
==== Front
Oncol Lett
Oncol Lett
OL
Oncology Letters
1792-1074
1792-1082
D.A. Spandidos

10.3892/ol.2024.14671
OL-28-5-14671
Articles
TREM2 promotes the proliferation and invasion of renal cell carcinoma cells by inhibiting the P53 signaling pathway
Zhang Liang 12
Lv Zhong 12
Xu Qin-Yu 12
Wu Bin 12
1 Department of Urology, Wujin Hospital Affiliated with Jiangsu University, Changzhou, Jiangsu 213003, P.R. China
2 Department of Urology, The Wujin Clinical College of Xuzhou Medical University, Changzhou, Jiangsu 213003, P.R. China
Correspondence to: Dr Bin Wu or Dr Qin-Yu Xu, Department of Urology, The Wujin Clinical College of Xuzhou Medical University, 2 Yongning North Road, Changzhou, Jiangsu 213003, P.R. China, E-mail: 644271587@qq.com 972201@qq.com
11 2024
06 9 2024
06 9 2024
28 5 53810 1 2024
17 6 2024
Copyright: © 2024 Zhang et al.
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.
Renal cell carcinoma (RCC) is a prevalent malignancy characterized by poor prognosis and high mortality. The role of triggering receptor expressed on myeloid cells-2 (TREM2) in RCC progression has been increasingly recognized, yet its underlying mechanisms remain to be fully elucidated. The aim of the present study was to assess the effects of TREM2 on RCC cells and its potential mechanisms. Lentiviral transfection was used to knockdown and overexpress TREM2 in RCC cells, and the expression level of TREM2 was evaluated using reverse transcription-quantitative PCR. Cell Counting Kit-8 (CCK-8) and 5-ethynyl-2′-deoxyuridine (EdU) assays were used to assess the proliferation of the RCC cells. Cell migration and invasion was evaluated using the wound healing assay and Transwell assay, respectively. Western blotting was used to assess the expression levels of TREM2, P53, p-P53, P21 and p-P21 in TREM2 knockdown or overexpression RCC cells. The results demonstrated that the expression level of TREM2 was significantly higher in cancer tissues compared with adjacent normal tissues. The results of the CCK-8 and EdU assays demonstrated that knockdown of TREM2 significantly inhibited the proliferation of RCC cells, whilst overexpression of TREM2 enhanced the proliferation of RCC cells. The results of the wound healing and Transwell assay revealed that, compared with the control group, the overexpression of TREM2 significantly increased the migration and invasion of RCC cells, whereas knockdown of TREM2 significantly decreased the migration of RCC cells. In addition, western blotting demonstrated that the phosphorylation levels of P53 and P21 proteins were significantly increased after TREM2 knockdown in RCC cells. In conclusion, TREM2 is highly expressed in RCC tissues and promotes the migration of RCC cells by inhibiting the P53 signaling pathway. The present study provides new insights into the regulatory effect of TREM2 on RCC and further reveals the potential of TREM2 as a therapeutic target for RCC.

renal cell carcinoma
triggering receptor expressed on myeloid cells-2
P53
proliferation
migration
Jiangsu University Clinical Medical Science and Technology Development FundJLY2021021 The present study was supported by Jiangsu University Clinical Medical Science and Technology Development Fund (grant no. JLY2021021).
==== Body
pmcIntroduction

Renal cell carcinoma (RCC), a malignant tumor of the urinary system, is one of the 15 most common cancers worldwide (1). Nearly 400,000 people are affected by RCC, resulting in >100,000 deaths each year globally (2). At present, RCC is the second most common genitourinary tumor in China, second only to bladder cancer. The incidence of RCC has been on the rise annually and is notably higher in males than that in females (3,4). Early diagnosis of RCC is closely associated with improved survival rates (5). Therefore, it is the focus of RCC research to explore the mechanisms and landmark targets of RCC.

P53, a tumor suppressor protein, can regulate the cell cycle, DNA replication and cell division (6). Normally, when cells undergo uncontrolled division and proliferation, the P53 protein is activated, which in turn induces P21 expression. This process results in cell cycle arrest and inhibition of cell proliferation; however, when cell damage cannot be repaired, P53 triggers apoptosis-related genes (such as Bcl-2-associated X-protein) and programmed cell death (6–8). In addition, when P53 proteins are mutated or aggregated, their functions are lost, leading to abnormal cell proliferation and eventually inducing the occurrence of cancer (9). As a key tumor suppressor, the P53 protein is also regulated by several genes. Specifically, a large number of genes modulate the occurrence and development of RCC by regulating the P53 protein. For instance, tripartite motif 47 can promote the malignant progression of RCC by mediating the ubiquitination and degradation of P53 protein (10), and RNA-binding motif 4 inhibits the proliferation of RCC cells by enhancing the stability of P53 mRNA (11).

