
==== Front
Redox Biol
Redox Biol
Redox Biology
2213-2317
Elsevier

S2213-2317(24)00324-0
10.1016/j.redox.2024.103346
103346
Research Paper
LOX-mediated ECM mechanical stress induces Piezo1 activation in hypoxic-ischemic brain damage and identification of novel inhibitor of LOX
Jiang Dongya a1
Zhao Jing b1
Zheng Jie f
Zhao Yingmin d
Le Meini b
Qin Dani e
Huang Qiong b
Huang Jinyu c
Zhao Qingshun qingshun@nju.edu.cn
a⁎⁎
Wang Long wanglong@hospital.westlake.edu.cn
c⁎⁎⁎
Dong Xiaohua njfishxiaohua@163.com
b⁎
a Model Animal Research Center, Medical School, Nanjing University, Nanjing, Jiangsu, China
b Hongqiao International Institute of Medicine, Tongren Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China
c Department of Cardiology, Translational Medicine Research Center, Affiliated Hangzhou First People's Hospital, School of Medicine, Westlake University
d Department of Pediatric, Jingjiang People's Hospital Affiliated to Yangzhou University, Jingjiang, China
e Department of Pediatrics, Yixing People's Hospital, Yixing, China
f School of Basic Medical Sciences, State Key Laboratory of Medical Neurobiology, MOE Frontiers Center for Brain Science, Institutes of Brain Science, and Department of Neurology, Huashan Hospital, Fudan University, Shanghai, China
⁎ Corresponding author. njfishxiaohua@163.com
⁎⁎ Corresponding author. qingshun@nju.edu.cn
⁎⁎⁎ Corresponding author. wanglong@hospital.westlake.edu.cn
1 These authors contribute equally to this work.

07 9 2024
10 2024
07 9 2024
76 10334622 8 2024
5 9 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the CC BY-NC license (http://creativecommons.org/licenses/by-nc/4.0/).
Hypoxic-ischemic encephalopathy (HIE) poses a significant challenge in neonatal medicine, often resulting in profound and lasting neurological deficits. Current therapeutic strategies for hypoxia-ischemia brain damage (HIBD) remain limited. Ferroptosis has been reported to play a crucial role in HIE and serves as a potential therapeutic target. However, the mechanisms underlying ferroptosis in HIBD remain largely unclear. In this study, we found that elevated lysyl oxidase (LOX) expression correlates closely with the severity of HIE, suggesting LOX as a potential biomarker for HIE. LOX expression levels and enzymatic activity were significantly increased in HI-induced neuronal models both in vitro and in vivo. Notably, we discovered that HI-induced brain tissue injury results in increased stiffness and observed a selective upregulation of the mechanosensitive ion channel Piezo1 in both brain tissue of HIBD and primary cortex neurons. Mechanistically, LOX increases its catalytic substrates, the Collagen I/III components, promoting extracellular matrix (ECM) remodeling and possibly mediating ECM cross-linking, which leads to increased stiffness at the site of injury and subsequent activation of the Piezo1 channel. Piezo1 senses these stiffness stimuli and then induces neuronal ferroptosis in a GPX4-dependent manner. Pharmacological inhibition of LOX or Piezo1 ameliorated brain neuronal ferroptosis and improved learning and memory impairments. Furthermore, we identified traumatic acid (TA) as a novel LOX inhibitor that effectively suppresses LOX enzymatic activity, mitigating neuronal ferroptosis and promoting synaptic plasticity. In conclusion, our findings elucidate a critical role for LOX-mediated ECM mechanical stress-induced Piezo1 activation in regulating ferroptotic cell death in HIBD. This mechanistic insight provides a basis for developing targeted therapies aimed at ameliorating neurological outcomes in neonates affected by HIBD.

Graphical abstract

Image 1

Keywords

LOX
HIBD
Ferroptosis
Piezo1
TA
==== Body
pmc1 Introduction

Hypoxic-ischemic encephalopathy is a severe neurological disorder in newborns, associated with high mortality and long-term disability rates [1]. Pathologically, HIE is characterized by neuronal injury, brain edema, and neuroinflammation, all of which contribute to significant neurological deficits and subsequent developmental impairments, including cerebral palsy, epilepsy, cognitive deficits, and behavioral disorders [2,3]. The pathological process of neonatal HIBD is complex, with its molecular mechanisms and signaling pathways largely undetermined. Currently, therapeutic hypothermia is the only recognized treatment for HIBD in full-term newborns [3,4]. However, hypothermia therapy is only partially effective for moderate to severe HIBD, with an effective rate of less than 50 %. Additionally, the time window for cooling intervention is limited to within 6 h post-injury, restricting its clinical application [5,6]. Thus, there is an urgent need to elucidate the pathological mechanisms of HIE and identify potential therapeutic targets.

Ferroptosis, a regulated form of cell death characterized by iron-dependent lipid peroxidation, has emerged as a significant contributor to HI-induced neuronal injury, thereby promoting the extensive neuronal loss and subsequent neurological impairments observed in neonatal HIE [7]. Ferroptosis is tightly controlled by oxidation and antioxidant systems, primarily involving the system xc−-glutathione-glutathione peroxidase 4 (GPX4)-dependent antioxidant defense [8]. GPX4 is a key enzyme that protects cells from lipid peroxidation by directly converting phospholipid hydroperoxides to non-toxic lipid alcohols [9,10]. Pharmacological inhibition or genetic ablation of GPX4 significantly promotes ferroptotic cell death [11,12]. Targeting ferroptosis through the use of iron chelators, antioxidants, and inhibitors of lipid peroxidation holds potential as a therapeutic strategy to mitigate neuronal damage and improve outcomes in neonates with HIE [13,14]. Understanding the precise mechanisms of ferroptosis in HIE is crucial for developing effective treatments to protect the vulnerable neonatal brain from HI-induced injury.

LOX, a secreted copper-dependent amine oxidase, primarily facilitates the remodeling of the ECM and the cross-linking of collagen and/or elastin to generate highly reactive aldehyde residues [15]. This process increases tissue tensile strength and contributes to structural integrity, playing a crucial role in normal embryonic development and tissue repair [16]. Interestingly, LOX is a hypoxia-sensitive gene, reported to be induced by hypoxic tumor cells. The enzymatic activity of LOX is involved in the formation of the premetastatic niche for tumor growth [17]. Furthermore, recent insights demonstrate that LOX is expressed in the central nervous system (CNS) and is implicated in neurological diseases such as Alzheimer's disease, cerebral hemorrhage, and seizures [18]. However, whether LOX participates in HI-induced neuronal injury remains to be determined.

Here, we identified the LOX as a potential biomarker for HIE, noting its upregulation in response to HI induced neurological damage. We observed significant differences in the mechanical properties between HI-induced brain tissues and non-injured brain tissues in HIBD rat brain slices. Mechanistically, we demonstrated that HI-induced LOX overexpression regulates ECM remodeling by modulating collagen content and possibly promoting ECM crosslinking. This modulation transduces mechanical signals to neurons, activating the mechanosensitive Piezo1 channel, allowing extracellular calcium influx, and inducing cell ferroptosis. Furthermore, our results indicated that administering the LOX inhibitor β-Aminopropionitrile (BAPN) or the Piezo1-specific inhibitor GsMTx4 reduced neuronal damage and improved cognitive function in neonatal HIBD rats. This suggests that LOX and Piezo1 could be potential therapeutic targets for HIE treatment. Notably, we identified a new LOX-specific inhibitor, TA, which mitigated neuronal damage and promoted synaptic plasticity in HIBD rats. This indicates that TA may offer a novel therapeutic approach to combat HI-induced neuronal injury by suppressing LOX-mediated ferroptosis.

2 Materials and methods

2.1 Clinic samples collection

The peripheral blood of the neonates was collected as we previously reported [19]. Infants diagnosed with HIE were included in this study based on the following criteria: arterial cord blood pH less than 7.0 and an Apgar score below 5 at 5 min post-birth. Criteria for the control group were defined as the Apgar score exceeding 8 at 5 min after birth, and normal performance during the first three days of life. The clinical characteristics of the HIE and the control group are shown in Table 1.Table 1 Baseline characteristics.

Table 1Characteristics	Control	HIE	
Number	10	10	
Age (mean)	5 d	1 d	
Sex	
Male, n (%)	6 (60.0 %)	5 (50.0 %)	
Female, n (%)	4 (40.0 %)	5 (50.0 %)	
5 min Apgar	
1-2, n (%)	0 (0 %)	5 (50.0 %)	
3-4, n (%)	0 (0 %)	5 (50.0 %)	
9-10, n (%)	10 (100 %)	0 (0 %)	
10 min Apgar	
<6, n (%)	0 (0.0 %)	9 (90.0 %)	
6-8, n (%)	0 (0.0 %)	1 (10.0 %)	
10, n (%)	10 (100 %)	0 (0 %)	

2.2 Cell culture and treatment

HT22 cells, a widely used neuronal cell line derived from mouse hippocampal neurons (FuHeng Biology Co., Ltd, Shanghai, China), were cultured in Dulbecco's Modified Eagle Medium (DMEM, Gibco, USA) supplemented with 10 % fetal bovine serum (FBS, Gibco, USA) and 1 % penicillin-streptomycin solution (PS, Gibco, USA). Under normal conditions, HT22 cells were maintained in a cell incubator at 37 °C with 5 % CO2. For OGD/R injury, TA (MCE, HY 119358, USA) was added to the HT22 culture medium 12 h prior to treatment, followed by replacement with glucose-free DMEM containing 1 % PS. The cells were then incubated under hypoxic conditions with 5 % CO2, 94.9 % N2, and 0.1 % O2 for 12 h, and subsequently reoxygenated under normal conditions for 0, 12, 24, or 36 h. For BAPN (MCE, HY Y1750, USA) treatment, 500 nM BAPN was added to the HT22 culture medium before OGD. For GsMTx4 (MCE, HY P1410, USA) and Yoda1 (MCE, HY 18723, USA) interventions, 50 nM GsMTx4 or 5 nM Yoda1 was added to the HT22 culture medium prior to OGD.

Primary rat cortical neurons were isolated from postnatal day 0 Sprague-Dawley (SD) rats. Briefly, the dissected cerebral cortex was digested with 0.25 % trypsin for 15 min at 37 °C. The digestion was stopped by replacing trypsin with DMEM containing 10 % F12 and 10 % FBS, and the cells were washed twice with this medium. The cells were then cultured on petri dishes coated with Poly-d-Lysine (0.01 mg/ml, Gibco, A38904-01, USA) in DMEM containing 10 % F12 and 10 % FBS for 4 h. After initial attachment, the cortical neurons were maintained in serum-free neurobasal medium (Gibco, 17,504–044, USA) supplemented with 1 % GlutaMAX and 2 % B27, and incubated at 37 °C with 5 % CO2. For hypoxia-ischemia (HI) treatment, the cultured rat cortical neurons were exposed to a hypoxic environment (5 % CO2, 90 % N2, 5 % O2) for 1 h, followed by reoxygenation under normal conditions for 12 h. For TA treatment, TA was added to the neuronal culture medium 12 h prior to OGD.

2.3 Quantitative real-time PCR (qPCR)

Total RNA was extracted with RNA isolater Total RNA Extraction Reagent (Vazyme, R701-01, Nanjing) according to the instruction. The cDNA synthesized with HiScript II Q Select RT SuperMix for qPCR (+gDNA wiper) (Vazyme, R222-01, Nanjing) according to the instruction. The qPCR was performed as we previously reported.

