
==== Front
Sci Adv
Sci Adv
sciadv
advances
Science Advances
2375-2548
American Association for the Advancement of Science

adn7724
10.1126/sciadv.adn7724
Research Article
Biomedicine and Life Sciences
SciAdv r-articles
Cell Biology
Stem Cells
Stem Cells
Generation and characterization of giant panda induced pluripotent stem cells
Giant panda induced pluripotent stem cells
https://orcid.org/0009-0008-5177-9129
Liu Yuliang Conceptualization Formal analysis Funding acquisition Investigation Methodology Resources Validation Writing - review & editing 1 2 †
https://orcid.org/0009-0003-5919-8437
Zhang Shihao Conceptualization Data curation Formal analysis Investigation Methodology Project administration Supervision Validation Visualization Writing - original draft Writing - review & editing 3 4 †
Zou Gaoyang Formal analysis Investigation Methodology Validation Visualization 3 5
https://orcid.org/0000-0003-2174-6162
An Junhui Conceptualization Resources Validation 1 2
Li Yuan Conceptualization Investigation Methodology Resources Supervision Validation Writing - review & editing 1 2
Lin Danni Investigation Methodology Visualization 3
https://orcid.org/0000-0002-4099-1924
Wang Donghui Investigation Resources Validation Writing - original draft 1 2
https://orcid.org/0000-0003-4537-7672
Li Yan Formal analysis Investigation Methodology Software Visualization 1 2
Chen Jiasong Resources Writing - review & editing 1 2
https://orcid.org/0000-0002-7928-7707
Feng Tongying Conceptualization Investigation 1 2
Li Hongyan Resources Validation 1 2
Chen Yijiao Validation 1 2
https://orcid.org/0000-0002-2203-1655
Zhang Mingyue Investigation Resources Supervision Visualization Writing - review & editing 1 2
https://orcid.org/0000-0002-3901-9679
Kumar Manish Investigation Supervision Visualization Writing - original draft Writing - review & editing 3
https://orcid.org/0009-0000-8071-0093
Wang Luqin Funding acquisition Project administration Supervision Validation Visualization Writing - review & editing 3 *
https://orcid.org/0009-0008-9208-8244
Hou Rong Conceptualization Funding acquisition Investigation Supervision Validation 1 2 *
https://orcid.org/0000-0003-1600-7744
Liu Jing Conceptualization Data curation Funding acquisition Project administration Supervision Writing - original draft Writing - review & editing 3 5 6 *
1 Chengdu Research Base of Giant Panda Breeding, Sichuan Province, Chengdu 610081, China.
2 Sichuan Key Laboratory of Conservation Biology for Endangered Wildlife, Sichuan Province, Chengdu 610081, China.
3 CAS Key Laboratory of Regenerative Biology, Guangdong Provincial Key Laboratory of Stem Cell and Regenerative Medicine, Guangdong-Hong Kong Joint Laboratory for Stem Cell and Regenerative Medicine, Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences, Guangzhou 510530, China.
4 University of Chinese Academy of Sciences, Beijing 100049, China.
5 Guangzhou Regenerative Medicine and Health Guangdong Laboratory at GIBH, Guangzhou 510530, China.
6 Centre for Regenerative Medicine and Health, Hong Kong Institute of Science & Innovation, Chinese Academy of Sciences, Hong Kong SAR, P.R.China.
* Corresponding author. Email: liu_jing@gibh.ac.cn (J.L.); hourong@panda.org.cn (R.H.); wang_luqin@gibh.ac.cn (L.W.)
† These authors contributed equally to this work.

20 9 2024
20 9 2024
10 38 eadn772428 12 2023
14 8 2024
Copyright © 2024 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works. Distributed under a Creative Commons Attribution NonCommercial License 4.0 (CC BY-NC).
2024
The Authors
https://creativecommons.org/licenses/by-nc/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial license, which permits use, distribution, and reproduction in any medium, so long as the resultant use is not for commercial advantage and provided the original work is properly cited.

The giant panda (Ailuropoda melanoleuca) stands as a flagship and umbrella species, symbolizing global biodiversity. While traditional assisted reproductive technology faces constraints in safeguarding the genetic diversity of giant pandas, induced pluripotent stem cells (iPSCs) known for their capacity to differentiate into diverse cells types, including germ cells, present a transformative potential for conservation of endangered animals. In this study, primary fibroblast cells were isolated from the giant panda, and giant panda iPSCs (GPiPSCs) were generated using a non-integrating episomal vector reprogramming method. Characterization of these GPiPSCs revealed their state of primed pluripotency and demonstrated their potential for differentiation. Furthermore, we innovatively formulated a species-specific chemically defined FACL medium and unraveled the intricate signaling pathway networks responsible for maintaining the pluripotency and fostering cell proliferation of GPiPSCs. This study provides key insights into rare species iPSCs, offering materials for panda characteristics research and laying the groundwork for in vitro giant panda gamete generation, potentially aiding endangered species conservation.

The establishment of giant panda induced pluripotent stem cells contributes to understanding and conservation of this species.

http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China 31970681 http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China 32022019 http://dx.doi.org/10.13039/501100018542 Natural Science Foundation of Sichuan Province 2023NSFSC0170 The Chengdu Giant Panda Breeding Research Foundation CPF2017-16 National Forestry and Grassland Administration CGF2024002 http://dx.doi.org/10.13039/501100021171 Basic and Applied Basic Research Foundation of Guangdong Province 2020A1515110122 National Key R & D Program of China 2018YFE0204800
==== Body
pmcINTRODUCTION

The giant panda (Ailuropoda melanoleuca) is a rare and endangered animal species exclusively found in China, with an estimated wild population of around 2000 individuals (1). This iconic species faces substantial threats to its survival due to various human activities in its habitat, including livestock grazing, roads, herb collection, and logging. Understanding and addressing these challenges are crucial for the conservation of the giant panda and the preservation of its unique ecosystem (2). At present, efforts to conserve the giant panda population have resulted in a measured increase, largely attributed to habitat protection and captive breeding (3). However, the Fourth National Giant Panda Census showed pandas living in 33 isolated populations and 15 populations face a risk of extinction >90%, and it is imperative to preserve the genetic resources of giant pandas (4). As the need to conserve the genetic resources of giant pandas grows more pressing, various cell types, including skin fibroblasts, bone marrow mesenchymal stem cells (MSCs), umbilical cord MSCs, breast milk cells, semen-derived cells, and the fibroblast cell line have been isolated and preserved (5–9). Despite these efforts, the limited proliferative capacity and the weak differentiation ability of these cells hinder their application in giant panda research (10). Giant panda reproduction faces several challenges. Limited gametes and genetic diversity, primarily due to the origin of the captive population from only a few founders, pose notable barriers (11). Moreover, the lack of extensive research into the embryonic development of giant pandas hinders efforts to enhance population size and genetic variety. These issues underscore the critical need for advanced research and innovative approaches in the fields of embryonic development, reproduction, and conservation of giant pandas.

Induced pluripotent stem cells (iPSCs) offer a self-renewing, inexhaustible source of material from endangered species, capable of regenerating various cell types as needed (12). In recent years, the application of iPSC technology has shown promising outcomes in the conservation of genetic resources and exploration of species characteristic for endangered species such as the northern white rhinoceros (Ceratotherium simum cottoni), Grevy’s zebra (Equus grevyi), Tasmanian devil (Sarcophilus harrisii), and Sumatran rhinoceros (Dicerorhinus sumatrensis), among others (13–16). Moreover, iPSC could serve as a crucial tool in preventing species extinction by differentiating into primordial germ cell–like cells, equivalent to primordial germ cells (PGCs) (17). PGCs, the origin of eggs and sperm, can be used in conjunction with assisted reproductive technology to augment the size and diversity of the endangered species population (12). Researchers have successfully generated PGCs from iPSCs in various mammalian species (17–19). As embryonic material from endangered large mammals is limited, iPSCs represent an unprecedented tool to gain insights into embryogenesis and organogenesis, extending beyond applications in innovative conservation strategies. In the context of giant pandas, unique developmental features, including embryonic diapause, the birth of highly underdeveloped fetuses, and comparatively small body size underscore the need for sophisticated tools such as iPSC in advancing research in this field (20–24).