Triggering receptor expressed on myeloid cells-2 (TREM2), a transmembrane receptor protein of the immunoglobulin superfamily, is primarily expressed in microglia and myeloid cells (12). TREM2 has several biological functions, including cell proliferation, cell survival, inflammatory regulation and phagocytosis (13). Disease research initially focused on the association between TREM2 and Alzheimer's disease. In the central nervous system, TREM2 promotes microglial transition to disease-associated microglia by affecting lipid metabolism (cholesterol, myelin and phospholipid metabolism), which may contribute to the occurrence of Alzheimer's disease. Therefore, TREM2 is considered a promising therapeutic target for the treatment of the disease (14). In addition, TREM2 has been reported to serve an important role in cancer. For example, Katzenelenbogen et al (15) reported the novel Arg1+ Trem2+ regulatory myeloid cells, which can mediate immunosuppression. The study reported that the elimination of these cells activated the natural killer cells and inhibited tumor growth. Furthermore, TREM2+ monocyte-derived macrophages have been reported to inhibit the accumulation of natural killer cells in tumor tissues and reduce oncolytic activity, thereby promoting the malignant development of lung cancer (16). Moreover, although a study has suggested that TREM2 can promote the occurrence and development of RCC through the phosphatase and tensin homolog-phosphatidylinositol 3-kinase/protein kinase B signaling (17), whether there are additional mechanisms remains to be further explored.

The present study aimed to investigate the role of TREM2 in the progression of RCC and to explore its underlying mechanisms, particularly its interaction with the P53 signaling pathway, using methods such as reverse transcription-quantitative PCR (RT-qPCR), cell proliferation, migration and invasion assays, and western blotting, with the goal of providing novel therapeutic targets for RCC.

Materials and methods

Tissue samples

RCC tumor and adjacent normal tissues were collected from patients with RCC (n=10) admitted to Wujin Hospital Affiliated with Jiangsu University (Changzhou, China) between January 2022 and June 2022. The tissue samples were stored at −80°C prior to use. Patients were divided into the high TREM2 expression group or the low TREM2 expression group based on the median expression of TREM2. The clinicopathological data of the patients in each group are presented in Table I. The TNM staging system used in this study was the American Joint Committee on Cancer 8th edition system (18). The present study was approved by the Ethics Committee of Wujin Hospital Affiliated with Jiangsu University (approval no. 2022-SR-092), and written informed consent was obtained from all patients according to the requirements of The Declaration of Helsinki (19).

Patients diagnosed with RCC, aged between 18 and 75 years, who provided written informed consent, and had sufficient tissue available for analysis were included in the study. The exclusion criteria included: Patients with other types of cancer, those who received chemotherapy or radiotherapy prior to sample collection, and patients with severe systemic diseases or infections.

Cell culture

Human RCC ACHN (cat. no. SCSP-5063), human renal tubular epithelial HK-2 (cat. no. SCSP-511) and 293T (cat. no. SCSP-502) cell lines were purchased from the National Collection of Authenticated Cell Cultures (Cell Bank of Type Culture Collection of The Chinese Academy of Sciences). The 293T, ACHN and HK-2 cells were cultured in Roswell Park Memorial Institute 1640 Medium (cat. no. 22400071; Gibco; Thermo Fisher Scientific, Inc.) containing 10% fetal bovine serum (cat. no. 10099158; Gibco; Thermo Fisher Scientific, Inc.) in a thermostatic incubator (Thermo Fisher Scientific, Inc.) at 37°C with 5% CO2 for 48 h.

Lentivirus packaging and infection

To assess the role of RCC, lentiviral vectors were used to modulate the expression of TREM2 in RCC cells. The constructs for these experiments were generated by cloning the short hairpin (sh)RNA-targeting TREM2 (sh-TREM2, sense: 5′-GATCCGAGCCTCTTGGAAGGAGAAATCTCGAGATTTCTCCTTCCAAGAGGCTCTTTTTG-3′ and anti-sense: 5′-AATTCAAAAAGAGCCTCTTGGAAGGAGAAATCTCGAGATTTCTCCTTCCAAGAGGCTCG-3′) into a pSicoR vector, resulting in a lenti-shTREM2 construct for knockdown. A lentivirus vector containing scrambled shRNA (sh-NC, sense: 5′-GATCCCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3′ and anti-sense: 5′-AATTCAAAAACAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGG'3′) was constructed as a negative control. For overexpression, the full-length TREM2 coding sequence was incorporated into a pCDH-CMV-MCS-EF1-copGFP vector, resulting in a lenti-TREM2 construct. A control vector lacking any insert (empty vector) was used as a negative control. For transfection, a total of 5 µg of each plasmid (Sangon Biotech Co., Ltd.) was used, with a 3:2:1 ratio of the lentivirus, packaging (psPAX2) and envelope (pMD2.G) plasmids. A third-generation lentiviral packaging system was used. The plasmids were transfected into 293T cells using Lipofectamine™ 2000 (cat. no. 11668019; Invitrogen™; Thermo Fisher Scientific, Inc.) at 37°C for 48 h. After transfection, the medium was replaced with fresh growth medium to facilitate viral production. Viral particles were harvested by collecting the medium every 8 h, subsequently filtering it through a 0.45 µm filter (cat. no. HVLP02500; MilliporeSigma; Merck KGaA) to remove cellular debris. The purified viral particles were then aliquoted and stored at −80°C.