Total RNA was extracted using the RNA isolater Total RNA Extraction Reagent (Vazyme, R701-01, Nanjing) following the manufacturer's instructions. cDNA was synthesized using the HiScript II Q Select RT SuperMix for qPCR (+gDNA wiper) (Vazyme, R222-01, Nanjing), also according to the manufacturer's instructions. qPCR was performed as previously described [20], using PowerUP SYBR Green Master Mix (Thermo Fisher, USA) on an ABI StepOne Plus system. The primer sequences of LOX were 5′- ACTGCACACACACAGGGATT -3’ (Forward) and 5′- AGCTGGGGTTTACACTGACC -3’ (Reverse), the primer sequences of β-Actin were 5′- GACGACATGGAGAAAATCTG -3’ (Forward) and 5′- ATGATCTGGGTCATCTTCTC -3’ (Reverse). Relative expression levels were calculated using the 2–ΔΔCt method, with β-Actin serving as the internal control.

2.4 Cell viability assay

Cell viability was assessed using the Cell Counting Kit-8 (CCK8, Beyotime, C0039, China). Cells were incubated with a reaction solution added at 1/10 of the culture medium volume for 2 h in a cell incubator at 37 °C with 5 % CO2. Absorbance was measured at 450 nm using the Multiskan FC microplate reader (Thermo Fisher).

2.5 FerroOrange staining

To detect cellular iron accumulation, cells were incubated with 1 μmol/L FerroOrange (Dojindo, F374, Japan). Briefly, the culture medium was discarded, and the cells were washed three times with PBS before incubation with FerroOrange for 30 min at 37 °C. Iron staining was then visualized using the confocal microscope (Leica SP8, Germany).

2.6 Intracellular [Ca2+]i measurement

Intracellular [Ca2+]i levels were measured using the Fluo-4 Calcium Ion Detection Kit (Beyotime, S1061S, China) following the manufacturer's instructions. Cells were incubated with 1× Fluo-4 AM staining solution and 1× Solubility Enhancer at 37 °C for 30 min. After staining, the cells were incubated with Hoechst (Beyotime, C1017, China) at 37 °C for 10 min to label the nuclei, followed by three washes to remove any excess dye. The fluorescence intensity was then imaged using the confocal microscope (Leica SP8, Germany) and analyzed with ImageJ software.

2.7 Reactive oxygen species (ROS) assay

ROS levels were measured using the ROS assay kit (Applygene Technologies Inc., C1300-2, China) according to the manufacturer's instructions. Briefly, cells were incubated with a 10 μM DHE probe for 30 min in a dark, humidified chamber at 37 °C. The fluorescence intensity was then imaged using the confocal microscope (Leica SP8, Germany) and analyzed with ImageJ software.

2.8 Immunofluorescence (IF)

The IF staining was carried out as we previously reported [20]. Primary rat cortical neurons were fixed with 4 % paraformaldehyde (PFA) for 20 min at 4 °C and then washed with PBST. The samples were incubated at 4 °C with primary antibodies against GPX4 (Proteintech, 67,763-1-lg, 1:500, USA), LOX (Abcam, ab174316, 1:200, UK), TUBB3 (Affinity Biosciences, AF7000, 1:200, USA), TUBB3 (Proteintech, 66,375–1, 1:200, USA), Piezo1 (Affinity Biosciences, DF12083, 1:200, USA), Collagen III (ABclonal, A0817, 1:50, China), Collagen I (ABclonal, A1352, 1:50, China), ELN (ABclonal, A2723, 1:100, China), and Collagen IV (ABclonal, A25131, 1:100, China). Following incubation, the cells were washed with PBST and then incubated with secondary antibodies (Proteintech, SA00013-1; SA00013-2; SA00013-3; SA00013-4, 1:500, USA). After three additional washes with PBST, the cells were mounted with Antifade Mounting Media containing DAPI (Beyotime, P0131, China). Images were captured using the confocal microscope (Leica SP8, Germany).

For brain immunofluorescence (IF) staining, rats were anesthetized with 10 % chloral hydrate, and their brains were collected and fixed in 4 % paraformaldehyde (PFA) at room temperature. After fixation, the brain tissue was cryoprotected in 30 % and 40 % sucrose solutions and then dehydrated in 40 % sucrose for 72 h at 4 °C. Coronal sections of 5 μm thickness were prepared using a cryotome (Leica, Germany) and used for IF labeling. The sections were first incubated with a blocking solution for 30 min. Following blocking, the tissue sections were incubated overnight with primary antibodies. The next day, the sections were washed with PBST and then incubated with secondary antibodies. After three additional washes with PBST, the sections were mounted with Antifade Mounting Media containing DAPI. Images were captured using a confocal microscope (Leica SP8, Germany). Primary antibodies used were GPX4 (Proteintech, 67,763-1-lg, 1:500, USA), NeuN (Servicebio, GB11138, 1:200, China), NeuN (Proteintech, 66,836–1, 1:200, USA), Piezo1 (Affinity Biosciences, DF12083, 1:200, USA), and LOX (Abcam, ab174316, 1:200, UK). Secondary antibodies were obtained from Proteintech (SA00013-1; SA00013-2; SA00013-3; SA00013-4, 1:500, USA).

2.9 Transmission electron microscopy (TEM)

HT22 samples were fixed in 3 % phosphate-buffered glutaraldehyde and 1 % osmium tetroxide, then stained with lead citrate and uranyl acetate. The prepared samples were subsequently imaged using the Tecnai G2 20 Twin transmission electron microscope (FEI, USA). Mitochondrial morphology was evaluated with TEM, and the ratio of mitochondria containing cristae to the total number of mitochondria was quantified within the same field of view at the consistent magnification.

2.10 MitoTracker staining

Mitochondrial activity was assessed as described previously [21]. Briefly, cells were incubated with 200 nM Mitotracker Red (Invitrogen, M7512, USA) for 30 min in a dark, humidified chamber. After staining, cells were washed with fresh medium, then incubated with Hoechst dye and washed twice with PBS. Mitochondrial activity was immediately captured using the confocal microscope (Leica SP8, Germany), and the images were analyzed using ImageJ software.

2.11 Enzyme-linked immunosorbent assay (ELISA)

LOX enzyme activity in HT22 cells and rat brain tissue was quantified using the LOX ELISA kit (Wuhan Fine Biotech Co., Ltd., EM1614, China) and Rat LOX ELISA kit (COIBO BIO Co., Ltd., CB12787-Ra, China) following the manufacturer's instructions. Briefly, samples were collected and mixed with 10 μl of the sample and 40 μl of sample diluent. Then, 100 μl of HRP-conjugate reagent was added to each well and incubated for 60 min at 37 °C. After incubation, each well was aspirated and washed five times with wash solution, ensuring complete removal of the wash solution. Next, 50 μl of chromogen solution A and 50 μl of chromogen solution B were added to each well, mixed, and incubated for 15 min at 37 °C. Afterward, 50 μl of stop solution was added to each well. The OD was measured using the Multiskan FC (Thermo Fisher) at 450 nm within 15 min.

2.12 Overexpression of LOX in HT22

The full-length LOX cDNA (NM_010,728) was cloned into the pLV4-ltr-PGK- Puro-CMV vector for lentiviral packaging. HT22 cells were seeded in a 6-well cell culture plate and were transduced with lentivirus at multiplicities of infection (MOI) of 5, 10, 20, and 40, along with 10 μg/ml polybrene when cells reaching 50 % confluence. After 24 h, the culture medium was replaced with fresh medium. Cells were collected 48 h post-transduction for Western blot and immunofluorescent staining.

2.13 RNA-sequencing (RNA-seq) analysis

RNA-seq was performed as we previously reported [21]. Primary cortical neurons subjected to OGD/R treatment and untreated controls were collected for RNA-seq. RNA-seq analysis was performed by OE Biotech Co., Ltd. (Shanghai, China). Differential expression analysis was conducted using DESeq2, with significant differentially expressed genes (DEGs) defined by a q-value <0.05 and a fold change >1.5 or < 0.67. Enrichment analysis of DEGs was performed for KEGG pathways, Reactome, and WikiPathways to identify significantly enriched terms using R (version 3.2.0).

2.14 Neonatal HIBD rat model

The neonatal HIBD rat model used in this study was established based on a modified Rice-Vannucci method [22]. All animal surgical procedures were approved by the Ethics Committee of Shanghai Tongren Hospital (Approval No. A2023-058-01). Briefly, P7 Sprague-Dawley (SD) rats were anesthetized with isoflurane, and the right common carotid artery (CCA) was exposed and ligated with double-layer 7-0 sutures. Following ligation, the rat pups were returned to their mothers for 2 h. Subsequently, the pups were placed in a hypoxic chamber with 8 % O₂ and 92 % N₂ at 37 °C for 2 h to induce hypoxia after ischemia. After the hypoxic exposure, the neonatal rats were again returned to their mothers. In the sham group, the pups underwent exposure of the right CCA without ligation or subsequent ischemia. For the TA treatment group, the rat pups received an intracerebroventricular (icv) injection of TA at doses of 5 μg/kg, 15 μg/kg, or 25 μg/kg following surgery. For the BAPN treatment group, the pups were administered an intraperitoneal (i.p.) injection of BAPN at 100 mg/kg. For treatment with the Piezo1 inhibitor GsMTx4, the pups received an icv injection of 50 nM. All rats were sacrificed 72 h post-HI insult, and their brain tissues were harvested for subsequent analyses.

2.15 LOX overexpression in the rat cortex

The full-length human Lox gene (NM_002317.7) was cloned into the pLV4ltr-Puro-CMV-LOX vector for lentivirus packaging. At 7 days post-birth, the right hemisphere of the rats was microinjected with Lenti-LOX or Lenti-negative control. Each rat received a cortical injection at the right posterior region relative to the bregma. A 0.7 μl volume of lentivirus suspension, containing 2 × 10⁹ TU/ml, was injected at a rate of 0.2 μl/min, and the needle was gradually withdrawn over 5 min. Western blot and immunofluorescence analyses were performed five days after the lentivirus injection.

2.16 Brain water content determination

Rats from each experimental group were sacrificed 72 h post-surgery. The dissected brain tissue was first photographed, after which the cerebellum and olfactory bulb were removed. The ipsilateral cerebral hemispheres were then isolated for analysis of brain water content. The wet weight of each sample was measured initially, followed by a drying process in an oven at 80 °C for 24 h. After drying, the dry weight of each sample was recorded, and the brain water content was calculated using the following formula:BrainWaterContent=WetWeight−DryWeightWetWeight×100%

2.17 2, 3, 5-triphenyltetrazolium chloride (TTC) staining

The brains were harvested 72 h after HIBD and sectioned into 2 mm coronal slices. The brain slices were then stained with 2 % TTC (Coolaber, G3005, China) solution for 30 min at 37 °C. Red-stained areas indicated non-ischemic tissue, while white-stained areas corresponded to ischemic necrotic tissue. The cerebral infarct volume was quantified using TTC staining and analyzed with ImageJ software.

