
==== Front
Acta Pharm Sin B
Acta Pharm Sin B
Acta Pharmaceutica Sinica. B
2211-3835
2211-3843
Elsevier

S2211-3835(24)00219-3
10.1016/j.apsb.2024.05.026
Original Article
Identification of novel small-molecule inhibitors of SARS-CoV-2 by chemical genetics
Chan Chris Chun-Yiu a†
Guo Qian a†
Chan Jasper Fuk-Woo abcd†
Tang Kaiming a†
Cai Jian-Piao a†
Chik Kenn Ka-Heng ac
Huang Yixin e
Dai Mei f
Qin Bo f
Ong Chon Phin e
Chu Allen Wing-Ho ac
Chan Wan-Mui a
Ip Jonathan Daniel a
Wen Lei ac
Tsang Jessica Oi-Ling ac
Wang Tong-Yun a
Xie Yubin a
Qin Zhenzhi a
Cao Jianli ac
Ye Zi-Wei e
Chu Hin abc
To Kelvin Kai-Wang abc
Ge Xing-Yi g
Ni Tao e
Jin Dong-Yan ce
Cui Sheng f
Yuen Kwok-Yung abcd
Yuan Shuofeng yuansf@hku.hk
abc⁎
a State Key Laboratory of Emerging Infectious Diseases, Carol Yu Centre for Infection, Department of Microbiology, School of Clinical Medicine, Li Ka Shing Faculty of Medicine, the University of Hong Kong, Pokfulam, Hong Kong SAR 999077, China
b Department of Infectious Diseases and Microbiology, the University of Hong Kong-Shenzhen Hospital, Shenzhen 518000, China
c Centre for Virology, Vaccinology and Therapeutics, Hong Kong Science and Technology Park, Hong Kong SAR 999077, China
d Academician Workstation of Hainan Province, Hainan Medical University-the University of Hong Kong Joint Laboratory of Tropical Infectious Diseases, Haikou 571100, China
e School of Biomedical Sciences, Li Ka Shing Faculty of Medicine, the University of Hong Kong, Pokfulam, Hong Kong SAR 999077, China
f NHC Key Laboratory of Systems Biology of Pathogens, Institute of Pathogen Biology Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100730, China
g College of Biology, Hunan Provincial Key Laboratory of Medical Virology, Hunan University, Changsha 410082, China
⁎ Corresponding author. yuansf@hku.hk
† These authors made equal contributions to this work.

31 5 2024
9 2024
31 5 2024
14 9 40284044
5 12 2023
24 4 2024
16 5 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
There are only eight approved small molecule antiviral drugs for treating COVID-19. Among them, four are nucleotide analogues (remdesivir, JT001, molnupiravir, and azvudine), while the other four are protease inhibitors (nirmatrelvir, ensitrelvir, leritrelvir, and simnotrelvir-ritonavir). Antiviral resistance, unfavourable drug‒drug interaction, and toxicity have been reported in previous studies. Thus there is a dearth of new treatment options for SARS-CoV-2. In this work, a three-tier cell-based screening was employed to identify novel compounds with anti-SARS-CoV-2 activity. One compound, designated 172, demonstrated broad-spectrum antiviral activity against multiple human pathogenic coronaviruses and different SARS-CoV-2 variants of concern. Mechanistic studies validated by reverse genetics showed that compound 172 inhibits the 3-chymotrypsin-like protease (3CLpro) by binding to an allosteric site and reduces 3CLpro dimerization. A drug synergistic checkerboard assay demonstrated that compound 172 can achieve drug synergy with nirmatrelvir in vitro. In vivo studies confirmed the antiviral activity of compound 172 in both Golden Syrian Hamsters and K18 humanized ACE2 mice. Overall, this study identified an alternative druggable site on the SARS-CoV-2 3CLpro, proposed a potential combination therapy with nirmatrelvir to reduce the risk of antiviral resistance and shed light on the development of allosteric protease inhibitors for treating a range of coronavirus diseases.

Graphical abstract

This study identifies a novel compound that blocks SARS-CoV-2 3CLpro dimerization, extending the enzyme's druggable pockets with an allosteric inhibitory mechanism.Image 1

Key words

SARS-CoV-2
High throughput screening
Broad-spectrum antiviral treatment
3CLpro inhibitor
Allosteric-site inhibitor
Animal models
Chemical genetics
Reverse genetics
==== Body
pmc1 Introduction

In the past 20 years, the human society has encountered three significant spillovers of novel coronaviruses: SARS-CoV, MERS-CoV, and SARS-CoV-21, 2, 3. Among these outbreaks, the COVID-19 pandemic caused by SARS-CoV-2 has resulted in millions of cases and fatalities, and caused a severe impact on the global economy. At the dawn of COVID-19 outbreak, patients typically exhibited symptoms such as cough, congestion, fatigue, fever, breathing difficulties, and ground-glass opacity found in lung CT scans4, 5, 6, 7. Some patients also experienced diarrhea, confusion, abnormal liver, and renal functions4,6,7. However, as the pandemic evolved, COVID-19 has gradually become an upper respiratory tract infection in most cases and symptoms are often mild8. Although the world is moving towards a post-COVID phase, it is crucial to be prepared for the emergence of a new variant of SARS-CoV-2 or another zoonotic spillover of coronaviruses from wild reservoirs. One of the crucial measures to control emerging coronavirus outbreaks is to develop effective antivirals with broad-spectrum activity. Currently, there are only three major druggable protein targets in SARS-CoV-2: Spike protein, 3CL-protease (3CLpro), and RNA-dependent RNA polymerase (RdRp)9, 10, 11. Most monoclonal antibodies initially developed for the treatment of COVID-19 by targeting the Spike protein have failed, due to the emergence of the Omicron variant12. There are eight approved small molecule antiviral drugs, yet they are either conventional RdRp or 3CLpro inhibitors10,13, 14, 15. Four of them (Remdesivir, JT001, Molnupiravir, and Azvudine) are nucleotide analogues16, 17, 18, 19, which could be detrimental to the dividing cells20,21. Four of them are 3CLpro inhibitors (Nirmatrelvir/ritonavir, Ensitrelvir, Leritrelvir, and Simnotrelvir/Ritonavir)10,22, 23, 24. Nirmatrelvir/ritonavir (Paxlovid) is a covalent protease inhibitor, while Ensitrelvir is a non-covalent inhibitor that binds to the substrate-binding pocket of 3CLpro10,22. Despite the potent antiviral activity of these drugs, none of them were designed for SARS-CoV-2 specifically and resistance has been reported in some in vitro studies25, 26, 27, 28. Therefore, it is essential to continue the search for novel antivirals. Given the complex life cycle of SARS-CoV-2 which involves multiple steps, there are potentially new antiviral pathways that remain unexplored. Chemical genetics is one of the approaches to reveal novel antiviral pathways. It is the study of functions of genes by disruption with small chemical molecules29,30. Chemical genetics has benefits over traditional genetics in the discovery of novel druggable targets. Traditional reverse genetics often relies on altering gene expression, which may not fully capture the complexity of protein function, such as post-translational modifications or protein interactions29,30. Additionally, some proteins are essential for normal cellular function, knocking them out could be detrimental. Chemical genetics can be divided into two categories: forward and reverse chemical genetics30. Forward chemical genetics involves studying the phenotypic changes caused by small molecules, which can lead to the discovery of novel drug targets30. Reverse chemical genetics, on the other hand, requires a defined cellular target, followed by studying its function using small molecules30. This approach can be used to identify new small molecules that can achieve a desired phenotype.