The MOI used to infect ACHN cells was 10, with a transduction duration of 24 h. After the 24-h transduction period, the cells were washed with PBS and incubated with fresh medium for an additional 48 h. Following this incubation, ACHN cells were selected using puromycin at a concentration of 2 µg/ml for 7 days to create a stable cell line. For maintenance, the concentration of puromycin was reduced to 1 µg/ml. After the stable cell lines continued to be cultured for 3–7 days, total RNA was extracted, and the knockdown or overexpression of TREM2 was detected by RT-qPCR.

RT-qPCR

Total RNA was extracted from RCC tissues, ACHN cells and HK-2 cells using a TRIzol™ kit (cat. no. 15596026CN; Invitrogen; Thermo Fisher Scientific, Inc.). The extracted RNA was reverse transcribed into complementary DNA using the SuperScript™ III Reverse Transcriptase kit (cat. no. 18080085; Invitrogen; Thermo Fisher Scientific, Inc.) with the following temperature protocol: 25°C for 10 min, 50°C for 50 min and 85°C for 5 min. Quantitative PCR was performed using the Hieff® qPCR SYBR® Green Master Mix (No Rox; cat. no. 11201ES08; Shanghai Yeasen Biotechnology Co., Ltd.) under the following thermocycling conditions: Initial denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. The sequences of the primers used are listed in Table II. GAPDH served as a standardized control. The expression of TREM2 was quantified using the 2−ΔΔCq method (20).

Western blotting

ACHN cells were lysed with radioimmunoprecipitation assay buffer (cat. no. 89900; Thermo Fisher Scientific, Inc.) at 4°C for 30 min. Subsequently, the lysed cells were centrifuged at 12,000 × g at 4°C for 15 min using a high-speed microcentrifuge, and the supernatant was collected. Bicinchoninic acid was used to determine the protein concentration in the supernatant. Upon denaturation at 100°C for 5 min, protein samples (20 µg/lane) were subjected to 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The protein samples were then transferred to polyvinylidene fluoride membranes (cat. no. IPFL00005; MilliporeSigma; Merck KGaA) using the wet transfer method. The membranes were blocked with 5% skim milk at room temperature for 2 h and then primary antibodies were added for incubation overnight at 4°C. The antibodies used included β-actin (1:5,000; cat. no. 13E5; CST Biological Reagents Co., Ltd.), TREM2 (1:1,000; cat. no. 91068; CST Biological Reagents Co., Ltd.), P53 (1:2,000; cat. no. 2527; CST Biological Reagents Co., Ltd.), p-P53 (1:1,000; cat. no. 82530; CST), P21 (1:2,000; cat. no. 2947; CST Biological Reagents Co., Ltd.) and p-P21 (1:500; cat. no. ab47300; Abcam). Subsequently, the membranes were washed three times with Tris-buffered saline with 0.1% Tween 20. The membranes were then incubated with HRP-conjugated goat anti-rabbit IgG secondary antibodies (1:5,000; cat. no. 7074; CST Biological Reagents Co., Ltd.) at room temperature for 2 h, followed by rinsing again with Tris-buffered saline with Tween 20 in triplicate. Subsequently, the Pierce™ ECL Western Blotting Substrate (cat. no. 32209; Thermo Fisher Scientific, Inc.) was evenly dripped onto the membrane. The proteins were developed using the ChemiDoc Imaging System (Bio-Rad Laboratories, Inc.) and the gray values were calculated using ImageJ software (V1.8.0; National Institutes of Health).

Cell Counting Kit-8 (CCK-8) assay

The proliferation ability of RCC cells was assessed by CCK-8 assay (cat. no. HY-K0301; MedChemExpress). Briefly, ACHN cells infected with the corresponding lentivirus were seeded into 96-well plates at a density of 5×103 cells/well, with six replicates per group. After 48 h, the cells were supplemented with 10 µl of the CCK-8 reagent and incubated for another 2 h. The absorbance of each well at 450 nm was detected using a microplate reader.

5-ethynyl-2′-deoxyuridine (EdU) incorporation assay

To further assess cell proliferation, an EdU incorporation assay was performed. EdU, a nucleoside analog of thymidine (21), was used to track active DNA synthesis. Cells were incubated with 10 µM EdU for 2 h at 37°C and then fixed with 4% paraformaldehyde at room temperature for 15 min. After fixation, cells underwent a click reaction with Alexa Fluor™ 488 Azide (cat. no. A10266; Invitrogen; Thermo Fisher Scenic, Inc.) to stain the incorporated EdU according to the manufacturer's instructions at room temperature for 30 min. Subsequently, cells were counterstained with DAPI at room temperature for 10 min to label all DNA, providing a control for cell nuclei identification. Fluorescence microscopy was used to capture images of the labeled cells. The proportion of EdU+ cells was quantified by comparing them to the total number of DAPI-stained nuclei.

Wound healing assay

ACHN cells cultured to 100% confluence in a 6-well plate were subjected to starvation treatment with a serum-free medium. After 24 h, a tip was used to scratch the cells. The scratched cells were then washed with phosphate-buffered saline and cultured in a serum-free medium for 24 h at 37°C. Subsequently, wound healing of the cells was observed using an inverted microscope and photographed at 0 and 24 h. Two black lines were drawn on the images to facilitate calculations. The black line at 0 h represented the initial scratch or wound created in the cell monolayer, serving as the baseline for the measurements. The black line at 24 h illustrated the boundary of cell migration into the scratch area after 24 h of incubation. This line was determined based on the leading edge of the migrating cells, which is a standard practice in scratch assays to assess cell migration and wound closure rate (22). The criteria for determining this line involved identifying the foremost edge of the cells that moved closest to the original wound edge without crossing it.

