
==== Front
Anim Nutr
Anim Nutr
Animal Nutrition
2405-6545
2405-6383
KeAi Publishing

S2405-6545(24)00069-6
10.1016/j.aninu.2024.04.016
Original Research Article
Dietary supplementation with succinic acid improves growth performance and flesh quality of adult Nile tilapia (Oreochromis niloticus) fed a high-carbohydrate diet
Cao Manxia ab†
Xie Ningning a†
Zhang Jianmin a
Jiang Ming a
Huang Feng b
Dong Lixue a
Lu Xing a
Wen Hua wenhua.hb@163.com
a⁎
Tian Juan tianjuan@yfi.ac.cn
ab⁎
a Key Laboratory of Freshwater Biodiversity Conservation, Ministry of Agriculture, Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China
b Key Laboratory for Animal Nutrition and Feed Science of Hubei Province, Wuhan Polytechnic University, Wuhan 430023, China
⁎ Corresponding author. wenhua.hb@163.comtianjuan@yfi.ac.cn
† These authors contributed equally to this work.

25 5 2024
9 2024
25 5 2024
18 390407
7 12 2023
20 2 2024
29 4 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
To evaluate the effects of dietary supplementation with succinic acid on growth performance, flesh quality, glucose, and lipid metabolism of Nile tilapia (Oreochromis niloticus) fed a high-carbohydrate diet (HCD), five iso-nitrogenous and iso-lipidic diets were prepared as follows: HCD (control group) consisting of 55% corn starch and HCD supplemented with 0.5%, 1.0%, 2.0%, and 4.0% succinic acid, respectively. Tilapia with an initial body weight of 204.90 ± 1.23 g randomly assigned to 15 tanks with 3 replicates per group and 10 fish per tank fed for 8 weeks. Increasing dietary succinic acid supplementation resulted in significant second-order polynomial relationship in the weight gain rate (WGR), specific growth rate (SGR), feed conversion ratio (FCR), protein efficiency rate (PER), viscerosomatic index, condition factor, and contents of muscular crude lipid and glycogen (P < 0.05). The hepatosomatic index, mesenteric fat index, liver glycogen content and crude lipid contents of the whole-body and liver demonstrated significantly linear and second-order polynomial relationship (P < 0.05). Quadratic curve model analysis based on WGR, SGR, PER, and FCR demonstrated that optimal supplementation with succinic acid in the HCD of Nile tilapia ranged from 1.83% to 2.43%. Fish fed with 1.0% succinic acid had higher muscular hardness, increased the contents of alkali-soluble hydroxyproline in collagen, docosahexaenoic acid (DHA) and n-3 polyunsaturated fatty acid (n-3PUFA) in muscle, and lower total fatty acid content in muscle (P < 0.05) compared with the control group. Compared to the control group, dietary supplementation with 1.0% succinic acid significantly increased the contents of total bounding amino acid (arginine, histidine, isoleucine, lysine, methionine, alanine, proline), total flavor amino acid (free aspartic acid), the catalase (CAT) activity and total antioxidant capacity, and the mRNA relative expression levels of CAT, superoxide dismutase (SOD), and nuclearfactor erythroidderived 2-like 2 (Nrf2) in muscle (P < 0.05). Furthermore, succinic acid supplementation significantly up-regulated mRNA relative expression levels of glycolysis genes (hexokinase 2 [HK2], phosphofructokinase, muscle-A [PFKMA], and phosphofructokinase, muscle-B [PFKMB]), a key glycogen synthesis gene (glycogen synthase [GYS]), and lipid catabolism genes (carnitine palmitoyltransferase-1B [CPT1B], hormone sensitive lipase [HSL], and lipoprotein lipase [LPL]), while down-regulating the mRNA relative expression level of fatty acid synthase (FASN) in muscle (P < 0.05). In conclusion, dietary supplementation with 1.83% to 2.43% succinic acid improved muscle quality by increasing muscle antioxidant capacity and hardness, changing muscle amino acid and fatty acid composition, and regulating muscle glucose and lipid metabolism.

Keywords

Oreochromis niloticus
High-carbohydrate diet
Succinic acid
Antioxidant capacity
Muscular nutritional value
Muscle growth
==== Body
pmc1 Introduction

With the scarcity and sudden rise in the price of fish meal, enhancing the utilization of non-protein nutrients in aquatic animals is of vital importance (Aragão et al., 2022). Carbohydrates are abundantly available and affordable, and the optimum dietary carbohydrate level might enhance growth and feed efficiency (Kamalam et al., 2017). Therefore, high-carbohydrate diets (HCD) have been extensively used in both omnivorous (Boonanuntanasarn et al., 2018b) and herbivorous (Tan et al., 2009) fish cultures to minimize protein and lipid catabolism in fish (Krogdahl et al., 2005). Nonetheless, the ability of fish to utilize carbohydrates is limited, and they are considered “glucose intolerant” (Polakof et al., 2012). Excessive dietary carbohydrate ingestion causes metabolic disorders, reduced growth performance (Li et al., 2016), prolonged hyperglycemia (Kostyniuk et al., 2019), and extreme lipid deposition (Prisingkorn et al., 2017; Viegas et al., 2016). Moreover, excessive carbohydrate intake decreased the content of polyunsaturated fatty acids (PUFA) and affected the amount of essential amino acids (EAA) in muscle (Wang et al., 2017, Wang et al., 2017; Wu et al., 2021; Li et al., 2014), resulting in poor fish flesh quality. Hence, the pursuit of effective methods to improve the utilization of carbohydrates and reduce metabolic disorders and muscle quality degradation caused by HCD has attracted increasing attention.

Long-term consumption of HCD has been found to lead to changes in concentrations of intermediate metabolites from the tricarboxylic acid cycle (TCA), such as cis-aconitate and malic acid (Zakim et al., 1967; Zhang et al., 2021, Zhang et al., 2021). Succinic acid, situated at the core position of various metabolic pathways, can be produced by glycolysis and fatty acid β-oxidation pathways, as well as by intestinal microbial fermentation of dietary fiber (Cummings et al., 1987; De Vadder et al., 2016). Additionally, succinic acid is also a downstream product of the α-ketoglutarate dehydrogenase complex and is involved in the formation and elimination of endogenous reactive oxygen species (ROS) (Liang, 2018). The above results raise speculation that supplementation with exogenous succinic acid may be an effective way to enhance the utilization of HCD. Studies have indicated that dietary supplementation with 0.5% succinic acid promotes the growth, feed utilization, and immunity of white shrimp (Litopenaeus vannamei) (Duan et al., 2018). Dietary supplementation with 0.15% succinate also promoted growth, feed intake, and protein deposition in juvenile zebrafish (Danio rerio) (Ding et al., 2022). Succinic acid has also been reported to induce the conversion of fast-twitch muscle fibers to slow-twitch muscle fibers in the skeletal muscle of mice, change the proportion of muscle fibers, and significantly improve muscle quality (Wang et al., 2019). However, the role of succinic acid in improving the muscle quality of farmed fish remains unexplored.

Nile tilapia (Oreochromis niloticus) is a crucial economic fish farmed globally, playing a significant role in addressing the issue of fish scarcity in developing nations due to its ease of cultivation, substantial flesh, and high protein content (Deng et al., 2010; He et al., 2021). Tilapia have been found to tolerate 330 g/kg of carbohydrate (Boonanuntanasarn et al., 2018a), and a diet with a carbohydrate/lipid ratio of 2:1 to 6.5:1 was most conducive to growth (Kabir et al., 2020). Diets are classified as HCD when the dietary carbohydrate content exceeds 380 g/kg (Ning et al., 2023). Prior research has indicated that diets with carbohydrate levels of 420 and 449 g/kg decrease muscle quality (Wu et al., 2021), systemic lipid accumulation, and glucose metabolism disorders (Liu et al., 2018). Therefore, the aim of the current study was to investigate the effects of succinic acid supplementation in a HCD containing 55% corn starch on the growth performance, flesh quality, glucose, and lipid metabolism of Nile tilapia and the underlying mechanisms. Our study might provide a new method for alleviating HCD stress and improving the quality of fish flesh.

2 Materials and methods

2.1 Animal ethics statement

In China, tilapia is widely farmed and is neither an endangered nor a protected species. The Yangtze River Fisheries Research Institute's Institutional Animal Care and Use Committee gave its approval for this work (Permit Number: YFI 2018-40).

2.2 Experimental diets

Five iso-nitrogenous and iso-lipidic diets were designed for this experiment. Succinic acid (99% purity) was obtained from Shanghai Yuanye Bio-Technology Co., Ltd. (Shanghai, China). In the current study, casein and gelatin were utilized as protein sources, fish and soybean oils were utilized as lipid sources, and corn starch was utilized as a carbohydrate source. The experimental diets were divided into a HCD (CON group, containing 550 g/kg corn starch and 60 g/kg lipid) and four supplementary diets supplemented with 0.5% (S0.5), 1.0% (S1.0), 2.0% (S2.0), and 4.0% (S4.0) succinic acid (Table 1). All components were precisely weighed, ground through a 60-mesh screen, and mixed evenly. Oil and water (about 30% of the dry ingredients) were added and mixed thoroughly. The well-mixed ingredients were then extruded (2.0 mm in diameter) using a laboratory pellet mill (TY-432, Shanghai Taiyi Machinery, China). The resultant noodle-like diets were dried in a convection oven at 60 °C for 3 h. For later usage, the feeds were crushed into tiny pellets and kept at −20 °C.Table 1 Composition and nutrient levels of the diets (DM basis, g/kg).

Table 1Item	Groups	
CON	S0.5	S1.0	S2.0	S4.0	
Ingredients	
Casein	256.00	256.00	256.00	256.00	256.00	
Gelatin	64.00	64.00	64.00	64.00	64.00	
Fish oil	30.00	30.00	30.00	30.00	30.00	
Soybean oil	30.00	30.00	30.00	30.00	30.00	
Corn starch	550.00	550.00	550.00	550.00	550.00	
Succinic acid		5.00	10.00	20.00	40.00	
Cellulose	40.00	35.00	30.00	20.00		
Vitamin premix1	5.00	5.00	5.00	5.00	5.00	
Mineral premix2	5.00	5.00	5.00	5.00	5.00	
Ca(H2PO4)2	15.00	15.00	15.00	15.00	15.00	
Choline chloride	2.50	2.50	2.50	2.50	2.50	
Vitamin C	2.50	2.50	2.50	2.50	2.50	
Total	1,000.00	1,000.00	1,000.00	1,000.00	1,000.00	
Nutrient levels3	
Dry matter	958.42	952.95	960.02	964.94	961.88	
Ash	19.76	19.36	19.96	19.96	19.51	
Crude protein	320.06	319.19	316.94	316.48	317.82	
Crude lipid	61.46	61.13	60.76	60.75	58.49	
Gross energy, MJ/kg	20.58	20.58	20.55	20.52	20.36	
1 One kilogram of vitamin premix contained the following: vitamin A 0.8 g, vitamin D3 0.08 g, vitamin E 20 g, vitamin K3 18.3 g, vitamin B1 10 g, vitamin B2 12.5 g, vitamin B6 8 g, nicotinic acid 12 g, biotin 3 g, calcium pantothenate 20 g, folic acid 3.2 g, inositol 406 g. All ingredients were diluted with micro-cellulose to 1 kg.

2 One kilogram of mineral premix contained the following: C6H10CaO6 50 g, FeSO4 20 g, MgSO4 100 g, NaH2PO4 100 g, NaCl 20 g, AlCl3 0.6 g, KIO3 0.6 g, KCl 40 g, CuSO4 2 g, MnSO4 4 g, ZnSO4 20 g, CoCl2 2 g. All ingredients were diluted with micro-cellulose to 1 kg.

3 Nutrient levels were measured values.

2.3 Experimental fish and feeding trial

The feeding study was carried out at the Yangtze River Fisheries Research Institute (Wuhan, China) with an indoor recirculating aquaculture system. Tilapia were purchased from the Guangxi Tilapia National Breeding Station (Nanning, China) and cultured in an indoor recirculating aquaculture system with commercial tilapia feed (supplied by Shenzhen Alpha Feed Co., Ltd.) for 2 weeks to acclimate to the environment. Prior to the feeding trial, the experimental fish were fasted for 24 h and anesthetized with 50 mg/L of MS-222 (tricaine methane sulfonate). About 150 healthy fish with initial body weights (204.90 ± 1.23 g) were chosen, weighed, and arranged in 15 tanks with a total water volume of 400 L and 10 fish each. Three tanks were selected at random for each diet. The fish were hand-fed 3 times a day, at 08:30, 12:30, and 17:30, until their behavior demonstrated signs of satiety. The water temperature, feeding behavior, and mortality of tilapia were recorded daily. Approximately 30% of the water in each tank was exchanged every 2 days. The parameters of the water throughout the experiment were as follows: pH 6.8 to 7.2; dissolved oxygen content > 5 mg/L; ammonia nitrogen mass content < 0.05 mg/L. The temperature of the water was between 28 and 33 °C. The feeding trial lasted for 8 weeks.

2.4 Sample collection

At the end of the feeding trial, fish were fasted for 24 h. All fish were anesthetized with 80 mg/L of MS-222 before sampling. To calculate the specific growth rate (SGR), weight gain rate (WGR), survival rate (SR), and feed conversion ratio (FCR), the number and total weight of fish in each tank were recorded. Two fish were randomly selected from each tank for whole-body composition determination. The other six fish from each tank were randomly chosen to measure the body weight and length to calculate the condition factor (CF). Then, blood samples were drawn from the caudal vein of these 6 fish using a 2-mL syringe. Blood samples were centrifuged (960 × g, 4 °C) to obtain serum samples and stored at −80 °C prior to analysis. The above six fish were disinfected with 75% alcohol before dissection. The viscera, liver, and mesenteric fat were weighed to calculate the viscerosomatic index (VSI), hepatosomatic index (HSI), and mesenteric fat index (MFI). Then, the dorsal muscle was separated, immediately frozen in liquid nitrogen, and stored at −80 °C for RNA isolation. To examine the texture, the muscles (10 mm × 10 mm × 5 mm) at the third to fifth dorsal fins above the lateral line of two fish from each tank were cut and stored at 4 °C. The muscle (5 mm × 5 mm × 5 mm) of the other two fish per tank was collected and then fixed in 4% phosphate buffer saline (PBS) for histology determination. The muscle and liver of the remaining fish were isolated and stored at −20 °C for further nutritional value analysis.