In this study, 50,213 raw compounds from the SMART™ Library were screened from a forward chemical genetics direction, to determine their ability to inhibit cytopathic effect on VeroE6 cells. Secondary screening was then performed on A549-TMPRSS2-ACE2 cells to identify compounds with dose-dependent antiviral activity. The antiviral properties of the screened compounds were validated using plaque reduction assay and MTT cytotoxicity assay. Ultimately, five out of 50,213 compounds were confirmed to have anti-SARS-CoV-2 activity in vitro. Among these, 10-(4-methylphenyl)-7-phenyl-6,7,8,10-tetrahydro-5H-indeno[1,2-b]quinoline-9,11-dione (designated compound 172), exhibited the highest selectivity index (SI), inhibited several SARS-CoV-2 variants of concern (VOC) and multiple human coronaviruses including MERS-CoV, SARS-CoV, and HCoV-229E. Importantly, compound 172 also demonstrated antiviral activity in both Golden Syrian Hamster and K18-hACE mice models. Interestingly, mechanistic studies revealed that compound 172 targets a novel allosteric site on 3CLpro domain III and interferes with protein dimerization. Additionally, compound 172 can achieve drug synergism with Nirmatrelvir, an active compound in Paxlovid10,31, at nanomolar concentrations. Altogether, these findings suggest the presence of an alternative antiviral target on coronavirus 3CLpro and provide insights for the development of allosteric protease inhibitors.

2 Materials and methods

2.1 Chemical reagents

SMART™ Library purchased from ChemDiv (San Diego, CA, USA) contains a total of 50,213 structurally diverse synthetic raw compounds. The whole library is formatted in 167,384-well plates of 10 mmol/Lstock concentration dissolved in DMSO per well. The library is kept at −80 °C for storage. Remdesivir, GC-376 and Nirmatrelvir were purchased from MedChemExpress (NJ, USA). FRET-based protease activity substrate: dabcyl-KTSAVLQSGFRKM-E(Edans)-NH2 was purchased from Bachem Bioscience (Bubendorf, Switzerland). CellTiter Glo® cell viability assay kit was purchased from Promega USA.

2.2 Cell and virus culture

Multiple cell lines were used in this study: VeroE6, Vero-TMPRSS2, A549-TMPRSS2-ACE2, Huh7, U251, and HK2. VeroE6, U251, Huh7, and HK2 were maintained in DMEM supplemented with 5%–10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (PS). Vero-TMPRSS2 was maintained in 10% FBS DMEM supplemented with 1% PS and 1 mg/mL G-418 for marker selection. A549-TMPRSS2-ACE2 was maintained in 10% FBS DMEM supplemented with 1% PS, 0.5 μg/mL Puromycin, and 300 μg/mL Hygromycin for marker selection. All cell lines were passaged at least once per week.

Several SARS-CoV-2 variants were used in this study: Wild Type (strain HKU-001a) (GenBank: MT230904), strain B.1.1.7 (Alpha) (GenBank: OM212469), strain B.1.617.2 (Delta) (GenBank: OM212471), Omicron BA.1, and Omicron BA.5 (GenBank: OM212472). These variants were isolated from patients with laboratory confirmed COVID-19 in Hong Kong32. Virus expansion and propagation were conducted as previously described32. The resulting virus stocks were stored at −80 °C. MERS-CoV (EMC/2012) was kindly provided by Ron Fouchier (Erasmus Medical Center, The Netherlands). Archived clinical strains of SARS-CoV-1 (GZ50 strains, GenBank: AY304495), and HCoV-229E were obtained from the Department of Microbiology, the University of Hong Kong. Experiments involving live SARS-CoV-2 virus were performed in the BSL-3 facility located in Block T of Queen Mary Hospital.

2.3 Primary screening of SMART™ library by CellTiter-Glo® assay

VeroE6 cells were dispensed onto 384-well plates at a density of 5000 cells per well using a liquid dispenser. Selected SMART™ stock plates were diluted 20-fold using the Apricot S1 automatic 384 format liquid handling system (Apricot Designs, USA), and 0.5 μL of the diluted stock was added to each well using the same system. A positive control, Remdesivir at 10 μmol/L, was added to column 23. The cells and compounds were co-incubated overnight at 37 °C with 5% CO2 before being transferred to the BSL-3 facility for infection with SARS-CoV-2 WT strain D614G at a multiplicity of infection (MOI) of 0.01 in 10 μL per well, except for column 1 and 24 which served as mock infections. The final compound concentration was 5 μmol/L. After a 3-day incubation at 37 °C with 5% CO2, CellTiter Glo® reagent was added to each well, and cell viability was measured using a plate reader located inside the BSL-3 facility. The primary screening was performed in duplicate, and compounds that demonstrated >60% cell viability in both duplicates were selected for secondary screening. The cell viability data was analysed using a self-developed R studio script.

2.4 Secondary screening by RT-qPCR

The day before infection, A549-TMPRSS2-ACE2 cells were seeded onto 96-well plates at a density of 20,000 cells per well. On the following day, the plates were transferred to the BSL-3 facility for infection with SARS-CoV-2 strain D614G at MOI 0.01. After a 1-h adsorption period, the cell supernatant was removed, and the cells were washed once with PBS before being treated with primary hit compounds that had been prepared in advance at concentrations of 20, 5, and 1.25 μmol/L. Following a 2-day incubation period at 37 °C with 5% CO2, the cell supernatant was collected and lysed using RLT lysis buffer. RNA extraction was performed using the RNeasy kit (Qiagen, Germany) according to the manufacturer's protocol. The extracted RNA was then quantified using the Takara One-Step TB Green® PrimeScript™ RT-QPCR kit II (Takara, Japan) and SARS-CoV-2 RdRp/Hel gene primers as described previously32. Primary hit compounds that resulted in more than a 2-log10 viral load reduction in one or more concentrations were considered as secondary hits and would be validated by Plaque Reduction Assay in tertiary screening.

2.5 Plaque reduction assay

Briefly, compounds of interest were prepared in 2× gradient concentrations using 2% FBS/2% PS DMEM and mixed with LMP-agarose at a 1:1 ratio after a 1-h virus adsorption period. The compound-agarose mixture was then overlayed onto cells, and the plates were inverted and placed in a 37 °C/5% CO2 incubator for 3 days. A solution of 10% formalin in PBS was used to fix the cells, and a 0.25% solution of crystal violet was used to stain the plaques. The GraphPad Prism software was used to compute an IC50 value for each compound that demonstrated a reduction in plaque activity without significant cell toxicity.

2.6 MTT cytotoxicity assay

Briefly, cells were seeded onto a 96-well plate at a density of 20,000 cells per well one day before treatment. On the following day, compounds of interest were added to the cells in gradient concentrations and incubated at 37 °C with 5% CO2 for either 48 or 96 h. After medium removal, 100 μL of 1 × MTT solution in plain DMEM was added to the cells and incubated at 37 °C with 5% CO2 for 3–4 h. Then, MTT lysis buffer (10% SDS/10 mmol/L HCl) was added to the cells and incubated at room temperature for 3–4 h. Cell viability was measured in absorbance (OD595) using a plate reader (Glomax, Promega).

2.7 SARS-CoV-2 N antigen expression assay

After infecting VeroE6 cells with SARS-CoV-2 for 1 h at a 37 °C/5% CO2 incubator, the medium was removed and replaced with 1% FBS 1% PS DMEM containing the compound of interest. After 3 days post-infection (dpi), the medium was removed, and the cells were fixed with a 10% formaldehyde solution in PBS for 15 min. Following this, the formaldehyde was removed, and the cells were rinsed briefly with Virkon before being transferred to a BSL-2 laboratory for IF staining. The IF staining process involved adding 0.1% Triton X-100 in PBS to permeabilize the cells. Next, 2% bovine serum albumin (BSA) in PBS was used to incubate the cells for 1 h at room temperature (RT) to reduce non-specific bindings of the primary antibody. Then, an in-house rabbit antiserum against SARS-CoV-2 N protein, diluted at a ratio of 1:200 in 1% BSA in PBS, was added to the cells and incubated at 4 °C overnight. The cells were washed twice with PBS-T (0.05% Tween 20 in PBS) after removing the primary antibody, followed by the addition of Alexa Fluor secondary antibody (ThermoFisher Scientific, USA) at 1:500 dilution and incubation for 1–2 h at RT. The cells were then labeled with 4′,6-diamidino-2-phenylindole (DAPI) nucleic acid stain (ThermoFisher Scientific, USA) to label cell nuclei and mounted with the Diamond Prolong Antifade mountant (ThermoFisher Scientific, USA). Finally, the stained cells were observed under a fluorescent microscope to determine the antigen's intensity.