Transwell assay

The invasion assay was performed with a Transwell chamber coated with Matrigel (BD Biosciences) at 37°C for 1 h. The upper chamber was supplemented with ACHN cells (5×104) resuspended in serum-free medium, whilst the lower chamber was covered with Dulbecco's Modified Eagle Medium containing 10% fetal bovine serum (cat. no. 10099158; Gibco; Thermo Fisher Scientific, Inc.). The chambers were cultured in an incubator at 37°C and 5% CO2 for 24 h, during which time a certain number of cells attached to the upper chamber passed through the membrane to the lower chamber. Subsequently, the chambers were rinsed with phosphate-buffered saline, fixed with a 4% formaldehyde solution at room temperature for 15 min, and stained with crystal violet (0.01%) at room temperature for 15 min. The cells that passed through the membrane into the lower chamber were observed using a light microscope (BX53; Olympus Corporation) and images were captured.

Statistical analysis

These aforementioned experiments were independently repeated three times. All data were analyzed using SPSS 23.0 (IBM Corp.) and GraphPad Prism V.7.01 (Dotmatics). Continuous data from biological replicates are expressed as mean ± standard deviation. The paired or unpaired Student's t-test was used for comparisons between two groups, and one-way analysis of variance followed Tukey's post hoc test was used to compare differences among multiple groups. Categorical data are expressed as n (%) and Fisher's exact test was used for analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

TREM2 is highly expressed in patients with RCC

To assess the effect of TREM2 expression on RCC, 10 pairs of RCC and adjacent normal tissues were obtained. RNA was extracted from the tissue samples, and the expression level of TREM2 was determined by reverse transcription-quantitative PCR. The results demonstrated that the mRNA expression level of TREM2 was significantly increased in tumor tissue compared with that in normal tissues (Fig. 1A). To further confirm the higher expression level of TREM2 in cancer cells, the expression level of TREM2 in the RCC ACHN cell line and the normal renal cortex/proximal tubular HK-2 cell line were evaluated. The results revealed that the expression level of TREM2 was significantly higher in ACHN cells than that in HK-2 cells (Fig. 1B). These findings indicate that TREM2 is a potential target of RCC, and the mechanism of TREM2 in RCC deserves further exploration.

TREM2 promotes the proliferation of RCC cells

To assess the function of TREM2 in regulating the phenotype of ACHN cells, lentiviral transfection was used to knockdown or overexpress TREM2 in ACHN cells. After 48 h of infection, the cells were collected, and the expression of TREM2 was assessed using reverse transcription-quantitative PCR and western blotting (Fig. 2A and B). The results showed that TREM2 mRNA and protein levels were significantly lower in the sh-TREM2 group compared with the sh-NC group and significantly higher in the TREM2 overexpression group compared with the vector group. Furthermore, the results of the CCK-8 and EdU staining assays demonstrated that the knockdown of TREM2 significantly decreased cell viability and proliferation in comparison with the sh-NC group; whilst overexpression of TREM2 significantly increased cell viability and proliferation in comparison with the vector group (Fig. 2C and D). Therefore, the findings indicate that TREM2 could promote the proliferation of RCC cells.

TREM2 promotes the migration and invasion of RCC cells

Migration and invasion are an important indices to assess the malignant phenotype of cancer cells (23). To evaluate the effect of TREM2 on the migration of RCC cells, a wound healing assay was performed to observe the wound healing of cells at 0 and 24 h. Briefly, in comparison with the sh-NC group, the knockdown of TREM2 significantly inhibited the wound healing rate of ACHN in RCC cells. Conversely, overexpression of TREM2 promoted the wound healing rate of ACHN in RCC cells compared with the vector group (Fig. 3A). These results suggest that TREM2 could enhance the migration of RCC cells. A Transwell assay further revealed that knockdown of TREM2 significantly inhibited the cell invasion compared with that in the sh-NC group, while overexpression of TREM2 resulted in a significantly higher cell invasion compared with the vector group (Fig. 3B). Overall, the findings indicate that TREM2 promotes the migration and invasion of RCC cells.

TREM2 promotes the proliferation of RCC cells by inhibiting the P53 signaling pathway

The P53 signaling pathway serves an important role in regulating the cell cycle and the proliferation, invasion and migration of cells (9). The effect of TREM2 on the activation of the P53 signaling pathway was evaluated to assess whether TREM2 regulates tumor occurrence and development through the P53 signaling pathway. Western blotting revealed that knockdown or overexpression of TREM2 had no significant effect on the total protein levels of P53 and P21; however, in comparison with the sh-NC group, knockdown of TREM2 significantly increased the phosphorylation levels of P53 and P21, whilst overexpression of TREM2 significantly decreased the phosphorylation levels of P53 and P21 (P<0.01, Fig. 4). In summary, the results indicated that TREM2 may promote the proliferation, invasion and migration of RCC cells by inhibiting the activation of the P53 signaling pathway.