2.18 Hematoxylin-eosin (HE) staining

Fresh brains were collected 72 h after HIBD surgery and rinsed three times with PBS before being transferred to 10 % formalin solution for 24-h fixation. The samples were then dehydrated through a graded ethanol series, cleared with xylene, and embedded in paraffin in the appropriate orientation. The paraffin-embedded brain tissues were sectioned at a thickness of 5 μm and baked in a 60 °C oven. After dewaxing in xylene and rehydrating through a graded ethanol series, the sections were further rehydrated with ROH₂O. The sections were stained with hematoxylin for 3–5 min, differentiated in acid ethanol for 2 min, rinsed in running tap water, and blued in tap water for 10 min. Finally, the sections were counterstained with eosin for 5 min and sealed with resin. The stained sections were imaged using the Pannoramic SCAN II (3DHISTECH, Hungary).

2.19 Nissl staining

Paraffin-embedded brain sections were prepared following the procedure used for HE staining. After rehydration, the sections were immersed in 0.1 % cresyl violet staining solution at 37 °C for 25 min. The sections were then rinsed with deionized water, dehydrated through a graded ethanol series, cleared in xylene for 10 min, and sealed with resin. The stained sections were observed and imaged using the Pannoramic SCAN II (3DHISTECH, Hungary).

2.20 Atomic force microscopy (AFM)

AFM measurements were performed using a commercial AFM setup (NT-AIST, HORIBA, Japan) in force mapping mode, equipped with a high-quality tip (MikroMasch, USA). The cantilever had a spring constant of 0.5 N/m. To remove contaminants, the tips were cleaned with ethanol and exposed to UV light after each force map. Both topography and Young's modulus images were captured to characterize the structures of the biological samples. Young's modulus maps for the sham and HIBD samples were generated over a 10 μm × 10 μm scan area, with 20 × 20 force-indentation curves measured.

2.21 Y maze test

The Y maze test was conducted 20 days after HIBD to evaluate the spatial and short-term memory of the rats. The Y maze was constructed from black plexiglass, with each arm forming a 120-degree angle. The arms were designated as ‘starting,’ ‘other,’ and ‘novel.’ In the initial phase, rats were placed at the end of the starting arm and allowed 5 min of unrestricted exploration in the starting and other arms, while the novel arm was blocked with a plastic partition. After this 5-min period, the rats were returned to their home cages, and the Y maze was cleaned with 70 % ethanol to remove olfactory cues. One hour later, the rats were reintroduced into the starting arm and permitted to explore all three arms for 5 min, with their behavior recorded by a video tracking system. The frequency of entries into the novel arm and the latency to enter the novel arm were statistically analyzed.

2.22 Morris water maze (MWM) test

The Morris Water Maze (MWM) test was conducted 24 days after HI injury to evaluate the learning and memory capabilities of the experimental animals. In this test, animals were required to navigate a black circular pool with a diameter of 140 cm and a height of 50 cm to locate a submerged platform. The pool, situated in a controlled environment to minimize noise and light, had water depth set 1 cm above the platform. The water was colored black with non-toxic ink, and the pool was divided into four equal quadrants. Over 5 days, the rats underwent training sessions to familiarize themselves with the pool and platform, with escape latency meticulously recorded. After the training period, the platform was removed, and the time spent in the target quadrant and the number of crossings over the previous platform location were analyzed statistically.

2.23 Golgi staining

After completing the behavioral tests, the rats were sacrificed, and their brains were isolated and sectioned into blocks measuring 5–10 mm in thickness. The brain tissue blocks were then immersed in Golgi stain fixative solution (Servicebio, G1069-30 ML, China) at room temperature in a ventilated environment. The blocks were subsequently transferred to Golgi staining solution (Servicebio, G1069-1, China) and incubated in a cool, ventilated area at 26 °C for 14 days in darkness. Following this, the tissue blocks underwent a 1-h treatment with tissue treatment solution (Servicebio, G1069-3, China), followed by an additional treatment at 4 °C in the dark for 3 days. The brain tissue was then sectioned into 60 μm slices and incubated with the treatment solution. The slices were washed with ultra-pure water, exposed to Golgi developer solution (Servicebio, G1069-2, China) for 30 min, and excess water was removed from the slides. Finally, the slides were mounted with glycerin gelatin mounting medium (Servicebio, G1402, China), and images were captured using digital scanning under white light (3DHISTECH, Hungary).

2.24 Lip-SMap analysis

HT22 cells were collected in lysis buffer and centrifuged at 12,000 rpm for 10 min at 4 °C. Protein concentrations were measured using a BCA assay kit (Thermo Fisher, A55865, USA). Protein integrity was assessed by Coomassie Brilliant Blue staining (Beyotime, China) following SDS-PAGE electrophoresis. The protein concentration was adjusted to 100 mg/ml and aliquoted into 6 parts, with each portion containing 100 μg of protein. For treatment, 50 μM TA was incubated with the collected protein, while DMSO was used as a control. TA was incubated with 100 μg of total protein at 25 °C for 10 min. Additionally, proteinase K (ProK) was added and incubated at 25 °C for 5 min. The samples were then transferred to a 95 °C water bath to completely inactivate the ProK. After cooling to room temperature for 5 min, 2 % DOC and 200 mM ABC (pH 8.5) were added.

Samples were treated with 10 mM DTT and incubated for 30 min at 37 °C, followed by addition of 40 mM IAA for an additional 30 min at 37 °C in the dark. Proteins were then digested with trypsin (1:50) overnight at 37 °C, and the reaction was halted with formic acid (pH < 2). The samples were centrifuged at 16,000×g for 10 min; the supernatant was collected and washed twice with 200 μl of 2 % TFA. Peptide mixtures were desalted using C18 SPE columns, and 2 μl of the peptide solution were analyzed using nano-UPLC coupled with a nanoelectrospray ion source on a Q Exactive HFX Orbitrap (Thermo Fisher Scientific). Separation was achieved on a reverse-phase column with a 120-min gradient at 300 nL/min. The Orbitrap analyzer performed data-dependent acquisition with specific settings for MS1 and MS2. MS data were processed with Proteome Discoverer (PD) software and the Sequest HT search engine, using the UniProt FASTA database for peptide identification, with a false discovery rate (FDR) set to 0.01 for both peptide-spectrum match (PSM) and peptide levels.

2.25 Molecular docking of TA to LOX

Download the 3D structure of metabolites in PDB format from the HMDB database (https://hmdb.ca). Import the structure into ChemBio3D Ultra 14.0 for energy minimization, setting the Minimum RMS Gradient to 0.001, and save the optimized small molecules in MOL2 format. Import the optimized small molecules into AutoDockTools-1.5.6 for hydrogenation, charge calculation, and distribution, and set the rotatable bonds. Save the processed molecules in PDBQT format. Upload the LOX sequence to SwissModel for homologous modeling. Import the modeled protein structure into PyMOL 2.3.0 to remove crystal water and original ligands. Next, import the cleaned protein structure into AutoDockTools (v1.5.6) for hydrogenation, charge calculation, and assignment. Specify atom types and save the protein structure in PDBQT format. Protein binding sites were predicted using POCASA 1.1. Docking was performed with AutoDock 4.26, with the following parameters: center_x = −14.35, center_y = −14.93, center_z = 52.62; search space dimensions: size_x = 60, size_y = 60, size_z = 60 (with a grid spacing of 0.375 Å). All other parameters were set to default. The interaction patterns of the docking results were analyzed using PyMOL 2.3.0 and LigPlot v2.2.5.

2.26 Cellular thermal shift assay (CETSA)

Cellular Thermal Shift Assay (CETSA) was performed as previously described [23]. For the intact cell assay, HT22 cells were treated with 200 μM TA or DMSO for 12 h. The cells were then harvested and washed several times with PBS to remove excess TA residues. Each cell suspension was aliquoted into separate 0.2 ml PCR tubes. The samples were subjected to thermal denaturation at various temperatures using a PCR instrument (Eppendorf) for 3 min, followed by two freeze-thaw cycles with liquid nitrogen. The samples were centrifuged, and the supernatants were analyzed by Western blot.

For the cell lysate assay, HT22 cells were collected, and the lysates were subjected to two freeze-thaw cycles with liquid nitrogen. Subsequently, 200 μM TA or DMSO was added to the lysates and incubated for 30 min at 25 °C. The protein samples were then denatured at different temperatures for 3 min, centrifuged, and the supernatants were analyzed by Western blot.

2.27 Western blot

Western blotting was performed on HT22 cells, primary cortical neurons, and rat brain tissue. Cells and tissues were lysed with Radio Immunoprecipitation Assay (RIPA) buffer (Beyotime, P0013B, China) supplemented with 1 mM PMSF (Beyotime, ST506, China). The lysates were centrifuged at 12,000 rpm for 15 min. Protein concentrations were quantified using a BCA kit. For each sample, 25 μg of protein was separated by electrophoresis on acrylamide/bisacrylamide gels (Smart-Lifesciences, SLE019/SLE014, China) and then transferred to PVDF membranes (Millipore, USA). The membranes were blocked with 5 % non-fat milk for 1.5 h, then incubated with primary antibodies overnight at 4 °C. After washing with TBST three times, the membranes were incubated with HRP-conjugated secondary antibodies for 1 h. Protein bands were visualized using a Tanon 6200 imaging system (Tanon, Shanghai). The following primary antibodies were used: LOX (Abcam, ab174316, ab31238, 1:1000, UK), GPX4 (Abcam, ab125066, 1:5000, UK), TAZ (ABclonal, A8202, 1:500, China), Collagen III (ABclonal, A0817, 1:750, China), Collagen I (ABclonal, A1352, 1:750, China), Piezo1 (ABclonal, A23380, 1:750, China), β-actin (Signalway Antibody, 52,901, 1:10,000, USA), YAP (CST, 14074 S, 1:1000, USA), and Tubulin (ABclonal, AC021, 1:7500, China). The secondary antibodies used were Goat Anti-Rabbit IgG (H + L) HRP (Thermo Fisher, 31,460, 1:10,000, USA) and HRP-conjugated Affinipure Goat Anti-Mouse IgG (H + L) (Proteintech, SA00001-1, 1:10,000, USA).

2.28 Quantification and statistical analysis

Data were analyzed using GraphPad Prism (Version 9.0, GraphPad Software, USA). Comparisons between two groups were performed using an unpaired Student's t-test. For comparisons involving multiple groups, one-way ANOVA was utilized. A p-value of <0.05 was considered statistically significant. Error bars represent the standard deviation (SD).