2.8 Viral load reduction assay by RT-qPCR

Viral load reduction assay was performed by quantitative reverse transcription-polymerase chain reaction (RT-qPCR) with slight modifications from a previously described protocol33. RNA was extracted from the culture supernatants of CoV-infected cell lines, as described earlier, using the RNeasy extraction kit (Qiagen, Germany). Reverse transcription was performed using the Transcriptor First Strand cDNA Synthesis Kit from Roche (Basel, Switzerland) with oligodT primers. To determine the virus genome copies, qPCR was performed using the LightCycler 480 SYBR Green I Master Mix from Roche with specific primers. The virus genome copies in the supernatant samples were quantified with a standard using the following specific primers: hCoV-229E_Forward: CTACAGATAGAAAAGTTGCTTT; hCoV-229E_Reverse: GGTCGTTTAGTTGAGAAAAGT; SARS-CoV(-2)_Forward: CGCATACAGTCTTRCAGGCT; SARS-CoV(-2)_Reverse: GTGTGATGTTGAWATGACATGGTC; MERS-CoV_Forward: GGGTGTACCTCTTAATGCCAATTC: MERS-CoV_Reverse: TCTGTCCTGTCTCCGCCAAT.

2.9 Generation and RT-qPCR validation of escape mutant

To investigate the antiviral mechanism of compound 172, an escape mutant was generated. Vero-TMPRSS2 cells were seeded onto a 12-well plate at a density of 4 × 105 cells per well one day before infection to generate passage 1. On the next day, SARS-CoV-2 WT D614G was inoculated into the cells at MOI 1 in the presence of 5 μmol/L of compound 172 or 0.05% DMSO (control). After 48 h of incubation at 37 °C/5% CO2, around 50% CPE formation was observed. The supernatant of passage 1 was transferred to a new plate of Vero-TMPRSS2 cells and absorbed for 1 h at 37 °C, and the remaining of passage 1 was stored at −80 °C. After 1 h, the cell medium was replaced with 6 μmol/L of compound 172 or 0.06% DMSO, and the plate was incubated at 37 °C/5% CO2. This procedure was repeated with decreasing MOI and increasing drug concentration. At passage 6, CPE formation was observed in the presence of 8 μmol/L compound 172, and it was collected for plaque quantification, escape mutant validation, and Nanopore sequencing.

The escape mutant was validated using the RT-qPCR method. Vero-TMPRSS2 cells were seeded onto a 96-well plate at a density of 20,000 cells per well one day before infection. The cells were then infected with the virus from passage 6 and passage 0 (strain D614G) at MOI 0.01, and treated with compound 172 in gradient concentration after 1 h of virus adsorption. After 48 h post-infection (hpi), the cell supernatant was collected, and RNA was extracted using the RNeasy kit from Qiagen (Germany) following the manufacturer's protocol. The viral RNA copy was measured using the Takara One-Step TB Green® PrimeScriptTM RT-qPCR kit II from Takara (Japan) with SARS-CoV-2 RdRp/Hel gene as mentioned previously.

2.10 Nanopore sequencing of escape mutant

Nanopore sequencing technology (Oxford Nanopore Technologies, UK) was used to perform whole genome sequencing of SARS-CoV-2, as previously described34. RNA was extracted from passage 6 using the RNeasy kit (Qiagen, Germany) and then reverse transcribed into cDNA using SuperScript™ IV reverse transcriptase (ThermoFisher Scientific, USA) according to the manufacturer's protocol. PCR was performed using the ARTIC nCoV-2019 V3 Panel (IDT, USA) and Q5® Hot Start High-Fidelity 2X Master Mix (New England Biolabs, USA), as per the manufacturer's protocol. PCR product cleanup was conducted using 1 × Agencourt AMPure XP (Beckman Coulter, USA). End-prep, barcode ligation, and sequencing adaptor ligation were performed according to the PCR tiling of SARS-CoV-2 virus with Native Barcoding Expansion 96 protocol (Version: PTCN_9103_v109_revH_13Jul2020). The library was loaded and sequenced on MinION with R9.4.1 flow cells for 48 h. Nanopore sequencing data were analysed following the Artic Network nCoV-2019 novel coronavirus bioinformatics protocol with minor modifications35.

2.11 Generation of recombinant mutant virus from Bacterial Artificial Chromosome (BAC)

An infectious molecular clone of SARS-CoV-2 on a Bacterial Artificial Chromosome (BAC) was used. The 3CLpro S301P substitution was introduced into the clone using λ-Red-mediated homologous recombination, as we previously described36. Firstly, homologous recombination was carried out to insert a galK expression cassette, which was amplified using 50-bp 3CLpro-flanking homology arms to bind to plasmid pMOD4-galK-G (5′–3′ Forward: GTAGTGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAACCTGTTGACAATTAATCATCGGCA; 5′–3′ Reverse: GTGGTGTGTACCCTTGATTGTTCTTTTCACTGCACTTTGGAAAGTAACACTCAGCACTGTCCTGCTCCTT). The galK cassette was introduced into the site of interest by electroporation into competent E. coli SW105 strain. Electroporated bacterial cells were plated onto M63 minimal agar supplemented with galactose for 3 days at 32 °C. The galK-bearing clone was isolated and purified, and then subjected to a second round of recombination. Secondly, annealed oligonucleotides bearing the 3CLpro S301P mutation ordered from Integrated DNA Technologies (IDT) were electroporated to substitute the galK cassette (5′–3′ Forward: GTAGTGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGACAATGCCCAGGTGTTACTTTCCAAAGTGCAGTGAAAAGAACAATCAAGGGTACACACCAC; 5′–3′ Reverse: GTGGTGTGTACCCTTGATTGTTCTTTTCACTGCACTTTGGAAAGTAACACCTGGGCATTGTCTAACAACATCAAAAGGTGTAAATTCATCTTCTAATAAAGCACTAC). The electroporated-bacterial cells were plated onto M63 minimal agar supplemented with 2-deoxy-galactose to remove the galK-bearing clone. The successful clone was screened using PCR amplification flanking the 3CLpro site of interest, and the point mutation was confirmed through Sanger Sequencing. Purified BAC bearing the 3CLpro S301P mutation was extracted using the PureLink™ HiPure BAC Buffer Kit (ThermoFisher Scientific, USA).

Recombinant virus rescue was performed in Vero-TMRPSS2 cells. 6 μg of BAC was transfected into the cells using Lipofectamine 3000 according to the manufacturer's instructions, and then transferred into a BSL-3 facility. After 6 h, the BAC-containing medium was replaced with serum-free DMEM. The cells were monitored for cytopathic effect over the course of 3 days. Upon confirmation of the cytopathic effect, virus-containing supernatant was clarified and harvested. SARS-CoV-2 3CLpro S301P was further passaged in VeroE6-TMPRSS2 cells, and the viral titers were determined using plaque assay.

2.12 Validation of antiviral resistance recombinant mutant virus

The antiviral resistance phenotype of the recombinant mutant virus was confirmed using three methods: phenotypic observation, RT-qPCR, and plaque reduction assay. Phenotypic validation involved observing CPE formation. Vero-TMRPRSS2 cells were seeded onto a 96-well plate at a density of 20,000 cells/well one day before infection. On the following day, the cells were infected with recombinant WT and 3CLpro S301P mutant viruses at an MOI of 0.01, and the cell medium was replaced with compound 172 in gradient concentration after 1 h of virus adsorption. After 48 hpi, CPE formation was observed under an electronic light microscope, and photos were taken in the BSL-3 facility. Cell supernatant was collected and RNA extraction was performed using the RNeasy kit from (Qiagen, Germany) following the manufacturer's protocol. The SARS-CoV-2 viral RNA of both recombinant WT and mutant viruses was measured by RT-qPCR using the Takara One-Step TB Green® PrimeScript™ RT-qPCR kit II (Takara, Japan), with SARS-CoV-2 RdRp/Hel gene primers as mentioned. Plaque reduction assay was also used to validate the antiviral resistance phenotype of the recombinant mutant virus as previously described.