Discussion

In the present study, TREM2 was significantly upregulated in RCC tissues, which is consistent with the findings of a previous study (17). Such a result strengthens the hypothesis that TREM2 serves a crucial role in the pathophysiology of RCC. Furthermore, the results of the present study align with emerging research indicating that TREM2 is associated with several cancers, including lung cancer, colorectal cancer, thyroid cancer and RCC (16,17,24,25), highlighting its potential as a common mediator in oncogenic processes. Notably, the findings of the present study extend the current understanding by demonstrating that TREM2 was not only elevated in RCC but also served a significant role in regulating key molecular pathways. A novel layer of complexity to its role in cancer was added in the observed TREM2 upregulation in RCC tissues, particularly in how it influenced malignant cell proliferation, a pivotal characteristic of cancer cells (26). The present study made a unique contribution to the oncological field by providing evidence of the regulatory effects of TREM2 on the phosphorylation levels of P53 and P21. P53 and P21 are critical regulators of cell cycle and apoptosis (27), suggesting a mechanism by which TREM2 could promote oncogenesis and tumor progression. These insights into the molecular interactions of TREM2 not only offer a deeper understanding of its function in RCC but also underscore its potential as a therapeutic target based on its significant impact on tumor biology.

In the present study, the results of the CCK-8 assay revealed that TREM2 could promote the proliferation of ACHN cells, which aligns with the findings of Zhang et al (17). The invasion and migration ability of cancer cells is an important index to evaluate the malignancy of tumors (26,28) and it is of importance to explore the molecular regulatory mechanism of cancer cell invasion and migration for identifying therapeutic targets for cancer. In the present study, the wound healing and Transwell assays were used to determine the regulatory effect of TREM2 on the migration and invasion of RCC cells. The results revealed that knockdown of TREM2 expression significantly inhibited the migration and invasion of ACHN cells, whereas overexpression of TREM2 promoted migration and invasion. These results indicate that TREM2 may promote the development of RCC by facilitating the migration and invasion of RCC cells. Moreover, as reported in several previous studies, TREM2 can regulate the invasion and migration of many cancer cells, but its function varies in different tumors (24,29,30). For example, TREM2 promotes the invasion and migration of gastric cancer cells (24), but inhibits the viability of colorectal and liver cancer cells (24,29,30). Therefore, the role of TREM2 in different cancers must be carefully evaluated when selecting it as a target for cancer treatment.

In the present study, the relationship between TREM2 and RCC progression was evaluated, focusing on the P53/P21 signaling axis. This signaling axis serves a crucial role in cell cycle regulation, DNA replication and cell division (31). The cell cycle of cancer cells is frequently abnormal, accelerating cell division and leading to uncontrollable cell proliferation and tumor formation (32). P53, a key regulator of the cell cycle, is often altered in several forms of cancer, marking a significant step in carcinogenesis (6,33,34); however, the present study revealed that the total expression levels of the P53 protein were not affected by TREM2, suggesting that the regulatory role of TREM2 in cancer proliferation is not directly involved in altering P53 expression. Protein phosphorylation, a vital post-translational modification of the P53 protein, serves a crucial role in its nuclear localization and activation of downstream signaling pathways (35). In the present study, it was observed that TREM2 knockdown could increase the phosphorylation levels of P53, enhancing its tumor-suppressive functions; however, TREM2 overexpression decreased P53 phosphorylation, potentially facilitating oncogenic activities. Additionally, P21, as a downstream effector of the P53 pathway, serves a key role in halting the cell cycle by inhibiting cyclin D1 and cyclin-dependent kinase (36). The results of the present study indicate that TREM2 could influence the progression of RCCs by modulating the phosphorylation states of P53 and P21, thereby affecting their functional states without altering their protein expression levels. This modulation suggests that TREM2 could exert its effects on tumor biology through a specific, post-translational mechanism. According to Lei et al (37), such mechanisms of TREM2-mediated post-translational mechanism serve a significant role in regulating cancer progression, supporting the pivotal roles of TREM2 in modulating key signaling pathways in cancer. For example, TREM2-mediated phosphorylation affected Akt in prostate adenocarcinoma and RCC, and NF-κB in papillary thyroid carcinoma and gastric cancer (38). To the best of our knowledge, the present study is the first to demonstrate that TREM2 regulates RCC progression by specifically targeting the P53/P21 signaling axis, particularly through the modulation of protein phosphorylation rather than through changes in protein quantity. Further in-depth investigation is needed to elucidate exactly how TREM2 interacts with the molecular mechanisms regulating the phosphorylation of P53 and P21, thereby providing a deeper understanding of its role in cancer pathology and its potential as a therapeutic target.