3 Results

3.1 LOX is involved in the pathogenesis of HIE and is upregulated in HI-induced cortical and hippocampal neurons

LOX exhibits a high sensitivity to the hypoxic microenvironment and has been reported to be associated with brain injury [24,25]. HIE, triggered by HI, inflicts damage on brain tissue. To elucidate the involvement of LOX in HIE, clinical samples of HIE were collected for the assessment of LOX expression in the peripheral blood of neonates (Fig. 1A). The results revealed a significant increase in LOX levels among HIE infants (Fig. 1B). The ROC curve analysis indicated an AUC of 0.92 for LOX, suggesting its potential as a biomarker for distinguishing HIE from other conditions (Fig. 1C).Fig. 1 LOX is associated with HIE and is upregulated in neurons induced by hypoxia-ischemia both in vitro and in vivo. (A) Schematic diagram of neonate samples collection and experimental design. (B) Quantification of the LOX expression in peripheral blood of HIE and control subjects by qPCR. (C) ROC curve analysis of LOX to distinguish between neonates with and without HIE. (D) Schematic diagram illustrating the construction of the HIBD model. (E) Representative images of LOX (green) and neuron (NeuN, red) in cortex, CA1, CA3, DG regional of hippocampus in HIBD brains at 72 h post-surgy. Scale bar = 50 μm. (F) Quantitative analysis of the relative fluorescence intensity of LOX + NeuN + in the Cortex, CA1, and CA3 of sham and HIBD group (n = 5 rats per group). (G–H) Immunoblotting and statistical analysis of LOX protein levels in HIBD-injured brain tissues at 72 h post-surgy (n = 3 independent experiments). (I) Schematic drawing of in vitro experiments. (J) Representative images of LOX (red) in HT22 cells and LOX (green) in primary cortical neurons (TUBB3, red). Scale bar = 50 μm. (K) Quantification of LOX fluorescence intensity in HT22 and primary cortical neurons. (L) Immunoblotting shows LOX protein levels in OGD/R-induced HT22 (n = 3 independent experiments). (M) Statistical analysis of the immunoblotting results from L. Data are presented as mean with SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 1

To investigate the impact of hypoxic conditions on LOX expression in the CNS in vivo, the expression pattern of LOX in neonatal rats with HIBD was examined. The HIBD model was induced by ligating the right common carotid artery, followed by 2 h of hypoxia in a container containing 8 % O2 and 92 % N2 (Fig. 1D). Immunofluorescence results showed robust upregulation of LOX in NeuN-positive neurons in the cortex and hippocampus regions of HIBD rats compared with sham groups (Fig. 1E and F). Consistently, the protein level of LOX was also dramatically upregulated in the brain tissues suffered to HI (Fig. 1G and H).

Next, we conducted further investigation into the expression of LOX in neurons subjected to HI in vitro. HT22 cells and primary cortex neurons were exposed to hypoxic conditions for either 12 h or 1 h, followed by re-oxygenation for 24 h or 12 h to establish the oxygen-glucose deprivation/re-oxygenation (OGD/R) model (Fig. 1I). Immunofluorescence and Western blot analyses revealed significant upregulation of LOX in both HT22 cells and primary cortex neurons (Fig. 1J–M). Taken together, these results suggest that the HI-induced increase in LOX protein levels in neurons may contribute to the pathogenesis of HIE.

3.2 Pharmacological inhibition of LOX alleviates HI-induced pathologies in vivo

To further ascertain the role of LOX in HIBD, we used the LOX family inhibitor BAPN as an ex vivo perturbation to assess LOX functional responses in HIBD rats. The results showed that the incidence of brain edema and the brain water content was significantly lower in HIBD rats with BAPN intraperitoneal injection (Fig. 2A–C). TTC staining indicated that brain infarct volume was significantly reduced in BAPN-treated HIBD rats (Fig. 2B–D). Additionally, HE and Nissl staining revealed closely arranged neurons with clear structures in the cortex and hippocampus of the sham group. In contrast, HIBD rats exhibited loosely arranged tissue and significantly damaged neurons with nuclear contraction and abnormal morphology. BAPN intervention significantly improved cell arrangement and neuron morphology in the injured brain (Fig. 2E and F). Neuron counts in the cortex, CA1, CA3, and DG regions were dramatically reduced in the HIBD group but significantly restored with BAPN treatment (Fig. 2G–J).Fig. 2 Inhibition of LOX by BAPN effectively mitigates HI-induced brain injury and improves cognitive function in rats with HIBD. (A) Morphology of cerebral edema in sham, HIBD and BAPN intervention groups (100 mg/kg/ip/day) at 72 h post-surgery. (B) TTC staining of cerebral infarction in sham, HIBD, and BAPN intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (C) Statistics analysis of brain water content from A (n = 5 rats/group). (D) Quantification of infarct area in B (n = 5 rats/group). HE staining (E) and Nissl staining (F) of the whole brain sections with enlarged views of cortex and hippocampus regions in sham, HIBD and BAPN intervention groups. Scale bar = 2.5 mm, enlarged scale bar = 250 μm. Statistics analysis of the number of neurons (cells/mm2) in the cortex (G), CA3 (H), CA1 (I) and DG (J) regions of the hippocampus in sham, HIBD, and BAPN intervention groups (n = 5 rats/group). (K) Schematic drawing of the Y Maze test. Quantitative analysis of the time spent in the novel arm (L), the number of entries into the novel arm (M), and the latency to enter the novel arm (N) (n = 6 rats/group). (O) Golgi staining in the cortical regions in sham, HIBD, and BAPN intervention groups. Scale bar = 10 μm. Data are presented as mean with SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Fig. 2

Brain disabilities are common consequences of HIBD. We next investigated whether the aberrant brain functions observed in HIE might be initiated by LOX activation, resulting in subsequent cognitive and learning deficits. The Y maze test was performed to determine the spatial learning and memory abilities of rat in BAPN treatment group at 20 days post-surgery (Fig. 2K). The results showed that the time spent in the novel arm was dramatically increased in BAPN-treated HIBD rats compared to HIBD rats (Fig. 2L). Additionally, the frequency of entries into the novel arm was significantly increased in LOX-inhibited HIBD rats compared to HIBD rats (Fig. 2M). Moreover, the enter latency was reduced in BAPN-treated HIBD rats relative to HIBD rats (Fig. 2N). Furthermore, dendritic spine formation is crucial for neuron function. We observed abnormal neuron morphology in the cortex of HIBD rats, characterized by significant shrinkage and a reduced number of dendritic spines. However, suppression of LOX using BAPN in HIBD rats led to a restoration of neurons to a more normal state (Fig. 2O).

3.3 LOX is required for HI-induced neuron death associated with ferroptosis

Ferroptosis, a form of regulated cell death dependent on iron and initiated by lipid peroxides on cellular membranes, has been implicated in HI-mediated neuronal death and the pathophysiological processes of HIBD. To investigate the role of LOX in HI-mediated neuronal ferroptosis, markers of ferroptosis were analyzed in HT22 cells with LOX inhibition and overexpression. BAPN treatment significantly increased cell viability in HT22 cells subjected to OGD/R (Fig. 3A). TEM analysis revealed that the mitochondria exhibited typical characteristics of ferroptosis-induced damage, including reduced mitochondrial volume and the loss of mitochondrial cristae. However, incubation with BAPN mitigated the mitochondrial damage induced by OGD/R (Fig. 3B and C). Furthermore, immunofluorescence and Fe2+ staining showed that BAPN effectively upregulated GPX4 expression and reduced OGD/R-induced Fe2+ accumulation (Fig. 3D and E). Additionally, overexpression of LOX via transfection with LOX-containing lentivirus resulted in elevated ROS and Fe2⁺ accumulation (Fig. 3F and G). Notably, transfection of HT22 cells with LOX-containing lentiviruses at multiplicities of infection (MOI) ranging from 5 to 40 demonstrated a dose-dependent upregulation of LOX protein levels, accompanied by a downregulation of GPX4 (Fig. 3H and I). Moreover, GPX4 expression was markedly increased in the neuons of cortex and the CA3 region of the hippocampus in BAPN-treated HIBD rats compared to untreated HIBD rats (Fig. 3J–L). These findings collectively suggest that LOX promotes ferroptosis and that inhibition of LOX effectively reduces HI-induced neuronal ferroptosis.Fig. 3 LOX induces GPX4-dependent ferroptosis in HI-induced neuronal injury. (A) Cell viability in BAPN treated OGD/R-induced HT22 cells at reoxygenation 0 h, 12 h and 24 h. (B) Representative TEM images of mitochondrial morphology in BAPN-incubated HT22 cells under OGD/R-induced conditions. Green arrows indicate normally shaped mitochondria, black arrows indicate damaged mitochondria. Scale bar = 400 nm. (C) Quantification the ratio of mitochondria containing cristae to the total number of mitochondria in B (n = 6 cells/group). (D) Representative images of GPX4 (green) and Fe2+ (red) in BAPN-treated OGD/R-induced HT22 cells. Scale bar = 20 μm. (E) Quantification of Fe2+ and GPX4 fluorescence intensity in D. (F) Representative images of Fe2+ (red) and ROS (red) in LOX-overexpression HT22 cells. Scale bar = 20 μm. (G) Quantification of the Fe2+ and ROS fluorescence intensity in F. (H) Immunoblotting showing GPX4 and LOX protein levels in HT22 cells infected with Lenti-LOX at different multiplicities of infection (MOI). (I) Statistics analysis of the GPX4 and LOX protein levels in H. (J) Representative images of GPX4 (green) and neurons (NeuN, red) in the cortex, and CA3 region of the hippocampus in HIBD brains at 72 h post-surgery. Scale bars = 50 μm. Quantification of GPX4+NeuN+ fluorescence intensity in the cortex (K) and CA3 region of hippocampus (L) from I (n = 5 rats per group). Data are presented as mean with SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 3

3.4 Neuronal Piezo1 upregulation is disease-associated

To elucidate the potential mechanisms involved in HI-induced neuronal damage, RNA-seq profiling was conducted on OGD/R-induced primary cortex neurons. The results revealed that a total of 2946 genes were dysregulated in OGD/R-induced primary cortex neurons, including 882 upregulated genes and 2064 downregulated genes (Fig. 4A). GO analysis showed that the extracellular matrix, extracellular region, and extracellular space were the most enriched GO terms in OGD/R-mediated primary cortex neurons (Fig. 4B). KEGG analysis suggested that the calcium signaling pathway and ECM-receptor interaction were significantly altered in HI-induced primary cortex neurons (Fig. 4C). GSEA analysis demonstrated that the cellular response to mechanical stimulus was dramatically upregulated in primary neurons in response to OGD/R (Fig. 4D). Interestingly, we found that the mechanosensitive ion channel protein Piezo1 was 4.7-fold upregulated in OGD/R-induced primary neurons compared with normal condition neurons (Fig. 4E). IF analysis indicated that Piezo1 is abundantly expressed in primary cortical neurons, and its expression is significantly upregulated following OGD/R treatment (Fig. 4F and G). To detected whether the Piezo1 channel is activated in OGD/R-induced primary cortical neurons, the [Ca2+]i production was measured in neurons. Ca2⁺ imaging revealed the significant increase in Ca2⁺ influx in primary cortical neurons subjected to OGD/R stimulation. Conversely, pharmacological inhibition with the Piezo1 inhibitor GsMTx4 significantly reduced calcium ion concentration in these OGD/R-induced primary neurons (Fig. 4H and I). The results indicating that the Piezo1-mediated Ca2⁺ influx plays a crucial role in the dysregulation of calcium homeostasis during OGD/R-induced neuronal injury.Fig. 4 Piezo1 activation is involved in LOX-induced neuronal ferroptosis. (A) Volcano plot illustrating the differentially expressed genes in OGD/R-induced primary cortex neurons compared to untreated neurons. (B) GO enrichment analysis of the top 10 terms in OGD/R-induced primary cortex neurons compared to untreated neurons. (C) KEGG enrichment analysis of the top 10 terms in OGD/R-induced primary cortex neurons compared to untreated neurons. (D) GSEA analysis of differentially expressed genes related to cellular response to mechanical stimulus in primary cortex neurons following OGD/R-treatment. (E) Dysregulated genes in the KEGG term for cellular response to mechanical stimulus in OGD/R-induced primary cortex neurons compared to untreated neurons. (F) Representative images of Piezo1 (green) and neuron (TUBB3, red) in OGD/R-induced primary cortex neurons. Scale bars = 100 μm. (G) Quantification of the relative fluorescence intensity of Piezo1 from F. (H) Representative confocal images of [Ca2+]i staining using Fluo-4/AM in primary neurons. Scale bars = 50 μm. (I) Quantification of the [Ca2+]i fluorescence intensity from H. (J) Representative images of Piezo1 in HIBD brain tissues at 72 h post-surgery. Scale bars = 10 μm. (K) Quantification of the Piezo1 fluorescence intensity from J (n = 5 rats per group). (L) Immunoblotting shows the Piezo1, YAP, and TAZ protein levels in HIBD injured brain tissues at 72 h post-surgery. (M) Statistics analysis of the Piezo1, YAP, and TAZ protein levels in L. Data are presented as mean with SD. *p < 0.05, **p < 0.01, ***p < 0.001. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 4

Next, we investigated whether the brain tissue of HIBD rats displays upregulated Piezo1 expression. Piezo1 exhibited high expression in the damaged neurons in the cortex neurons (Fig. 4J and K). It has been reported that activation of Piezo1 channels can regulate YAP/TAZ signaling in response to mechanotransduction. As expected, the expression of Piezo1, YAP, and TAZ was dramatically upregulated in the damage cortex tissue of HIBD rats (Fig. 4L and M), indicating that the HI induces Piezo1 channel activation in the brain tissue of HIBD rats.