2.13 Drug synergism checkerboard assay

Compound 172 and Nirmatrelvir were prepared in a gradient of 4 × concentrations, mixed in a checkerboard pattern at a 1:1 ratio, and added to A549-TMPRSS2-ACE2 cells were seeded onto 96-well plates one day before. On the next day, wild type SARS-CoV-2 was then added to the cells at a 1:1 volume ratio with a MOI of 0.1. After 48 h post-infection (hpi), CellTiter Glo® reagent was added to the cells, and cell viability was measured in luminance using a plate reader in a BSL-3 facility. The cell viability was normalized and fitted into a non-linear regression model using GraphPad Prism, and an IC50 value was calculated for each compound with the corresponding partner compound concentration. The paired IC50 values with the corresponding partner compound concentrations were plotted as a scatterplot for data visualization. The paired values were also fitted into the Loewe's additivity (LA) equation, as Eq. (1):(1) [A]/IC50[A] + [B]/IC50[B] = 1

2.14 Expression and purification of SARS-CoV-2 WT and mutant 3CL-protease

Recombinant SARS-CoV-2 WT 3CLpro and mutant (S301P) using the reference Wuhan-Hu-1 (GenBank ID: YP_009724390.1) were codon-optimized and cloned into pET28b+ for E. coli BL21 expression as previously described37. A 6 × His tag was added to the N-terminal of each protein construct for Ni-NTA purification. To induce recombinant 3CLpro production, the E. coli subculture was grown until reaching an OD600 absorbance of 0.6, and then induced with 0.5 mmol/L isopropyl β-d-1-thiogalactopyranoside (IPTG) at 25 °C for 16 h with agitation. After overexpression, the bacterial pellet was collected, lysed with 0.1% Triton X-100 in PBS, and stored at −80 °C overnight. The total proteins were released from the lysate through sonication, followed by centrifugation at 13,000×g/4 °C for 30 min. The solution was passed through the Ni-NTA column twice to bind, washed with 500 mL washing buffer (50 mmol/L NaH2PO4, 300 mmol/L NaCl, 40 mmol/L imidazole, pH 8.0) at a controlled and steady flow rate, then eluted with 10 mL elution buffer (50 mmol/L NaH2PO4, 300 mmol/L NaCl, 250 mmol/L imidazole; pH 8.0) into fractions. The purity of each fraction was analysed by SDS-PAGE followed by Coomassie blue staining. The concentration of the purified 3CLpro was determined using the Bradford Assay.

2.15 Fluorescence-based protease activity assay

A fluorescent-resonance-energy-transfer (FRET)-based protease activity assay was developed to investigate the inhibitory effects of compound 172 on the enzymatic activity of WT and mutant 3CLpro. Compound 172 was prepared in 50× gradient concentration in DMSO, while substrate (dabcyl-KTSAVLQSGFRKM-E(Edans)-NH2) and 3CLpro (WT or S301P) were prepared in 2× concentration in reaction buffer (50 mmol/L HEPES, 0.1 mg/mL BSA, 5 mmol/L DTT, pH 7.5). 1 μL of 50 × compound 172 was added into 25 μL of 2× 3CLpro and incubated at room temperature for 30 min on a black walled 384-well plate (ThermoFisher Scientific, USA). Then, 25 μL of 2× substrate was added to the mixture. Fluorescence (excitation/emission: 365 nm/500–550 nm) was measured by a plate reader (Glomax, Promega) after 20 min. The initial velocity of fluorophore release was normalized against DMSO control. GC-376 was used as a positive control throughout the experiment.

2.16 Michaelis–Menton inhibitory kinetics assay

A Michaelis–Menton inhibitory kinetic assay was conducted to compare the modes of inhibition between compound 172 and Nirmatrelvir on WT 3CLpro. Compound 172 and Nirmatrelvir were prepared in a 2-fold gradient 100 × concentrations in DMSO, while substrate (dabcyl–KTSAVLQSGFRKM-E(Edans)–NH2) and WT 3CLpro were prepared in 2 × concentration with reaction buffer (50 mmol/L HEPES, 0.1 mg/mL BSA, 5 mmol/L DTT, pH 7.5). 1 μL of 100× compound 172 or Nirmatrelvir was added to 50 μL of 2× 3CLpro and incubated at room temperature for 30 min on a black walled 96-well plate (ThermoFisher Scientific, USA). Then, 50 μL of 2× substrate was added to each well and incubated for an additional 20 min, followed by measuring fluorescence (excitation/emission: 365 nm/500–550 nm) using a plate reader (Glomax, Promega). The initial velocity was calculated by dividing the fluorescent intensity by incubation time. The data was fitted into the mixed-model inhibition function to generate alpha values in GraphPad Prism. According to GraphPad Prism, when alpha value equals 1, it represents the ideal non-competitive inhibition38. When the alpha is greater than 1, the inhibitor preferentially binds to the free enzyme, and if it is very large, the model approaches competitive inhibition38. When alpha is less than 1, the inhibitor preferentially binds to the enzyme‒substrate complex, and if it is very small, the model approaches an uncompetitive model38.

2.17 Surface plasmon resonance (SPR) spectroscopy

To verify the interaction between compound 172 and 3CLpro, a surface plasmon resonance (SPR) experiment was carried out on the Biacore T-200 machine (Cytiva, USA). First, WT or mutant 3CLpro was diluted with acetate buffer (pH 5.0) to reach a concentration of 40 μg/mL or higher and immobilized onto a Series S Sensor Chip CM5 until a response unit of 15,000 RU was achieved. Next, a running buffer containing 5% DMSO in 1× PBS was prepared, and compound 172 and GC-376 were prepared in gradient concentrations, with one concentration duplicated. DMSO was used as a negative control and background. “LMW kinetics” was selected in the Biacore software protocol wizard, and compounds were added onto a 96-well U-bottom plate based on the layout generated in the software. The reaction was started according to the software instructions. After overnight incubation, the SPR results, including the drug‒protein response curve and affinity curve were generated.

2.18 Analytical ultracentrifugation (AUC) assay

The sedimentation velocity experiment was carried out using a Beckman Coulter Optima analytical ultracentrifuge (Beckman Coulter, USA), equipped with an An-60 Ti rotor, at a temperature of 20 °C. To examine the dimer-inhibitory effect of 172 against SARS-CoV-2 3CLpro, the 600 μg/mL freshly purified WT 3CLpro was incubated with 20 μmol/L 172 or 0.2% DMSO for at least 2 h on ice before this assay. Then the sample was centrifuged at 40,000 rpm using 12-mm standard double sector centerpieces. A total of 400 scans were taken at 4-min intervals, featuring the data resolution at 10 μm. The detection of monomer or dimer, based on radial position and time, was achieved through absorbance measurements at 280 nm, as well as interference detection. The resulting profiles were analyzed using Sedfit software's continuous distribution model.