In 2006, Takahashi and Yamanaka (25) achieved the reprogramming of somatic cells into iPSCs using four transcription factors Oct4, Sox2, Klf4, and c-Myc. Subsequently, iPSCs from humans and other species were developed using a similar induction strategy (26–28). In addition, researchers identified other transcription factors, including NANOG, LIN28A, NR5A2, and ESRRB, which play a role in the reprogramming process (26, 29–31). Furthermore, various microRNAs, including miR-302 and miR-372, have been demonstrated to enhance the transformation of fibroblasts into iPSCs (32, 33). To further enhance reprogramming efficiency, researchers have introduced different compounds such as vitamin C, CHIR99021, SGC0946, GSK-LSD1-2HCl, and LiCl into the induction medium. They have also developed efficient reprogramming culture media, such as iCD1 (iPS chemically defined medium1) and iCD3 (iPS chemically defined medium 3) (34–37). The aforementioned studies have laid the groundwork for the development of a practical and efficient iPSC reprogramming system for endangered species. IPSCs are categorized into naïve and primed states based on their growth characteristics in vitro and their potential to give rise to all somatic lineages and the germ line in chimeras (38, 39). The potential for germ cell induction is a distinguishing feature between the naïve and primed state of pluripotent stem cells (PSCs) (38, 40). Simultaneously, through the application of different small-molecule inhibitors and growth factors, the naïve and the primed state can transformed into each other in vitro (41). Therefore, it is crucial to identify the pluripotency state and culture conditions of iPSCs, as well as to understand the signaling networks required for maintaining their pluripotency.

In this study, we achieved a significant milestone by successfully establishing non-integrating iPSCs from primary fibroblasts of giant panda and optimized reprogramming methods. Through our research, we identified the pluripotent state of the giant panda and its ability to differentiate into the three germ layers. In addition, we developed species-specific culture conditions and delineated the signaling pathway networks crucial for that maintaining pluripotency and cell proliferation of giant panda induced pluripotent stem cells (GPiPSCs). The establishment of GPiPSCs is crucial for both safeguarding and leveraging resources from wild populations. This innovation can not only be used to enhance the genetic diversity of captive giant panda populations but also offers valuable resources for advanced research into giant panda stem cells, markedly boosting conservation efforts for this rare species.

RESULTS

Derivation of giant panda pluripotent stem cell

Giant panda fibroblasts (GPFs) at passage 3 or 4 exhibited a characteristic long spindle shape with increased proliferation speed, features essential for our reprogramming system (fig. S1, A and B). In our pursuit of non-integrating iPSCs from GPFs, we opted for an episomal system to deliver the reprogramming factors. The episome, derived from Epstein-Barr virus (EBV) Epstein-Barr nuclear antigen-1 (EBNA1)/Origin of Plasmid (OriP) system, facilitates the replication of transfected plasmid in eukaryotic cells, a method previously used in iPSC generation from different cells (33, 42). We conducted transfections using two episomal vectors via electroporation into giant panda skin fibroblasts. We achieved induction in two stages by changing the culture medium (Fig. 1A). At 34 days postelectroporation, discernible iPS clones were observed (Fig. 1B). Demonstrating the reprogramming efficiencies, we successfully generated approximately 20 alkaline phosphatase (AP)–positive iPS clones from 3 × 105 cells used at the commencement of stage II (Fig. 1C). For each individual panda fibroblast cell line, at least two clones were selected and expanded for subsequent characterization. Notably, the obtained GPiPSC clones displayed AP positivity when cultured in mTeSR Plus medium (Fig. 1D and fig. S1D). The reprogramming progression from GPFs to GPiPSCs was visually represented using t-distributed stochastic neighbor embedding (t-SNE) analysis (Fig. 1E). Subsequently, a heatmap illustrated the differentially expression of genes organized into seven clusters (c1 to c7) among the trajectory of reprogramming. Notably, in the early stages, we observed a down-regulation of somatic programs, succeeded by the up-regulation of a set of genes associated with embryonic development (Fig. 1F). The expression dynamics of key genes remained remarkably consistent throughout the reprogramming process (fig. S1E). Further confirmation through quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis revealed that pluripotency-related genes, including endo-OCT4, endo-SOX2, endo-LIN28A, and endo-SALL4, were up-regulated during the transition (Fig. 1G).

Fig. 1. Derivation of giant panda pluripotent stem cell.

(A) Schematic of reprogramming from fibroblasts to GPiPSCs. (B) Morphology of transduced GPFs on day 0, day 2, day 10, day 26, and day 34. Scale bars, 200 μm. (C) Left: AP staining of iPSCs generated from GPF cells in 12-well plates in mTeSR Plus medium. Right: Reprogramming efficiencies of AP-positive cells. n = 3. (D) Morphology and AP of XR (Xingrong, XX) GPiPSCs-1#and LB (Loubao, XY) GPiPSCs-1# in mTeSR Plus medium. Scale bars, 100 μm. (E) t-SNE analysis of the transcriptomes of GPiPSC induction. (F) Heatmaps of the transcriptomes during GPiPSC induction. (G) qRT-PCR validation of pluripotency genes expression during GPiPSC induction. For (C) and (G), the quantitative data represent the mean ± SE; n = 3 independent experiments.

To enhance reprogramming efficiency and reduce the time required, we introduced various compounds into the induction medium (iCD3). The efficiency of this reprogramming was then evaluated by assessing the AP staining at an earlier time point, specifically 26 days postelectroporation (Fig. 2A). Among them, the components [pipecolic acid, γ-aminobutyric acid, transforming growth factor–β1 (TGFβ1), and LiCl] contained in the second-stage culture medium mTeSR, such as LiCl and TGFβ1, exhibit a stimulatory effect on reprogramming (43, 44). In addition, epigenetic inhibitors Valproic acid (VPA) and 3-deazaneplanocin A (DZNeP) and signaling pathways modulators [bone morphogenetic protein 4 (BMP4), SB431542, RepSox, and A83-01] can also significantly improve the efficiency of reprogramming (Fig. 2B) (45–48). Notably, our investigations revealed that the TGFβ type I receptor kinase (ALK5) inhibitors played a pivotal role in improving induction efficiency and reducing induction time (Fig. 2C). Statistical analysis of AP-positive iPS clones showed that adding A83-01 increased efficiency at least fivefold compared to baseline, with similar effects observed for Repsox and SB431542 (Fig. 2D). Transcriptome analysis revealed that A83-01 notably promoted the expression of pluripotent marker genes (Fig. 2E). In addition, we successfully obtained two GPiPSC clones using the induction medium containing A83-01 (Fig. 2F).

Fig. 2. Enhancing giant panda pluripotent stem cell induction efficiency with ALK5 inhibitors.

(A) Schematic of reprogramming from fibroblasts to GPiPSCs with different compounds. (B) Table of tested compounds and their known targets. (C) AP staining of GPiPSCs reprogrammed by different compounds in 12-well plates in mTeSR Plus medium. (D) Reprogramming efficiencies of different compounds. n = 3. (E) Comparison of transcriptomes of cells reprogrammed by iCD3 and iCD3 + A83-01 in day 18, with differentially expressed genes (DEGs) [>2 times, false discovery rate (FDR) < 0.001, log2TPM > 1]. (F) Morphology and AP staining of XR (Xingrong, XX) GPiPSCs-4#, 5# reprogrammed by iCD3 + A83-0 in mTeSR Plus medium. Scale bars, 100 μm. For (D), the quantitative data represent the mean ± SE; n = 3 independent experiments. ***P < 0.001.

Characterization of pluripotent stem cells in giant panda

To characterize the GPiPSCs obtained by reprogramming somatic cells, specific antibodies were used in immunostaining to confirm the expression of pluripotent marker proteins (SALL4, OCT4, and LIN28A) in both XR-GPiPSCs-1 and LB-GPiPSCs-1 (Fig. 3A), along with additional pluripotent markers such as LIN28B and SOX2 (fig. S2A). Our POU5F1-2A-EGFP-GPiPSC cell line also exhibited activation of endogenous OCT4 expression (fig. S3, C and D). Long-term cell proliferation assays indicated that the pluripotent stem cells maintained rapid growth characteristics (Fig. 3B). Karyotype analysis of cells cultured over extended periods, specifically XR-GPiPSCs-1# (P30) and LB-GPiPSCs-1# (P30), confirmed stable diploid chromosome configurations (Fig. 3C) and consistent colony morphology (fig. S2E).

Fig. 3. Characterization of pluripotent stem cells in giant panda.