3.5 LOX-mediated Piezo1 activation depends on LOX-induced ECM remodeling

To determine if LOX promotes HI-induced neuron damage through modulating Piezo1 activation, the expression of Piezo1 was detected in LOX-overexpression HT22 cells. Piezo1 protein levels increased in HT22 cells with LOX overexpression (Fig. 5A). Fluo-4 AM staining showed that the [Ca2+]i level was elevated in LOX-overexpressing HT22 cells. However, compared to untreated LOX-overexpressing HT22 cells, the activated intracellular Ca2⁺ signal significantly decreased when Piezo1 channels were pharmacologically inhibited with the Piezo1 inhibitor GsMTx4 in LOX-overexpressing cells (Fig. 5B and C). Similarly, a stronger Ca2⁺ signal was observed in OGD/R-induced HT22 cells compared to the control group. Inhibition of LOX with BAPN significantly attenuated the Ca2⁺ activity induced by OGD/R stimulation. However, treatment with Yoda1, an agonist of Piezo1, reversed the decrease in [Ca2⁺]i influx induced by BAPN (Fig. 5D and E). These results indicated that LOX regulates the Piezo1 expression and activation.Fig. 5 LOX mediate the activation of Piezo1 by increasing ECM stiffness through enhancing ECM components. (A) Immunoblotting shows the Piezo1 level in LOX-overexpression HT22 cells. (B) Representative images of [Ca2+]i staining using Fluo-4/AM in control, negative control, LOX overexpression, and LOX overexpression combined with GsMTx4 treatment groups of HT22 cells. Scale bars = 25 μm. (C) Quantification of the [Ca2+]i fluorescence intensity from B. (D) Representative images showing [Ca2+]i staining using Fluo-4/AM in control, OGD/R-treated, BAPN-treated OGD/R-induced, and BAPN combined with Yoda1-treated OGD/R-induced HT22 cells. Scale bars = 25 μm. (E) Statistical analysis of the [Ca2+]i fluorescence intensity from D. (F) Schematic drawing of AFM measurements of brain slice. (G) Representative images showing the 3D structural diagram, the force map, and the statistical analysis of the Young's modulus measured in HIBD brain tissue. (H–I) Immunoblotting and quantification of the Collagen I and Collagen III protein levels in LOX-overexpression HT22 cells. (J, L) Representative images showing the Collagen I/III/Ⅳ/ELN (green) and neurons (Tubb3, red) in OGD/R-induced primary neuron. Scale bars = 100 μm. (K, M) Quantification of Collagen I/III/Ⅳ/ELN fluorescence intensity from J and L. (N–O) Immunoblotting and quantification of the Collagen I and Collagen III protein levels in brain tissue of HIBD rats. (P–Q) Immunoblotting and quantification of LOX, Piezo1, and Collagen III protein levels in brain tissue from rats with LOX overexpression. Data are presented as mean with SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 5

Piezo1 is a mechanical sensor that responds to stiffness. To investigate whether LOX regulates Piezo1 activation by influencing tissue tensile strength and stiffness, AFM indentation experiments were performed on brain slices from HIBD rats and relative controls (Fig. 5F). The elastic modulus of HIBD damage tissue was elevated compared to normal brain tissue, indicating significantly higher stiffness in HIBD compared to the control at 72 h post-surgery (Fig. 5G). These results suggest that the increased stiffness in damaged brain tissue may be influenced by LOX-mediated processes.

LOX is a copper-dependent amine oxidase that oxidizes the peptidyl lysine residues of ECM proteins, such as Collagen I and Collagen III, thereby increasing tissue stiffness. It has been reported that LOX not only promotes collagen cross-linking but also enhances the production of the ECM, leading to changes in tissue stiffness. To further determine whether LOX regulates Piezo1 activation by modulating ECM remodeling, we measured the protein levels of ECM production. Western blot analysis showed that the ECM components of LOX substrates, Collagen I and Collagen III, were significantly upregulated in LOX-overexpressing HT22 cells (Fig. 5H and I) and in brain tissue of HIBD rats (Fig. 5N and O). Next, we evaluated the expression of ECM proteins in OGD/R-induced primary neurons. Consistent with LOX overexpression HT22 cells, IF results showed that the expression of Collagen I and Collagen III was significantly elevated in OGD/R-induced neurons (Fig. 5J and K). However, the levels of other ECM components, such as ELN and Collagen IV, remained unchanged in neurons from the cortex affected by HI (Fig. 5L and M). To further investigate whether LOX regulates ECM-induced Piezo1 activation in vivo, we microinjected the lentivirus designed to overexpress LOX (Lenti-LOX) into the cortical brain tissue. Western blot analysis confirmed a significant upregulation of LOX in the Lenti-LOX injection groups (Fig. 5P and Q). Additionally, cortical levels of Collagen III and Piezo1 were markedly increased in the Lenti-LOX injected rats (Fig. 5P and Q). These results suggest that LOX regulate Piezo1 activation and subsequent neuronal damage by promoting ECM remodeling and crosslinking.

3.6 Suppression of Piezo1 attenuates brain injury and cognitive impairment in HIBD rats

To further assessed the role of Piezo1 in neuron injury in vivo, we inhibited Piezo1 using GsMTx4. The brain water content was significantly decreased in icv intervention of 50 nM GsMTx4 HIBD rats compared to HIBD rats (Fig. 6A and B). TTC staining showed the significantly reduction in brain infarct volume in GsMTx4-treated rats with HIBD (Fig. 6C and D). Nissl staining revealed that GsMTx4 intervention significantly restored abnormal neuronal morphology, with neurons showing clear structures and round nucleoli in the injured regions of the cortex, CA1, and CA3 regions of the hippocampus (Fig. 6E). Moreover, the number of neurons was significantly increased in GsMTx4 treatment group (Fig. 6F–H). Immunostaining results demonstrated elevated expression of GPX4 in the cortex and hippocampal CA1 regions of HIBD rats following GsMTx4 treatment (Fig. 6I–K).Fig. 6 Targeting Piezo1 mitigates nerve damage and cognitive impairment in HIBD rats. (A) The morphology of cerebral edema in sham, HIBD, and GsMTx4 intervention groups (50 nM/icv) at 72 h post-surgery (n = 5 rats/group). (B) Statistics analysis of the brain water content from A. (C) TTC staining of the cerebral infarction in sham, HIBD, and GsMTx4 intervention groups at 72 h post-surgery (Red dashed area represents the infarcted brain region). (D) Quantification of the infarct area in C. (E) Nissl staining of the whole brain with enlarged cortex and hippocampus regions in sham, HIBD and GsMTx4 intervention groups. Scale bar = 2.5 mm, enlarged scale bar = 50 μm. Statistics analysis of the number of neurons (cells/mm2) in cortex (F), CA1 (G), and CA3 (H) regions in sham, HIBD, and GsMTx4 intervention groups (n = 5 rats/group). (I) Representative images of GPX4 (green) and neurons (NeuN, red) in the cortex and CA1 region of the hippocampus in GsMTx4-treated HIBD rats. Scale bars = 100 μm. (J–K) Quantification of the GPX4 fluorescence intensity from I (n = 5 rats/group). (L) Schematic drawing of the MWM test. (M) Representative training trajectory of rats in sham, HIBD and GsMTx4 treated HIBD groups in the MWM test. (N) Quantitative analysis of the escape latency during MWM training sessions from day 2 to day 5. Blue circle indicates the hidden platform. (O) Representative trajectories of rats in sham, HIBD and GsMTx4 treated HIBD group in the MWM test. Black circle indicates the removed platform. Quantitative analysis of the time in correct quadrant (P), the crossing platform frequency (Q), and the entry latency (R) of rats in O (n = 6/groups). Data are presented as mean with SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 6

To determine whether Piezo1 inhibition facilitates the recovery of neurological function in HIBD, MWM test were performed to assess the spatial learning and memory abilities of the rats (Fig. 6L). During the training trials on days 4 and 5 of the MWM, HIBD rats exhibited longer escape latencies compared to the sham group. However, administration of GsMTx4 significantly reduced escape latencies on these days compared to the HIBD group (Fig. 6M and N). Additionally, following platform removal on day 6 of the MWM trial, HIBD rats spent significantly less time in the target quadrant and made fewer platform crossings compared to sham rats. In contrast, GsMTx4-treated rats spent significantly more time in the target quadrant and made more frequent platform crossings than HIBD rats (Fig. 6O–Q). Furthermore, enter latency was reduced after GsMTx4 treatment in HIBD rats (Fig. 6R). These findings collectively suggest that inhibiting Piezo1 attenuates neuronal ferroptosis and improves learning and memory deficits in HIBD rats.