2.19 Golden Syrian golden hamster experiment

Golden Syrian hamsters, either male or female, aged between 4 and 6 months, were accommodated in a BSL-3 facility and provided with standard food pellet and water. The hamsters were grouped randomly in groups of 4 (n = 4) for antiviral assessment. All experimental protocols were approved by the Animal Ethics Committee at the University of Hong Kong (CULATR), and were conducted according to the standard operating procedures of the BSL-3 animal facilities (reference code CULATR 5370-20). The treatment group hamsters received the first dose of compound 172 (dissolved in 20% SBE-β-CD/0.9% saline at the concentration of 1 mg/kg), while the control group received 5% DMSO in vehicle. Both groups were administered through intraperitoneal (i.p.) injection 3 h before infection. The experiments were not blinded. Each hamster received a nasal inoculation of 1000 PFU of Wild Type SARS-CoV-2 in 50 μL PBS while under i.p. anaesthesia with ketamine (200 mg/kg body weight) and xylazine (10 mg/kg body weight). Five hours after being infected with SARS-CoV-2, the hamsters received the second dose of treatment or DMSO vehicle. In the following 3 days, the hamsters were treated with a daily Q12 regimen of treatment and were monitored for signs of illness and changes in body weight. The same protocol was followed for an in vivo drug toxicity experiment, except that the virus was not inoculated. The infected hamsters were euthanized 3 days after virus inoculation for virological and histopathological examination. Their lungs and nasal turbinate were collected for viral RNA detection and plaque quantification. The tissue pathology of infected animals was examined by Hematoxylin and Eosin staining, and immunofluorescence staining, according to an established protocol37.

2.20 K18-hACE2 mouse survival experiment

Male or female K18-hACE2 transgenic mice, aged between 6 and 8 weeks, were accommodated at the BSL-3 animal facility, and provided with standard food pellet and water. The use of K18-hACE2 transgenic mice has been approved by the CULATR of The University of Hong Kong under Animal Ethics Committee (reference code: 5370-20). On the day of infection, the hACE2 mice were intranasally inoculated with either 200 PFU B.1.1.7, 1 or 10,000 PFU B.1.1.529 sub-lineage BA.5, pre-diluted in 20 μL PBS. Mice were treated with either 50 mg/kg compound 172 in 20% SBE-β-CD/0.9% saline, 200 mg/kg PF-07321332 (Nirmatrelvir) in vehicle or 5% DMSO in vehicle, by i.p. injection daily until sample collection or animal death. The body weight and survival of the mice were monitored on a daily basis. Mice were euthanized at designated timepoints and organ tissues were sampled for virological analyses. The mice's lungs and nasal turbinate were collected for viral RNA detection and plaque quantification19.

2.21 Molecular docking

The 3D structure of compound 172 was retrieved from the PubChem database39 with ID 3700821. The high-resolution dimer structure of SARS-CoV-2 main protease (Mpro) was downloaded from the Protein Data Bank (PDB) database40 with ID 6Y2G. The structure of Mpro bound to Pelitinib was retrieved with PDB ID 7AXM. The charge/protonation state of Mpro protein was assigned with H++ server41. Potential ligand-binding pockets of Mpro was probed with Metapocket42. Leadfinder v.180443 was used to dock compounds against Mpro protein with extra precision mode (-xp). Intermolecular interaction plot was generated by Pymol.

2.22 Molecular dynamics (MD) simulation

The best-scoring binding poses of 172‒Mpro complex was used as the initial conformation and solvated in cubic water box with the TIP3P water model, extending to at least 10 Å from the protein atoms. The ff14SB force field44 was used to describe the protein, together with general Amber force field (GAFF)45 parameters for ligands. The simulation was carried out using the Amber17 package46, long-range electrostatics were treated with the particle mesh Ewald method, while the van der Waals interactions were truncated at a cutoff of 10 Å. After 1 ns of equilibration, three 10 ns production runs were carried out in the NPT ensemble at 300 K. The time step was 2 fs, and snapshots were saved for analysis every 20 ps.

2.23 Permeability of compound 172 in Caco-2 assay

Caco-2 cells were seeded onto 0.4 μm pore polycarbonate membranes (PC) in 96-well Corning Insert plates at a density of 3.5 × 104 cells/cm2. HBSS with 10.0 mmol/L HEPES at pH 7.40 ± 0.05 as the transport buffer. The compound was subjected to bidirectional testing in triplicate at 2.00 μmol/L. The plate was incubated in a CO2 incubator with 5% CO2 at 37.0 °C and saturated humidity for 2 h without shaking. All samples were centrifuged at 3220×g for 10 min after being combined with acetonitrile containing internal standard. Using the peak area ratio of the analyte/internal standard, LC‒MS/MS techniques were used to quantify the concentrations of the compound in the beginning solution, donor solution, and recipient solution. Following transportation, lucifer yellow rejection assay was applied to determine the Caco-2 cell monolayer integrity.

For data analysis, permeability (Papp), efflux ratio, and percent recovery were calculated using Eqs. (2), (3), (4):(2) Papp = (dCr/dt) × Vr/(A × C0)

(3) Efflux ratio = Papp[BA]/Papp[AB]

(4) Solution recovery (%) = 100 × [(Vr × Cr) + (Vd × Cd)] / (Vd × C0)

Reference compounds were analysed in parallel as assay control.

2.24 Metabolic stability of compound 172 in mouse and human liver microsomes

Mouse and human liver microsomes were respectively provided by RILD and corning. They were collected from CD-1 mouse or human and prepared in 100 mmol/L potassium phosphate buffer. The reaction was started by the addition of 100 μmol/L compound 172 working solution with or without NADPH co-factor and terminated by adding cold (4 °C) acetonitrile (ACN) containing 250 nmol/L tolbutamide and 250 nmol/L labetalol. Aliquots were sampled at 0, 5, 15, 30, 45, and 60 min for LC‒MS/MS analysis.

2.25 Mouse pharmacokinetics study

The pharmacokinetic characteristics of compound 172 after a single intraperitoneal dosage of 5 mg/kg on BALB/c mice were investigated. There were three male mice (6–10 weeks) in the experimental group and the dose volume will be determined by the animals’ body weight collected on the morning of dosing day. At 0.25, 0.5, 1, 2, 4, 6, 8, and 24 h after dosage, blood samples were obtained from saphenous vein and placed in tubes containing EDTA-K2. After 3200×g of centrifugation at 4 °C for 10 min, plasma samples were quickly frozen over dry ice and kept at −80 °C. Identification of compound 172 in plasma was performed by LC‒MS/MS analysis on DG-Triple Quad 6500 plus. Pharmacokinetic parameters were calculated by i.p.-noncompartmental model 200 using Phoenix WinNonlin 8.3.5.

3 Results

3.1 Phenotype-based high throughput screening

The phenotypic-based high throughput screening (HTS) was performed in three levels (Supporting Information Fig. S1). First, primary screening was conducted by screening 50,213 synthetic compounds for their CPE inhibition (CPEi) activity against SARS-CoV-2 wildtype (WT) D614G infection in VeroE6 cells. CellTiter Glo® reagent was added to cells to measure cell viability after 72 h-post-infection (hpi). Over 60% cell viability in both duplicates was set as a selection criterion in primary screening. As a result, 168 out of 50,213 compounds were discovered to inhibit over 60% CPE formation in VeroE6 cells at 5 μmol/L (Fig. 1A). Afterwards, the 168 primary hits were moved onto secondary screening using human A549-TMPRSS2-ACE2 cells. Forty out of 168 compounds were found to reduce 2-log10 or higher SARS-CoV-2 viral load using at least one concentration (Supporting Information Fig. S2). Next, 40 secondary screen hits were validated for their anti-SARS-CoV-2 activity by plaque reduction assay. Ultimately, five out of 40 compounds were confirmed to reduce anti-SARS-CoV-2 infectious particles with a 50% effective dose (IC50) at lower μmol/L levels (<5 μmol/L, Fig. 1B) without significant cytotoxicity. These final hits, designated 16, 65, 77, 132, and 172, also reduced SARS-CoV-2 N protein expression in VeroE6-TMPRSS2 cells by immunofluorescent (IF) staining (Supporting Information Fig. S3). The greatest reductions in N protein expression were observed in compound 172 (Fig. S3), which is consistent with plaque reduction assay result (Fig. 1B). While the remaining four compounds exhibited a moderate degree of reduction in N antigen expression (Fig. S3). MTT cytotoxicity assay was also conducted to confirm that the antiviral phenotype was not due to drug cytotoxicity (Supporting Information Fig. S4). The selectivity index (SI) of these five compounds was calculated as shown (Fig. 1C). Compounds 16 and 77 have lower SI (15.3 and 15.1, respectively) due to their lower CC50 values (37.67 and 35.05, respectively). For compounds 65, 132, and 172, their SI are higher (>52.9, >40.3, and >54.9, respectively) which achieve CC50 values higher than 100 μmol/L.Figure 1 Phenotype-based high-throughput antiviral screening. (A) Primary screening results using a CPE-inhibition assay. The primary screening cutoff was set as over 60% cell viability in both duplicates. Out of 50,213 compounds, 168 were identified to satisfy this criterion. Mock infection was included to normalize the cell viability (100%). Remdesivir was added at a concentration of 10 μmol/L as positive control (shown in red). (B) Plaque reduction assay results of the five finalized compounds. VeroE6 cells were inoculated with 40 PFU of SARS-CoV-2 D614G virus and subsequently treated with each of the five selected hit compounds, which were diluted from 20 to 1.25 μmol/L in 2-fold intervals. At 72 hpi, the cells were fixed with 10% formalin/PBS and stained with a 0.5% crystal violet solution to visualize the plaques. The IC50 value was calculated by fitting the number of plaque formations against the logarithmic concentrations of the compounds using a non-linear regression model in GraphPad Prism software. (C) Antiviral profiles of the five selected compounds with their chemical structure, IC50 (by plaque reduction assay), CC50 (by MTT cytotoxicity assay), and selectivity index (SI) as shown. The highest tested concentration in the MTT cytotoxicity assay was 100 μmol/L due to the maximal water solubility in 1% DMSO.