Although the present study elucidated the role of TREM2 in promoting the proliferation, and migration of RCC cells through controlled in vitro experiments, it is crucial to recognize the limitations posed by the lack of in vivo studies and comprehensive clinical data. The complexity of the tumor microenvironment in living organisms, including multiple cell types and dynamic signaling interactions, serves a crucial role in influencing cancer cell behaviors. These intricacies are often not fully replicated in in vitro models. Additionally, the present study did not include longitudinal clinical data or follow-up data of patients with RCC, which are essential for assessing outcomes, such as survival rates and therapy responses. Furthermore, TREM2 serves a crucial role in modulating immune responses within the tumor microenvironment, influencing not only inflammation and tissue remodeling but also the broader immune landscape in cancers like RCC. Specifically, TREM2 has been associated with immunosuppressive functions, including the regulation of myeloid cell activity and the suppression of CD8+ T-cell infiltration (16,38,39). Future studies should use flow cytometry, immune assays, RNA sequencing, animal models and clinical trials to thoroughly explore the immunosuppressive impact of TREM2 on RCC, highlighting its potential as a therapeutic target. Finally, the interactions between TREM2 and other genes and signaling pathways involved in RCC remain underexplored. Understanding these interactions could reveal complex regulatory networks that contribute to the pathogenesis of RCC and may identify novel therapeutic targets. To thoroughly explore these interactions, a comprehensive experimental approach is necessary, which should include the following: RNA sequencing to analyze gene expression patterns; protein-protein interaction assays to detect direct interactions; genetic manipulation to observe effects of TREM2 modulation; phosphorylation studies to assess signaling changes; reporter assays for evaluating transcription factor activity; pathway inhibition tests to determine pathway dependencies; and animal model analyses to study the in vivo relevance. These methods will collectively enhance the understanding of the role of TREM2 in RCC and its potential as a therapeutic target.

In conclusion, the present study demonstrated that TREM2 may promote the malignant biological behavior of RCC cells through the P53 signaling pathway. Furthermore, the results revealed the relationship between TREM2 and RCC, providing new insights into the regulation of RCC by TREM2 and further demonstrating the potential of TREM2 as a therapeutic target for RCC.

Acknowledgements

Not applicable.

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

LZ, QX and BW designed the study. ZL collated the data, performed data analyses. QX and BW drafted the manuscript. QX and BW confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Ethics Committee of Wujin Hospital Affiliated with Jiangsu University (Changzhou, China; approval no. 2022-SR-092), and written informed consent was obtained from all patients according to the requirements of the approved guidelines.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Figure 1. High expression of TREM2 in RCC tissues. Reverse transcription-quantitative PCR was used to detect the expression of TREM2 in (A) 10 cases of RCC and matched adjacent normal tissues and (B) HK-2 and ACHN cells. **P<0.01, ****P<0.0001. TREM2, triggering receptor expressed on myeloid cells-2.

Figure 2. TREM2 promotes the proliferation of RCC cells. ACHN cells were infected with the corresponding lentiviruses (sh-NC, sh-TREM2, vector and TREM2). After 48 h, cells were collected and the results of the knock-down and overexpression of TREM2 was assessed using (A) reverse transcription-quantitative PCR and (B) western blotting. (C) Cell Counting Kit-8 and (D) EdU assays were used to detect the effect of the knockdown or overexpression of TREM2 on the viability and proliferation of RCC cells. **P<0.01. TREM2, triggering receptor expressed on myeloid cells-2; RCC, renal cell carcinoma; sh, short hairpin; NC, negative control; EdU, 5-ethynyl-2′-deoxyuridine.

Figure 3. TREM2 promotes migration of RCC cells. (A) Wound healing assay and (B) Transwell assays were used to assess the effect of the knockdown or overexpression of TREM2 on the migration and invasion of RCC cells. (A) Magnification, ×100. (B) Scale bar, 50 µm. **P<0.01. TREM2, triggering receptor expressed on myeloid cells-2; RCC, renal cell carcinoma; sh, short hairpin; NC, negative control.

Figure 4. TREM2 promotes the proliferation of renal cell carcinoma cells by inhibiting the P53 signaling pathway. (A) Western blotting was used to assess the effects of the knockdown or overexpression of TREM2 on the protein and phosphorylation levels of P53 and P21, as well as the phosphorylation levels. (B) Semi-quantitative results of P53, p-P53, P21 and p-P21 protein bands. Relative ratio of (C) p-P53/P53 and (D) p-P21/P21. **P<0.01. TREM2, triggering receptor that is expressed on myeloid cells-2; sh, short hairpin; NC, negative control.

Table I. Clinicopathological data of the patients.

Variable	Total (n=10)	High expression of TREM2 (n=5)	Low expression of TREM2 (n=5)	t/χ2	P-value	
Age, years	59.00±10.20	59.00±14.75	59.00±4.06	0.000	>0.999	
Sex				0.400	>0.999	
  Male	5 (50)	2 (40)	3 (60)			
  Female	5 (50)	3 (60)	2 (40)			
BMI, kg/m2	22.78±1.67	22.60±1.51	22.90±2.00	−0.286	0.782	
Tumor size, cm	4.29±2.38	5.48±3.00	3.10±0.42	1.759	0.117	
Tumor side				0.400	>0.999	
  Left	5 (50)	2 (40)	3 (60)			
  Right	5 (50)	3 (60)	2 (40)			
TNM stage				1.111	>0.999	
  T1	9 (90)	4 (80)	5 (100)			
  T2	0 (0)	0 (0)	0 (0)			
  T3	0 (0)	0 (0)	0 (0)			
  T4	1 (10)	1 (20)	0 (0)			
Lymph node metastasis				1.111	>0.999	
  Negative	9 (90)	4 (80)	5 (100)			
  Positive	1 (10)	1 (20)	0 (0)			
Pathology type				3.143	>0.999	
  Clear cell	7 (70)	4 (80)	3 (60)			
  Papillary	2 (20)	0 (0)	2 (40)			
  Chromophobe	0 (0)	0 (0)	0 (0)			
  Others	1 (10)	1 (20)	0 (0)			
Data are presented as mean ± standard deviation or n (%). TREM2, triggering receptor expressed on myeloid cells-2; BMI, body mass index; T, tumor.