3.7 Piezo1 was required for LOX-mediated ferroptosis in neurons

To investigate the dependency of HI-induced LOX-mediated ferroptosis on Piezo1 activation, we administered GsMTx4 to LOX-overexpressing HT22 cells. The results revealed that LOX overexpression significantly reduced GPX4 expression, whereas treatment with the Piezo1 inhibitor GsMTx4 restored GPX4 levels in LOX-overexpressing HT22 cells (Fig. 7A and B). Furthermore, GPX4 expression was markedly decreased in OGD/R-induced HT22 cells, inhibition of LOX activity by BAPN increased GPX4 levels, whereas GPX4 expression was dramatically reduced in cells treated with Yoda1 under OGD/R and BAPN conditions (Fig. 7C and D). Together, these findings illustrate that HI induces increased LOX expression, leading to elevated levels of Collagen I and III, possibly enhancing ECM cross-linking and increasing matrix stiffness. This process activates neuronal Piezo1 channels, ultimately leading to neuronal ferroptosis (Fig. 7E).Fig. 7 LOX-mediated neuronal ferroptosis requires Piezo1 activation. (A) Protein levels of GPX4 and LOX in control, negative control, LOX overexpression, and LOX overexpression with GsMTx4 treatment groups. (B) Statistics analysis of GPX4 protein levels in A. (C) Protein levels of GPX4 and LOX in the control, OGD/R-induced, BAPN-treated OGD/R, and BAPN combined with Yoda1 treatment groups of HT22 cells. (D) Statistics analysis of the GPX4 protein levels in C. (E) LOX working model. HI induces LOX overexpression and enzymatic activity, leading to increased expression of Collagen components, enhancing extracellular collagen cross-linking and mechanotransduction, thereby activating neuronal Piezo1 ion channels, ultimately resulting in neuronal ferroptosis. *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 7

3.8 TA was identified as a new inhibitor of LOX

The clinical application of the LOX inhibitor BAPN has been hindered by its cardiotoxicity and neurotoxicity [18]. We identified TA, an oxidative derivative of unsaturated fatty acids (Fig. 8A), as showing high affinity for LOX through LiP-SMap assay (Fig. 8B). A total of 17,369 quantified peptides representing 3231 proteins were analyzed, revealing 279 differentially binding proteins (Fold change ≤0.67 or Fold change ≥1.5, p < 0.05), with LOX being the most significantly enriched protein in the TA incubation group compared to control (Fig. 8C). Molecular docking analysis indicated strong hydrogen bond interactions between TA and LOX residues such as His 289, Glu 242, Glu 287, and Ser 322 (Fig. 8D). Bioinformatics analysis further pinpointed these binding sites within catalytic domain of LOX, suggesting that TA may influence catalytic activity of LOX (Fig. 8E).Fig. 8 Identification of TA as a specific inhibitor of LOX enzyme activity. (A) Structural formula of TA. (B) Schematic diagram of Lip-SMap assay. (C) Volcano map depicting potential binding proteins of TA. Red and blue dot indicate proteins upregulated and downregulated, respectively, in HT22 cells. (D) Representative images of autodocking of TA and LOX. (E) Schematic diagram of TA binding site on the LOX protein domain. (F) CETSA-Western blot analysis to detect the interaction between TA and LOX in cell lysate and intact cell of HT22. (G) Statistical analysis of LOX intensity in F. (H) Western blot analysis of LOX expression o in HT22 cells post reoxygenation for 12 h, 24 h, and 36 h, respectively. (I) Statistics analysis of the LOX protein levels in H. (J) ELISA analysis of LOX enzyme activity in HT22 cells post-reoxygenation for 12 h, 24 h, and 36 h, respectively. (K) LOX expression in rats at 24 h, 48 h, and 72 h post-surgery. (L) Statistics analysis of the LOX protein levels in K. (M) LOX enzyme activity in rats at 24 h, 48 h, and 72 h post-surgery. Data were presented as mean with SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 8

To further confirm the interaction between the TA and the LOX protein, we conducted the CETSA to evaluate the affinity of TA and in vivo target engagement. Representative western blots demonstrating the stabilization of LOX are presented. Soluble LOX proteins exhibited distinct patterns at denaturation temperatures ranging from 45.7 °C to 51.9 °C in the presence and absence of TA, indicating direct binding of TA to the LOX protein (Fig. 8F and G). Whole-cell CETSA with compound TA revealed a thermal shift for LOX at denaturation temperatures of 51.9 °C (Fig. 8F and G). These findings confirm that compound TA effectively entered cells and bound to the LOX protein.

Notably, Western blot analysis revealed a significant increase in LOX protein levels at 12 h, 24 h, and 36 h after OGD, with no significant difference observed between the OGD/R and TA-treated groups (Fig. 8H and I). In contrast, LOX enzymatic activity was notably elevated in OGD/R-induced HT22 cells and markedly reduced in TA-treated HT22 cells compared to OGD/R at 12 h, 24 h, and 36 h post-HI (Fig. 8J). Similarly, there was no significant change in LOX protein levels in the TA-treated HIBD rats at 24 h, 48 h, and 72 h post-surgery (Fig. 8K and L), yet LOX enzymatic activity was significantly lower in the TA treatment group compared to HIBD (Fig. 8M). These results indicate that TA inhibits LOX enzymatic activity by directly binding to LOX, independently of its impact on LOX expression levels.

3.9 TA inhibited HI-induced ferroptosis in vitro

To determine whether TA reduces HI-induced ferroptosis, we measured free-iron levels and ROS generation in primary cortical neurons and HT22 cells. The results demonstrated that TA administration significantly decreased OGD/R-induced Fe2+ accumulation and ROS generation in both primary neurons and HT22 cells (Fig. 9A–D). Mitochondrial staining with MitroTracker revealed that TA treatment markedly enhanced mitochondrial activity in OGD/R-induced primary neurons and HT22 cells (Fig. 9E and F). Moreover, TEM analysis demonstrated that TA pretreatment in OGD/R-exposed HT22 cells slightly restored mitochondrial damage induced by OGD/R (Fig. 9G). The immunostaining results indicated that TA treatment increased GPX4 expression in OGD/R-induced primary neurons (Fig. 9H and I), while immunoblot analysis similarly showed elevated GPX4 protein levels in TA-treated OGD/R-induced HT22 cells (Fig. 9J and K). Together, these findings suggest that TA effectively inhibits HI-mediated ferroptosis in vitro.Fig. 9 TA administration suppressed neuronal ferroptosis induced by HI. (A) Representative images of Fe2+ staining in HT22 cells and in primary cortical neurons. Scale bar = 5 μm. (B) Statistical analysis of Fe2+ fluorescence intensity in A. (C) Representative images of ROS staining in HT22 cells and primary cortical neurons. Scale bar = 50 μm. (D) Statistical analysis of ROS fluorescence intensity in HT22 cells and primary cortical neurons in C. (E) Representative images of MitoTracker staining of mitochondrial activity in HT22 cells and in primary cortical neurons. Scale bar = 10 μm. (F) Statistical analysis of MitoTracker fluorescence intensity in E. (G) TEM analysis of mitochondrial morphology in HT22 cells. Green arrows indicate normally shaped mitochondria, black arrows indicate damaged mitochondria. (H) Immunofluorescence staining of GPX4 in cortical neurons. Scale bar = 100 μm. (I) Statistical analysis of GPX4 fluorescence intensity in H. (J) Immunoblotting of GPX4 in OGD/R-induced HT22 cells. (K) Statistical analysis of GPX4 fluorescence intensity of in J. Data are presented as mean with SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

Fig. 9

3.10 TA treatment ameliorated HI-induced brain injury in neonatal HIBD rats

To investigate whether TA provides protection against HI-induced neuronal damage in vivo, rats received icv injections of TA after surgery. The results showed that the incidence of brain edema was significantly lower in HIBD pups treated with 15 μg/kg and 25 μg/kg TA compared with the HIBD group at 72 h post-surgery (Fig. 10A). Additionally, brain water content was significantly decreased in rats treated with TA compared with HIBD rats (Fig. 10B). TTC staining indicated that the brain infarct volume was significantly reduced in the 15 μg/kg and 25 μg/kg TA-treated groups compared with HIBD rats (Fig. 10C and D). These results suggest that TA treatment at a dose of 25 μg/kg exerts a significant protective impact against HI-induced brain damage in rats. Consequently, the 25 μg/kg TA dose was used in subsequent in vivo experiments. Furthermore, HE and Nissl staining demonstrated that TA intervention exerted a neuroprotective effect by reducing neuronal loss in the cortex and hippocampus regions of HIBD rats (Fig. 10E and F). Additionally, the number of neurons was dramatically reduced in the HIBD group compared with the sham group, whereas the TA treatment group showed significant neuronal restoration (Fig. 10G–I). These findings suggest that TA exerts neuroprotective effects by reducing neuronal damage in HIBD rats.Fig. 10 TA reduces nerve damage in neonatal HIBD rats. (A) Morphology of cerebral edema in the brain of rats at 72 h post-surgery. (B) Statistics analysis of the brain water content from A. (C) TTC staining of the cerebral infarction brain of rats at 72 h post-surgery. (D) Quantification of the infarct area in C. HE staining (E) and Nissl staining (F) of whole brain with enlarged cortex and hippocampus regions in brain of rats at 72 h post-surgery. Scale bar = 2.5 mm, Scale bar = 50 μm, and Scale bar = 250 μm, respectively. Statistics analysis of neuron density (cells/mm2) in cortex (G), CA1 (H) and CA3 (I) regions of hippocampus pus in F. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Fig. 10

3.11 TA facilitates the recovery of learning and memory functions and increases the quantity of dendritic spines in HIBD rats

To assess the impact of TA on neurological recovery in HIBD, Y maze and MWM tests were conducted to evaluate rat spatial learning and memory. In MWM training, HIBD rats swam longer distances and had longer latencies than sham rats (Fig. 11A and B). Notably, TA significantly reduced escape latencies on days 3–5 compared to HIBD rats (Fig. 11B). After removing the platform on day 6, HIBD rats spent less time in the target quadrant with fewer platform crossings compared to sham rats, whereas TA-treated rats spent more time in the target quadrant with increased crossings compared to HIBD rats (Fig. 11C–E). In the Y maze, HIBD rats took longer to enter the novel arm compared to sham rats, which was improved by TA treatment (Fig. 11F and G). Additionally, the frequency of entries into the novel arm was lower in HIBD rats compared to sham rats, but TA administration increased this frequency in HIBD rats (Fig. 11H). Golgi staining revealed that TA significantly rescued HI-induced dendritic spine loss in cortical and hippocampal regions (Fig. 11I–K). These findings suggest that TA improves learning, short-term spatial memory impairments, and prevents dendritic spine loss in wild-type rats with HI injury.Fig. 11 TA mitigates HI-induced spatial memory deficits and restores dendritic spine number in rats. (A) Representative training trajectory of rats in the MWM test. (B) Quantitative analysis of the escape latency during MWM training sessions spanning from day 2 to day 5. (C) Representative trajectories of rats in the MWM test. Black circle indicates the removed platform. Quantitative analysis of the time spent in the correct quadrant (D) and frequency of platform crossings (E) in C. (F) Representative trajectory of rats in the Y maze test. Quantitative analysis of latency to enter the novel arm (G) and frequency of entries into the novel arm (H) in F. Quantitative analysis of dendritic spine numbers in cortical (I) and hippocampal regions (J) in K. (K) Golgi staining in the cortical and hippocampal regions in rats. Scale bar = 10 μm. Data are presented as mean with SD. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Fig. 11

4 Discussion

HIE is the most severe brain injury in newborns, often resulting in lasting neurological damage. Effective clinical treatments for HI-induced neuronal damage are currently lacking. In this study, we elucidated a mechanism of HI-mediated neuronal ferroptosis involving activation of the LOX/ECM remodeling/Piezo1 axis in HIBD. We identified that LOX expression is associated with HIE, and quantification of LOX levels effectively distinguishes HIE from other conditions, suggesting LOX as a potential biomarker for HIE. Moreover, we demonstrated that HI-induced LOX overexpression increases Collagen I and Collagen III expression, promoting enhanced extracellular collagen cross-linking and mechanotransduction. This process activates neuronal Piezo1 ion channels, acting as mechanosensors, which induce neuronal ferroptosis and contribute to neurological deficits. Additionally, targeting LOX and its downstream signaling molecules, such as Piezo1, significantly attenuated HI-induced neurons death and improved learning and memory impairment. This highlights the involvement of the LOX/Piezo1-mediated mechanosensory signaling axis in neuron response to extracellular stiffness, triggering detrimental responses to HI and promoting disease progression. Importantly, we identified TA as a specific LOX inhibitor that binds directly to LOX, suppressing its enzymatic activity. Administration of TA effectively alleviates cognitive impairment by inhibiting neuronal ferroptosis and promoting synaptic plasticity.