Figure 1

3.2 Prioritization of the compounds

Among the five candidates, one of them (compound 172) exhibits the lowest IC50 (1.82 μmol/L) and high CC50 (>100 μmol/L), which gives a SI > 54.9 (Fig. 1C). Therefore, we decided to investigate further on its antiviral potency and mechanism. Although compound 65 has a comparable SI with 172, it was not chosen to be studied further because it demonstrated some extent of cytotoxicity in VeroE6 cells at 20 μmol/L using plaque reduction assay, which corresponds to 80% cell viability in MTT assay, yet 172-treated cells had over 90% cell viability at 100 μmol/L and high tolerability in multiple cell lines (Fig. S4). Interestingly, compound 172 was potent against other variants of concerns (VOC) of SARS-CoV-2, such as B.1.617.2 (Delta), Omicron BA.1 and Omicron BA.5, with micromolar IC50(Fig. 2A). Compound 172 could also inhibit the replication of MERS-CoV, SARS-CoV, and HCoV-229E in vitro and in a dose-dependent manner (Fig. 2B). Notably, compound 172 reduced the MERS-CoV supernatant viral RNA level below the RT-qPCR detection limit at 5 μmol/L or above, and > 5-log10 reduction in the normalized expression of N gene in cell lysate (Fig. 2B). Additionally, more than 3-log10 viral RNA reduction was observed in the supernatant of HCoV-229E infected Huh7 cells and similar results were found in the cell lysate (Fig. 2B). Lastly, compound 172 demonstrated 1-log10 reduction of SARS-CoV viral load in the supernatant and cell lysate (Fig. 2B). As a reference control, Nirmatrelvir shows potent antiviral effects against SRAS-CoV-2 variants and other human coronaviruses with sub-nanomolar IC50 values ranging from 4.5 to 32 nmol/L (Fig. 2C). Taken together, compound 172 exhibits pan-coronavirus antiviral activity.Figure 2 Pan-coronavirus activity and raise of escape mutant of compound 172. (A) viral load reduction assay conducted against SARS-CoV-2 VOC Delta, Omicron BA.1/BA.5, and co-plotted with cytotoxicity using MTT cytotoxicity assays. The viral yield was expressed as a percentage of DMSO control. Compound 172 was diluted in 2-fold intervals from 20 μmol/L to 0.3125 μmol/L, and the IC50 value was calculated by fitting the normalized viral load against the logarithmic concentrations using a non-linear regression model in GraphPad Prism software. MTT cytotoxicity assays were carried out as previously described. (B) VeroE6 or Huh7 cells were infected with MERS-CoV, SARS-CoV, or HCoV-229E at MOI 0.01. After 48 hpi, the supernatant and cell lysate were collected and lysed, and the viral RNA copies were measured using RT-qPCR. (C) Antiviral activity of Nirmatrelvir as a reference control of compound 172. (D) VeroE6-TMPRSS2 cells were infected either by Passage 0 (D614G virus) or Passage 6 virus at MOI 0.01, followed by treatment with varying concentrations of compound 172. After 48 h, the supernatant was collected and the viral load was measured using RT-qPCR. Statistical analysis for all the assays above were performed by Student's t-test: Data are presented as mean ± SD. ∗∗∗P < 0.001; ∗∗P < 0.01; ∗P < 0.05. (E) Nanopore sequencing results. 84% virus population carried S301P point mutation in the 3CLpro. 172 Escape mutant was raised in six passages in VeroE6-TMPRSS2, by reducing MOI and increasing 172 concentrations in each passage, until the CPE inhibition effect of 172 was abolished.

Figure 2

3.3 Mode of action of compound 172

To investigate the antiviral mechanism of compound 172, an escape mutant was generated. After six rounds of passages with increasing compound 172 concentration (Supporting Information Fig. S5A), CPE inhibition by compound 172 was abolished at 8 μmol/L in passage 6. Therefore, passage 6 was collected for plaque quantification and escape mutant validation (Fig. S5A). Interestingly, passage 6 was completely resistant toward compound 172 when compared to passage 0 (WT D614G), as shown by RT-qPCR analysis (Fig. 2D). Moreover, Nanopore sequencing discovered more than 80% virus population in passage 6 carried a single nonsynonymous mutation at the 10,955 genome locus: a T to C nucleotide mutation, which results in the amino acid substitution of serine by proline at the 301th position (S301P) of 3CLpro (Fig. 2E), when compared to that of passage 0. This single point mutation was also verified by traditional Sanger sequencing (Fig. S5B).

To validate the correlation between 3CLpro S301P and compound 172, a recombinant mutant virus was constructed using bacterial artificial chromosome (BAC) recombineering technology. 3CLpro S301P virus was generated and validated by traditional Sanger sequencing (Fig. S5C). The mutant virus was rescued and passaged successfully in VeroE6-TMPRSS2 cells (Fig. 3A). Replication kinetics of recombinant WT and mutant S301P virus demonstrated comparable growth rate with slight attenuation in the mutant virus (Fig. 3B). As expected, compound 172 demonstrated CPE inhibition phenotype in VeroE6-TMPRSS2 cells infected by recombinant WT virus, whereas the CPEi phenotype was abolished and cell syncytia could be observed under the infection of S301P virus (Fig. 3C). Moreover, plaque formation assay with the treatment of compound 172 resulted in an IC50 value of 3.88 μmol/L in recombinant WT, comparable with previous screening results (Fig. 3D). However, when the cells were infected by mutant S301P virus, no plaque reduction phenotype was observed, which indicated antiviral resistance (Fig. 3D). The result also suggests that 3CLpro S301 residue is critical for the antiviral phenotype of compound 172. To further elucidate the antiviral mechanism of compound 172, the S301P virus was tested against two “reference compounds” with the clarified mode of action, nirmatrelvir and Pelitinib. Nirmatrelvir is a peptidomimetic inhibitor, the active component of Paxlovid10. Interestingly, both recombinant WT and S301P viruses are susceptible to nirmatrelvir, with similar IC50 (18.35 and 20.06 nmol/L) in vitro (Fig. 3D). This suggests 3CLpro S301P does not confer resistance towards nirmatrelvir and implies the antiviral mechanism of compound 172 is different from nirmatrelvir. On the other hand, Pelitinib is an epidermal growth factor receptor (EGFR) inhibitor47. An X-ray crystallography screening study suggested that Pelitinib could interact with an allosteric site of SARS-CoV-2 3CLpro associated with S301, resulting in antiviral activity48. Indeed, antiviral IC50 of Pelitinib increased from 1.62 μmol/L towards recombinant WT virus to 7.30 μmol/L against the mutant virus (Fig. 3D), which verified the important role of S301 in this proposed allosteric site. Taken together, the result implied that compound 172 is a 3CLpro allosteric inhibitor associated with S301.Figure 3 Characterization of compound 172-resistant S301P recombinant SARS-CoV-2. (A) Plaque morphology of recombinant WT and 3CLpro S301P virus. VeroE6-TMPRSS2 cells were utilized to culture and quantitate 3CLpro S301P virus, which was rescued using VeroE6-TMPRSS2 cells. (B) Replication kinetics of 3CLpro S301P recombinant virus. Both recombinant WT and mutant viruses replicate at comparable rate, 3CLpro S301P showed slight attenuation in growth rate. (C) Microscopic images of recombinant WT and 3CLpro S301P mutant virus in the presence of compound 172 and percentages of CPE of each image. VeroE6-TMPRSS2 was infected with either virus at MOI 0.01 and treated with compound 172 at different concentrations ranging from 20 to 0.625 μmol/L. Representative images of CPE formation were captured at 48 hpi. Scale bar = 100 μm. The experiment was performed in triplicate and repeated twice for confirmation. The CPE severity in each group was scored and compared by two-way ANOVA. (D) Plaque formation assay of recombinant WT and 3CLpro S301P virus under the treatment of compound 172, Pelitinib, and Nirmatrelvir, respectively. Antiviral IC50 of each drug compound against WT and mutant viruses were plotted by GraphPad. Data are presented as mean ± SD. ∗∗∗∗P < 0.0001; ∗∗∗P < 0.001.