(A) Immunostaining of pluripotency marker (SALL4, OCT4, and LIN28A) in GPiPSCs in mTeSR Plus medium. Scale bars, 100 μm. (B) Growth curve of XR GPiPSCs-1# and LB GPiPSCs-1# at passages 10 and 30 in mTeSR Plus medium. (C) Karyotype analysis of XR GPiPSCs-1# and LB GPiPSCs-1# at passage 30 in mTeSR Plus medium. Normal: 42, XX with 20 matched pairs of autosomes and X/X paired sex chromosomes; XY with 20 pairs of matched autosomes and X/Y unpaired sex chromosomes. (D) Scatterplots of transcriptomes of GPiPSCs and GPFs, with DEGs (>2 times, FDR < 0.001, log2TPM > 1). (E) Principal components analysis of GPiPSCs in comparison to iPSCs derived from other species. Each dot represents one dataset. (F) Heatmaps of the transcriptomes between GPiPSCs and other species. (G) Gene Ontology (Biological Process) [GO(BP)] analyses of significantly up-regulated gene (cluster 10) in GPiPSCs. DAPI, 4A,6-diamidino-2-phenylindole; ncRNA, noncoding RNA; tRNA, transfer RNA.

Furthermore, we conducted a further analysis on the gene expression characteristics of GPiPSCs. Transcriptome analysis revealed significant differences in gene expression profiles between GPFs and GPiPSCs, with 1671 down-regulated and 1261 up-regulated genes [>2 times, false discovery rate (FDR) < 0.001, log2TPM (transcript per million) > 1] detected (Fig. 3D). The up-regulation of genes associated with embryonic development and increased cell proliferation was notably observed in GPiPSCs (fig. S3A). Transcriptome profiles of evolutionarily divergent mammalian species PSCs derived from published data (49, 50), mouse (Mus musculus), human (Homo sapiens), dog (Canis familiaris), pig (Sus scrofa), and marmoset (Callithrix jacchus), were collected and compared to our giant panda data. Principal components analyses were conducted to provide a comprehensive overview of these commonalities (Fig. 3E). The correlation coefficients strongly support our hypothesis, illustrating that iPSCs of giant pandas are grouped together with iPSCs of all other mammals (fig. S3B). Through heatmap clustering analysis, we further delineated the unique characteristics of GPiPSCs compared to other mammals. We identified 6561 homologous genes with high expression (TPM ≥ 10) across various species, which we classified into 10 groups (fig. S3C). This analysis showed that GPiPSCs not only have a unique gene expression profile but also share similarities with genomically related species, such as humans and dogs (Fig. 3F) (51). Gene Ontology (GO) analyses revealed that genes in cluster 10, which show elevated expression levels in giant pandas, are enriched in several pathways. These include noncoding RNA metabolism, transfer RNA metabolism, and chordate embryonic development (Fig. 3G).

The primed state of giant panda pluripotent stem cells

The differentiation potential of iPSCs, especially into diverse cell types like PGCs, relies heavily on their pluripotent state. Although we noted that GPiPSCs form three-dimensional clones similar to naïve mouse embryonic stem cell (ESC) clones (Fig. 3A), we further characterized their pluripotent state to identify its specificity. Comparing gene expression profiles between the naïve and primed states of both mouse ESCs and human ESCs, we identified 305 genes up-regulated in the naïve state and 586 genes in the primed states (Fig. 4A). A correlation matrix of these gene expressions revealed that GPiPSCs exhibit a primed state based on these specific genes (Fig. 4B). qRT-PCR analysis further demonstrated the full activation of endogenous pluripotent marker genes (OCT4, SOX2, and SALL4) and primed states marker genes (ZIC2, SOX11, and DNMT3B), whereas naïve states marker genes (TFE3, DNMT3L, and KLF4) were not activated in GPiPSC clones (Fig. 4C). In addition, DNA methylation analysis showed that the promoters of ZIC2 were demethylated, whereas the promoters of TFE3 remained methylated (Fig. 4D). In female mammals, both X chromosomes in the inner cell mass of preimplantation blastocysts or naïve state ESCs remain active; however, one X chromosome becomes transcriptionally inactivated when entering primed state (52). The inactive X (Xi) is characterized by hypermethylation of H3 lysine 27 (53). Immunocytochemical staining demonstrated that the X chromosomes in female XR GPiPSCs remained inactive (Fig. 4E). Collectively, these findings unequivocally indicate that GPiPSCs are in the primed state.

Fig. 4. The primed state of giant panda pluripotent stem cells.

(A) The Venn diagrams identify genes co–up-regulated in the naïve or primed state in human and mouse PSCs, with DEGs (>2 times, FDR < 0.001, log2TPM > 1). (B) The heatmap shows correlation coefficients of gene expression representing the pluripotent state. (C) qRT-PCR validation of pluripotent marker genes (POU5F1, SOX2, and SALL4), primed state marker genes (ZIC2, SOX11, and DNMT3B), and naïve state marker genes (KLF4, TEF3, and DNMT3L) in LB GPiPSCs-1# (LB-1#), LB GPiPSCs-2# (LB-2#), XR GPiPSCs-1# (XR-1#), and XR GPiPSCs-2# (XR-2#). (D) Bisulfite sequencing analysis of the DNA CpG methylation statuses of the primed state marker gene ZIC2 and the naïve state marker gene TEF3 promoter loci in GPiPSCs and GPFs. (E) Immunostaining for hypermethylation of H3 lysine 27me3 (H3K27me3) in mTeSR Plus medium. Scale bars, 10 μm. For (C), the quantitative data represent means ± SE; n = 3 independent experiments. *P < 0.05, **P < 0.01, and ***P < 0.001.

Differentiation potential of giant panda pluripotent stem cells

To further assess the differentiation potential of GPiPSCs, we monitored the formation of embryoid bodies (EBs) (Fig. 5A). RT-PCR analyses revealed a decrease in the expression OCT4, SALL4, and LIN28A, while the expression of ectodermal markers (NESTIN and PAX6) increased in the early stages of differentiation. In the later stages of differentiation, mesodermal markers (TBX5, GATA4, and SMA) and endodermal transcription factors (GATA6 and SOX17) were activated (Fig. 5B). Immunofluorescence analysis further confirmed that the differentiated cells were positive for the ectoderm marker beta-III-TUBULIN, mesoderm markers SMA and GATA4, and the endoderm marker SOX17 (Fig. 5C). Moreover, we generated EBs from POU5F1-2A-EGFP GPiPSCs. Fluorescence microscopy results indicated a gradual weakening of the green fluorescence of POU5F1-2A-EGFP with some cells eventually showing no green fluorescence (fig. S3A). Hematoxylin and eosin (H&E) staining revealed that teratoma derived from GPiPSCs displayed the typical structure of three germ layers, including neural rosettes (ectoderm), muscle fibers and adipocyte (mesoderm), and gut-like epithelia (endoderm) (Fig. 5D).

Fig. 5. Potentiation of differentiation in giant panda pluripotent stem cells.

(A) EBs derived from GPiPSCs in differentiation medium. Images were taken at days 4, 8, 12, 16, and 20. Scale bars, 200 μm. (B) qRT-PCR validation of selected genes at days 4, 8, 12, 16, and 20 of EB differentiation. (C) Immunostaining for markers of endoderm (SOX17), mesoderm (SMA and GATA4), and ectoderm (β3-TUBULIN). Scale bars, 50 μm. (D) Images of teratoma derived from GPiPSCs at 45 days and microscopic images of H&E-stained sections of teratoma. Scale bars, 50 μm. For (B), the quantitative data represent means ± SE; n = 3 independent experiments. *P < 0.05, **P < 0.01, and ***P < 0.001.

Signaling pathways maintaining pluripotency in giant panda pluripotent stem cells

The GPiPSC culture system uses a chemically defined medium (mTeSR Plus) along with Matrigel. However, the complexity of mTeSR Plus medium components makes it challenging to identify the specific signaling molecules essential for the extended in vitro culture of GPiPSCs. This limitation impedes a comprehensive understanding of the unique characteristics of GPiPSCs, particularly in the context of their evolutionary comparisons with other animal species. Primed state PSCs (PSCs) require basic fibroblast growth factor (bFGF or FGF2) and depend on the activin/nodal pathway to maintain pluripotency. FA medium, which includes N2B27 medium supplemented with bFGF and activin A, is used for cultivating these primed state PSCs (39, 54, 55). Initially, we observed that FA medium was insufficient to maintain colony morphology of GPiPSCs (fig. S4A). Subsequently, we supplemented the FA medium with different signaling molecules necessary for the extended in vitro culture of ESCs. Notably, we discovered that GPiPSCs could maintain their morphology in FA medium supplemented with 3 μM specific GKS3 inhibitor CHIR99021 (fig. S4A). In addition, our findings highlighted the contribution of leukemia inhibitory factor (LIF) to the maintenance of GPiPSCs cell morphology during long-term culture (fig. S4D). We demonstrated that GPiPSCs can uphold pluripotency, as evidenced by pluripotency gene (OCT4-2A-GFP) expression, in FACL medium (N2B27 medium containing bFGF, activin A, CHIR99021, and LIF) (Fig. 6A). The results of AP staining and growth curve further supported the maintenance of pluripotency during long-term culture in FACL medium (fig. S4, B and C). Subsequently, we compared the proliferation efficiency in FACL medium and mTeSR Plus. Notably, the proliferation efficiency of GPiPSC in FACL medium exceeded that in mTeSR Plus (Fig. 6B). Furthermore, transcriptomic analysis demonstrated that primary GPiPSC in FACL medium exhibited similarities to those in mTeSR Plus (Fig. 6C).