Table II. Primer sequences.

RNA	Direction	Sequence (5′-3′)	
TREM2	Forward	5′-AGGGCCCATGCCAGCGTGTGGT-3′	
	Reverse	5′-CCAGAGATCTCCAGCATC-3′	
GAPDH	Forward	5′-GTCTCCTCTGACTTCAACAGCG-3′	
	Reverse	5′-ACCACCCTGTTGCTGTAGCCAA-3′	
TREM2, triggering receptor expressed on myeloid cells-2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
==== Refs
References

1 Miller KD Nogueira L Devasia T Mariotto AB Yabroff KR Jemal A Kramer J Siegel RL Cancer treatment and survivorship statistics, 2022 CA Cancer J Clin 72 409 436 2022 10.3322/caac.21731 35736631
2 Linehan WM Ricketts CJ The cancer genome atlas of renal cell carcinoma: Findings and clinical implications Nat Rev Urol 16 539 552 2019 10.1038/s41585-019-0211-5 31278395
3 Campi R Rebez G Klatte T Roussel E Ouizad I Ingels A Pavan N Kara O Erdem S Bertolo R Effect of smoking, hypertension and lifestyle factors on kidney cancer-perspectives for prevention and screening programmes Nat Rev Urol 20 669 681 2023 10.1038/s41585-023-00781-8 37328546
4 Ge W Song S Qi X Chen F Che X Sun Y Wang J Li X Liu N Wang Q Wu G Review and prospect of immune checkpoint blockade therapy represented by PD-1/PD-L1 in the treatment of clear cell renal cell carcinoma Oncol Res 31 255 270 2023 10.32604/or.2023.027942 37305384
5 Harrison H Thompson RE Lin Z Rossi SH Stewart GD Griffin SJ Usher-Smith JA Risk prediction models for kidney cancer: A systematic review Eur Urol Focus 7 1380 1390 2021 10.1016/j.euf.2020.06.024 32680829
6 Joerger AC Fersht AR Structural biology of the tumor suppressor p53 Annu Rev Biochem 77 557 582 2008 10.1146/annurev.biochem.77.060806.091238 18410249
7 Wu D Prives C Relevance of the p53-MDM2 axis to aging Cell Death Differ 25 169 179 2018 10.1038/cdd.2017.187 29192902
8 Zavileyskiy L Bunik V Regulation of p53 function by formation of non-nuclear heterologous protein complexes Biomolecules 12 327 2022 10.3390/biom12020327 35204825
9 Wang H Guo M Wei H Chen Y Targeting p53 pathways: Mechanisms, structures, and advances in therapy Signal Transduct Target Ther 8 92 2023 10.1038/s41392-023-01347-1 36859359
10 Chen JX Xu D Cao JW Zuo L Han ZT Tian YJ Chu CM Zhou W Pan XW Cui XG TRIM47 promotes malignant progression of renal cell carcinoma by degrading P53 through ubiquitination Cancer Cell Int 21 129 2021 10.1186/s12935-021-01831-0 33622324
11 Jian W Xue W Wang T Yu Y Cai L Meng Y Xia Z Zhang C RBM4 inhibits the growth of clear cell renal cell carcinoma by enhancing the stability of p53 mRNA Mol Carcinog 62 464 478 2023 10.1002/mc.23499 36585906
12 Fassler M Benaim C George J TREM2 agonism with a monoclonal antibody attenuates tau pathology and neurodegeneration Cells 12 1549 2023 10.3390/cells12111549 37296669
13 Molgora M Liu YA Colonna M Cella M TREM2: A new player in the tumor microenvironment Semin Immunol 67 101739 2023 10.1016/j.smim.2023.101739 36989543
14 Li RY Qin Q Yang HC Wang YY Mi YX Yin YS Wang M Yu CJ Tang Y TREM2 in the pathogenesis of AD: A lipid metabolism regulator and potential metabolic therapeutic target Mol Neurodegener 17 40 2022 10.1186/s13024-022-00542-y 35658903
15 Katzenelenbogen Y Sheban F Yalin A Yofe I Svetlichnyy D Jaitin DA Bornstein C Moshe A Keren-Shaul H Cohen M Coupled scRNA-Seq and intracellular protein activity reveal an immunosuppressive role of TREM2 in cancer Cell 182 872 885.e19 2020 10.1016/j.cell.2020.06.032 32783915
16 Park MD Reyes-Torres I LeBerichel J Hamon P LaMarche NM Hegde S Belabed M Troncoso L Grout JA Magen A TREM2 macrophages drive NK cell paucity and dysfunction in lung cancer Nat Immunol 24 792 801 2023 10.1038/s41590-023-01475-4 37081148
17 Zhang H Sheng L Tao J Chen R Li Y Sun Z Qian W Depletion of the triggering receptor expressed on myeloid cells 2 inhibits progression of renal cell carcinoma via regulating related protein expression and PTEN-PI3K/Akt pathway Int J Oncol 49 2498 2506 2016 10.3892/ijo.2016.3740 27779645