2.5 Growth indices and biochemical analyses

2.5.1 Growth indices

The following formulae were used to calculate the experimental fish's SR, WGR, SGR, feeding rate (FR), feeding intake (FI), FCR, HSI, VSI, CF, MFI, and protein efficiency ratio (PER) based on the measured data.WGR (%) = [(Wt − W0)/W0] × 100;

SR (%) = Nt/N0 × 100;

SGR (%/d) = [(lnWt − lnW0)/t] × 100;

FR (%) = [Wf/(Wt + W0) × 2/t] × 100;

FI (g/fish) = Wf/Nt;

FCR = Wf/(WtNt − W0N0 + Wd);

HSI (%) = Wh/Wt × 100;

VSI (%) = Wv/Wt × 100;

CF (%) = Wt/L3 × 100;

MFI (%) = Wm/Wt × 100;

PER (%) = [(Wt − W0)/(Wf × Wp)] × 100;

where Wt is final body weight (g); W0 is initial body weight (g); L is body length (cm); Nt is final fish number; N0 is initial individual fish number; t is experimental days (d); Wf is dry feed consumed (g); Wd is total death weight (g); Wh is hepatopancreas weight (g); Wv is viscerosomatic weight (g); Wp is feed crude protein content (%); Wm is mesenteric fat weight (g).

2.5.2 Composition analysis

The standard methodology was used to determine the proximate composition of diets, liver, muscle, and whole fish (AOAC, 2005). Diets were dried at 105 °C to a consistent weight according to AOAC method 2001.12 in order to measure their moisture content. The whole-body, muscle, and liver were freeze-dried for 72 h in a vacuum freeze dryer (Christ Beta 2-4 LD plus LT, Marin Christ Corporation, Osterode, Germany) to determine their moisture content. The crude protein content was measured with an auto Kjeldahl system (Kjelflex K-360; BUCHI Labortechnik AG, Flawil, Switzerland) according to the AOAC method 2001.11. Crude lipid content was determined by petroleum ether Soxhlet extraction (Sox606, Hanon Advanced Technology Group Co., Ltd., China) according to AOAC method 920.39. The ash content was determined by calcination in a muffle furnace (SX-4-10, Nanbei Instrument Limited, China) for 10 h at 550 °C according to AOAC method 942.05. An adiabatic bomb calorimeter (SDC311; Hunan Sundy Science and Technology Development Co., Ltd., China) was used to measure the gross energy of the meals by direct combustion.

2.5.3 Serum biochemical analysis

The contents of total protein (TP) (Sysmex, 290618), total cholesterol (TCHO) (Sysmex, 290723, 290724), triglyceride (TG) (Sysmex, 80945, 80946), glucose (GLU) (Sysmex, 290713, 290714), and albumin (ALB) (Sysmex, 290615) in serum were determined by the methods of biuret, cholesterol oxidase-peroxidase aminoantipyrine (CHOD-PAP), glycerol kinase-glycerol phosphate oxidase-peroxidase (GK-GPO-POD), hexokinase, and bromocresol green (BCG), respectively. The activities of aspartate aminotransferase (AST) (Sysmex, 290705, 290706), alanine aminotransferase (ALT) (Sysmex, 290703, 290704), and alkaline phosphatase (ALP) (Sysmex, 290701, 290702) in serum were determined by the methods of lactate dehydrogenase-ultraviolet (LDH-UV), malate dehydrogenase-ultraviolet (MDH-UV), and nitrophenyl-disodium phosphate -amino methy propanol (NPP-AMP), respectively. The kits were acquired from Sysmex Corporation in order to use an automated biochemical analyzer (BX-3010, Sysmex Corporation, Tokyo, Japan) to identify serum indicators.

2.5.4 Activities of liver and intestinal digestive enzymes

The fresh liver and intestine samples (about 0.6 g per sample) were accurately weighed and put into 10 mL centrifuge tubes. The samples were homogenized with ice-cold physiological saline solution (1:9, w/v) on ice using a portable homogenizer and then centrifuged at 960 × g for 30 min at 4 °C. The resulting supernatants were collected and kept at −80 °C to analyze the enzyme activity. The lipase (LPS, A054-2-1) activity, amylase (AMS, C016-1-1) activity, and total protein (TP, A045-4) content of the liver and intestine were determined by commercial kits (Nanjing Jiancheng Bioengineering Institute, China). The protease activity was determined by the Folin-phenol method as follows: 0.25 mL of tissue homogenate supernatant was added with 0.5 mL of 0.5% casein preheated in advance and reacted in a water bath for 15 min. Then 0.75 mL of 10% trichloroacetic acid was added and centrifuged (960 × g, 10 min) to remove precipitation. Then 1.25 mL of sodium carbonate (0.55 mol/L) and 0.25 mL of Folin reagent were added to 0.25 mL of the resultant supernatant, respectively. The color was developed in a water bath for 15 min. The corresponding optical density (OD) values were recorded at 680 nm wave length for subsequent calculations.

2.5.5 Determination of glycogen content of liver and muscle

The fresh liver and muscle tissue were weighted (about 0.1 g), and 3 times the volume of alkali solution was added and hydrolyzed in a boiling water bath for 20 min. The resultant hydrolysate was collected, and the glycogen contents of the liver and muscle were determined by commercial kits (A043-1-1, Nanjing Jiancheng Bioengineering Institute, China).

2.5.6 Muscle texture properties analysis (TPA)

Complete fresh back muscle blocks were selected and cut into 1 cm × 1 cm × 1 cm squares. Texture profile analysis was used to measure muscle hardness, springiness, gumminess, chewiness, and resilience with the TVT-300XP texture instrument (Perten Instruments (Beijing) Co., Ltd., Beijing, China). The P-cy5s cylindrical probe was used for two tests; the test speed was 1 mm/s, the interval was 5 s, the deformation was 60%, and the data acquisition rate was 200 pps. The test speed was 2 mm/s before and after the test. Each sample was pressed twice.

2.5.7 Determination of collagen content

The hydroxyproline (Hyp) content was used to determine the collagen concentration. The muscle alkaline-soluble Hyp and alkaline-insoluble Hyp were separated by the method provided by Li et al. (2005). In brief, following the homogenization of muscle samples, sodium hydroxide (0.2 mol/L) and 8 mol/L hydrochloric acid (HCl) were used to extract the alkaline-soluble and alkaline-insoluble Hyp in an ice bath, respectively. The Hyp was determined by the method provided by Zhang et al. (2013). The Hyp content was calculated using a standard curve.

2.5.8 Determination of muscle antioxidant capacity

The fresh muscle samples (about 0.6 g per sample) were accurately weighed and put into 10 mL centrifuge tubes. The samples were homogenized with ice-cold physiological saline solution (1:9, w/v) on ice using a portable homogenizer and then centrifuged at 960 × g for 30 min at 4 °C. The resulting supernatants were collected and kept at −80 °C to analyze the enzyme activity. Using assay kits acquired from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China), the total protein (TP, A045-4) content, total antioxidant capacity (T-AOC, A015-2-1), catalase (CAT, A007-1-1) activity, superoxide dismutase (SOD, A001-3) activity, and malondialdehyde (MDA, A003-1) content of muscle were determined.

2.5.9 Histological properties analysis

Following ethanol dehydration and xylene cleaning, muscle samples were embedded in paraffin. Hematoxylin and eosin were used to stain the 5 μm tissue sections, followed by observation and photography using the light microscope DM2500 (Leica DM2500, Leica, Solms, Germany). The myofiber characteristics, including the number of muscle fiber and density, were measured using Image-J Launcher software. The muscle fiber density (N/mm2) was expressed as the rate of all the fibers in the entire region.

2.5.10 Analysis of amino acid and fatty acid contents

Bound amino acids were determined using an automated amino acid analyzer (HITACHI L-8900, Tokyo, Japan). Samples of muscle were prepared using the following method: freeze-dried muscle samples weighing about 0.1 g were put into glass tubes that were sealed, and 12 mL of HCl (6 mol/L) was added to hydrolyze the samples for 24 h at 110 °C. The hydrolysate was then filtered and diluted with distilled water to a volume of 100 mL. A vacuum drier was used for 24 h to remove the HCl from the filtrate (2 mL), which was then evaporated to dryness at 60 °C. A second 24 h evaporation of the 2 mL of distilled water was added. Then, 8 mL of 0.1 mol/L HCl was used to deliquesce the sedimentation and filter the mixture through a 0.22 μm millipore membrane, leaving 1 mL of the supernatant for analysis of bound amino acids.

The free amino acids were determined using an automated amino acid analyzer (HITACHI L-8900, Tokyo, Japan). Samples of muscle were prepared using the following method: fresh muscle tissues weighing approximately 1.0 g were homogenized with 3 mL of 10% sulfosalicylic acid and then centrifuged (18,000 × g, 4 °C, 15 min). Then 1 mL of supernatant was filtered through a 0.22 μm millipore membrane and used for the measurement of free amino acids.

The fatty acids were isolated from the muscle in accordance with the Chinese standard (GB 5009.168-2016). Briefly, approximately 0.4 g of muscle tissue was put into a 5 mL centrifuge tube, then 4 mL of isooctane was added, vortexed, and mixed for 30 s, and then shaken in a shaker at 25 °C overnight for extraction. Then, 8 mL of 2% sodium hydroxide in methanol solution was added to the resultant extraction solution and gently boiled for 40 min. Following this, 20 min of gentle boiling was spent adding 7 mL of 15% boron trifluoride to the methanol solution. Twenty milliliters of n-heptane were added and boiled gently for 1 min. The mixture was allowed to stratify after adding the saturated sodium chloride solution. Five mL of the upper n-heptane extraction solution was taken. Then 5 g of anhydrous sodium sulfate was added and stirred for 1 min and stood for 5 min. The resulting supernatants were put in a 2 mL centrifuge tube and kept at −20 °C until analysis. Gas chromatography (GC, Agilent 7890A, Agilent Technologies, Santa Clara, USA) was used to determine individual fatty acids. A polydicyanopropyl siloxane capillary column with a strong polar stationary phase separated the lipids under the following GC conditions: the injection volume was 1 μL, and the temperatures of the injection port and the detection port were 270 and 280 °C, respectively. The temperature schedule was set up as follows: after 13 min at 100 °C, the temperature was increased to 180 °C at a rate of 10 °C per min and maintained for 6 min. After that, the temperature increased to 200 °C at a rate of 1 °C per min and stayed there for 20 min. After reaching 230 °C at a rate of 4 °C per min, the temperature was maintained for 10.5 min. The carrier was nitrogen gas, and the split ratio was 100:1. The ratio of the peak areas of various fatty acids to the internal standard's peak areas (C11:0) was used to compute the fatty acid content.

2.5.11 cDNA synthesis and quantitative reverse transcription polymerase chain reaction (RT-qPCR)

TRIzol reagent (Life Technologies, Carlsbad, CA, USA) was used to extract total RNA from muscle, and PrimeScript RT reagent Kit with gDNA Eraser (Perfect Real Time) (Takara Biotech, Dalian, China) instructions were followed to generate cDNA. TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa Biotech, Dalian, China) was utilized to quantify the mRNA expression of genes. The RT-qPCR was carried out according to published papers (Xie et al., 2021). The primers are listed in Table 2 (synthesized by Sangon Biotech). β-actin was selected as the housekeeping gene. Using the 2−ΔΔCt method, relative quantification of transcript expression was computed, with the relative mRNA expressions of the CON group serving as the reference.Table 2 Primer sequences for real-time qPCR.

Table 2Gene	Accession number	Primer sequence (5′ to 3′)	Product length, bp	Melting temperature, °C	
β-actin	XM_003443127.5	Forward:	180	60	
TCGTGCGTGACATCAAGGAGAAG	
Reverse:	
CAAGGAAGGAAGGCTGGAAGAGG	
MyoD	NM_001279720.1	Forward:	181	60	
CCTCCTCTTCATCCTCATCCTCC	
Reverse	
GCGTTGGTCGTCTTCCTCTTG	
MyoG	NM_001279526.1	Forward	185	59	
GAGGAGCACGCTGATGAACC	
Reverse	
CGCTTGACGACGACACTCTG	
Myf5	XM_005456634.3	Forward	121	58	
GGCGGCTGAAGAAGGTGAAC	
Reverse	
AGGCTCTCGATGTACTGGATGG	
MRF4	NM_001282891.1	Forward	116	60	
CCTCCGCTGACCATTCCACTT	
Reverse	
GCTGTCGTTGGTGATGCTGTC	
Nrf2	XM_003447296.5	Forward	184	58	
GCTGGACTCGCTGAAGGAAGA	
Reverse	
GCCATCCGTTGACTGCTGAAG	
CAT	XM_003447521.5	Forward	175	58	
CCCATCCTTCGTTCATTCCCAGAA	
Reverse	
GGTGTGAGAGCCGTAGCCATTC	
SOD	XM_003446807.4	Forward	219	56	
GCCCACACTTCAATCCCTACAA	
Reverse	
GGCTCTCTTCATTTCCTCCTTT	
FASN	XM_031753129.2	Forward	141	60	
TGAAACTGAAGCCTTGTGTGCC	
Reverse	
TCCCTGTGAGCGGAGGTGATTA	
LPL	XM_031725752.2	Forward	217	59	
TGCTAATGTGATTGTGGTGGAC	
Reverse	
GCTGATTTTGTGGTTGGTAAGG	
ACC	XM_031755303.2	Forward	197	60	
CCACCACAGGCTGAACTGAGAG	
Reverse	
GCCAGACTAGCATAGACCGAATCC	
CPT1B	XM_031737259.2	Forward	114	59	
TTGTCCACCAGCCAGACTCCA	
Reverse	
ACCATAACCATCGTCAGCCACAG	
GLUT1	XM_031739850.2	Forward	167	60	
GTTGGAACTGCGGTGATTGGCT	
Reverse	
ATAGCAACAGCGATGGACCACAC	
GLUT4	XM_031727154.2	Forward	223	60	
GCTGTCCGTTGCCATCTTCTCC	
Reverse	
TGTCAAGCCAGATGCCAATCCA	
PFKMA	XM_031746855.2	Forward	264	59	
CCGTGAGAGCCACAGTCAGAGT	
Reverse	
TGCCGTCTCCACCGATTACACA	
PFKMB	XM_031739988.2	Forward	143	58	
GGTCGCATCTTCGCCAACTCTC	
Reverse	
AGCCTTAGCCACCACTGTGTCTT	
HK1A	XM_039611531.1	Forward	183	60	
TGCCACTGCTACACTGAAGATGC	
Reverse	
TCCTCGGGCGTGTCGTAGATTT	
HK1B	XM_019360229.2	Forward	273	60	
TTCTCTTTCCCGTGTGCCCAAAC	
Reverse	
GTGACGCAGTTCCTCCATGTAGC	
PCK	XM_031730149.2	Forward	146	58	
GCACCTCCAACAAGACCAACC	
Reverse	
ATGCCAATCTGTGAGCGTGATG	
GYS	XM_031732663.2	Forward	276	59	
GAGGCATCTACACCGTCATCCA	
Reverse	
GCTCGCTCTTCCAGGAGTCTAA	
MyoD = myogenic differentiation antigen; MyoG = myogenin; Myf5 = myogenic factor 5; MRF4 = muscle regulatory factor 4; Nrf2 = nuclear factor-erythroid 2 related factor 2; CAT = catalase; SOD = superoxide dismutase; FASN = fatty acid synthase; LPL = lipoprotein lipase; ACC = acetyl-CoA carboxylase; CPT1B = carnitine palmitoyltransferase-1B; GLUT1 = glucose transporter 1; GLUT4 = glucose transporter 4; PFKMA = phosphofructokinase muscle-A; PFKMB = phosphofructokinase muscle-B; HK1A = hexokinase-1A; HK1B = hexokinase-1B; PCK = phosphoenolpyruvate carboxykinase; GYS = glycogen synthase.

