 13 2010 1963 1975 20062079
9 Koshland D.E. Guacci V. Sister chromatid cohesion: the beginning of a long and beautiful relationship Curr. Opin. Cell Biol. 12 3 2000 297 301 10801457
10 Yueh W.T. Singh V.P. Gerton J.L. Maternal Smc3 protects the integrity of the zygotic genome through DNA replication and mitosis Development 148 24 2021
11 Bauer B.W. Davidson I.F. Canena D. Wutz G. Tang W. Litos G. Cohesin mediates DNA loop extrusion by a "swing and clamp" mechanism Cell 184 21 2021 5448 5464 e22 34624221
12 Bastos N. Castaldo S.A. Adem B. Machado J.C. Melo C.A. Melo S.A. SMC3 epigenetic silencing regulates Rab27a expression and drives pancreatic cancer progression J. Transl. Med. 21 1 2023 578 37641131
13 Wang T. Glover B. Hadwiger G. Miller C.A. di Martino O. Welch J.S. Smc3 is required for mouse embryonic and adult hematopoiesis Exp. Hematol. 70 2019 70 84 e6 30553776
14 Arkoun B. Robert E. Boudia F. Mazzi S. Dufour V. Siret A. Stepwise GATA1 and SMC3 mutations alter megakaryocyte differentiation in a Down syndrome leukemia model J. Clin. Invest. 132 14 2022
15 Dasgupta T. Antony J. Braithwaite A.W. Horsfield J.A. HDAC8 inhibition blocks SMC3 deacetylation and delays cell cycle progression without affecting cohesin-dependent transcription in MCF7 cancer cells J. Biol. Chem. 291 24 2016 12761 12770 27072133
16 Li S. Yue Z. Tanaka T.U. Smc3 deacetylation by Hos1 facilitates efficient dissolution of sister chromatid cohesion during early anaphase Mol. Cell 68 3 2017 605 614 e4 29100057
17 Hesse E. Saito H. Kiviranta R. Correa D. Yamana K. Neff L. Zfp521 controls bone mass by HDAC3-dependent attenuation of Runx2 activity J. Cell Biol. 191 7 2010 1271 1283 21173110
18 Bernaudo F. Monteleone F. Mesuraca M. Krishnan S. Chiarella E. Scicchitano S. Validation of a novel shotgun proteomic workflow for the discovery of protein-protein interactions: focus on ZNF521 J. Proteome Res. 14 4 2015 1888 1899 25774781
19 Abramson J. Adler J. Dunger J. Evans R. Green T. Pritzel A. Accurate structure prediction of biomolecular interactions with AlphaFold 3 Nature 630 8016 2024 493 500 38718835
20 Hentges K.E. Weiser K.C. Schountz T. Woodward L.S. Morse H.C. Justice M.J. Evi3, a zinc-finger protein related to EBFAZ, regulates EBF activity in B-cell leukemia Oncogene 24 7 2005 1220 1230 15580294
21 Scicchitano S. Montalcini Y. Lucchino V. Melocchi V. Gigantino V. Chiarella E. Enhanced ZNF521 expression induces an aggressive phenotype in human ovarian carcinoma cell lines PLoS One 17 10 2022 e0274785
22 Cheng Y. Ni Y.J. Tang L.M. ZNF521/EBF1 axis regulates AKR1B1 to promote the proliferation, migration, and invasion of gastric cancer cells Kaohsiung J. Med. Sci. 39 3 2022 244 253 36397644
23 Kraft B. Lombard J. Kirsch M. Wuchter P. Bugert P. Hielscher T. SMC3 protein levels impact on karyotype and outcome in acute myeloid leukemia Leukemia 33 3 2019 795 799 30323357
24 Rivas M.A. Meydan C. Chin C.R. Challman M.F. Kim D. Bhinder B. Smc3 dosage regulates B cell transit through germinal centers and restricts their malignant transformation Nat. Immunol. 22 2 2021 240 253 33432228
25 Long J. Jia M.Y. Fang W.Y. Chen X.J. Mu L.L. Wang Z.Y. FLT3 inhibition upregulates HDAC8 via FOXO to inactivate p53 and promote maintenance of FLT3-ITD+ acute myeloid leukemia Blood 135 17 2020 1472 1483 32315388
26 Qi J. Singh S. Hua W.K. Cai Q. Chao S.W. Li L. HDAC8 inhibition specifically targets Inv(16) acute myeloid leukemic stem cells by restoring p53 acetylation Cell Stem Cell 17 5 2015 597 610 26387755
27 Zhang P. Brinton L.T. Williams K. Sher S. Orwick S. Tzung-Huei L. Targeting DNA damage repair functions of two histone deacetylases, HDAC8 and SIRT6, sensitizes acute myeloid leukemia to NAMPT inhibition Clin. Cancer Res. 27 8 2021 2352 2366 33542077