LOX belong to the family of copper-dependent ECM proteins [26]. Initially expressed as a pro-enzyme, LOX is activated through cleavage by BMP-1 and TLL1 or 2 [27]. LOX plays a crucial role in collagen fibrogenesis and catalyzes the crosslinking between extracellular matrix elastin and collagen [28,29]. It is expressed in various brain tissues, including neurons, blood vessel walls, and is implicated in neurodegenerative diseases. It was reported that LOX activity was increased by up to 30 % in the hippocampal region of Alzheimer's disease [30]. Notably, LOX expression is induced under hypoxic conditions and regulated by HIF1α, promoting cancer metastasis [31,32]. However, the relationship between LOX and HIBD remains unexplored. In this study, we highlight the involvement of LOX in HIBD, demonstrating that LOX upregulation is closely associated with clinical neonatal HIE. In addition, LOX was significantly upregulated in HI-induced neurons both in vitro and in vivo. Inhibiting LOX activity through administration with BAPN ameliorates the HI-induced ferroptosis and cognitive decline in HIBD rats.

The ECM in the CNS is a complex network composed of proteins and glycans, distributed throughout the extracellular spaces of the parenchyma and barriers [33]. Accumulated evidence indicates that maintaining ECM homeostasis in the CNS is crucial for brain development and function, including guides cell survival, activity, stabilizing synapses, and regulating synaptic plasticity [33,34]. Changes in ECM protein composition mainly include collagen types I, III, elastin, fibronectin, and alterations in ECM-modifying enzyme activities such as oxidases and proteases, which play a core role in ECM remodeling [35]. However, the role of ECM in HIE remains largely unknown. It was reported that the ECM was deposited in the early stage following ischemic stroke and intracerebral hemorrhage [36]. Our data showed that LOX overexpression promotes the expression of LOX substrate components, Collagen I and Collagen III, which is consistent with previous reports that LOX directly contributes to ECM production [37]. Additionally, we found that LOX enzyme activity was dramatically activated in both HI-induced neuronal cells and brain tissue of HIBD rats. AFM results showed that the stiffness of damage brain regions of HIBD rats was increased compared to healthy brain tissue. All results strongly indicated that LOX promote the stiffness by regulated ECM remodeling. Interestingly, Emad et al. demonstrated that the stiffness of brain regions near stab injury site was soften at both 9 days post injury and 22 days post injury [38]. However, in our study, we found that the brain tissues were exhibited a tougher mechanical signature at the onset of the HIBD, 3 days post-surgy. We propose that in the early pathogenesis stage of HIBD, HI-induced LOX upregulation promotes ECM remodeling by increasing ECM components and cross-linking, thereby contribute to the stiffness of the injured brain tissues and inducing neuronal ferroptosis.

Piezo1 is a mechanically activated ion channel essential for various physiological processes, including touch sensation, pain perception, and vascular regulation [39]. Evidence shows that Piezo1 was expressed in multiple neuronal cell types, including neural stem cells, microglia, astrocytic, oligodendrocytes, and neurons, and contributes to various CNS disorders, such as Alzheimer's disease, stroke, and multiple sclerosis [40]. Recent studies have highlighted the importance of the mechanical properties of neurons in various aspects of neuronal development, such as migration, neurogenesis, and the morphogenesis of axons and dendrites [[41], [42], [43], [44]]. However, the regulation of Piezo1 in the CNS remains largely undetermined. Our results showed that the Piezo1 channel was activated in HI-induced neurons, due to the increased stiffness of the extracellular matrix, which was regulated by LOX. This finding offers new insights into the regulation of mechanical force signal transduction in brain injury, mediated by LOX/ECM remodeling and Piezo1 mechanosensation.

Ferroptosis is a form of programmed cell death induced by the accumulation of iron-dependent lipid peroxidation. Increasing evidence indicates that ferroptosis plays a significant role in the pathogenesis of HIBD [13,45]. Few studies have demonstrated that LOX and Piezol are involved in ferroptosis. For example, Mao et al. reveled that LOX stimulates ferroptosis by activating ERK-Alox5 signaling, which is involved in seizure-induced neuronal damage [18]. Additionally, it has been reported that activation of the Piezo1 channel exacerbates ferroptosis by facilitating calcium or iron influx [46,47]. In the present study, HI-induced LOX overexpression increased mechanical stress, which in turn activated the Piezo1 channel, leading to neuronal ferroptosis. Pharmacological inhibition of LOX or Piezo1 with BAPN or GsMTx4 significantly reduced HI-induced ferroptosis and improved learning and memory function in HIBD rats. Mechanistically, inhibiting Piezo1 channel function with GsMTx4 rescued the suppression of GPX4 in hippocampal neurons overexpressing LOX. Furthermore, the Piezo1 agonist Yoda1 abolished GPX4 expression in BAPN-treated, HI-induced HT22 cells. These results indicate a specific mechanical mechanism in which LOX-mediated mechanical stress induces Piezo1 activation, correlating with GPX4-dependent ferroptosis. However, further study is warranted to investigate how Piezo1 regulates GPX4-dependent ferroptosis.

Given evidence suggests that LOX plays a vital role in HI-induced neuronal ferroptosis, our current research demonstrated that intraperitoneal injection of BAPN significantly inhibited ferroptosis, and facilitated the recovery of neuronal function in HIBD. However, high concentrations of BAPN have been associated with cardiotoxicity and neurotoxicity [48,49]. In this study, we identified a new LOX inhibitor, TA, which specifically targets LOX by directly binding to its enzymatic catalytic domain. Administration of TA dramatically reduced HI-mediated neuronal ferroptosis and mitigated the neuronal damage phenotype in HIBD rats, thereby exerting a protective effect on brain function recovery by promoting hippocampal neuronal synaptic plasticity. In our study, we strategically administered LOX and Piezo1 inhibitors after HIBD surgery but before hypoxic treatment, aiming to modulate early injury responses and enhance neuroprotection. This preemptive approach targets key pathways to mitigate damage, potentially improving outcomes in hypoxic-ischemic brain injury. However, the neuroprotective efficacy of these interventions when administered after the onset of HI injury remains uncertain and requires further investigation.

In summary, we have demonstrated that LOX-mediated ECM mechanical stress-induced Piezo1 activation plays a crucial role in regulating ferroptotic cell death. This conclusion is based on our primary findings. Firstly, hypoxia-inducible conditions lead to LOX overexpression, which enhances ECM stiffening by promoting excessive deposition and crosslinking of collagen. Secondly, mechanical forces induce the gating of the mechanosensitive receptor Piezo1 in neurons, allowing Ca2+ influx. Thirdly, the activation of the Piezo1 channel causes downregulation of GPX4, ultimately leading to ferroptosis in a stress-responsive manner. Fourthly, inhibiting LOX or Piezo1 can reverse GPX4 suppression. Furthermore, TA was identified as a novel therapeutic drug for HI-induced diseases.

Funding

This research was supported by National Natural Science Foundation of China under Grant no. 82101621 and 62161160312 , Science and Technology Foundation of Zhejiang Province of China under Grant no.2020C03018 , the Shanghai Municipal Commission of Health and Family Planning under Grant no. 20214Y0432 , Shanghai Jiao Tong University School of Medicine: Nursing Development Program under Grant No. SJTUHLXK2021 , Shanghai Tongren Hospital talent project under Grant No. TR2023rc01 and TRKYRC-yc202203 , and the Taizhou Science and Technology Support Plan (Social Development) project under Grant No. SSF20200345 .

Ethics approval and consent to participate

This clinic sample collection was approved by the Medical Ethics Committee of Jingjiang People's Hospital in China (Approval No. (2017)25). We declare that we have received the written informed consent from participants in this study. The animal surgical experimental and procedures were approved by the ethical committee of Shanghai Tongren hospital (A2023-058-01).

Consent for publication

Not applicable.

Availability of data and materials

The RNA-Seq profiling of primary cortex neurons have been deposited in the National Center for Biotechnology Information GEO database under accession number GSE270560. The Lip-SMap mass spectrometry proteomics data have been submitted to the ProteomeXchange Consortium (http://proteomecentral.proteomexchange.org) database. The accession number is PXD047489.

CRediT authorship contribution statement

Dongya Jiang: Data curation, Formal analysis, Methodology, Validation, Conceptualization, Writing – original draft. Jing Zhao: Data curation, Funding acquisition, Validation. Jie Zheng: Formal analysis, Validation. Yingmin Zhao: Conceptualization, Supervision, Validation, Funding acquisition. Meini Le: Funding acquisition, Methodology, Project administration. Dani Qin: Data curation, Validation. Qiong Huang: Data curation, Methodology, Funding acquisition. Jinyu Huang: Investigation, Methodology, Funding acquisition. Qingshun Zhao: Conceptualization, Supervision. Long Wang: Conceptualization, Data curation, Supervision. Xiaohua Dong: Conceptualization, Funding acquisition, Project administration, Supervision, Visualization, Writing – review & editing.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix ASupplementary data

The following is the Supplementary data to this article.Multimedia component 1

Multimedia component 1

Acknowledgements

We would like to thank Biotree (www.biotree.com.cn) for providing the Lip-SMap analysis.

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.redox.2024.103346.
==== Refs
References