Fig. 6. Signaling pathways maintaining pluripotency in giant panda pluripotent stem cells.

(A) Morphology and fluorescence images of POU5F1-2A-EGFP GPiPSCs in mTeSR Plus medium and FACL medium. Scale bars, 100 μm. (B) Growth curve of GPiPSCs in mTeSR Plus medium and FACL medium. (C) Scatterplots comparing the global gene expression of GPiPSCs in mTeSR Plus medium and FACL medium, with DEGs (>4 times, FDR < 0.001, log2TPM > 1). (D) Morphology and fluorescence images of GPiPSCs culture in FACL medium and FACL medium minus different components. Scale bars, 100 μm. (E) Growth curve of giant panda PSCs in FACL medium and FACL medium minus different components. (F) Scatterplots comparing the global gene expression of giant panda PSCs in FACL medium and FACL medium minus CHIR99021, with DEGs (>2 times, FDR < 0.001, log2TPM > 1). (G) GO analyses of significantly up-regulated gene in FACL medium minus CHIR99021. (H) Heatmap of the transcriptome data of lineage marker genes between FACL medium and FACL medium minus CHIR99021. (I) Fluorescence images of pluripotent marker proteins (SALL4 and LIN28A) in FACL medium and FACL medium minus CHIR99021. Scale bars, 100 μm. (J) Heatmaps of the transcriptome data of CKIs between FACL medium and FACL medium minus CHIR99021, phycoerythrin (PE-A). (K) Result of cell cycle in FACL medium and FACL medium minus CHIR99021. For (B), (E), and (K), the quantitative data represent means ± SE; n = 3 independent experiments. **P < 0.01.

In the subsequent investigation, we delved into the roles of different components of FACL medium. Notably, we observed that the removal of CHIR99021 or FGF2 significantly impaired the proliferation of GPiPSCs (Fig. 6, D and E). In particular, the withdrawal of CHIR99021 led to a decrease in OCT4-2A-GFP expression and an alteration of clone morphology (Fig. 6D). Removal of activin A or LIF did not exhibit significant effect on short-term culture; however, during extended culture, the cells differentiated and displayed morphological heterogeneity (fig. S4D). The activation of WNT signaling by CHIR99021 is known to have effects on both the maintenance of pluripotency and differentiation (56). Regarding the impact of CHIR99021 withdrawal, transcriptome analysis revealed the up-regulation of 1478 genes and the down-regulation of 522 genes (Fig. 6F). GO analysis indicated that the up-regulated genes were enriched in the development of distinct germ layers and cell growth (Fig. 6G). The heatmap illustrated distinct differences in stemness and lineage marker expression between conditions with CHIR99021 withdrawal and those with FACL medium (Fig. 6H). Following the withdrawal of CHIR99021, the mRNA levels of stemness markers, such as POU5F1 and LIN28A, decreased, while the mRNA levels of lineage markers associated with endodermal (EOMES and CXCR4), mesodermal (CDH2 and SNAI1), and ectodermal (PAX6 and FOXP2) differentiation increased. This expression trend was consistently observed in qRT-PCR analysis (Fig. 6E). In FAL medium, cells demonstrated differentiation characteristics. There was a significant reduction in the expression of pluripotent marker proteins such as SALL4 and LIN28A, along with the appearance of differentiation-specific cells (Fig. 6I). The presence of neural-specific proteins, PAX6 and FOXP2, was observed, suggesting a shift toward neural differentiation (fig. S6F). It is known that cell cycle arrest is mediated through the expression of CIP/KIP [CDKN1A (p21), CDKN1B (p57), and CDKN1C (p27)] and INK4 [CDKN2A (p15), CDKN2B (p16), CDKN2C (p18), and CDKN2D (p14)] family members of cyclin dependent kinase (CDK) inhibitors (CKIs) (57–59). Furthermore, the high proliferation rate of ESCs is believed to be partly due to the very low expression of p21 (60). The heatmap demonstrated the up-regulation of these genes after the withdrawal of CHIR99021 (Fig. 6J). RT-PCR analysis revealed a significant increase in the expression of CDKN1A (p21) (fig. S6G). Correspondingly, after removing CHIR99021, the cell cycle is arrested, and more cells remain in the G1 phase (Fig. 6K). Consequently, CHIR99021 may promote the proliferation of GPiPSCs by maintaining the low expression levels of CKIs. In summary, these findings collectively confirm that the optimized culture conditions in FACL facilitate the long-term stable maintenance and expansion of pluripotent GPiPSCs.

DISCUSSION

In the wake of the groundbreaking generation of iPSCs from mice and humans, somatic cell reprogramming technology has made substantial strides in extending its application to various mammalian species. This study marks a pioneering effort as we report the successful generation of iPSCs from the giant panda—transforming GPFs into GPiPSCs. This accomplishment underscores the potential of somatic cell reprogramming in contributing to the preservation and study of endangered species. Drawing inspiration from reprogramming methods used in other species, we devised a two-step induction protocol using two induction media, iCD3 and mTeSR Plus. To enhance efficiency, we incorporated an ALK5 inhibitor into iCD3, a strategic modification that significantly improved induction efficiency and expedited the overall induction process (Fig. 7A). The optimization of our induction system for GPiPSCs lays the foundation for establishing a comprehensive resource library of these PSCs. This refined methodology not only contributes to the efficiency of iPSC generation from giant pandas but also sets the stage for broader applications in the study of endangered species.

Fig. 7. Proposed model for generation and characterization of iPSCs in giant pandas.

Primary fibroblast cells are isolated from the giant panda, and GPiPSCs are generated using a non-integrating episomal vector reprogramming method, while ALK5 inhibitors can enhance GPiPSC induction efficiency. GPiPSCs were in the primed state when cultured in FACL medium and have the ability to differentiate into the three germ layers.

The GPiPSCs generated in this study exhibited pluripotent stem cell (PSC) characteristics, as evidenced by their morphology and the expression of key pluripotency markers such as POU5F1, SALL4, LIN28A, and SOX2. A comparative analysis revealed that the pluripotency profile of GPiPSCs closely aligns with that of many mammalian species. While this study sheds light on the pluripotent nature of iPSCs from a rare species, it also underscores the importance of acknowledging variations in gene expression across different species. These observed differences warrant further investigation and exploration, offering a promising avenue for future research and discovery. Our findings contribute valuable insights into the gene expression basis underlying mammalian PSCs, deepening our understanding of iPSCs derived from a species of conservation concern. Simultaneously, we explored the differentiation potential of the generated GPiPSCs into the three germ layers. Our findings revealed that GPiPSCs exhibit the capability to differentiate into various cell types, marking a notable contribution to the repertoire of resources for basic research on giant pandas and clinical treatment of giant panda diseases (Fig. 7A). This versatile differentiation capacity underscores the broader implications of iPSC technology, advancing our understanding of giant panda biology and offering potential therapeutic avenues for addressing health concerns in this endangered species.

PSCs are categorized into two distinct pluripotent states: naïve and primed. Naïve PSCs exhibit heightened pluripotency, demonstrating the ability to form chimeric embryos and differentiate into PGCs (61). In contrast, primed PSCs are characterized by a greater commitment along the differentiation pathway (41). Our results unequivocally indicate that the iPSCs derived in this study exist in a primed pluripotent state (Fig. 7A). This finding serves as a foundational platform for our ongoing efforts to establish an induction system aimed at obtaining naïve state giant panda stem cells and PGCs. This pivotal advancement represents a substantial stride toward our ultimate objective of using GPiPSCs for in vitro generation of gamete cells and embryos.