18 Amin MB Edge SB Greene FL Byrd DR Brookland RK Washington MK Gershenwald JE Compton CC Hess KR Sullivan DC AJCC cancer staging manual 8th edition New York Springer 2017
19 World Medical Association World medical association declaration of Helsinki: Ethical principles for medical research involving human subjects JAMA 310 2191 2194 2013 10.1001/jama.2013.281053 24141714
20 Livak KJ Schmittgen TD Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method Methods 25 402 408 2001 10.1006/meth.2001.1262 11846609
21 Salic A Mitchison TJ A chemical method for fast and sensitive detection of DNA synthesis in vivo Proc Natl Acad Sci USA 105 2415 2420 2008 10.1073/pnas.0712168105 18272492
22 Liang CC Park AY Guan JL In vitro scratch assay: A convenient and inexpensive method for analysis of cell migration in vitro Nat Protoc 2 329 333 2007 10.1038/nprot.2007.30 17406593
23 Leber MF Efferth T Molecular principles of cancer invasion and metastasis (review) Int J Oncol 34 881 895 2009 19287945
24 Li C Hou X Yuan S Zhang Y Yuan W Liu X Li J Wang Y Guan Q Zhou Y High expression of TREM2 promotes EMT via the PI3K/AKT pathway in gastric cancer: Bioinformatics analysis and experimental verification J Cancer 12 3277 3290 2021 10.7150/jca.55077 33976737
25 Wang J Li Z TREM2 is a prognostic biomarker and correlated with an immunosuppressive microenvironment in thyroid cancer Dis Markers 2022 1807386 2022 10.1155/2022/1807386 36438899
26 Hanahan D Weinberg RA Hallmarks of cancer: The next generation Cell 144 646 674 2011 10.1016/j.cell.2011.02.013 21376230
27 Jung Y Kraikivski P Shafiekhani S Terhune SS Dash RK Crosstalk between Plk1 and p53, cell cycle, and G2/M DNA damage checkpoint regulation in cancer: Computational modeling and analysis NPJ Syst Biol Appl 7 46 2021 10.1038/s41540-021-00203-8 34887439
28 Saha T Solomon J Samson AO Gil-Henn H Invasion and metastasis as a central hallmark of breast cancer J Clin Med 10 3498 2021 10.3390/jcm10163498 34441794
29 Kim SM Kim EM Ji KY Lee HY Yee SM Woo SM Yi JW Yun CH Choi H Kang HS TREM2 Acts as a tumor suppressor in colorectal carcinoma through Wnt1/β-catenin and Erk signaling Cancers (Basel) 11 1315 2019 10.3390/cancers11091315 31489935
30 Tang W Lv B Yang B Chen Y Yuan F Ma L Chen S Zhang S Xia J TREM2 acts as a tumor suppressor in hepatocellular carcinoma by targeting the PI3K/Akt/β-catenin pathway Oncogenesis 8 9 2019 10.1038/s41389-018-0115-x 30683932
31 Engeland K Cell cycle regulation: p53-p21-RB signaling Cell Death Differ 29 946 960 2022 10.1038/s41418-022-00988-z 35361964
32 Liu J Peng Y Wei W Cell cycle on the crossroad of tumorigenesis and cancer therapy Trends Cell Biol 32 30 44 2022 10.1016/j.tcb.2021.07.001 34304958
33 Sabapathy K Lane DP Corrigendum to ‘understanding p53 functions through p53 antibodies’ J Mol Cell Biol 11 1105 2019 10.1093/jmcb/mjz110 31881082
34 Hernández Borrero LJ El-Deiry WS Tumor suppressor p53: Biology, signaling pathways, and therapeutic targeting Biochim Biophys Acta Rev Cancer 1876 188556 2021 10.1016/j.bbcan.2021.188556 33932560
35 Chen L Liu S Tao Y Regulating tumor suppressor genes: Post-translational modifications Signal Transduct Target Ther 5 90 2020 10.1038/s41392-020-0196-9 32532965
36 Shamloo B Usluer S p21 in cancer research Cancers (Basel) 11 1178 2019 10.3390/cancers11081178 31416295
37 Lei X Gou YN Hao JY Huang XJ Mechanisms of TREM2 mediated immunosuppression and regulation of cancer progression Front Oncol 14 1375729 2024 10.3389/fonc.2024.1375729 38725629
38 Tan J Fan W Liu T Zhu B Liu Y Wang S Wu J Liu J Zou F Wei J TREM2+ macrophages suppress CD8+ T-cell infiltration after transarterial chemoembolisation in hepatocellular carcinoma J Hepatol 79 126 140 2023 10.1016/j.jhep.2023.02.032 36889359
39 Sun R Han R McCornack C Khan S Tabor GT Chen Y Hou J Jiang H Schoch KM Mao DD TREM2 inhibition triggers antitumor cell activity of myeloid cells in glioblastoma Sci Adv 9 eade3559 2023 10.1126/sciadv.ade3559 37172094