2.6 Statistical analysis

The experiment data were analyzed with SPSS 26.0 software (SPSS Inc., Chicago, IL, USA). All results were presented as the means ± standard deviation (SD). Normality and homoscedasticity were confirmed initially. Then, a one-way analysis of variance was performed on all the data, and Tukey's multiple range tests were performed. Furthermore, orthogonal polynomial contrasts were used to evaluate all the data in order to determine if the tendency (or pattern) was linear or second-order polynomial. Statistical differences were evaluated at P < 0.05. GraphPad Prism 8 was used to create the column charts (GraphPad Software, Inc., La Jolla, CA, USA). The quadratic regression graphs were made using OriginLab 2019 (OriginLab Inc., Massachusetts, USA).

3 Results

3.1 Growth performance and feed utilization

The SR of tilapia was 100%. With the increase in succinic acid supplementation in the CON diet, the WGR, SGR, PER, FCR, VSI and CF of tilapia demonstrated a significantly second-order polynomial relationship (P < 0.05), and the HSI and MFI revealed a significantly linear and second-order polynomial relationship (P < 0.05). The minimum of VSI and HSI and the maximum of CF were recorded in the S1.0 group. The maximum of WGR, SGR, and PER and the minimum of FCR were recorded in the S2.0 group (Table 3). Dietary supplementation with succinic acid had no considerable effect on the FR and FI (P > 0.05). Quadratic curve model analysis based on WGR, SGR, PER, and FCR demonstrated that the optimal supplementation with succinic acid in HCD ranged from 1.83% to 2.43% for tilapia (Fig. 1).Table 3 Effects of dietary supplementation with succinic acid levels on growth performance of Nile tilapia.1

Table 3Item	Groups2	P-value	
CON	S0.5	S1.0	S2.0	S4.0	ANOVA	L	Q	
IBW, g	204.79 ± 0.873	205.41 ± 0.518	203.27 ± 1.558	205.63 ± 1.150	205.39 ± 0.372	0.087	0.376	0.656	
FBW, g	459.36 ± 4.026b	476.69 ± 4.918c	492.83 ± 1.336d	504.52 ± 4.939d	442.61 ± 6.716a	<0.001	0.395	0.018	
WGR, %	124.31 ± 2.008b	132.07 ± 2.867c	142.46 ± 1.312d	145.35 ± 2.641d	115.49 ± 3.257a	<0.001	0.195	<0.001	
SGR, %/d	1.44 ± 0.016b	1.50 ± 0.022c	1.58 ± 0.010d	1.60 ± 0.019d	1.37 ± 0.027a	<0.001	0.175	<0.001	
FCR	1.27 ± 0.026c	1.22 ± 0.013b	1.23 ± 0.007bc	1.16 ± 0.023a	1.21 ± 0.006b	<0.001	0.076	<0.001	
FR, %	1.64 ± 0.079	1.69 ± 0.075	1.62 ± 0.089	1.66 ± 0.046	1.48 ± 0.118	0.082	0.016	0.022	
FI, g/fish	295.26 ± 32.060	318.16 ± 18.565	295.59 ± 31.580	318.98 ± 4.030	259.03 ± 32.905	0.103	0.077	0.044	
VSI, %	7.93 ± 0.212c	7.22 ± 0.155b	6.86 ± 0.146a	7.49 ± 0.272b	7.81 ± 0.321c	<0.001	0.128	<0.001	
HSI, %	2.15 ± 0.061b	1.91 ± 0.097a	1.83 ± 0.079a	1.86 ± 0.067a	1.90 ± 0.069a	<0.001	0.012	<0.001	
MFI, %	2.83 ± 0.077b	2.16 ± 0.082a	2.21 ± 0.080a	2.26 ± 0.103a	2.26 ± 0.090a	<0.001	0.008	<0.001	
CF, %	3.97 ± 0.149a	4.10 ± 0.135a	4.31 ± 0.158b	4.15 ± 0.095ab	4.07 ± 0.134a	<0.001	0.810	0.003	
PER, %	2.35 ± 0.020a	2.45 ± 0.020ab	2.47 ± 0.050b	2.63 ± 0.060c	2.49 ± 0.010b	0.001	0.070	<0.001	
IBW = initial body weight; FBW = final body weight; WGR = weight gain rate; SGR = specific growth rate; FCR = feed conversion ratio; FR = feed rate; FI = feed intake; VSI = viscerosomatic index; HSI = Hepatosomatic index; MFI = mesenteric fat index; CF = condition factor; PER = protein efficiency ratio.

a-d Different letters in the same line show significant differences (P < 0.05).

1 All values are means ± SD (n = 6). L: linear trend; Q: second order polynomial trend.

2 CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid.

Fig. 1 Quadratic curve model analysis of weight gain rate （WGR） (A), specific growth rate (SGR) (B), protein efficiency ratio (PER) (C) and feed conversion ratio (FCR) (D) of Nile tilapia.

Fig. 1

3.2 Proximate composition and muscle collagen content

With the increase in succinic acid supplementation in the CON diet, the contents of whole fish moisture and muscle crude protein exhibited a significantly linear relationship (P < 0.05), and the contents of whole fish crude lipid, muscle crude lipid, muscle glycogen, liver moisture, and collagen alkali-soluble hydroxyproline demonstrated a significantly second-order polynomial relationship (P < 0.05). The contents of liver crude lipid, collagen alkali-insoluble hydroxyproline, and total hydroxyproline revealed a significantly linear and second-order polynomial relationship (P < 0.05). The maximum contents of muscle ash, muscle crude protein, and total hydroxyproline appeared in the S0.5 group; the minimum crude lipid contents of the whole fish, muscle, and liver were recorded in the S1.0 group; and the maximum contents of muscle glycogen and collagen alkali-soluble hydroxyproline were presented in the S2.0 group. Dietary supplementation with succinic acid had no considerable effect on the contents of whole fish ash, muscle moisture, and liver crude protein (P > 0.05, Table 4).Table 4 Effects of dietary supplementation with succinic acid levels on proximate composition and muscle collagen content of Nile tilapia1 (g/kg).

Table 4Item	Groups2	P-value	
CON	S0.5	S1.0	S2.0	S4.0	ANOVA	L	Q	
Whole fish	
Moisture	701.81 ± 8.228ab	684.06 ± 5.124a	695.35 ± 7.452ab	704.79 ± 8.146b	708.51 ± 6.566b	0.015	0.041	0.123	
Ash	39.81 ± 2.459	42.34 ± 2.745	41.56 ± 2.353	39.62 ± 1.286	40.56 ± 2.809	0.261	0.619	0.884	
Crud protein	156.37 ± 2.759ab	161.36 ± 3.568b	156.95 ± 4.174ab	154.98 ± 2.278a	156.65 ± 2.302ab	0.018	0.268	0.437	
Crud lipid	98.80 ± 1.647b	92.14 ± 2.183ab	85.10 ± 6.532a	85.63 ± 3.981a	85.94 ± 5.118a	<0.001	0.002	<0.001	
Muscle	
Moisture	765.67 ± 7.751	762.54 ± 3.699	766.42 ± 4.898	766.61 ± 5.602	765.96 ± 7.942	0.784	0.616	0.834	
Ash	11.95 ± 0.455a	12.68 ± 0.438b	12.25 ± 0.271ab	12.20 ± 0.420ab	12.36 ± 0.236ab	0.037	0.648	0.832	
Crud protein	185.89 ± 3.585a	196.97 ± 7.555b	190.78 ± 5.825ab	180.95 ± 6.155a	183.48 ± 5.420a	0.001	0.029	0.091	
Crud lipid	23.55 ± 0.949b	20.35 ± 0.629a	20.06 ± 0.854a	21.18 ± 0.727a	20.53 ± 1.132a	<0.001	0.052	0.008	
Glycogen	0.76 ± 0.075a	1.00 ± 0.069b	1.10 ± 0.107b	1.12 ± 0.112b	1.01 ± 0.093b	<0.001	0.050	<0.001	
Liver	
Moisture	733.07 ± 11.781c	682.29 ± 5.905ab	671.51 ± 19.431ab	651.73 ± 24.298a	694.45 ± 6.526bc	0.001	0.343	<0.001	
Crud protein	92.99 ± 3.738	91.54 ± 3.917	92.79 ± 3.037	93.07 ± 2.774	92.17 ± 4.072	0.935	0.917	0.961	
Crud lipid	90.77 ± 4.171c	84.20 ± 5.377bc	72.79 ± 6.280a	79.85 ± 4.421ab	77.42 ± 3.808ab	<0.001	0.016	0.001	
Glycogen	107.30 ± 4.980bc	108.57 ± 4.563bc	116.95 ± 8.601c	102.06 ± 6.555b	72.31 ± 1.659a	<0.001	<0.001	<0.001	
Collagen	
Alkali-soluble hydroxyproline	1.65 ± 0.037a	1.71 ± 0.053abc	1.73 ± 0.036bc	1.77 ± 0.041c	1.65 ± 0.065ab	<0.001	0.760	<0.001	
Alkali-insoluble hydroxyproline	1.42 ± 0.042bc	1.52 ± 0.051c	1.36 ± 0.048ab	1.29 ± 0.105a	1.29 ± 0.061a	<0.001	<0.001	0.001	
Total hydroxyproline	3.06 ± 0.066a	3.23 ± 0.081b	3.09 ± 0.051ab	3.06 ± 0.133a	2.94 ± 0.107a	0.001	0.002	0.005	
a-c Different letters in the same line show significant differences (P < 0.05).

1 All values are means ± SD (n = 6). L: linear trend; Q: second order polynomial trend.

2 CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid.

3.3 Serum biochemical indices

With the increase in succinic acid supplementation in the CON diet, the activities of AST, ALT, and TG content in serum exhibited a significantly second-order polynomial relationship (P < 0.05), and the contents of TP, ALB, TCHO, and GLU demonstrated a significantly linear and second-order polynomial relationship (P < 0.05). The maximum contents of TP and ALB in serum were recorded in the S1.0 group, and the minimum amounts of AST and ALT activities and the contents of ALP and TG appeared in the S1.0 group. The minimum amount of serum TCHO content was presented to group S4.0 (Table 5).Table 5 Effects of dietary supplementation with succinic acid levels on serum biochemical indices of Nile tilapia.1

Table 5Item	Groups2	P-value	
CON	S0.5	S1.0	S2.0	S4.0	ANOVA	L	Q	
TP, g/L	35.82 ± 0.947b	36.92 ± 1.609b	37.31 ± 1.661b	35.95 ± 2.571b	32.78 ± 1.408a	0.001	0.001	<0.001	
ALB, g/L	8.72 ± 0.329ab	9.13 ± 0.321b	9.14 ± 0.400b	8.76 ± 0.2333ab	8.34 ± 0.227a	0.001	0.002	0.001	
AST, U/L	48.83 ± 2.927b	36.83 ± 1.941a	36.33 ± 1.633a	38.83 ± 2.483a	39.33 ± 2.582a	<0.001	0.113	0.001	
ALT, U/L	30.17 ± 2.041b	28.17 ± 1.472ab	26.50 ± 0.837a	27.17 ± 1.472a	27.67 ± 0.816a	0.002	0.096	0.002	
ALP, U/L	26.33 ± 1.366b	24.00 ± 0.632a	23.00 ± 1.265a	24.83 ± 0.983ab	24.00 ± 1.549a	0.001	0.214	0.116	
TG, mmol/L	3.21 ± 0.157d	2.09 ± 0.146ab	1.89 ± 0.194a	2.23 ± 0.102bc	2.37 ± 0.095c	<0.001	0.202	<0.001	
TCHO, mmol/L	4.18 ± 0.163b	3.79 ± 0.271ab	3.74 ± 0.261a	3.60 ± 0.285a	3.45 ± 0.158a	<0.001	<0.001	<0.001	
GLU, mmol/L	6.07 ± 0.502a	5.77 ± 0.408a	6.12 ± 0.638ab	6.23 ± 0.545ab	7.06 ± 0.747b	0.010	0.001	0.002	
TP = total protein; ALB = albumin; AST = aspartate aminotransferase; ALT = alanine aminotransferase; ALP = alkaline phosphatase; TG = triglyceride; TCHO = total cholesterol; GLU = glucose.

a-d Different letters in the same line show significant differences (P < 0.05).