Figure 3

To confirm 3CLpro is the antiviral target of compound 172, WT and S301P 3CLpro were expressed and purified, for fluorescent-resonance-energy-transfer (FRET)―based protease activity assays and surface plasmon resonance (SPR) spectroscopy. Notably, compound 172 exhibited a dose-dependent inhibition of WT 3CLpro cleavage activity in vitro, yet was unable to inhibit S301P 3CLpro activity (Fig. 4A). Utilizing SPR spectroscopy, compound 172 was demonstrated to bind with 3CLpro with a dissociation constant (Kd) of 3.65 μmol/L, while a higher KD was estimated for S301P protein (Kd = 11.9 μmol/L) (Fig. 4B and C). Altogether, our findings confirmed that 3CLpro is the antiviral target of compound 172.Figure 4 Mechanistic investigation of compound 172. (A) FRET-based protease activity assay. Recombinant WT and S301P 3CLpro were expressed and purified. Compound 172 was diluted from 100 to 6.26 μmol/L and incubated with 1.25 μmol/L WT or S301P 3CLpro at RT for 30 min. 50 μmol/L fluorophore-conjugated substrate was added to the mixture after 20 min as previously established. 200 nmol/L GC376 was added as a positive control. Both experiments were performed in triplicate. Statistical analysis by Student's t-test: Data present as mean ± SD. ∗∗∗P < 0.001; ∗∗P < 0.01; ∗P < 0.05. (B, C) Surface plasmon resonance (SPR) spectroscopy of compound 172 with WT and S301P 3CLpro. The Biacore T-200 machine was used to conduct SPR spectroscopy. 40 μg/mL of protease was immobilized on a Series S Sensor Chip CM5. Compound 172 was added to the chip at gradient concentrations ranging from 100 to 3.125 μmol/L. Cytiva software was used to generate the association-dissociation graph and the dissociation constant (KD). (D, E) Michaelis–Menton inhibition kinetics of compound 172 and Nirmatrelvir. 1.25 μmol/L WT 3CLpro was incubated with compound 172 or Nirmatrelvir in a gradient of concentrations at RT for 30 min, followed by the addition of fluorophore-conjugated substrate in a range of concentrations and measured in fluorescence (Excitation: 365 nm, Emission: 500–550 nm) in 20 min as initial velocity. (F) Analytical ultracentrifugation (AUC) for WT 3CLpro with compound 172. 600 μg/mL WT 3CLpro was incubated with 20 μmol/L compound 172 or 0.2% DMSO before this sedimentation velocity experiment. The main peaks for 3CLpro monomer and dimer showed a sedimentation coefficient of 3.3 and 4.6 S respectively. Two independent experiments were performed. Statistical analysis by Student's t-test: Data are presented as mean ± SD. ∗∗∗P < 0.001; ∗∗P < 0.01; ∗P < 0.05. (G, H) Intermolecular interaction of pelitinib and compound 172 to 3CLpro. Monomers are shown in cyan and green cartoon representations, respectively. Interacting residues of 3CLpro within 3.5 Å of compound are shown in magenta sticks and labelled accordingly. (I) List of Loewe's additivity (LA) indices calculated with the IC50 values of each compound combination. LA < 1, synergism; LA = 1, independent; LA > 1, antagonism. 172 concentrations that lowered Nirmatrelvir IC50 are highlighted in green. This experiment was conducted in triplicates.

Figure 4

Moreover, Michaelis–Menton inhibitory kinetics was conducted to compare the mode of inhibition of compound 172 and nirmatrelvir. Notably, the inhibitory constant (Ki) for compound 172 and nirmatrelvir differ greatly: 274.2 and 192.2 nmol/L (Fig. 4D and E), suggesting 172 could be targeting the dimeric interface which is not revealed at native conditions. Importantly, the Alpha values for compound 172 and nirmatrelvir are 1.50 and 0.60 respectively (Fig. 4D and E). This indicates compound 172 is a weak competitive inhibitor while nirmatrelvir is a non-competitive inhibitor under this experimental setup38. The results suggest compound 172 inhibits 3CLpro by a different mode of action other than direct catalytic inhibition by nirmatrelvir.

In addition, the analytical ultracentrifugation (AUC) was conducted to explore the effects of 172 on 3CLpro dimerization. Upon mixing 20 μmol/L of compound 172 with WT 3CLpro, there was a significant reduction on 3CLpro dimerization, reducing its contribution by about 10% (Fig. 4F, Supporting Information Fig. S6A). Taken together, compound 172 can induce considerable effects on 3CLpro conformation by disrupting its dimerization.

On the other hand, due to distinct MOAs between compound 172 and nirmatrelvir, it is interesting to investigate the mode of interaction between two compounds. Therefore, a drug synergism checkerboard assay was conducted. Notably, when compound 172 was at nanomolar concentration, 172-nirmatrelvir synergism could be achieved, as shown by the two green points within the “isobole” (Supporting Information Fig. S7A). Fitting the IC50 values of nirmatrelvir with the corresponding compound 172 concentration into the Loewe's additivity (LA) equation also yielded consistent results: when compound 172 was at 312.5 and 156.25 nmol/L, the LA values were smaller than 1 (0.58 and 0.24 respectively) (Fig. 4I). This indicated that 172-nirmatrelvir drug synergism can be achieved when compound 172 is at nanomolar concentrations.

Based on the identified S301 amino acid residue responsible for compound 172 resistance (Fig. 3), molecular docking predicted that compound 172 binds to a novel allosteric site situated between the two monomers of 3CLpro, which is different from that of Pelitinib48 (Fig. 4G and H). Specifically, the allosteric site bound by Pelitinib is comprised of Y118, L141, N142, I213, L253, Q256, V297, C300, S301, and G30248. However, 172's allosteric site was predicted to be surrounded by M6, F8, Y118, N119, S121, S123, L141, I152, D153, F294, R298, Q299, and S301. Human coronavirus 3CLpro alignment analysis showed that M6, Y118, and Q299 are fully conserved amino acid residues, while N119 and L141 are highly similar residues among human coronaviruses, which explains compound 172 broad spectrum activity (Supporting Information Fig. S8). Furthermore, 10ns molecular dynamics (MD) simulation showed the binding of compound 172 was thermodynamically stable, with an average root mean square deviation (RMSD) value of 2 Å (Fig. S7B).