1 Greco P. Nencini G. Piva I. Scioscia M. Volta C.A. Spadaro S. Neri M. Bonaccorsi G. Greco F. Cocco I. Sorrentino F. D'Antonio F. Nappi L. Pathophysiology of hypoxic-ischemic encephalopathy: a review of the past and a view on the future Acta Neurol. Belg. 120 2020 277 288 32112349
2 Yang L. Zhao H. Cui H. Treatment and new progress of neonatal hypoxic-ischemic brain damage Histol. Histopathol. 35 2020 929 936 32167570
3 Douglas-Escobar M. Weiss M.D. Hypoxic-ischemic encephalopathy: a review for the clinician JAMA Pediatr. 169 2015 397 403 25685948
4 Wassink G. Davidson J.O. Dhillon S.K. Zhou K. Bennet L. Thoresen M. Gunn A.J. Therapeutic hypothermia in neonatal hypoxic-ischemic encephalopathy Curr. Neurol. Neurosci. Rep. 19 2 2019
5 Fabres R.B. Nunes R.R. de Medeiros de Mattos M. Andrade M.K.G. Martini A.P.R. Tassinari I.D. Sanches E.F. de Fraga L.S. Netto C.A. Therapeutic hypothermia for the treatment of neonatal hypoxia-ischemia: sex-dependent modulation of reactive astrogliosis Metab. Brain Dis. 37 2022 2315 2329 35778625
6 Jia W. Lei X. Dong W. Li Q. Benefits of starting hypothermia treatment within 6 h vs. 6-12 h in newborns with moderate neonatal hypoxic-ischemic encephalopathy BMC Pediatr. 18 2018 50 29433475
7 Wu L. Chang E. Zhao H. Ma D. Regulated cell death in hypoxic-ischaemic encephalopathy: recent development and mechanistic overview Cell Death Dis. 10 2024 277
8 Chen X. Li J. Kang R. Klionsky D.J. Tang D. Ferroptosis: machinery and regulation Autophagy 17 2021 2054 2081 32804006
9 Bersuker K. Hendricks J.M. Li Z. Magtanong L. Ford B. Tang P.H. Roberts M.A. Tong B. Maimone T.J. Zoncu R. Bassik M.C. Nomura D.K. Dixon S.J. Olzmann J.A. The CoQ oxidoreductase FSP1 acts parallel to GPX4 to inhibit ferroptosis Nature 575 2019 688 692 31634900
10 Chen X. Kang R. Kroemer G. Tang D. Ferroptosis in infection, inflammation, and immunity J. Exp. Med. 218 2021
11 Friedmann Angeli J.P. Schneider M. Proneth B. Tyurina Y.Y. Tyurin V.A. Hammond V.J. Herbach N. Aichler M. Walch A. Eggenhofer E. Basavarajappa D. Radmark O. Kobayashi S. Seibt T. Beck H. Neff F. Esposito I. Wanke R. Forster H. Yefremova O. Heinrichmeyer M. Bornkamm G.W. Geissler E.K. Thomas S.B. Stockwell B.R. O'Donnell V.B. Kagan V.E. Schick J.A. Conrad M. Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice Nat. Cell Biol. 16 2014 1180 1191 25402683
12 Seibt T.M. Proneth B. Conrad M. Role of GPX4 in ferroptosis and its pharmacological implication Free Radic. Biol. Med. 133 2019 144 152 30219704
13 Lin W. Zhang T. Zheng J. Zhou Y. Lin Z. Fu X. Ferroptosis is involved in hypoxic-ischemic brain damage in neonatal rats Neuroscience 487 2022 131 142 35182697
14 Zhu K. Zhu X. Sun S. Yang W. Liu S. Tang Z. Zhang R. Li J. Shen T. Hei M. Inhibition of TLR4 prevents hippocampal hypoxic-ischemic injury by regulating ferroptosis in neonatal rats Exp. Neurol. 345 2021 113828
15 Vallet S.D. Ricard-Blum S. Lysyl oxidases: from enzyme activity to extracellular matrix cross-links Essays Biochem. 63 2019 349 364 31488698
16 Ye M. Song Y. Pan S. Chu M. Wang Z.W. Zhu X. Evolving roles of lysyl oxidase family in tumorigenesis and cancer therapy Pharmacol. Ther. 215 2020 107633
17 Erler J.T. Bennewith K.L. Cox T.R. Lang G. Bird D. Koong A. Le Q.T. Giaccia A.J. Hypoxia-induced lysyl oxidase is a critical mediator of bone marrow cell recruitment to form the premetastatic niche Cancer Cell 15 2009 35 44 19111879
18 Mao X. Wang X. Jin M. Li Q. Jia J. Li M. Zhou H. Liu Z. Jin W. Zhao Y. Luo Z. Critical involvement of lysyl oxidase in seizure-induced neuronal damage through ERK-Alox5-dependent ferroptosis and its therapeutic implications Acta Pharm. Sin. B 12 2022 3513 3528 36176900
19 Dong X. Zhao Y. Huang Y. Yu L. Yang X. Gao F. Analysis of long noncoding RNA expression profiles in the whole blood of neonates with hypoxic-ischemic encephalopathy J. Cell. Biochem. 120 2019 8499 8509 30474258
20 Dong X. Jiang D. Wang L. Zhao J. Yu L. Huang Y. Wu X. Zhu Y. Zhao Y. Zhao Q. Zhang G. Li X. VPS28 regulates brain vasculature by controlling neuronal VEGF trafficking through extracellular vesicle secretion iScience 25 2022 104042
21 Zhao J. Le M. Li J. Huang Q. Chen H. Zhang W. Mao H. Sun Q. Li A. Zhao Y. Yu L. Yi M. Wang J. Li X. Zhang G. Ma J. Dong X. LINC00938 alleviates hypoxia ischemia encephalopathy induced neonatal brain injury by regulating oxidative stress and inhibiting JNK/p38 MAPK signaling pathway Exp. Neurol. 367 2023 114449
22 Rice J.E. 3rd Vannucci R.C. Brierley J.B. The influence of immaturity on hypoxic-ischemic brain damage in the rat Ann. Neurol. 9 1981 131 141 7235629
23 Jafari R. Almqvist H. Axelsson H. Ignatushchenko M. Lundback T. Nordlund P. Martinez Molina D. The cellular thermal shift assay for evaluating drug target interactions in cells Nat. Protoc. 9 2014 2100 2122 25101824
24 Gilad G.M. Kagan H.M. Gilad V.H. Lysyl oxidase, the extracellular matrix-forming enzyme, in rat brain injury sites Neurosci. Lett. 310 2001 45 48 11524154
25 Saatci O. Kaymak A. Raza U. Ersan P.G. Akbulut O. Banister C.E. Sikirzhytski V. Tokat U.M. Aykut G. Ansari S.A. Dogan H.T. Dogan M. Jandaghi P. Isik A. Gundogdu F. Kosemehmetoglu K. Dizdar O. Aksoy S. Akyol A. Uner A. Buckhaults P.J. Riazalhosseini Y. Sahin O. Targeting lysyl oxidase (LOX) overcomes chemotherapy resistance in triple negative breast cancer Nat. Commun. 11 2020 2416 32415208
26 Wei S. Gao L. Wu C. Qin F. Yuan J. Role of the lysyl oxidase family in organ development Exp. Ther. Med. 20 2020 163 172 submitted for publication
27 Trackman P.C. Functional importance of lysyl oxidase family propeptide regions J Cell Commun Signal 12 2018 45 53 29086201
28 Herchenhan A. Uhlenbrock F. Eliasson P. Weis M. Eyre D. Kadler K.E. Magnusson S.P. Kjaer M. Lysyl oxidase activity is required for ordered collagen fibrillogenesis by tendon cells J. Biol. Chem. 290 2015 16440 16450 25979340
29 Kagan H.M. Li W. Lysyl oxidase: properties, specificity, and biological roles inside and outside of the cell J. Cell. Biochem. 88 2003 660 672 12577300
30 Gilad G.M. Kagan H.M. Gilad V.H. Evidence for increased lysyl oxidase, the extracellular matrix-forming enzyme, in Alzheimer's disease brain Neurosci. Lett. 376 2005 210 214 15721223
31 Ko Y.S. Rugira T. Jin H. Joo Y.N. Kim H.J. Radiotherapy-resistant breast cancer cells enhance tumor progression by enhancing premetastatic niche formation through the HIF-1 alpha-LOX Axis Int. J. Mol. Sci. 21 2020
32 Wong C.C. Gilkes D.M. Zhang H. Chen J. Wei H. Chaturvedi P. Fraley S.I. Wong C.M. Khoo U.S. Ng I.O. Wirtz D. Semenza G.L. Hypoxia-inducible factor 1 is a master regulator of breast cancer metastatic niche formation Proc. Natl. Acad. Sci. U. S. A. 108 2011 16369 16374 21911388
33 Lau L.W. Cua R. Keough M.B. Haylock-Jacobs S. Yong V.W. Pathophysiology of the brain extracellular matrix: a new target for remyelination Nat. Rev. Neurosci. 14 2013 722 729 23985834
34 Dityatev A. Schachner M. Extracellular matrix molecules and synaptic plasticity Nat. Rev. Neurosci. 4 2003 456 468 12778118
35 Winkler J. Abisoye-Ogunniyan A. Metcalf K.J. Werb Z. Concepts of extracellular matrix remodelling in tumour progression and metastasis Nat. Commun. 11 2020 5120 33037194
36 Li H. Ghorbani S. Ling C.C. Yong V.W. Xue M. The extracellular matrix as modifier of neuroinflammation and recovery in ischemic stroke and intracerebral hemorrhage Neurobiol. Dis. 186 2023 106282
37 Nguyen X.X. Nishimoto T. Takihara T. Mlakar L. Bradshaw A.D. Feghali-Bostwick C. Lysyl oxidase directly contributes to extracellular matrix production and fibrosis in systemic sclerosis Am. J. Physiol. Lung Cell Mol. Physiol. 320 2021 L29 L40 33026236
38 Moeendarbary E. Weber I.P. Sheridan G.K. Koser D.E. Soleman S. Haenzi B. Bradbury E.J. Fawcett J. Franze K. The soft mechanical signature of glial scars in the central nervous system Nat. Commun. 8 2017 14787
39 Coste B. Mathur J. Schmidt M. Earley T.J. Ranade S. Petrus M.J. Dubin A.E. Patapoutian A. Piezo1 and Piezo 2 are essential components of distinct mechanically activated cation channels Science 330 2010 55 60 20813920
40 Zong B. Yu F. Zhang X. Pang Y. Zhao W. Sun P. Li L. Mechanosensitive Piezo1 channel in physiology and pathophysiology of the central nervous system Ageing Res. Rev. 90 2023 102026
41 Koser D.E. Thompson A.J. Foster S.K. Dwivedy A. Pillai E.K. Sheridan G.K. Svoboda H. Viana M. Costa L.D. Guck J. Holt C.E. Franze K. Mechanosensing is critical for axon growth in the developing brain Nat. Neurosci. 19 2016 1592 1598 27643431
42 Thompson A.J. Pillai E.K. Dimov I.B. Foster S.K. Holt C.E. Franze K. Rapid changes in tissue mechanics regulate cell behaviour in the developing embryonic brain Elife 8 2019
43 Barriga E.H. Franze K. Charras G. Mayor R. Tissue stiffening coordinates morphogenesis by triggering collective cell migration in vivo Nature 554 2018 523 527 29443958
44 Carnicer-Lombarte A. Barone D.G. Wronowski F. Malliaras G.G. Fawcett J.W. Franze K. Regenerative capacity of neural tissue scales with changes in tissue mechanics post injury Biomaterials 303 2023 122393
45 Zheng J. Fang Y. Zhang M. Gao Q. Li J. Yuan H. Jin W. Lin Z. Lin W. Mechanisms of ferroptosis in hypoxic-ischemic brain damage in neonatal rats Exp. Neurol. 372 2024 114641
46 Wang S. Li W. Zhang P. Wang Z. Ma X. Liu C. Vasilev K. Zhang L. Zhou X. Liu L. Hayball J. Dong S. Li Y. Gao Y. Cheng L. Zhao Y. Mechanical overloading induces GPX4-regulated chondrocyte ferroptosis in osteoarthritis via Piezo1 channel facilitated calcium influx J. Adv. Res. 41 2022 63 75 36328754
47 Xiang Z. Zhang P. Jia C. Xu R. Cao D. Xu Z. Lu T. Liu J. Wang X. Qiu C. Fu W. Li W. Cheng L. Yang Q. Feng S. Wang L. Zhao Y. Liu X. Piezo1 channel exaggerates ferroptosis of nucleus pulposus cells by mediating mechanical stress-induced iron influx Bone Res 12 2024 20 38553442
48 Fitzharris T.P. Markwald R.R. Dunn B.E. Effects of beta-aminopropionitrile fumurate (BAPN) on early heart development J. Mol. Cell. Cardiol. 12 1980 553 577 7452734
49 Martin J.E. Sosa-Melgarejo J.A. Swash M. Mather K. Leigh P.N. Berry C.L. Purkinje cell toxicity of beta-aminopropionitrile in the rat Virchows Arch. A Pathol. Anat. Histopathol. 419 1991 403 408 1750186