1 All values are means ± SD (n = 6). L: linear trend; Q: second order polynomial trend.

2 CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid.

3.4 Activities of liver and intestinal digestive enzymes

With the increase in succinic acid supplementation in the CON diet, the activities of AMS and LPS in the liver demonstrated a significantly second-order polynomial relationship (P < 0.05), and the activity of LPS in the intestine revealed a significantly linear (P < 0.001) and second-order polynomial relationship (P = 0.001). The highest AMS activity in the intestine was recorded in the S0.5 group, the maximum AMS activity in the liver was recorded in the S1.0 group, the maximum LPS activity in the liver appeared in the S2.0 group, and the maximum LPS activity in the intestine was presented in the S4.0 group. Dietary supplementation with succinic acid had no considerable effect on the activity of protease in the liver and intestine (P > 0.05, Table 6).Table 6 Effects of dietary supplementation with succinic acid levels on digestive enzymes of Nile tilapia.1

Table 6Item	Groups2	P-value	
CON	S0.5	S1.0	S2.0	S4.0	ANOVA	L	Q	
Liver	
Amylase, U/mg prot	23.48 ± 0.532a	27.30 ± 0.965b	28.48 ± 1.042b	28.41 ± 0.390b	27.04 ± 0.898b	<0.001	0.177	0.001	
Lipase, U/g prot	0.32 ± 0.016a	0.38 ± 0.016b	0.38 ± 0.026b	0.45 ± 0.033c	0.32 ± 0.003a	<0.001	0.773	<0.001	
Protease, U/mg prot	152.73 ± 2.835	145.99 ± 5.202	148.80 ± 6.651	150.26 ± 1.199	150.80 ± 6.577	0.572	0.776	0.781	
Intestine	
Amylase, U/mg prot	30.36 ± 1.346a	32.78 ± 0.600b	30.15 ± 0.654a	29.16 ± 0.655a	29.84 ± 0.311a	0.002	0.111	0.194	
Lipase, U/g prot	0.33 ± 0.025a	0.40 ± 0.021a	0.42 ± 0.017ab	0.43 ± 0.055ab	0.51 ± 0.059b	0.004	<0.001	0.001	
Protease, U/mg prot	188.62 ± 7.458	179.69 ± 8.103	186.79 ± 8.353	182.09 ± 5.567	176.05 ± 9.548	0.347	0.098	0.267	
a,b Different letters in the same line show significant differences (P < 0.05).

1 All values are means ± SD (n = 6). L: linear trend; Q: second order polynomial trend.

2 CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid.

3.5 Muscle texture analysis

With the increase in succinic acid supplementation, muscle springiness and chewiness displayed a significantly second-order polynomial relationship (P < 0.05), and muscle hardness and resilience demonstrated a significantly linear and second-order polynomial relationship (P < 0.05). The maximum muscle hardness, gumminess, and chewiness were recorded in the S1.0 group, and the maximum muscle springiness and resilience were present in the S2.0 group (Table 7).Table 7 Effects of dietary supplementation with succinic acid levels on muscle texture of Nile tilapia.1

Table 7Item	Groups2	P-value	
CON	S0.5	S1.0	S2.0	S4.0	ANOVA	L	Q	
Hardness, g	2,594.00 ± 58.716ab	2,650.70 ± 80.000bc	2,726.90 ± 97.974c	2,671.40 ± 41.183bc	2,509.80 ± 50.988a	<0.001	0.002	<0.001	
Springiness	0.52 ± 0.032a	0.53 ± 0.032ab	0.55 ± 0.020ab	0.56 ± 0.036b	0.51 ± 0.033a	0.005	0.725	0.001	
Gumminess, g	1,088.77 ± 44.597a	1,116.57 ± 78.151ab	1,171.91 ± 64.082b	1,091.96 ± 54.321a	1,080.75 ± 33.862a	0.005	0.174	0.110	
Chewiness, g	563.90 ± 18.691a	598.04 ± 19.371b	621.57 ± 10.230c	600.86 ± 10.786bc	570.74 ± 25.309a	<0.001	0.321	<0.001	
Resilience	0.21 ± 0.017a	0.29 ± 0.022b	0.30 ± 0.021b	0.33 ± 0.017c	0.30 ± 0.011b	<0.001	0.001	<0.001	
a-c Different letters in the same line show significant differences (P < 0.05).

1 All values are means ± SD (n = 6). L: linear trend; Q: second order polynomial trend.

2 CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid.

3.6 Histological properties analysis

Compared with the CON group, the density of muscle fibers in the S1.0 group was higher, and the gap between muscle fibers was smaller (Fig. 2). In comparison to the CON group, the muscle fiber density of the S1.0 and S2.0 groups was significantly greater (P = 0.001). In contrast to the other groups, the number of muscle fibers with a diameter of 70 to 110 μm was significantly increased in the S1.0 group (P < 0.001), and the number of muscle fibers with a diameter of less than 70 μm was significantly decreased in the S1.0 group (P < 0.001) (Table 8).Fig. 2 Effects of dietary supplementation with succinic acid levels on the morphology of Nile tilapia. Myofiber microstructure of cross-section (200 ×). Scale bar = 50 μm. CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid.

Fig. 2

Table 8 Effects of dietary supplementation with succinic acid levels on the number of muscle fiber and fiber density of Nile tilapia.1

Table 8Item	Groups2	P-value	
CON	S0.5	S1.0	S2.0	S4.0	ANOVA	L	Q	
Number of muscle fiber	
Muscle fiber diameter <70 μm	27.66 ± 1.229c	22.09 ± 1.513b	15.01 ± 0.531a	21.69 ± 1.136b	30.43 ± 1.089c	<0.001	0.126	<0.001	
Muscle fiber diameter 70–110 μm	47.85 ± 1.023b	54.97 ± 1.807c	62.99 ± 1.531d	46.24 ± 0.719b	38.16 ± 1.278a	<0.001	0.007	0.004	
Muscle fiber diameter >110 μm	24.50 ± 2.055a	22.94 ± 0.664a	22.00 ± 1.474a	32.07 ± 0.558b	31.41 ± 1.035b	<0.001	0.001	0.004	
Muscle fiber density, N/mm2	155.95 ± 5.832a	164.88 ± 4.175ab	171.43 ± 5.051b	166.67 ± 4.325b	162.50 ± 6.682ab	0.001	0.592	0.003	
a-d Different letters in the same line show significant differences (P < 0.05).

1 All values are means ± SD (n = 6). L: linear trend; Q: second order polynomial trend.

2 CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid.

3.7 Muscle antioxidant capacity

With the increase in succinic acid supplementation, the activity of CAT and T-AOC in muscle displayed a significantly second-order polynomial relationship (P < 0.05), while the MDA content demonstrated a significantly linear (P = 0.005) and second-order polynomial relationship (P = 0.003). The maximum muscular SOD activity and the minimum MDA content appeared in the S0.5 group. The maximum muscular CAT activity was recorded in the S1.0 group, and the maximum T-AOC was recorded in the S2.0 group (Table 9). The mRNA expression levels of muscular CAT, SOD, and Nrf2 in the succinic acid supplementation group were significantly up-regulated (P < 0.05) (Fig. 3).Table 9 Effects of dietary supplementation with succinic acid levels on muscle antioxidant indices of Nile tilapia.1

Table 9Item	Groups2	P-value	
CON	S0.5	S1.0	S2.0	S4.0	ANOVA	L	Q	
CAT, U/mg prot	25.70 ± 1.976a	36.99 ± 1.293c	51.12 ± 3.379d	32.08 ± 1.990b	33.17 ± 1.765b	<0.001	0.856	0.031	
T-AOC, U/mg prot	0.19 ± 0.014a	0.20 ± 0.011a	0.45 ± 0.034b	0.48 ± 0.039b	0.19 ± 0.016a	0.005	0.975	<0.001	
SOD, U/mg prot	10.63 ± 0.813a	12.53 ± 0.824b	12.01 ± 1.014ab	11.10 ± 0.956a	11.91 ± 0.485ab	<0.001	0.544	0.765	
MDA, nmol/mg prot	0.16 ± 0.013b	0.13 ± 0.006a	0.13 ± 0.016a	0.16 ± 0.008b	0.17 ± 0.013b	<0.001	0.005	0.003	
CAT = catalase; T-AOC = total antioxidant capacity; SOD = superoxide dismutase; MDA = malondialdehyde.

a-d Different letters in the same line show significant differences (P < 0.05).

1 All values are means ± SD (n = 6). L: linear trend; Q: second order polynomial trend.

2 CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid.

Fig. 3 Effects of dietary supplementation with succinic acid levels on the relative mRNA expression of antioxidant genes in muscle of Nile tilapia. CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid. All values are means ± SD (n = 6). A: P-value of one-way analysis of variance; L: P-value of linear trend analyzed by orthogonal polynomial contrasts; Q: P-value of quadratic trend analyzed by orthogonal polynomial contrasts. SOD = superoxide dismutase; CAT = catalase; Nrf2 = nuclear factor-erythroid 2 related factor 2.a-d Bars with different letters are significantly different at P < 0.05.

Fig. 3

3.8 Fatty acid profiles of the muscle

There were 22 different types of fatty acids found in muscle tissue: 7 types of saturated fatty acids (SFA), 7 types of monounsaturated fatty acids (MUFA), and 8 types of PUFA (Table 10). With the increase in succinic acid supplementation, the contents of C18:2n-6c and ΣMUFA exhibited a significantly linear relationship (P < 0.05), and the contents of C18:3n-3 (LA) and Σn-3PUFA demonstrated a significantly second-order polynomial relationship (P < 0.05). The contents of C16:0, C18:1n-9c, C20:3n-6, C20:4n-6 (ARA), C20:5n-3 (EPA), C24:1n-9, and ΣSFA demonstrated a significantly linear and second-order polynomial relationship (P < 0.05). The maximum contents of ΣPUFA and Σn-6PUFA were present in the S0.5 group; the minimum content of ΣMUFA was recorded in the S1.0 group; the maximum contents of Σn-3PUFA and DHA appeared in the S1.0 group; and the maximum content of ΣSFA was recorded in the S2.0 group. The maximum contents of ARA and EPA were present in the S4.0 group.Table 10 Effects of dietary supplementation with succinic acid levels fatty acid composition in muscle of Nile tilapia1 (g/kg).

Table 10Item	Groups2	P-value	
CON	S0.5	S1.0	S2.0	S4.0	ANOVA	L	Q	
C12:0	0.03 ± 0.004	0.03 ± 0.005	0.03 ± 0.004	0.03 ± 0.003	0.03 ± 0.001	0.956	0.638	0.889	
C14:0	0.67 ± 0.052a	0.85 ± 0.066b	0.73 ± 0.046ab	0.83 ± 0.038b	0.74 ± 0.057ab	0.010	0.712	0.143	
C14:1n-5	0.04 ± 0.003	0.04 ± 0.007	0.03 ± 0.007	0.03 ± 0.002	0.04 ± 0.004	0.391	0.498	0.572	
C15:0	0.05 ± 0.011	0.05 ± 0.005	0.05 ± 0.005	0.05 ± 0.002	0.04 ± 0.005	0.966	0.541	0.835	
C16:0	4.30 ± 0.163a	4.64 ± 0.327a	4.60 ± 0.147a	5.23 ± 0.182b	5.23 ± 0.094b	0.001	<0.001	<0.001	
C16:1n-7	0.92 ± 0.097	1.03 ± 0.067	1.03 ± 0.030	1.05 ± 0.096	0.96 ± 0.094	0.273	0.958	0.095	
C17:0	0.05 ± 0.011	0.05 ± 0.005	0.05 ± 0.008	0.05 ± 0.003	0.05 ± 0.012	0.825	0.286	0.564	
C17:1n-7	0.03 ± 0.009	0.04 ± 0.002	0.03 ± 0.004	0.03 ± 0.004	0.04 ± 0.011	0.560	0.302	0.479	
C18:0	1.36 ± 0.125a	1.31 ± 0.025a	1.33 ± 0.041a	1.60 ± 0.030b	1.35 ± 0.044a	0.001	0.482	0.059	
C18:1n-9t	0.07 ± 0.003	0.07 ± 0.011	0.07 ± 0.008	0.09 ± 0.010	0.07 ± 0.001	0.056	0.617	0.108	
C18:1n-9c	7.51 ± 0.363b	6.22 ± 0.326a	5.81 ± 0.236a	6.45 ± 0.276a	5.66 ± 0.342a	<0.001	0.017	0.026	
C18:2n-6c	2.16 ± 0.116a	2.43 ± 0.050b	2.14 ± 0.028a	2.08 ± 0.103a	2.06 ± 0.060a	0.001	0.044	0.137	
C20:0	0.06 ± 0.005	0.06 ± 0.006	0.04 ± 0.010	0.05 ± 0.006	0.06 ± 0.014	0.189	0.467	0.177	
C18:3n-6	0.08 ± 0.019	0.08 ± 0.005	0.08 ± 0.012	0.09 ± 0.006	0.08 ± 0.013	0.823	0.417	0.630	
C20:1n-9	0.28 ± 0.022ab	0.22 ± 0.006a	0.28 ± 0.059ab	0.33 ± 0.006b	0.29 ± 0.013ab	0.018	0.150	0.198	
C18:3n-3 (LA)	0.19 ± 0.018	0.192 ± 0.014	0.213 ± 0.005	0.215 ± 0.010	0.195 ± 0.001	0.061	0.654	0.018	
C20:2n-6	0.118 ± 0.016	0.107 ± 0.004	0.12 ± 0.018	0.119 ± 0.016	0.112 ± 0.010	0.740	0.815	0.857	
C20:3n-6	0.13 ± 0.003a	0.13 ± 0.006a	0.13 ± 0.007a	0.15 ± 0.008b	0.15 ± 0.007b	0.003	0.002	0.004	
C20:4n-6 (ARA)	0.27 ± 0.013a	0.29 ± 0.011ab	0.29 ± 0.011ab	0.30 ± 0.007ab	0.31 ± 0.017b	0.040	0.003	0.014	
C20:5n-3 (EPA)	0.177 ± 0.005a	0.181 ± 0.002ab	0.173 ± 0.003a	0.192 ± 0.003b	0.213 ± 0.006c	<0.001	<0.001	<0.001	
C24:1n-9	0.04 ± 0.003	0.04 ± 0.004	0.04 ± 0.003	0.04 ± 0.005	0.04 ± 0.006	0.150	0.012	0.047	
C22:6n-3 (DHA)	1.19 ± 0.018a	1.25 ± 0.030ab	1.32 ± 0.059b	1.26 ± 0.045ab	1.26 ± 0.041ab	0.039	0.395	0.104	
ΣSFA	6.51 ± 0.329a	6.97 ± 0.284ab	6.82 ± 0.147a	7.85 ± 0.227c	7.51 ± 0.052bc	<0.001	0.004	0.001	
ΣMUFA	8.88 ± 0.458b	7.65 ± 0.393a	7.29 ± 0.158a	8.02 ± 0.346ab	7.11 ± 0.343a	0.001	0.023	0.055	
ΣPUFA	4.30 ± 0.078a	4.66 ± 0.102b	4.46 ± 0.065ab	4.39 ± 0.101a	4.38 ± 0.084a	0.005	0.468	0.578	
Σn-3PUFA	1.55 ± 0.039a	1.63 ± 0.042ab	1.70 ± 0.064b	1.67 ± 0.045ab	1.67 ± 0.040ab	0.024	0.105	0.022	
Σn-6PUFA	2.75 ± 0.107a	3.03 ± 0.065b	2.75 ± 0.034a	2.72 ± 0.117a	2.71 ± 0.097a	0.007	0.138	0.346	
Total FA	19.69 ± 0.728ab	19.28 ± 0.738ab	18.58 ± 0.159a	20.27 ± 0.484b	19.00 ± 0.383ab	0.022	0.043	0.056	
ΣSFA = total saturated fatty acid; ΣMUFA = total monounsaturated fatty acid; ΣPUFA = total polyunsaturated fatty acid; FA = fatty acid.

a-c Different letters in the same line show significant differences (P < 0.05).