PSCs in various species rely on distinct signaling networks to preserve their stem cell identity, dictated by their respective pluripotent state (62). In mice, the maintenance of naïve pluripotency in mouse ESCs typically involves both LIF signaling and BMP4 signaling (63–65). Conversely, in humans, human ESCs exhibit a primed state of pluripotency and depend on bFGF and activin A for sustained self-renewal (66). In our study, we observed that the pluripotency of GPiPSCs was effectively sustained in vitro through the use of chemically defined media, mTeSR Plus or FACL medium. Notably, bFGF and activin A emerged as key regulators in maintaining pluripotency in giant pandas, showcasing a conservation of their roles compared to primed pluripotency observed in other species. However, unlike in humans and mice, the specific GSK3 inhibitor CHIR99021 plays a pivotal role in sustaining the primed pluripotency in GPiPSCs (Fig. 7A). The species-specific signaling networks contribute invaluable insights into understanding the embryological development process of giant pandas and shed light on the variations in embryonic development between distinct species.

Collectively, the findings presented in this study represent a substantial contribution to the progression of our knowledge regarding mammalian PSCs. The successful derivation of iPSCs from GPFs stands out as a remarkable achievement. The reprogramming used for GPiPSCs serves as a valuable reference model, offering insights and guidance for the establishment of iPSCs from other endangered species. This work not only expands our understanding of PSCs but also has practical implications for the conservation and study of diverse endangered species. Moreover, the transcriptome analysis and the development of chemically defined media for GPiPSCs unveiled crucial molecular features and distinctive signaling networks, enhancing our comprehension of GPiPSC characterization. The establishment of these GPiPSCs not only contributes notable insights but also represents a valuable resource in the continuous endeavors to conserve the biodiversity of giant pandas. ESCs, typically derived from in vitro embryos, serve as the gold standard for studying the characteristics and functions of PSCs (67, 68). However, procuring ESCs from giant pandas presents considerable challenges. Techniques such as superovulation and ovum pick-up are prohibited, making it difficult to harvest eggs from living giant pandas. In addition, the scarcity of deceased individuals, many of whom are aged or in poor health, further complicates the collection of viable eggs. Establishing and researching GPiPSCs not only enhance our understanding of pluripotency and differentiation in giant pandas but also aid in developing methodologies for acquiring, cultivating, and identifying giant panda ESCs from in vitro embryos in future studies. Moving forward, the GPiPSCs generated in this study harbor substantial potential for studying unique developmental features, such as embryonic diapause and the birth of highly underdeveloped fetuses, making notable contributions to both scientific understanding and the conservation efforts aimed at safeguarding this endangered species.

MATERIALS AND METHODS

Ethics statement

The experiments involving animal research conforms to the policies and procedures outlined in the Institutional Animal Care and Use Committee (IACUC) of the Chengdu Research Base of Giant Panda Breeding and has been approved by the IACUC for experimentation. The IACUC approval number is 2018029.

Isolation and culture of GPFs

All GPFs used in this study were sourced from the Chengdu Research Base of Giant Panda Breeding. Skin tissue samples from two pandas, Xingrong (female, 13 years old, studbook number: 680) and Loubao (male, 14 years old, studbook number: 703), were processed. The tissue was initially digested with collagenase I (2 mg/ml) at 37°C for 45 min and then centrifuged at 800g for 5 min to remove debris. Further digestion was conducted with 0.25% trypsin-EDTA at 37°C for 30 min to isolate the GPFs. These cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM)/F12 supplemented with 10% fetal bovine serum (FBS), 1% nonessential amino acid (NEAA), 1% GlutaMAX, and 1× antibiotic-antimycotic solution at 37°C in a 5% CO2 environment.

Generation of GPiPSCs

GPFs at early passages were isolated through trypsin treatment (0.25% trypsin/0.5 mM EDTA, Gibco) and subjected to electroporation with specified episomal plasmids. This process used the Amaxa Basic Nucleofector Kit for primary fibroblasts cells, program T-020 (Lonza), or cells could be resuspended in phosphate-buffered saline (PBS) solution and electroporated using Gene Pulser MXcell Electroporation System (Bio-Rad). The electroporated GPFs were seeded onto Matrigel (BD) precoated P6 wells. Each electroporation involved 6 μg of pEP4 E02S ET2K (contains OCT4, SOX2, SV40LT, and KLF4) and 3 μg of pCEP4-miR-302-367 cluster (containing miR-302b, miR-302c, miR-302a, miR-302d, and miR-367). Plasmid pEP4 E02S ET2K was purchased from Addgene (#20927) (33, 42). We used pCEP4 (Invitrogen, #V04450) as the backbone and amplified miR-302-367 clusters using amplification primers (forward primer: GCAAGCTTGCTAGCGGCCCGAGAGGACCTGATTTCCCCAGG; reverse primer: TCAATGTATTATTATTATCATGTCTGGATCCTTTAACCAGTTAACCAC). The vector (pCEP4-miR-302-367 cluster) was obtained through homologous recombination.

For stage I induction, GPFs were cultured in iCD3 medium [DMEM (HyClone), 1× N2 (Gibco), 1× B27 (Gibco), 1% GlutaMAX (Gibco), 1% NEAA (Gibco), 0.1 mM 2-mercaptoethanol (Gibco), vitamin C (50 μg/ml; Sigma-Aldrich), thiamine HCL (9 μg/ml; Sigma-Aldrich), vitamin B12 (1.4 μg/ml; Sigma-Aldrich), bFGF (10 ng/ml; PeproTech), Human Leukemia Inhibitory Factor (hLIF) (10 ng/ml; PeproTech), 5 μM Y27632 (TargetMol), 1 μM GSK-LSD1 (TargetMol), 1 μM SGC0946 (Selleck), and 3 μM CHIR99021 (Sigma-Aldrich)]. This medium was changed daily. In stage II, cells from iCD3 medium were passaged as single cells into mTeSR Plus, and daily changes were made for the last 8 days. GPiPSC clones were selected around day 34.

GPiPSC culture

GPiPSCs were cultured on Matrigel in either mTeSR Plus or FACL medium [N2B27 medium, bFGF (12.5 ng/ml; PeproTech), activin A (20 ng/ml; PeproTech), hLIF (10 ng/ml; PeproTech), and 3 μM CHIR99021 (Sigma-Aldrich)]. Daily medium changes were performed, and passaging was carried out using trypsin treatment (0.25% trypsin/0.5 mM EDTA, Gibco). The N2B27 medium was composed of 50% DMEM/F12 (Gibco), 50% neurobasal (Gibco), 1× N2 (Gibco), 1× B27 (Gibco), 1% GlutaMAX (Gibco), 1% NEAA (Gibco), and 0.1 mM 2-mercaptoethanol (Gibco).

EB formation

GPiPSCs were diluted to 25,000/ml in differentiation medium [DMEM (Hyclone), 1% NEAA (Gibco), 1% GlutaMAX (Gibco), 0.1 mM 2-mercaptoethanol (Gibco), and 15% FBS (Biovision)], with 20 μl per drop aliquoted on low-adsorption plates for suspension culture to form sphere [Day 0 (D0)]. The medium was changed every 2 to 3 days. EB samples were collected on D4, 8, 12, 16, and 20. For immunofluorescence, after 8 days of floating culture, the EBs were transferred to gelatin-coated plate and cultured in the same medium for another 8 days.

Teratoma formation

GPiPSCs cells were dissociated into single cells, with 2 × 106 cells suspended in Matrigel and subcutaneously injected subcutaneously into 6-week-old immunodeficiency NCG (NOD/ShiLtJGpt-Prkdcem26Cd52Il2rgem26Cd22/Gpt) female mice, Teratomas were typically obtained within 7 to 8 weeks. After dissection, teratomas were dissected and fixed with 4% paraformaldehyde (PFA) for 24 hours at room temperature. The fixed teratomas were embedded in paraffin and sectioned for H&E staining.

Quantitative reverse transcription polymerase chain reaction

Total RNAs were isolated with TRIzol. For qPCR, cDNA was prepared with HiScript II Q RT SuperMix for qPCR (#R222-01, Vazyme) and then qPCR with ChamQ SYBR qPCR Master Mix (#Q311-02, Vazyme). The construction of RNA library was performed with the VAHTS mRNA-seq V3 Library Prep Kit for Illumina (#NR611, Vazyme), and sequencing was performed on the illumina NovaSeq 6000 platform with a NovaSeq 6000 S4 Reagent kit v1.5. The qPCR primers for pluripotent marker genes and relative genes used in this research can be found in table S1.