1 All values are means ± SD (n = 6). L: linear trend; Q: second order polynomial trend.

2 CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid.

3.9 Free and bound amino acid profiles in muscle

A total of 17 kinds of bound amino acids were detected in this study, including 9 kinds of EAA (except Try) and 8 kinds of non-essential amino acids (NEAA) (Table 11). With the increase in succinic acid supplementation, Arg content demonstrated a significantly second-order polynomial relationship (P = 0.017), and His, Ile, Lys, and Met contents displayed a significantly linear and second-order polynomial relationship (P < 0.05). The maximum content of Thr was recorded in the S0.5 group, the maximum content of Arg and the minimum content of Leu were recorded in the S1.0 group, the maximum content of Met was recorded in the S2.0 group, and the maximum contents of His, Ile, and Lys were recorded in the S4.0 group. Among the NEAA, the content of Tyr demonstrated a significantly linear relationship (P = 0.048), the content of Ala demonstrated a significantly second-order polynomial relationship (P = 0.003), and the contents of Asp and Cys demonstrated a significantly linear and second-order polynomial relationship (P < 0.05). The maximum contents of Pro and ΣNEAA were recorded in the S1.0 group; the maximum contents of Ala and Cys were recorded in the S2.0 group; and the maximum contents of Asp, ΣEAA and total amino acids (ΣTAA) were recorded in the S4.0 group. Dietary supplementation with succinic acid had no discernible effect on the content of Phe, Val, Gly, Glu, and Ser (P > 0.05).Table 11 Effects of dietary supplementation with succinic acid levels on bound amino acid contents in muscle of Nile tilapia1 (g/kg).

Table 11Item	Groups2	P-value	
CON	S0.5	S1.0	S2.0	S4.0	ANOVA	L	Q	
Arg	12.68 ± 0.491a	14.54 ± 0.833ab	15.05 ± 1.295b	14.83 ± 0.619b	15.19 ± 0.366b	0.017	0.036	0.017	
His	5.39 ± 0.361a	6.81 ± 0.768ab	7.03 ± 0.841b	7.01 ± 0.509b	7.42 ± 0.296b	0.016	0.017	0.013	
Ile	9.60 ± 0.340a	10.49 ± 0.500ab	10.62 ± 0.366b	11.10 ± 0.086b	11.23 ± 0.280b	0.001	0.001	<0.001	
Leu	16.19 ± 0.878ab	17.03 ± 0.566b	14.96 ± 0.773a	17.54 ± 0.875b	17.72 ± 0.446b	0.005	0.051	0.154	
Lys	15.16 ± 0.753a	19.26 ± 0.805b	19.56 ± 1.183b	19.74 ± 0.529b	19.97 ± 0.637b	<0.001	0.021	0.002	
Met	5.64 ± 0.465a	6.70 ± 0.507b	6.97 ± 0.151b	7.37 ± 0.137b	7.34 ± 0.179b	<0.001	0.004	<0.001	
Phe	9.16 ± 0.768	10.32 ± 0.610	10.56 ± 1.013	10.72 ± 0.545	10.89 ± 0.404	0.080	0.035	0.026	
Thr	10.54 ± 0.576a	14.15 ± 1.168b	11.64 ± 0.827a	11.88 ± 0.441a	12.03 ± 0.340a	0.002	0.927	0.827	
Val	10.84 ± 0.576	11.81 ± 0.519	11.95 ± 0.766	12.31 ± 0.767	12.21 ± 0.313	0.091	0.049	0.021	
Ala	11.64 ± 0.576a	12.99 ± 0.638ab	13.46 ± 0.594b	13.50 ± 0.080b	13.29 ± 0.429b	0.006	0.063	0.003	
Asp	18.43 ± 0.888a	19.55 ± 0.787ab	19.91 ± 0.607ab	20.17 ± 0.643ab	20.39 ± 0.552b	0.046	0.015	0.010	
Cys	1.61 ± 0.097a	1.80 ± 0.056ab	1.85 ± 0.024ab	2.26 ± 0.119c	1.99 ± 0.137b	<0.001	0.022	<0.001	
Gly	9.92 ± 0.333	10.71 ± 0.309	11.05 ± 0.608	10.84 ± 0.733	10.71 ± 0.105	0.114	0.314	0.077	
Glu	25.33 ± 1.135	26.76 ± 1.227	27.06 ± 1.733	27.82 ± 1.368	27.92 ± 0.764	0.172	0.036	0.037	
Pro	8.76 ± 0.595a	10.01 ± 0.278b	12.01 ± 0.235c	10.09 ± 0.500b	9.90 ± 0.248b	<0.001	0.769	0.073	
Ser	8.62 ± 0.507	9.48 ± 0.539	9.66 ± 0.748	9.90 ± 0.464	10.02 ± 0.273	0.057	0.020	0.014	
Tyr	3.89 ± 0.264b	2.13 ± 0.118a	3.66 ± 0.284b	2.26 ± 0.142a	2.33 ± 0.115a	<0.001	0.048	0.088	
ΣEAA	95.20 ± 4.235a	111.11 ± 4.928b	108.34 ± 5.411b	112.51 ± 4.035b	114.01 ± 3.023b	0.002	0.015	0.007	
ΣNEAA	88.20 ± 3.835a	93.43 ± 3.678ab	98.67 ± 3.527b	96.85 ± 3.747ab	96.54 ± 2.160ab	0.028	0.093	0.017	
TAA	183.40 ± 7.896a	204.53 ± 8.597b	207.02 ± 8.681b	209.36 ± 7.762b	210.55 ± 5.164b	0.009	0.026	0.006	
ΣEAA = total essential amino acids; ΣNEAA = total non-essential amino acids; TAA = total amino acids.

a-c Different letters in the same line show significant differences (P < 0.05).

1 All values are means ± SD (n = 6). L: linear trend; Q: second order polynomial trend.

2 CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid.

A total of 14 kinds of free amino acids were detected in the muscle tissue, including 8 kinds of EAA and 6 kinds of NEAA (Table 12). With the increase in dietary succinic acid supplementation, the contents of Leu and Phe demonstrated a significantly linear relationship (P < 0.05), and the contents of Ile, Met, Asp, Gly, Pro, and total bitter amino acid (ΣBAA) followed a significantly second-order polynomial relationship (P < 0.05). The content of Arg followed a significantly linear (P = 0.001) and second-order polynomial relationship (P < 0.001). The minimum contents of Ile and Leu were found in the S0.5 group; the maximum contents of Ala, ΣEAA, ΣNEAA, and TAA were recorded in the S0.5 group; the maximum contents of His, Lys, Pro, and ΣFAA were recorded in the S1.0 group; and the minimum contents of Met, Val, Gly, and Tyr were recorded in the S1.0 group. The maximum content of Asp and the minimum content of ΣBAA appeared in the S2.0 group, and the minimum content of Arg was recorded in the S4.0 group. The level of dietary supplementation with succinic acid had no discernible effect on the content of Glu (P = 0.077).Table 12 Effects of dietary supplementation with succinic acid on levels of free amino acid contents in muscle of Nile tilapia1 (g/kg).

Table 12Item	Groups2	P-value	
CON	S0.5	S1.0	S2.0	S4.0	ANOVA	L	Q	
Arg	71.16 ± 0.561d	52.47 ± 0.782c	41.02 ± 1.407b	38.93 ± 0.848ab	36.63 ± 0.313a	<0.001	0.001	<0.001	
His	206.19 ± 7.585a	225.22 ± 5.377bc	238.14 ± 3.698c	220.34 ± 1.068ab	233.29 ± 8.429bc	<0.001	0.080	0.108	
Ile	13.33 ± 1.129c	8.21 ± 0.464a	9.47 ± 0.675ab	10.08 ± 0.085b	12.31 ± 0.387c	<0.001	0.457	0.025	
Leu	20.32 ± 0.368c	15.03 ± 0.574a	17.66 ± 0.360b	20.20 ± 1.344c	21.63 ± 1.022c	<0.001	0.027	0.057	
Lys	165.69 ± 2.886ab	187.06 ± 4.625c	215.18 ± 13.138d	154.59 ± 9.460a	179.18 ± 4.281bc	<0.001	0.677	0.897	
Met	10.81 ± 0.650c	10.06 ± 0.441bc	8.37 ± 0.610a	9.38 ± 0.241ab	9.49 ± 0.454abc	0.002	0.246	0.028	
Phe	10.73 ± 0.881ab	10.89 ± 0.334ab	9.11 ± 0.864a	11.58 ± 1.085ab	12.32 ± 1.260b	0.019	0.036	0.081	
Val	12.45 ± 0.655c	9.66 ± 0.610ab	8.21 ± 0.880a	12.14 ± 0.362c	11.49 ± 0.958bc	<0.001	0.487	0.448	
Ala	345.83 ± 10.908a	428.55 ± 12.553b	367.20 ± 17.554a	348.48 ± 6.623a	421.38 ± 12.794b	<0.001	0.176	0.218	
Asp	5.53 ± 0.302a	6.65 ± 0.377ab	6.93 ± 0.711b	7.43 ± 0.457b	6.41 ± 0.248ab	0.005	0.357	0.001	
Gly	452.26 ± 13.302c	412.00 ± 5.467a	397.58 ± 11.761a	418.04 ± 6.626ab	443.74 ± 12.978bc	<0.001	0.505	0.007	
Glu	41.12 ± 1.263	42.54 ± 2.653	48.14 ± 3.189	43.07 ± 3.846	43.85 ± 1.601	0.077	0.657	0.428	
Pro	1,007.58 ± 25.822a	1,094.72 ± 42.108bc	1,143.76 ± 17.634c	1,122.52 ± 16.131bc	1,055.81 ± 17.148ab	0.001	0.829	0.001	
Tyr	25.72 ± 1.568d	18.54 ± 0.796b	15.35 ± 1.417a	22.11 ± 0.456c	17.65 ± 1.117ab	<0.001	0.186	0.251	
ΣEAA	657.07 ± 7.367a	714.71 ± 5.416b	701.61 ± 16.178b	652.55 ± 16.530a	663.35 ± 2.051a	<0.001	0.202	0.413	
ΣNEAA	1,878.05 ± 34.086a	2,003.01 ± 44.542b	1,978.96 ± 41.856b	1,961.65 ± 28.576ab	1,988.84 ± 18.186b	0.010	0.155	0.165	
ΣFAA	46.65 ± 1.563a	49.19 ± 2.692ab	55.07 ± 3.091b	50.50 ± 4.250ab	50.25 ± 1.387ab	0.047	0.555	0.175	
ΣBAA	334.26 ± 5.399c	320.65 ± 3.638ab	322.86 ± 5.200abc	311.05 ± 3.166a	324.85 ± 6.175bc	0.003	0.340	0.001	
TAA	2,535.12 ± 35.560a	2,717.71 ± 49.935b	2,680.57 ± 56.502b	2,614.2 ± 38.965ab	2,652.19 ± 18.356b	0.003	0.587	0.504	
ΣEAA = total essential amino acids; ΣNEAA = total non-essential amino acids; ΣFAA = total flavor amino acid; ΣBAA = total bitter amino acid; TAA = total amino acids.

a-d Different letters in the same line show significant differences (P < 0.05).

1 All values are means ± SD (n = 6). L: linear trend; Q: second order polynomial trend.

2 CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid.

3.10 Muscle regulatory factor (MRF) gene expression in the muscle

The mRNA expression levels of MyoD, MyoG, Myf5, and MRF4 were significantly up-regulated in the succinic acid supplementation group (P < 0.05). The S2.0 group had a significantly greater MyoD mRNA expression level compared to the other groups (P < 0.001). The S0.5 group had the highest MyoG mRNA expression level. With the increase in succinic acid supplementation, the mRNA expression levels of Myf5 and MRF4 demonstrated a significantly second-order polynomial relationship (P < 0.05), and the maximum was recorded in the S1.0 group (Fig. 4).Fig. 4 Effects of dietary supplementation with succinic acid levels on mRNA expression levels of MRF of Nile tilapia. CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid. All values are means ± SD (n = 6). A: P-value of one-way analysis of variance; L: P-value of linear trend analyzed by orthogonal polynomial contrasts; Q: P-value of quadratic trend analyzed by orthogonal polynomial contrasts. MyoD = myogenic differentiation antigen; MyoG = myogenin; MRF4 = muscle regulatory factor 4; Myf5 = myogenic factor 5. a-d Bars with different letters are significantly different at P < 0.05.