Immunofluorescence

The GPiPS colonies were cultured in a 24-well plate. When the state and size of iPS colonies are well enough, the iPS clones were washed three times with PBS. One hundred fifty microliters of 4% PFA was added to cells for 30 min at room temperature to fix it. A total of 4% PFA was discarded, and cells were washed three times with PBS. Then, an equal volume of 0.1% Triton X-100 and 3% bovine serum albumin was added to penetrate and block at room temperature. Subsequently, cells were washed three times with PBS and incubated with a primary antibody at 4°C overnight. After washing in PBS five times, cells were incubated for 2 hours in a second antibody at room temperature away from light. After that, cells were washed three times with PBS and incubated with 4′,6-diamidino-2-phenylindole for 1 min. Last, 500 μl of PBS was added, and cells were observed by an inverted fluorescence microscope.

AP staining

AP activity was assessed using the AP Detection Kit (Yeasen, 40749ES60) following the manufacturer’s instructions.

Bisulfite genomic sequencing

DNA was extracted using the Wizard Genomic DNA Purification Kit (Promage, A1120). The isolated DNA was modified by bisulfite treatment and purified using EpiTect Plus Bisulfite Kits (QIAGEN, 59124). The bisulfite-modified DNA was then amplified by PCR using TaKaRa Taq DNA Polymerase (TaKaRa Taq DNA Polymerase, R001AM). A list of the primers used is provided in table S1. The amplified fragments were cloned into pMD 18-T vector using the pMD 18-T Vector Cloning Kit (Takara, 6011), and vectors were transferred into Escherichia coli DH5α. Ten randomly picked clones from each sample were sequenced.

RNA-seq and gene expression analysis

Total RNA was isolated. Alignment of the high-quality RNA sequencing (RNA-seq) data and gene expression quantification was performed by using the high-speed transcript quantification tool Kallisto (v0.44.0). Differentially expressed genes were obtained using edgeR package (v3.28.1) implemented in the R software (v3.4.1). These differentially expressed genes in different species were analyzed using the R package Mfuzz (version 2.48.0). Functional enrichment analysis of GO terms and pathways was performed using a gene annotation and analysis resource (Metascape).

Statistics and reproducibility

Representative results from a minimum of three independent experiments were presented in all figure panels. Statistical differences were determined using a two-tailed unpaired t test, with a P value < 0.05 considered statistically significant. *P < 0.05, **P < 0.01, ***P < 0.001. Error bars represent the mean ± SE.

Acknowledgments

We thank A. Smith and G. Guo for helpful discussions and valuable insights on the manuscript.

Funding: This work was supported by National Key Research and Development Program of China (2018YFE0204800 to J.L.), National Forestry and Grassland Administration (CGF2024002 to R. Hou), Chengdu Giant Panda Breeding Research Foundation (CPF2017-16 to Y. Liu), National Natural Science Foundation of China (31970681 and 32022019 to J.L.), Guangdong Basic and Applied Basic Research Foundation (2020A1515110122 to L.W.), and Natural Science Foundation of Sichuan Province (2023NSFSC0170 to Y. Liu).

Author contributions: J.L. and Y. Liu designed the project. Y. Liu, S.Z., and G.Z. performed experiments. J.A., Yuan Li, and D.W. isolated the primary GPF cells. S.Z. and D.L. performed the teratoma injection. J.A. and Yan Li analyzed RNA-seq data. Y. Liu and S.Z. supervised the data analysis. S.Z. and M.K. wrote the original draft. All authors edited the paper. J.L., R.H., and L.W. supervised the whole study.

Competing interests: The authors declare that they have no competing interests.

Data and materials availability: RNA-seq data generated in this study have been deposited in the Gene Expression Omnibus (GEO) database under accession code GSE250292. Accession numbers of the data reported are listed in table S2. Source data for Figs. 1 to 6 and extended data for Figs. 1, 2, 4, and 5 are provided with the paper. All other data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials.

Supplementary Materials

The PDF file includes:

Figs. S1 to S5

Tables S1 to S4

Legends for data S1 and S2

Other Supplementary Material for this manuscript includes the following:

Data S1 and S2
==== Refs
REFERENCES AND NOTES

1 F. Wei, H. Fan, Y. Hu, Ailuropoda melanoleuca (Giant Panda). Trends Genet. 36 , 68–69 (2020).31727389
2 D. Kang, A review of the impacts of four identified major human disturbances on the habitat and habitat use of wild giant pandas from 2015 to 2020. Sci. Total Environ. 763 , 142975 (2021).33109372
3 R. R. Swaisgood, D. Wang, F. Wei, Panda downlisted but not out of the woods. Conserv. Lett. 11 , e12355 (2018).
4 L. Kong, W. Xu, Y. Xiao, S. L. Pimm, H. Shi, Z. Ouyang, Spatial models of giant pandas under current and future conditions reveal extinction risks. Nat. Ecol. Evol. 5 , 1309–1316 (2021).34312523
5 M. Zhang, R. Hou, H. Zheng, Q. Zhu, Z. Zhang, Y. Liu, Establishment and cryopreservation of a giant panda skin fibroblast cell line. Chin. J. Biol. 40 , 61–67 (2005).
6 Y. Liu, Y. Liu, S. Yie, J. Lan, J. Pi, Z. Zhang, H. Huang, Z. Cai, M. Zhang, K. Cai, H. Wang, R. Hou, Characteristics of mesenchymal stem cells isolated from bone marrow of giant panda. Stem Cells Dev. 22 , 2394–2401 (2013).23557186
7 Y. Liu, F. Li, Z. Cai, D. Wang, R. Hou, H. Zhang, M. Zhang, S. Yie, K. Wu, C. Zeng, J. An, Isolation and characterization of mesenchymal stem cells from umbilical cord of giant panda. Tissue Cell 71 , 101518 (2021).33676235
8 Y. Liu, Y. Li, R. Hou, Z. Cai, D. Wang, J. Chen, F. Li, Y. Chen, J. An, Isolation, culture, and characterization of cells derived from giant panda (Ailuropoda melanoleuca) semen. In Vitro Cell. Dev. Biol. Anim. 57 , 381–385 (2021).33928488
9 Y. Liu, J. Chen, T. Feng, R. Hou, Z. Cai, D. Wang, M. Zhang, Y. Li, Y. Chen, J. An, The establishment of giant panda (Ailuropoda melanoleuca) fibroblast cell line. In Vitro Cell. Dev. Biol. Anim. 58 , 194–198 (2022).35362864
10 J. D. Ballou, R. C. Lacy, K. Traylor-Holzer, K. Bauman, J. A. Ivy, C. Asa, Strategies for establishing and using genome resource banks to protect genetic diversity in conservation breeding programs. Zoo Biol. 42 , 175–184 (2023).36205245
11 J. Yang, F. Shen, R. Hou, Y. Da, Genetic composition of captive panda population. BMC Genet. 17 , 133 (2016).27716024
12 V. Selvaraj, D. E. Wildt, B. S. Pukazhenthi, Induced pluripotent stem cells for conserving endangered species? Nat. Methods 8 , 805–807 (2011).21959133
13 I. F. Ben-Nun, S. C. Montague, M. L. Houck, H. T. Tran, I. Garitaonandia, T. R. Leonardo, Y. C. Wang, S. J. Charter, L. C. Laurent, O. A. Ryder, J. F. Loring, Induced pluripotent stem cells from highly endangered species. Nat. Methods 8 , 829–831 (2011).21892153
14 P. Weeratunga, A. Shahsavari, D. A. Ovchinnikov, E. J. Wolvetang, D. J. Whitworth, Induced pluripotent stem cells from a marsupial, the tasmanian devil (Sarcophilus harrisii): Insight into the evolution of mammalian pluripotency. Stem Cells Dev. 27 , 112–122 (2018).29161957
15 Y. Endo, K. I. Kamei, K. Hasegawa, K. Okita, H. Ito, S. Terada, M. Inoue-Murayama, Generation and gene expression profiles of Grevy’s zebra induced pluripotent stem cells. Stem Cells Dev. 31 , 250–257 (2022).35316100
16 V. Zywitza, S. Frahm, N. Kruger, A. Weise, F. Goritz, R. Hermes, S. Holtze, S. Colleoni, C. Galli, M. Drukker, T. B. Hildebrandt, S. Diecke, Induced pluripotent stem cells and cerebral organoids from the critically endangered Sumatran rhinoceros. iScience 25 , 105414 (2022).36388963
17 K. Hayashi, H. Ohta, K. Kurimoto, S. Aramaki, M. Saitou, Reconstitution of the mouse germ cell specification pathway in culture by pluripotent stem cells. Cell 146 , 519–532 (2011).21820164
18 H. Cheng, D. Shang, R. Zhou, Germline stem cells in human. Signal Transduct. Target. Ther. 7 , 345 (2022).36184610
19 M. Hayashi, V. Zywitza, Y. Naitou, N. Hamazaki, F. Goeritz, R. Hermes, S. Holtze, G. Lazzari, C. Galli, J. Stejskal, S. Diecke, T. B. Hildebrandt, K. Hayashi, Robust induction of primordial germ cells of white rhinoceros on the brink of extinction. Sci. Adv. 8 , eabp9683 (2022).36490332
20 M. Sutherland-Smith, P. J. Morris, S. Silverman, Pregnancy detection and fetal monitoring via ultrasound in a giant panda (Ailuropoda melanoleuca). Zoo Biol. 23 , 449–461 (2004).
21 X. Zhu, D. G. Lindburg, W. Pan, K. A. Forney, D. Wang, The reproductive strategy of giant pandas (Ailuropoda melanoleuca): Infant growth and development and mother–infant relationships. J. Zool. 253 , 141–155 (2001).
22 D. Lai, J. Cao, W. Wang, Measurement and analysis on some internal organs of four giant pandas. J. Mianyang Agricultural College 7 , 50–53 (1990).
23 G. B. Schaller, The giant pandas of Wolong. Quart. Rev. Biol. 60 , 524–525 (1985).
24 J. Wauters, K. S. Wilson, T. Cools, C. Vancsok, T. Bouts, B. Mulot, A. Leclerc, M. Haapakoski, J. Kok, R. Kühne, A. Ochs, W. C. Duncan, S. J. Girling, T. B. Hildebrandt, Q. Zhou, R. Li, Y. Zhou, K. Cai, Y. Liu, R. Hou, D. Li, Pregnancy length and health in giant pandas: What can metabolic and urinary endocrine markers unveil? Theriogenology Wild 3 , 100063 (2023).
25 K. Takahashi, S. Yamanaka, Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126 , 663–676 (2006).16904174
26 J. Yu, M. A. Vodyanik, K. Smuga-Otto, J. Antosiewicz-Bourget, J. L. Frane, S. Tian, J. Nie, G. A. Jonsdottir, V. Ruotti, R. Stewart, I. I. Slukvin, J. A. Thomson, Induced pluripotent stem cell lines derived from human somatic cells. Science 318 , 1917–1920 (2007).18029452
27 H. Liu, F. Zhu, J. Yong, P. Zhang, P. Hou, H. Li, W. Jiang, J. Cai, M. Liu, K. Cui, X. Qu, T. Xiang, D. Lu, X. Chi, G. Gao, W. Ji, M. Ding, H. Deng, Generation of induced pluripotent stem cells from adult rhesus monkey fibroblasts. Cell Stem Cell 3 , 587–590 (2008).19041774
28 Y. Su, L. Wang, Z. Fan, Y. Liu, J. Zhu, D. Kaback, J. Oudiz, T. Patrick, S. P. Yee, X. C. Tian, I. Polejaeva, Y. Tang, Establishment of bovine-induced pluripotent stem cells. Int. J. Mol. Sci. 22 , 10489 (2021).34638830
29 B. Feng, J. Jiang, P. Kraus, J. H. Ng, J. C. Heng, Y. S. Chan, L. P. Yaw, W. Zhang, Y. H. Loh, J. Han, V. B. Vega, V. Cacheux-Rataboul, B. Lim, T. Lufkin, H. H. Ng, Reprogramming of fibroblasts into induced pluripotent stem cells with orphan nuclear receptor Esrrb. Nat. Cell Biol. 11 , 197–203 (2009).19136965
30 B. Wang, L. Wu, D. Li, Y. Liu, J. Guo, C. Li, Y. Yao, Y. Wang, G. Zhao, X. Wang, M. Fu, H. Liu, S. Cao, C. Wu, S. Yu, C. Zhou, Y. Qin, J. Kuang, J. Ming, S. Chu, X. Yang, P. Zhu, G. Pan, J. Chen, J. Liu, D. Pei, Induction of pluripotent stem cells from mouse embryonic fibroblasts by Jdp2-Jhdm1b-Mkk6-Glis1-Nanog-Essrb-Sall4. Cell Rep. 27 , 3473–3485 e5 (2019).31216469
31 J. C. Heng, B. Feng, J. Han, J. Jiang, P. Kraus, J. H. Ng, Y. L. Orlov, M. Huss, L. Yang, T. Lufkin, B. Lim, H. H. Ng, The nuclear receptor Nr5a2 can replace Oct4 in the reprogramming of murine somatic cells to pluripotent cells. Cell Stem Cell 6 , 167–174 (2010).20096661
32 D. Subramanyam, S. Lamouille, R. L. Judson, J. Y. Liu, N. Bucay, R. Derynck, R. Blelloch, Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. Nat. Biotechnol. 29 , 443–448 (2011).21490602
33 Y. Xue, X. Cai, L. Wang, B. Liao, H. Zhang, Y. Shan, Q. Chen, T. Zhou, X. Li, J. Hou, S. Chen, R. Luo, D. Qin, D. Pei, G. Pan, Generating a non-integrating human induced pluripotent stem cell bank from urine-derived cells. PLOS ONE 8 , e70573 (2013).23940595
34 M. A. Esteban, T. Wang, B. Qin, J. Yang, D. Qin, J. Cai, W. Li, Z. Weng, J. Chen, S. Ni, K. Chen, Y. Li, X. Liu, J. Xu, S. Zhang, F. Li, W. He, K. Labuda, Y. Song, A. Peterbauer, S. Wolbank, H. Redl, M. Zhong, D. Cai, L. Zeng, D. Pei, Vitamin C enhances the generation of mouse and human induced pluripotent stem cells. Cell Stem Cell 6 , 71–79 (2010).20036631
35 O. Bar-Nur, J. Brumbaugh, C. Verheul, E. Apostolou, I. Pruteanu-Malinici, R. M. Walsh, S. Ramaswamy, K. Hochedlinger, Small molecules facilitate rapid and synchronous iPSC generation. Nat. Methods 11 , 1170–1176 (2014).25262205