Fig. 4

3.11 Glucose lipid metabolism in the muscle

The mRNA expression level of FASN was significantly down-regulated in the succinic acid supplementation group (P = 0.004). With the increase in succinic acid supplementation, the mRNA expression levels of CTP1B and HSL demonstrated a significantly second-order polynomial relationship (P < 0.05), and the maximum was reflected in the S1.0 group and S2.0 group, respectively. The mRNA expression level of LPL demonstrated a significantly linear and second-order polynomial relationship (P < 0.05), and the minimum was recorded in the S4.0 group (Fig. 5).Fig. 5 Effects of dietary supplementation with succinic acid levels on mRNA expression levels of genes related to fatty acid anabolism of Nile tilapia. CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid. All values are means ± SD (n = 6). A: P-value of one-way analysis of variance; L: P-value of linear trend analyzed by orthogonal polynomial contrasts; Q: P-value of quadratic trend analyzed by orthogonal polynomial contrasts. FASN = fatty acid synthase; HSL = hormone sensitive lipase; LPL = lipoprotein lipase; CPT1B = carnitine palmitoyltransferase-1B. a-d Bars with different letters are significantly different at P < 0.05.

Fig. 5

The mRNA expression levels of genes related to glycolysis (PFKMA and PFKMB), glycogen synthesis (GYS), and gluconeogenesis (PCK) were significantly increased in the succinic acid supplementation group (P < 0.05). The mRNA expression levels of HK1A, HK1B, HK2, and GLUT4 demonstrated a significantly linear and second-order polynomial relationship (P < 0.05). The maximum mRNA expression levels of HK1B and HK2 were present in the S0.5 group, and the maximum mRNA expression level of HK1A was recorded in the S1.0 group. The maximum mRNA expression level of GLUT4 was recorded in the S2.0 group. The GLUT1 mRNA expression level revealed a significantly second-order polynomial relationship (P = 0.004), and the maximum appeared in the S1.0 group (Fig. 6).Fig. 6 Effects of dietary supplementation with succinic acid levels on mRNA expression levels of genes related to glucose metabolism and transport of Nile tilapia. CON: high-carbohydrate diet (HCD); S0.5: the HCD was supplemented with 0.5% succinic acid; S1.0: the HCD was supplemented with 1.0% succinic acid; S2.0: the HCD was supplemented with 1.5% succinic acid; S4.0: the HCD was supplemented with 2.0% succinic acid. All values are means ± SD (n = 6). A: P-value of one-way analysis of variance; L: P-value of linear trend analyzed by orthogonal polynomial contrasts; Q: P-value of quadratic trend analyzed by orthogonal polynomial contrasts. HK1A = hexokinase 1A; HK1B = hexokinase 1B; HK2 = hexokinase 2; PFKMA = phosphofructokinase, muscle-A; PFKMB = phosphofructokinase, muscle-B; GYS = glycogen synthase; PCK = phosphoenolpyruvate carboxykinase; GLUT1 = glucose transporter 1; GLUT4 = glucose transporter 4. a-d Bars with different letters are significantly different at P < 0.05.

Fig. 6

4 Discussion

4.1 Succinic acid supplementation in HCD improves the growth and feed utilization of tilapia

Carbohydrates are used in fish diets as the cheapest energy source to enhance growth performance and promote protein-sparing action (Li et al., 2020). The majority of research has revealed that the optimal dietary carbohydrate level improves growth, but excessive dietary carbohydrate negatively affects fish health (Han et al., 2021). In recent years, glucose metabolism intermediates or derivatives have been used as feed additives to improve growth performance and feed utilization in aquatic animals (Duan et al., 2018). For example, dietary supplementation with 0.2% malic acid and 0.2% citric acid significantly improved the growth performance of Gibel carp (Carassius auratus gibelio) (Zhang et al., 2020), and dietary supplementation with 0.15% succinate promoted the growth and whole-body protein deposition of zebrafish (Ding et al., 2022). Our study demonstrated that supplementation with 2.0% succinic acid in HCD significantly improved the WGR, SGR, and PER of tilapia and reduced the FCR, indicating that succinic acid ameliorated the adverse effects of HCD on tilapia. Previous studies in zebrafish have reported that the growth promotion effect of succinate was related to the increase in FI (Ding et al., 2022). Nevertheless, succinic acid had no impact on the FI of tilapia, which might be related to different feeding strategies, fish size, and cultivation density. Quadratic curve model analysis based on WGR, SGR, PER, and FCR demonstrated that the optimal supplementation level with succinic acid in HCD ranged from 1.83% to 2.43% for tilapia, which was higher than that of zebrafish (0.15%) (Ding et al., 2022) and white shrimp (0.5%) (Duan et al., 2018), which might be due to fish needing more succinic acid to increase body metabolism in HCD and alleviate HCD stress.

Generally, herbivorous and omnivorous fish have a stronger capacity to utilize dietary carbohydrates, which may be related to enhanced AMS activity in vivo (Bautista et al., 1988). Organic acids have the capacity to slightly reduce the pH of the intestinal environment, which further facilitates the improvement of digestive enzyme activity and boosts the digestion and absorption of nutrients (Li et al., 2006; Luckstadt, 2012). Prior research revealed that the addition of organic acids enhanced the digestive enzyme activity in red drum (Sciaenops ocellatus) (Castillo et al., 2014). Furthermore, dietary supplementation with 0.5% succinic acid promoted both digestive enzyme activity and feed utilization in white shrimp (Duan et al., 2018). In the current study, dietary supplementation with 0.5% succinic acid enhanced the activities of AMS and LPS, indicating that succinic acid might enhance the ability to utilize carbohydrates and promote the digestion and absorption of nutrients by improving digestive enzyme activity to adapt to a HCD, which was conducive to the growth of tilapia.

4.2 Succinic acid supplementation in HCD improves the muscle antioxidant capacity of tilapia

Excessive dietary carbohydrate induces excessive production of free radicals, especially ROS, which leads to the oxidation of lipids and proteins in muscle, resulting in a decline in muscle quality (Cai et al., 2022; Wang et al., 2015, Wang et al., 2015). In vitro studies on the muscle cells of olive flounder (Paralichthys olivaceus) found that HCD induced oxidative stress and led to the apoptosis of muscle cells (Liu et al., 2022). In addition, oxidative stress reduced the physicochemical and textural properties of common carp (Cyprinus carpio) muscle (Morachis-Valdez et al., 2015). Organisms have an antioxidant defense system, which includes enzymatic and non-enzymatic antioxidants like SOD and CAT, to avoid oxidative damage (Cai et al., 2021). Dietary supplementation with organic acids enhances the antioxidant capacity of aquatic animals (Duan et al., 2017; Wang et al., 2015). Dietary supplementation with 0.5% succinic acid increased the antioxidant capacity of the hepatopancreas of white shrimp (Duan et al., 2018). In this study, dietary supplementation with 0.5% to 1.0% succinic acid significantly enhanced the antioxidant capacity of tilapia by improving the activity of endogenous antioxidant enzymes, such as CAT, SOD, and T-AOC. The exogenous addition of succinic acid stimulates the activity of succinate dehydrogenase (SDH), a common antioxidant, which simultaneously links the TCA with oxidative phosphorylation and imports electrons from the TCA into the electron transport chain (Adisa et al., 2019). Dietary succinic acid might accelerate the flow of paired electrons in the electron transport chain and accelerate the generation of electrochemical transmembrane potential to prevent the leakage of unpaired electrons, causing ROS production and the formation of lipid peroxides (Grishina et al., 2015). Therefore, succinic acid improves muscle quality after slaughter and during storage by reducing oxidative damage in muscle.

4.3 Succinic acid supplementation in HCD improves the muscle hardness of tilapia

Muscle texture is one of the most important parameters for reflecting muscle quality. The assessment of muscle texture is commonly based on its textural properties (Liu et al., 2020). Muscle hardness is the main indicator for consumers to evaluate aquatic products, and is positively correlated with flesh quality (Cai et al., 2022). Long-term intake of HCD significantly reduces muscle hardness, gumminess, and chewiness (Bao et al., 2022; Wu et al., 2021). In the current study, dietary supplementation with 1.0% succinic acid significantly increased muscle hardness, gumminess, chewiness, and resilience, indicating that succinic acid improves muscle texture, thereby improving taste. Our results are consistent with studies on mammals such as cattle (Gao et al., 2014) and fattening pigs (Liang, 2018).

The textural properties of fish flesh are significantly influenced by the diameter and density of muscle fibers (Koganti et al., 2020). Studies have shown that the muscle fiber diameter of Atlantic salmon (Salmo salar) (Johnston et al., 2000), sea bass (Dicentrarchus labrax) (Periago et al., 2005), and gilthead sea bream (Sparus aurata) (Valente et al., 2011) were negatively correlated with muscle hardness, while muscle fiber density was positively correlated with muscle hardness, chewiness, and collagen content (Bao et al., 2022). Dietary supplementation with succinic acid promoted the transformation of fast-twitch muscle fibers into slow-twitch muscle fibers in mice by activating the Ca2+ signaling pathway mediated by the succinate receptor 1 (SUCNR1) gene (Wang et al., 2019). In the present study, dietary supplementation with 1.0% succinic acid increased the muscle fiber density and the number of muscle fibers with a diameter ranging from 70 to 110 μm, and decreased the number of muscle fibers greater than 110 μm, which might promote the transformation of muscle fiber type, change the proportion of muscle fibers and thus significantly improve muscle quality.

The development of muscle fibers is regulated by MRF genes; MyoD and Myf5 regulate myoblast proliferation, while MyoG and MRF4 regulate myoblast differentiation (Koganti et al., 2020). Prior research has confirmed that excessive carbohydrate intake reduces the mRNA expression level of MRF gene and inhibits muscle fiber hyperplasia (Bao et al., 2022; Chapalamadugu et al., 2009). In the current study, dietary supplementation with 0.5% to 2.0% succinic acid significantly up-regulated the mRNA expression levels of MyoD, MyoG, Myf5, and MRF4, indicating that succinic acid promotes the development of muscle fibers. Myogenic regulatory factors are regulated by the mammalian target of rapamycin (mTOR) signaling pathway, and the anabolic process of mTOR signaling requires adequate energy from the TCA (Meng et al., 2023; Periago et al., 2005). Therefore, succinic acid might promote the mTOR signaling pathway by accelerating the oxidative phosphorylation process, thereby up-regulating the expression level of MRF gene, stimulating muscle cell development, and thereby increasing muscle fiber density. The aforementioned statement provides additional clarification regarding the potential mechanism underlying succinate-induced alterations in muscle fiber diameter and density.

Collagen content, which is directly proportional to muscle hardness, is a crucial determinant of fish flesh quality (Dong et al., 2022). The concentration of hydroxyproline is used to measure collagen (Hofman et al., 2011). Hydroxyproline is a metabolite of Pro catalyzed by proline hydroxylase (PHD). Proline hydroxylase is a type of dioxygenase dependent on oxygen and α-ketoglutarate, which is also the basis for collagen to maintain its triple helix structure (Yang et al., 2021). In addition, collagen is mainly synthesized by fibroblasts using Gly and Pro (Li and Wu, 2018). In this study, supplementation with 0.5% succinic acid significantly increased the contents of Pro, Gly, and hydroxyproline in muscle, suggesting that succinic acid might increase the content of muscle collagen by increasing the raw materials for collagen synthesis. On the other hand, succinic acid might activate PDH to promote collagen synthesis by increasing the concentration of α-ketoglutarate. Other research revealed that the content of hydroxyproline in muscle was positively correlated with the muscle texture of Atlantic salmon (Li et al., 2005) and Atlantic halibut (Hippoglossus hippoglossus) (Hagen et al., 2007), which improves muscle hardness. In the current study, fish fed with 0.5% to 1.0% succinic acid had higher muscle fiber density and total hydroxyproline content, which might be one of the reasons for the increase in the muscle hardness of tilapia.

4.4 Succinic acid supplementation in HCD improves the muscular nutritional value and flavor of tilapia

The levels of protein and amino acids in muscle determine its nutritional value and flavor (Jiang et al., 2016). In the present research, dietary supplementation with 1.5% succinic acid significantly increased muscle crude protein content, which might be related to the activation of Akt/mTOR/S6 and other signaling pathways related to protein synthesis (Liang, 2018). Protein is composed of amino acids, and EAA content is an important indicator of nutritional value in muscle. Studies have shown that TCA cycle intermediate metabolites are precursors for the synthesis of some amino acids. For example, oxaloacetate is a precursor for the synthesis of aspartate (Ling et al., 2023). Exogenous addition of α-ketoglutaric acid significantly increased the contents of amino acids such as Arg, Ala, Gly, and Glu in cells (Mühling et al., 2010). In the current study, dietary supplementation with 0.5% to 4.0% succinic acid significantly increased the contents of muscle ΣEAA and TAA, suggesting that succinic acid might promote the synthesis of bound amino acids and increase protein content by increasing the concentration of TCA cycle intermediate metabolites, thereby improving the nutritional value of tilapia muscle.

Muscle fatty acid contents and composition are important for human health and are important indicators of the nutritional value of muscle (Wood et al., 2008). According to the World Health Organization (WHO) report, reducing the intake of SFA and increasing the intake of unsaturated fatty acids (especially n-3PUFA and n-6PUFA) in the human diet effectively prevents chronic disease (Diet nutrition and the prevention of chronic diseases, 2003). The human body cannot synthesize EPA and DHA, so fish is the preferred source of high-quality PUFA for consumers. Studies have shown that dietary supplementation with 1.2% citrate significantly increases PUFA content in muscle (Xu et al., 2020). In addition, unsaturated fatty acids (especially n-3PUFA) are prone to lipid peroxidation, which reduces the content of PUFA in the body (Kamal-Eldin and Yanishlieva, 2002). In the current study, fish fed with 1.0% succinic acid had higher n-3PUFA content and lower total fatty acid content, suggesting that succinic acid changes the composition of fatty acids and increases the nutritional value of tilapia muscle by reducing lipid peroxidation, which was also confirmed by the significant reduction of MDA content in muscle.

Free amino acids are the main basis of muscle flavor in aquatic animals, including umami and bitterness (Herranz et al., 2006). Among the 14 free amino acids detected in this study, Asp and Glu were related to umami, Ala and Gly were related to sweetness, and Val, Met, Ile, Leu, His, and Arg were associated with bitterness. The delicious taste of fish depends on the composition and contents of free amino acids in muscle, especially the contents of free Asp, Glu, Gly, and Ala (Cheng, 2021). Studies have shown that dietary supplementation with 1.5% α-ketoglutaric acid significantly increased the contents of Thr, Ala, and Pro, as well as TAA and EAA, in the muscle of mirror carp (Wang et al., 2017). Furthermore, supplementation with 1.0% α-ketoglutaric acid significantly increased the contents of Glu, Lys, Ala, and Pro in the skeletal muscle of growing pigs (Chen et al., 2018). Succinic acid is a natural flavor enhancer that increases muscle umami (Subbaraj et al., 2016). In the present research, dietary supplementation with 1.0% succinic acid increased the contents of ΣFAA (Asp and Glu) and sweet amino acids (Ala and Gly) and decreased the ΣBAA (Val, Met, Ile, Leu, His, and Arg). Therefore, succinic acid might increase the flavor of muscle by increasing the content of flavor amino acids.

4.5 Succinic acid supplementation in HCD affects the glucose and lipid metabolism of tilapia muscle

Gluconeogenesis and glycolysis are two crucial metabolic processes for carbohydrate metabolism. Hexokinase (HK), phosphofructokinase (PFK) and pyruvate kinase (PK) are three key enzymes in the glycolytic pathway, and phosphoenolpyruvate carboxykinase (PCK), fructose-1, 6-diphosphatase (FBPase) and glucose-6-phosphatase (G-6-pase) are the rate-limiting enzymes of gluconeogenesis (Enes et al., 2009; Polakof et al., 2011). Studies have shown that succinate significantly reduced liver G6Pase activity by regulating intestinal gluconeogenesis in mice, thereby reducing liver glucose production (De Vadder et al., 2016). In the current study, dietary supplementation with 1.0% succinic acid up-regulated the mRNA expression levels of glycolytic genes (HK2, HK1A, HK1B, PFKMA and PFKMB), indicating that succinic acid might promote glycolysis to accommodate HCD. In addition, excessive carbohydrates were converted into glycogen, which was stored in the muscles and liver to maintain blood glucose balance (Enes et al., 2009). In the current study, dietary supplementation with 1.0% succinic acid increased the contents of liver and muscle glycogen and significantly up-regulated the expression levels of glycogen synthesis (GYS) and glucose transporters (GLUT1 and GLUT4) genes, which was consistent with the results of previous studies in zebrafish (Ding et al., 2022). Therefore, succinic acid might promote glycolysis and glycogen deposition to maintain glucose homeostasis.

Long-term feeding of HCD might result in metabolic problems that cause fat storage and impair the growth performance of fish (Prisingkorn et al., 2017; Viegas et al., 2016). Thus, lipid anabolism plays a crucial role in maintaining glucose homeostasis. Fatty acid synthase is a key enzyme involved in lipid synthesis. Carnitine palmitoyltransferase-1 is considered to be the rate-limiting enzyme in fatty acid β-oxidation (Morash et al., 2008). Hormone sensitive lipase is an intracellular neutral lipase that hydrolyzes lipids such as triglycerides and cholesterol esters (Lampidonis et al., 2011). In this study, dietary supplementation with 0.5% succinic acid reduced the crude lipid content of the whole fish and liver, MFI, and muscle total fatty acid content, down-regulated the expression of the lipid synthesis gene (FASN), and up-regulated the expression of lipid catabolic genes (CTP1B, HSL, LPL), indicating that succinic acid might induce a change in muscle fatty acid content by promoting fatty acid decomposition and β-oxidation and inhibiting fatty acid synthesis. Furthermore, dietary supplementation with 0.5% to 2.0% succinic acid significantly reduced the HSI and VSI of tilapia, confirming that succinic acid reduces abnormal fat deposition, thereby increasing the proportion of edible parts (muscle). In addition, the contents of serum TG and TCHO reflected the status of lipid metabolism (Zhang et al., 2021). In this study, fish fed 1.0% to 4.0% succinic acid had lower contents of serum TG and TCHO. These results further confirm the promoting effect of succinic acid on lipid catabolism. Therefore, succinic acid might reduce muscle total fatty acid content by promoting fatty acid β-oxidation and inhibiting the fatty acid synthesis process.

5 Conclusion

Dietary supplementation with 1.83% to 2.43% succinic acid promoted the growth performance, digestion, absorption, and antioxidant capacity of Nile tilapia. Additionally, succinic acid changed the proportion of muscle fibers by up-regulating muscle regulatory factor genes to increase muscle hardness and altering muscle amino acid and fatty acid composition to improve muscle flavor and nutritional value (Fig. 7). Succinic acid also promoted glycolysis and fatty acid β-oxidation, inhibited lipogenesis, decreased the accumulation of fat in the whole-body, and maintained glucose homeostasis.Fig. 7 Summary figure of dietary supplementation with succinic acid levels affecting the flesh quality of Nile tilapia. Optimal succinic acid level ultimately improves the flesh quality of Nile tilapia by increasing muscle hardness, nutritional value, flavor, and decreasing oxidative stress. MRF = myogenic regulatory factors; EPA = eicosapentaenoic acid; DHA = docosahexaenoic acid; ΣFAA = total flavor amino acid; ΣBAA = total bitter amino acid; MF = muscle fiber.

Fig. 7

Author contributions

Juan Tian, Hua Wen: Conceptualization, Funding acquisition, Resources. Manxia Cao, Ningning Xie, Jianmin Zhang, Lixue Dong, Ming Jiang, Feng Huang, Xing Lu: Formal analysis, Investigation, Visualization. Manxia Cao, Ningning Xie, Juan Tian: Software, Methodology, Writing - Original draft, Writing - Reviewing & Editing. All the authors have read and approved the final manuscript.

Declaration of competing interest

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, and there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the content of this paper.

Acknowledgments

This study was supported by the China Agriculture Research System (No. CARS-46 ) and the National Key Research and Development Program of China (No. 2018YFD0900400 ).

Peer review under responsibility of Chinese Association of Animal Science and Veterinary Medicine.
==== Refs
References