36 J. Chen, J. Liu, Y. Chen, J. Yang, J. Chen, H. Liu, X. Zhao, K. Mo, H. Song, L. Guo, S. Chu, D. Wang, K. Ding, D. Pei, Rational optimization of reprogramming culture conditions for the generation of induced pluripotent stem cells with ultra-high efficiency and fast kinetics. Cell Res. 21 , 884–894 (2011).21445094
37 B. Wang, C. Li, J. Ming, L. Wu, S. Fang, Y. Huang, L. Lin, H. Liu, J. Kuang, C. Zhao, X. Huang, H. Feng, J. Guo, X. Yang, L. Guo, X. Zhang, J. Chen, J. Liu, P. Zhu, D. Pei, The NuRD complex cooperates with SALL4 to orchestrate reprogramming. Nat. Commun. 14 , 2846 (2023).37208322
38 J. Nichols, A. Smith, Naive and primed pluripotent states. Cell Stem Cell 4 , 487–492 (2009).19497275
39 D. Kumari, “States of pluripotency: Naive and primed pluripotent stem cells” in Pluripotent Stem Cells-From the Bench to the Clinic, M. Tomizawa, Ed. (InTech, 2016), pp. 31–45.
40 N. Irie, L. Weinberger, W. W. Tang, T. Kobayashi, S. Viukov, Y. S. Manor, S. Dietmann, J. H. Hanna, M. A. Surani, SOX17 is a critical specifier of human primordial germ cell fate. Cell 160 , 253–268 (2015).25543152
41 L. Weinberger, M. Ayyash, N. Novershtern, J. H. Hanna, Dynamic stem cell states: Naive to primed pluripotency in rodents and humans. Nat. Rev. Mol. Cell Biol. 17 , 155–169 (2016).26860365
42 J. Yu, K. Hu, K. Smuga-Otto, S. Tian, R. Stewart, I. I. Slukvin, J. A. Thomson, Human induced pluripotent stem cells free of vector and transgene sequences. Science 324 , 797–801 (2009).19325077
43 Q. Wang, X. Xu, J. Li, J. Liu, H. Gu, R. Zhang, J. Chen, Y. Kuang, J. Fei, C. Jiang, P. Wang, D. Pei, S. Ding, X. Xie, Lithium, an anti-psychotic drug, greatly enhances the generation of induced pluripotent stem cells. Cell Res. 21 , 1424–1435 (2011).21727907
44 X. Liu, H. Sun, J. Qi, L. Wang, S. He, J. Liu, C. Feng, C. Chen, W. Li, Y. Guo, D. Qin, G. Pan, J. Chen, D. Pei, H. Zheng, Sequential introduction of reprogramming factors reveals a time-sensitive requirement for individual factors and a sequential EMT–MET mechanism for optimal reprogramming. Nat. Cell Biol. 15 , 829–838 (2013).23708003
45 X. Chen, Y. Zhai, D. Yu, J. Cui, J. F. Hu, W. Li, Valproic acid enhances iPSC induction from human bone marrow-derived cells through the suppression of reprogramming-induced senescence. J. Cell. Physiol. 231 , 1719–1727 (2016).26620855
46 P. Hou, Y. Li, X. Zhang, C. Liu, J. Guan, H. Li, T. Zhao, J. Ye, W. Yang, K. Liu, J. Ge, J. Xu, Q. Zhang, Y. Zhao, H. Deng, Pluripotent stem cells induced from mouse somatic cells by small-molecule compounds. Science 341 , 651–654 (2013).23868920
47 P. Samavarchi-Tehrani, A. Golipour, L. David, H.-K. Sung, T. A. Beyer, A. Datti, K. Woltjen, A. Nagy, J. L. Wrana, Functional genomics reveals a BMP-driven mesenchymal-to-epithelial transition in the initiation of somatic cell reprogramming. Cell Stem Cell 7 , 64–77 (2010).20621051
48 N. Maherali, K. Hochedlinger, Tgfβ signal inhibition cooperates in the induction of iPSCs and replaces Sox2 and cMyc. Curr. Biol. 19 , 1718–1723 (2009).19765992
49 S. Yoshimatsu, M. Nakajima, A. Iguchi, T. Sanosaka, T. Sato, M. Nakamura, R. Nakajima, E. Arai, M. Ishikawa, K. Imaizumi, H. Watanabe, J. Okahara, T. Noce, Y. Takeda, E. Sasaki, R. Behr, K. Edamura, S. Shiozawa, H. Okano, Non-viral induction of transgene-free iPSCs from somatic fibroblasts of multiple mammalian species. Stem Cell Rep. 16 , 754–770 (2021).
50 A. C. Carter, B. N. Davis-Dusenbery, K. Koszka, J. K. Ichida, K. Eggan, Nanog-independent reprogramming to iPSCs with canonical factors. Stem Cell Rep. 2 , 119–126 (2014).
51 R. Li, W. Fan, G. Tian, H. Zhu, L. He, J. Cai, Q. Huang, Q. Cai, B. Li, Y. Bai, Z. Zhang, Y. Zhang, W. Wang, J. Li, F. Wei, H. Li, M. Jian, J. Li, Z. Zhang, R. Nielsen, D. Li, W. Gu, Z. Yang, Z. Xuan, O. A. Ryder, F. C.-C. Leung, Y. Zhou, J. Cao, X. Sun, Y. Fu, X. Fang, X. Guo, B. Wang, R. Hou, F. Shen, B. Mu, P. Ni, R. Lin, W. Qian, G. Wang, C. Yu, W. Nie, J. Wang, Z. Wu, H. Liang, J. Min, Q. Wu, S. Cheng, J. Ruan, M. Wang, Z. Shi, M. Wen, B. Liu, X. Ren, H. Zheng, D. Dong, K. Cook, G. Shan, H. Zhang, C. Kosiol, X. Xie, Z. Lu, H. Zheng, Y. Li, C. C. Steiner, T. T.-Y. Lam, S. Lin, Q. Zhang, G. Li, J. Tian, T. Gong, H. Liu, D. Zhang, L. Fang, C. Ye, J. Zhang, W. Hu, A. Xu, Y. Ren, G. Zhang, M. W. Bruford, Q. Li, L. Ma, Y. Guo, N. An, Y. Hu, Y. Zheng, Y. Shi, Z. Li, Q. Liu, Y. Chen, J. Zhao, N. Qu, S. Zhao, F. Tian, X. Wang, H. Wang, L. Xu, X. Liu, T. Vinar, Y. Wang, T.-W. Lam, S.-M. Yiu, S. Liu, H. Zhang, D. Li, Y. Huang, X. Wang, G. Yang, Z. Jiang, J. Wang, N. Qin, L. Li, J. Li, L. Bolund, K. Kristiansen, G. K.-S. Wong, M. Olson, X. Zhang, S. Li, H. Yang, J. Wang, J. Wang, The sequence and de novo assembly of the giant panda genome. Nature 463 , 311–317 (2010).20010809
52 I. Okamoto, C. Patrat, D. Thepot, N. Peynot, P. Fauque, N. Daniel, P. Diabangouaya, J. P. Wolf, J. P. Renard, V. Duranthon, E. Heard, Eutherian mammals use diverse strategies to initiate X-chromosome inactivation during development. Nature 472 , 370–374 (2011).21471966
53 A. Wutz, Gene silencing in X-chromosome inactivation: Advances in understanding facultative heterochromatin formation. Nat. Rev. Genet. 12 , 542–553 (2011).21765457
54 S. Morgani, J. Nichols, A.-K. Hadjantonakis, The many faces of pluripotency: In vitro adaptations of a continuum of in vivo states. BMC Dev. Biol. 17 , 7 (2017).28610558
55 M. Kinoshita, M. Barber, W. Mansfield, Y. Cui, D. Spindlow, G. G. Stirparo, S. Dietmann, J. Nichols, A. Smith, Capture of mouse and human stem cells with features of formative pluripotency. Cell Stem Cell 28 , 453–471.e8 (2021).33271069
56 H. Kim, J. Wu, S. Ye, C.-I. Tai, X. Zhou, H. Yan, P. Li, M. Pera, Q.-L. Ying, Modulation of β-catenin function maintains mouse epiblast stem cell and human embryonic stem cell self-renewal. Nat. Commun. 4 , 2403 (2013).23985566
57 M. Malumbres, M. Barbacid, Cell cycle, CDKs and cancer: A changing paradigm. Nat. Rev. Cancer 9 , 153–166 (2009).19238148
58 E. T. Canepa, M. E. Scassa, J. M. Ceruti, M. C. Marazita, A. L. Carcagno, P. F. Sirkin, M. F. Ogara, INK4 proteins, a family of mammalian CDK inhibitors with novel biological functions. IUBMB Life 59 , 419–426 (2007).17654117
59 T. Abbas, A. Dutta, p21 In cancer: Intricate networks and multiple activities. Nat. Rev. Cancer 9 , 400–414 (2009).19440234
60 S. Ruiz, A. D. Panopoulos, A. Herrerias, K. D. Bissig, M. Lutz, W. T. Berggren, I. M. Verma, J. C. Izpisua Belmonte, A high proliferation rate is required for cell reprogramming and maintenance of human embryonic stem cell identity. Curr. Biol. 21 , 45–52 (2011).21167714
61 M. Saitou, M. Yamaji, Primordial germ cells in mice. Cold Spring Harb. Perspect. Biol. 4 , a008375 (2012).23125014
62 F. Varzideh, J. Gambardella, U. Kansakar, S. S. Jankauskas, G. Santulli, Molecular mechanisms underlying pluripotency and self-renewal of embryonic stem cells. Int. J. Mol. Sci. 24 , 8386 (2023).37176093
63 Q. L. Ying, J. Wray, J. Nichols, L. Batlle-Morera, B. Doble, J. Woodgett, P. Cohen, A. Smith, The ground state of embryonic stem cell self-renewal. Nature 453 , 519–523 (2008).18497825
64 X. Qi, T. G. Li, J. Hao, J. Hu, J. Wang, H. Simmons, S. Miura, Y. Mishina, G. Q. Zhao, BMP4 supports self-renewal of embryonic stem cells by inhibiting mitogen-activated protein kinase pathways. Proc. Natl. Acad. Sci. U.S.A. 101 , 6027–6032 (2004).15075392
65 H. Niwa, T. Burdon, I. Chambers, A. Smith, Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev. 12 , 2048–2060 (1998).9649508
66 R. K. Humphrey, G. M. Beattie, A. D. Lopez, N. Bucay, C. C. King, M. T. Firpo, S. Rose-John, A. Hayek, Maintenance of pluripotency in human embryonic stem cells is STAT3 independent. Stem Cells 22 , 522–530 (2004).15277698
67 C. A. Cowan, I. Klimanskaya, J. McMahon, J. Atienza, J. Witmyer, J. P. Zucker, S. Wang, C. C. Morton, A. P. McMahon, D. Powers, D. A. Melton, Derivation of embryonic stem-cell lines from human blastocysts. N. Engl. J. Med. 350 , 1353–1356 (2004).14999088
68 M. J. Evans, M. H. Kaufman, Establishment in culture of pluripotential cells from mouse embryos. Nature 292 , 154–156 (1981).7242681