Adisa R.A. Kolawole N. Sulaimon L.A. Brai B. Ijaola A. Alterations of antioxidant status and Mitochondrial succinate dehydrogenase activity in the liver of wistar strain albino rats treated with by ethanol extracts of Annona senegalensis pers (annonaceae) stem bark Toxicol Res 35 2019 13 24 10.5487/TR.2019.35.1.013 30766654
AOAC Official methods of analysis 18st ed. 2005 AOAC Arlington, VA
Aragão C. Gonçalves A.T. Costas B. Azeredo R. Xavier M.J. Engrola S. Alternative proteins for fish diets: implications beyond growth Animals 12 2022 1211 10.3390/ani12091211 35565636
Bao S.T. Liu X.C. Huang X.P. Guan J.F. Xie D.Z. Li S.A. Magnesium supplementation in high carbohydrate diets: implications on growth, muscle fiber development and flesh quality of Megalobrama amblycephala Aquac Rep 23 2022 101039 10.1016/j.aqrep.2022.101039
Bautista J.M. Garrido-Pertierra A. Soler G. Glucose-6-phosphate dehydrogenase from Dicentrarchus labrax liver: kinetic mechanism and kinetics of NADPH inhibition BBA-GEN SUBJECTS 967 1988 354 363 10.1016/0304-4165(88)90098-0
Boonanuntanasarn S. Jangprai A. Kumkhong S. Plagnes-Juan E. Veron V. Burel C. Adaptation of Nile tilapia (Oreochromis niloticus) to different levels of dietary carbohydrates: new insights from a long term nutritional study Aquaculture 496 2018 58 65 10.1016/j.aquaculture.2018.07.011
Boonanuntanasarn S. Kumkhong S. Yoohat K. Plagnes-Juan E. Burel C. Marandel L. Molecular responses of Nile tilapia (Oreochromis niloticus) to different levels of dietary carbohydrates Aquaculture 482 2018 117 123 10.1016/j.aquaculture.2017.09.032
Cai M. Zhang Y. Zhu J. Li H. Tian H. Chu W. Intervention of re-feeding on growth performance, fatty acid composition and oxidative stress in the muscle of red swamp crayfish (Procambarus clarkii) subjected to short-term starvation Aquaculture 545 2021 737110 10.1016/j.aquaculture.2021.737110
Cai M. Chu W. Wang J. Shao C. Hu Yajun Che C. Intervention of taurine on fatty acid profiles, oxidative injury and autophagy status in the muscle of rice field eel (Monopterus albus) fed oxidized fish oil Aquaculture 551 2022 737904 10.1016/j.aquaculture.2022.737904
Castillo S. Rosales M. Pohlenz C. Gatlin D.M. Effects of organic acids on growth performance and digestive enzyme activities of juvenile red drum Sciaenops ocellatus Aquaculture 433 2014 6 12 10.1016/j.aquaculture.2014.05.038
Chapalamadugu K.C. Robison B.D. Drew R.E. Powell M.S. Hill R.A. Amberg J.J. Dietary carbohydrate level affects transcription factor expression that regulates skeletal muscle myogenesis in rainbow trout Comp Biochem Physiol B Biochem Mol Biol 153 2009 66 72 10.1016/j.cbpb.2009.01.013 19416696
Chen J. Su W. Kang B. Jiang Q. Zhao Y. Fu C. Supplementation with α-ketoglutarate to a low-protein diet enhances amino acid synthesis in tissues and improves protein metabolism in the skeletal muscle of growing pigs Amino Acids 50 2018 1525 1537 10.1007/s00726-018-2618-3 30167964
Cheng X.L. Study on the effects of dietary creatine supplementation on the growth performance and flesh quality of Pacific white shrimp (Litopenaeus vannamei) and grass carp (Ctenopharyngodon idella) 2021 Yangtze University
Cummings J.H. Pomare E.W. Branch W.J. Naylor C.P. Macfarlane G.T. Short chain fatty acids in human large intestine, portal, hepatic and venous blood Gut 28 1987 1221 1227 10.1136/gut.28.10.1221 3678950
De Vadder F. Kovatcheva-Datchary P. Zitoun C. Duchampt A. Bäckhed F. Mithieux G. Microbiota-produced succinate improves glucose homeostasis via intestinal gluconeogenesis Cell Metab 24 2016 151 157 10.1016/j.cmet.2016.06.013 27411015
Deng S.X. Tian L.X. Liu F.J. Jin S.J. Liang G.Y. Yang H.J. Toxic effects and residue of aflatoxin B1 in tilapia (Oreochromis niloticus×O. aureus) during long-term dietary exposure Aquaculture 307 2010 233 240 10.1016/j.aquaculture.2010.07.029
Diet, nutrition and the prevention of chronic diseases World Health Organ Tech Rep Ser 916 i–viii 2003 1 149 [backcover]
Ding Q. Lu C. Hao Q. Zhang Q. Yang Y. Olsen R.E. Dietary succinate impacts the nutritional metabolism, protein succinylation and gut microbiota of zebrafish Front Nutr 9 2022 894278 10.3389/fnut.2022.894278
Dong M. Zhang L. Wu P. Feng L. Jiang W.D. Liu Y. Dietary protein levels changed the hardness of muscle by acting on muscle fiber growth and the metabolism of collagen in sub-adult grass carp (Ctenopharyngodon idella) J Anim Sci Biotechnol 13 2022 10.1186/s40104-022-00747-7
Duan Y. Zhang Y. Dong H. Zheng X. Wang Y. Li H. Effect of dietary poly-β-hydroxybutyrate (PHB) on growth performance, intestinal health status and body composition of Pacific white shrimp Litopenaeus vannamei (Boone, 1931) Fish Shellfish Immunol 60 2017 520 528 10.1016/j.fsi.2016.11.020 27836720
Duan Y. Wang Y. Zhang J. Sun Y. Wang J. Dietary effects of succinic acid on the growth, digestive enzymes, immune response and resistance to ammonia stress of Litopenaeus vannamei Fish Shellfish Immunol 78 2018 10 17 10.1016/j.fsi.2018.04.008 29626670
Enes P. Panserat S. Kaushik S. Oliva-Teles A. Nutritional regulation of hepatic glucose metabolism in fish Fish Physiol Biochem 35 2009 519 539 10.1007/s10695-008-9259-5 18791853
Gao X. Wang Z. Tang M. Ma C. Dai R. Comparsion of the effects of succinate and NADH on postmortem metmyoglobin redcutase activity and beef colour stability J Integr Agric 13 2014 1817 1826 10.1016/S2095-3119(14)60754-1
Grishina E.V. Khaustova YaV. Vasilieva A.A. Mayevsky E.I. Age-related peculiarities of succinate effect on induced lipid peroxidation in rat liver mitochondria Biophysics 60 2015 581 587 10.1134/S0006350915040119
Hagen Ø. Solberg C. Sirnes E. Johnston I.A. Biochemical and structural factors contributing to seasonal variation in the texture of farmed Atlantic halibut (Hippoglossus hippoglossus L.) flesh J Agric Food Chem 55 2007 5803 5808 10.1021/jf063614h 17567023
Han H. Wang Z. Wang J. Wang T. Li Y. Guan D. Impact of high dietary cornstarch level on growth, antioxidant response, and immune status in GIFT tilapia Oreochromis niloticus Sci Rep 11 2021 6678 10.1038/s41598-021-86172-8 33758306
He C. Cao J. Bao Y. Sun Z. Liu Z. Li C. Characterization of lipid profiling in three parts (muscle, head and viscera) of tilapia (Oreochromis niloticus) using lipidomics with UPLC-ESI-Q-TOF-MS Food Chem 347 2021 129057 10.1016/j.foodchem.2021.129057
Herranz B. Fernández M. de la Hoz L. Ordóñez J.A. Use of bacterial extracts to enhance amino acid breakdown in dry fermented sausages Meat Sci 72 2006 318 325 10.1016/j.meatsci.2005.08.002 22061560
Hofman K. Hall B. Cleaver H. Marshall S. High-throughput quantification of hydroxyproline for determination of collagen Anal Biochem 417 2011 289 291 10.1016/j.ab.2011.06.019 21741948
Jiang W.D. Wu P. Tang R.J. Liu Y. Kuang S.Y. Jiang J. Nutritive values, flavor amino acids, healthcare fatty acids and flesh quality improved by manganese referring to up-regulating the antioxidant capacity and signaling molecules TOR and Nrf2 in the muscle of fish Food Res Int 89 2016 670 678 10.1016/j.foodres.2016.09.020 28460965
Johnston I.A. Alderson R. Sandham C. Dingwall A. Mitchell D. Selkirk C. Muscle fibre density in relation to the colour and texture of smoked Atlantic salmon (Salmo salar L.) Aquaculture 189 2000 335 349 10.1016/S0044-8486(00)00373-2
Kabir K.A. Verdegem M.C.J. Verreth J.A.J. Phillips M.J. Schrama J.W. Effect of dietary carbohydrate to lipid ratio on performance of Nile tilapia and enhancement of natural food in pond aquaculture Aquacult Res 51 2020 1942 1954 10.1111/are.14546
Kamal-Eldin A. Yanishlieva N.V. N-3 fatty acids for human nutrition: stability considerations Eur J Lipid Sci Technol 104 2002 825 836 10.1002/1438-9312(200212)104:12<825::AID-EJLT825>3.0.CO;2-N
Kamalam B.S. Medale F. Panserat S. Utilisation of dietary carbohydrates in farmed fishes: new insights on influencing factors, biological limitations and future strategies Aquaculture 467 2017 3 27 10.1016/j.aquaculture.2016.02.007
Koganti P. Yao J. Cleveland B.M. Molecular mechanisms regulating muscle plasticity in fish Animals 11 2020 61 10.3390/ani11010061 33396941
Kostyniuk D.J. Marandel L. Jubouri M. Dias K. de Souza R.F. Zhang D. Profiling the rainbow trout hepatic miRNAome under diet-induced hyperglycemia Physiol Genom 51 2019 411 431 10.1152/physiolgenomics.00032.2019
Krogdahl A. Hemre G.-I. Mommsen T.P. Carbohydrates in fish nutrition: digestion and absorption in postlarval stages Aquacult Nutr 11 2005 103 122 10.1111/j.1365-2095.2004.00327.x
Lampidonis A.D. Rogdakis E. Voutsinas G.E. Stravopodis D.J. The resurgence of Hormone-Sensitive Lipase (HSL) in mammalian lipolysis Gene 477 2011 1 11 10.1016/j.gene.2011.01.007 21241784
Li P. Wu G. Roles of dietary glycine, proline, and hydroxyproline in collagen synthesis and animal growth Amino Acids 50 2018 29 38 10.1007/s00726-017-2490-6 28929384
Li X. Bickerdike R. Lindsay E. Campbell P. Nickell D. Dingwall A. Hydroxylysyl pyridinoline cross-link concentration affects the textural properties of fresh and smoked Atlantic salmon (Salmo salar L.) flesh J Agric Food Chem 53 2005 6844 6850 10.1021/jf050743+ 16104809
Li J.S. Li J.L. Wu T.T. Ontogeny of protease, amylase and lipase in the alimentary tract of hybrid Juvenile tilapia (Oreochromis niloticus × Oreochromis aureus) Fish Physiol Biochem 32 2006 295 303 10.1007/s10695-006-9106-5
Li Y.J. Tang L. Yan S. Lu J. Shao Q.J. Effects of dietary protein and carbohydrate ratio on dorsal muscle composition and texture of black sea bream (Acanthopagrus schlegelii) J Fish China 38 2014 1476 1485
Li J.N. Xu Q.Y. Wang C.A. Wang L.S. Zhao Z.G. Luo L. Effects of dietary glucose and starch levels on the growth, haematological indices and hepatic hexokinase and glucokinase mRNA expression of juvenile mirror carp (Cyprinus carpio) Aquacult Nutr 22 2016 550 558 10.1111/anu.12278
Li M. Hu F.C. Qiao F. Du Z.Y. Zhang M.L. Sodium acetate alleviated high-carbohydrate induced intestinal inflammation by suppressing MAPK and NF-κB signaling pathways in Nile tilapia (Oreochromis niloticus) Fish Shellfish Immunol 98 2020 758 765 10.1016/j.fsi.2019.11.024 31730927
Liang B.Q. Effects of succinate on muscle growth and pork quality 2018 South China Agricultural University
Ling Z.N. Jiang Y.F. Ru J.N. Lu J.H. Ding B. Wu J. Amino acid metabolism in health and disease Sig Transduct Target Ther 8 2023 1 32 10.1038/s41392-023-01569-3
Liu C.Z. He A.Y. Ning L.J. Luo Y. Li D.L. Zhang M.L. Leptin selectively regulates nutrients metabolism in nile Tilapia fed on high carbohydrate or high fat diet Front Endocrinol 9 2018 574 10.3389/fendo.2018.00574
Liu J. Deng K. Pan M. Liu G. Wu J. Yang M. Dietary carbohydrates influence muscle texture of olive flounder Paralichthys olivaceus through impacting mitochondria function and metabolism of glycogen and protein Sci Rep 10 2020 21811 10.1038/s41598-020-76255-3
Liu J. Pan M. Huang D. Wu J. Liu Y. Guo Y. High glucose induces apoptosis, glycogen accumulation and suppresses protein synthesis in muscle cells of olive flounder Paralichthys olivaceus Br J Nutr 127 2022 1601 1612 10.1017/S0007114521002634 34256876
Luckstadt C. Luckstadt C. Effect of organic acid containing additives in worldwide aquaculture - sustainable production the non-antibiotic way 2012 Nottingham University Press Nottingham, UK 71 78 10.7313/UPO9781904761938.009
Meng Z. Zhou D. Lv D. Gan Q. Liao Y. Peng Z. Human milk extracellular vesicles enhance muscle growth and physical performance of immature mice associating with Akt/mTOR/p70s6k signaling pathway J Nanobiotechnology 21 2023 304 10.1186/s12951-023-02043-6 37644475
Morachis-Valdez G. Dublán-García O. López-Martínez L.X. Galar-Martínez M. Saucedo-Vence K. Gómez-Oliván L.M. Chronic exposure to pollutants in Madín Reservoir (Mexico) alters oxidative stress status and flesh quality in the common carp Cyprinus carpio Environ Sci Pollut Res Int 22 2015 9159 9172 10.1007/s11356-014-4061-7 25583264
Morash A.J. Kajimura M. McClelland G.B. Intertissue regulation of carnitine palmitoyltransferase I (CPTI): mitochondrial membrane properties and gene expression in rainbow trout (Oncorhynchus mykiss) Biochim Biophys Acta Biomembr 1778 2008 1382 1389 10.1016/j.bbamem.2008.02.013
Mühling J. Tussing F. Nickolaus K.A. Matejec R. Henrich M. Harbach H. Effects of α-ketoglutarate on neutrophil intracellular amino and α-keto acid profiles and ROS production Amino Acids 38 2010 167 177 10.1007/s00726-008-0224-5 19151914
Ning L. Zhang H. Chen X. Zhen J. Chen S. Guang J. A comparative study on the tolerance of tilapia (Oreochromis niloticus) to high carbohydrate and high lipid diets Anim Nutr 13 2023 160 172 10.1016/j.aninu.2023.01.007 37123615
Periago M.J. Ayala M.D. López-Albors O. Abdel I. Martínez C. García-Alcázar A. Muscle cellularity and flesh quality of wild and farmed sea bass, Dicentrarchus labrax L Aquaculture 249 2005 175 188 10.1016/j.aquaculture.2005.02.047
Polakof S. Mommsen T.P. Soengas J.L. Glucosensing and glucose homeostasis: from fish to mammals Comp Biochem Physiol B Biochem Mol Biol 160 2011 123 149 10.1016/j.cbpb.2011.07.006 21871969
Polakof S. Panserat S. Soengas J.L. Moon T.W. Glucose metabolism in fish: a review J Comp Physiol B 182 2012 1015 1045 10.1007/s00360-012-0658-7 22476584
Prisingkorn W. Prathomya P. Jakovlić I. Liu H. Zhao Y.H. Wang W.M. Transcriptomics, metabolomics and histology indicate that high-carbohydrate diet negatively affects the liver health of blunt snout bream (Megalobrama amblycephala) BMC Genom 18 2017 856 10.1186/s12864-017-4246-9
Subbaraj A.K. Kim Y.H.B. Fraser K. Farouk M.M. A hydrophilic interaction liquid chromatography-mass spectrometry (HILIC-MS) based metabolomics study on colour stability of ovine meat Meat Sci 117 2016 163 172 10.1016/j.meatsci.2016.02.028 26986230
Tan Q. Wang F. Xie S. Zhu X. Lei W. Shen J. Effect of high dietary starch levels on the growth performance, blood chemistry and body composition of gibel carp (Carassius auratus var. gibelio) Aquacult Res 40 2009 1011 1018 10.1111/j.1365-2109.2009.02184.x
Valente L.M.P. Cornet J. Donnay-Moreno C. Gouygou J.P. Bergé J.P. Bacelar M. Quality differences of gilthead sea bream from distinct production systems in Southern Europe: intensive, integrated, semi-intensive or extensive systems Food Control 22 2011 708 717 10.1016/j.foodcont.2010.11.001
Viegas I. Jarak I. Rito J. Carvalho R.A. Metón I. Pardal M.A. Effects of dietary carbohydrate on hepatic de novo lipogenesis in European seabass (Dicentrarchus labrax L.) J Lipid Res 57 2016 1264 1272 27247346
Wang B. Liu Y. Feng L. Jiang W.D. Kuang S.Y. Jiang J. Effects of dietary arginine supplementation on growth performance, flesh quality, muscle antioxidant capacity and antioxidant-related signalling molecule expression in young grass carp (Ctenopharyngodon idella) Food Chem 167 2015 91 99 10.1016/j.foodchem.2014.06.091 25148964
Wang Y. Li Z. Li J. Duan Y.F. Niu J. Wang J. Effects of dietary chlorogenic acid on growth performance, antioxidant capacity of white shrimp Litopenaeus vannamei under normal condition and combined stress of low-salinity and nitrite Fish Shellfish Immunol 43 2015 337 345 10.1016/j.fsi.2015.01.008 25600509
Wang B.K. Liu W.B. Xu C. Cao X.F. Zhong X.Q. Shi H.J. Dietary carbohydrate levels and lipid sources modulate the growth performance, fatty acid profiles and intermediary metabolism of blunt snout bream Megalobrama amblycephala in an interactive pattern Aquaculture 481 2017 140 153 10.1016/j.aquaculture.2017.08.034
Wang L. Wei Y. Wang C. Li J. Zhao Z. Luo L. Effects of α-ketoglutarate on the growth performance, amino acid metabolism and related gene expression of mirror carp (Cyprinus carpio) Aquacult Nutr 23 2017 926 933 10.1111/anu.12460
Wang T. Xu Y. Yuan Y. Xu P. Zhang C. Li F. Succinate induces skeletal muscle fiber remodeling via SUCNR1 signaling EMBO Rep 20 2019 e47892 10.15252/embr.201947892
Wood J.D. Enser M. Fisher A.V. Nute G.R. Sheard P.R. Richardson R.I. Fat deposition, fatty acid composition and meat quality: a review Meat Sci 78 2008 343 358 10.1016/j.meatsci.2007.07.019 22062452
Wu H.X. Li W.J. Shan C.J. Zhang Z.Y. Lv H.B. Qiao F. Oligosaccharides improve the flesh quality and nutrition value of Nile tilapia fed with high carbohydrate diet Food Chem: Molecular Sciences 3 2021 100040
Xie N. Wen H. Xie S. Jiang M. Yu L. Wu F. Adaptations of hepatic lipid and glucose metabolism in response to high-macronutrient diets in juvenile grass carp Aquacult Nutr 27 2021 1738 1749 10.1111/anu.13311
Xu Y. Huang J. Li W. Zheng Y. Jiang J. Ding Z. Dietary supplementation of vitamin E and citric acid could significantly promote the relative expression of PPARα and aconitase genes, concentration of polyunsaturated fatty acids, antioxidant enzyme activities, and growth of juvenile cobia Aquaculture 518 2020 734545 10.1016/j.aquaculture.2019.734545
Yang H. Xu Z. Li X. Tan S. Cheng Z. Leng X. Influences of dietary Eucommia ulmoides extract on growth, flesh quality, antioxidant capacity and collagen-related genes expression in grass carp (Ctenopharyngodon idellus) Anim Feed Sci Technol 277 2021 114965 10.1016/j.anifeedsci.2021.114965
Zakim D. Pardini R.S. Herman R.H. Sauberlich H.E. Mechanism for the differential effects of high carbohydrate diets on lipogenesis in rat liver Biochim Biophys Acta Lipids Lipid Metabol 144 1967 242 251 10.1016/0005-2760(67)90154-3
Zhang K. Ai Q. Mai K. Xu W. Liufu Z. Zhang Y. Effects of dietary hydroxyproline on growth performance, body composition, hydroxyproline and collagen concentrations in tissues in relation to prolyl 4-hydroxylase α(I) gene expression of juvenile turbot, Scophthalmus maximus L. fed high plant protein diets Aquaculture 404–405 2013 77 84 10.1016/j.aquaculture.2013.04.025
Zhang L. Zhang P. Xia C. Cheng Y. Guo X. Li Y. Effects of malic acid and citric acid on growth performance, antioxidant capacity, haematology and immune response of Carassius auratus gibelio Aquacult Res 51 2020 2766 2776 10.1111/are.14616
Zhang C. Yan Q. Zhu Q. Liu J. Dong Y. Li Y. Metabolomics study of isocaloric different dietary patterns on the life span in healthy population Clin Interv Aging 16 2021 2111 2123 10.2147/CIA.S343057 35221682
Zhang X. Zhang Y. Chen P. Gu X. Wu X. Han J. Spotted seabass, Lateolabrax maculatus can utilize the high-starch diet by effectively regulating the energy metabolism Aquaculture 543 2021 736948 10.1016/j.aquaculture.2021.736948