3.4 In vivo antiviral activity and drug-likeness of compound 172

Next, we evaluated the drug-likeness of compound 172. To explore the potential off-target effect, safety panel assays focusing on 44 selected host targets including 24 GPCRs, 8 ion channels, 7 enzymes, 3 monoamine transporters, and 2 nuclear hormone receptors were evaluated. The result suggests that compound 172 (10 μmol/L) showed no significant off-target effects on these host proteins (Supporting Information Table S1). Compound 172 exhibits moderate permeability and metabolic stability in cell cultures (Fig. 5A), and relatively good PK parameters in a BALB/c mouse model (Fig. 5B). The Cmax of the compound is 6.89 μmol/L, which is around 3.8-fold higher than its antiviral IC50 of 1.82 μmol/L. These results warrant further evaluation of compound 172's in vivo antiviral potency.Figure 5 In vivo activity of compound 172. (A) Permeability of compound 172 in Caco-2 cells and metabolic stability of 172 in mouse and human Liver microsomes. (B) In vivo pharmacokinetic profiling of compound 172 in a BALB/c mouse model (n = 3). (C) Schematics of compound 172 administration in a golden Syrian hamster model. Two groups of hamsters (n = 4) were given intranasal inoculations of 1000 PFU/animal of WT SARS-CoV-2. The treatment group (n = 4) received compound 172 (1 mg/kg) or nirmatrelvir (200 mg/kg) via intraperitoneal (ip) injection, or pelitinib (10 mg/kg) via oral gavage. The vehicle group (n = 4) was given 5% DMSO in 20% SBE-β-CD/0.9% saline. On the third day following the infection, the hamsters were euthanized for both viral yield and histopathological examination. (D) Hamsters lung and nasal turbinate viral yield were determined by RT-qPCR. Statistical analysis by one-way ANOVA: Data present as mean ± SD. ∗∗∗P < 0.001; ∗∗P < 0.01; ∗P < 0.05. (E) Representative images of H&E-stained and IF-stained lung tissue sections from hamster treated as indicated. Scale bars: 100 μm. (F) Schematic of compound 172 administration in a K18-hACE2 mouse model. K18-hACE2 mice were intranasally inoculated with either Alpha (B.1.1.7, n = 5 for survival rate) or Omicron (BA.5, n = 4 for viral load detection) at 200 PFU/animal or 10,000 PFU/animal, respectively. The treatment group was given compound 172 (50 mg/kg) dissolved in a solution of 20% SBE-β-CD/0.9% saline, administered once daily via i.p. injection. The vehicle group was given 5% DMSO in 20% SBE-β-CD/0.9% saline using the same treatment regimen. The positive control group was given Nirmatrelvir (200 mg/kg) dissolved in a solution of 20% SBE-β-CD and 0.9% saline using the same treatment regimen. The mice in the survival study were monitored daily, and drugs were administered until they reached the humane endpoint or died. The mice in the viral load study were euthanized on the third day after the infection, and their lungs and nasal turbinate were collected for viral load quantification. (G) Mouse survival rate (upper panel) and daily body weight changes (lower panel) of K18-hACE2 mice. The comparison of survival rates between groups were analysed using Log-rank (Mantel–Cox) tests and that of body weight using two-way ANOVA. (H) K18-hACE2 mouse lung and nasal turbinate viral titer determined by standard plaque assay. Statistical analysis by one-way ANOVA: Data are presented as mean ± SD. ∗∗∗P < 0.001; ∗∗P < 0.01; ∗P < 0.05; ns indicates not significant.

Figure 5

To evaluate the preclinical potential of compound 172, it was tested in both golden Syrian hamster and K18-hACE20 mouse models. To investigate the antiviral activity of compound 172 in Golden Syrian hamster, the hamsters (n = 4) were infected with 1000 PFU WT SARS-CoV-2 virus and treated with 1 mg/kg compound 172 (treatment) or Vehicle (control) or Nirmatrelvir (200 mg/kg) by intraperitoneal (i.p.) injection or Pelitinib (oral 10 mg/kg) at 12-h intervals (Fig. 5C). Notably, the lung and nasal turbinate (NT) of the hamsters in the 172-treated group exhibited a 1-log10 reduction when compared to the control group (Fig. 5D). The protection by Nirmatrelvir is extraordinarily potent in animal lungs with >4-log10 reduction, whereas that from Pelitinib is marginal (Fig. 5D). Histopathological and IF staining of the lungs of the 172-treated group also showed a lower degree of lymphocyte infiltration and reduced SARS-CoV-2 N antigen expression when compared to the control group (Fig. 5E).

On the other hand, compound 172 was also tested in the K18-hACE2 transgenic mice model. For the survival study, K18-hACE2 transgenic mice (n = 5) were challenged with 200 PFU SARS-CoV-2 Alpha variant (B.1.1.7) and treated with either 50 mg/kg compound 172 (treatment), 5% DMSO in vehicle (vehicle control), or 200 mg/kg Nirmatrelvir (positive control), by i.p. injection once daily, until death or reaching the humane endpoint (Fig. 5F). A higher drug dosage of 172 was administered due to the high susceptibility of K18-hACE2 mice to Alpha SARS-CoV-2 infection. i.p. injection was utilized to enhance the systemic dissemination of both compound 172 and Nirmatrelvir. In the vehicle control group, one mouse died on Day 5, and all remaining mice died on Day 6 (Fig. 5G). However, in the 172 treated groups, a delayed time of death was observed as one mouse died on Day 6, and all remaining mice died on Day 7 and/or 8 (Fig. 5G). The same delay in death was observed in the Nirmatrelvir group, where one mouse died on Day 6, and all remaining mice died on Day 8 (Fig. 5G). The mice's body weight was monitored daily, and a significant benefit in weight percentage was observed between the 172 and the vehicle control group on Day 4 (Fig. 5G). For the viral load study, K18-hACE2 transgenic mice were infected with 10,000 PFU Omicron BA.5 variant. In line with the finding in hamsters, compound 172 can reduce live virus titer in both the upper and lower respiratory tract of infected mice (Fig. 5H). Taken together, these findings suggest that compound 172 is effective against SARS-CoV-2 infection in vivo.

4 Discussion

In this study, we systematically screened a SMART™ chemical library with 50,213 small molecules against live SARS-CoV-2 infection and identified a 3CLpro-targeting inhibitor compound 172 with reasonably good selectivity, broad-coronavirus coverage and antiviral activity in vivo. Compound 172 binds to the domain III of 3CLpro, which is likely to interfere with protein dimerization, thus destabilizing protein conformation. Compound 172 exhibits drug synergism with Nirmatrelvir at nanomolar concentrations, which reduces the likelihood of antiviral resistance. Importantly, the pan-coronavirus and in vivo antiviral property signifies the clinical potential of compound 172.

The SARS-CoV-2 3CLpro is also known as Main Protease, which plays a crucial role in processing the viral polyprotein during early replication by cleaving at specific sequences between NSP5-169,49,50. The 3CLpro is conserved among coronaviruses and functions as a dimer with three domains9. Domains I (residues 10–99) and II (residues 100–182) are homologues of the 3C protease of Picornaviruses, due to similar secondary structures9,51. The catalytic dyads (C145 and H41) are situated within Domains I and II9. However, domain III (residues 198–303) is uniquely found in coronavirus and is involved in the dimerization of the protease9,52, 53, 54, 55. Since the 172-resistant S301P mutation in the 3CLpro is within domain III, the compound is likely to interfere with 3CLpro dimerization. Our AUC assay directly demonstrated that the compound 172 can disrupt the 3CLpro dimerization, inducing considerable changes on 3CLpro secondary structures (Fig. 4F). Furthermore, the 3CLpro S301P mutant only conferred resistance towards compound 172 but not Nirmatrelvir (Fig. 3D). These results suggested that compound 172 inhibits the 3CLpro via a distinct mechanism from Nirmatrelvir.

The association of S301 with an allosteric site on 3CLpro has been reported in a previous X-ray crystallography screening48. One of the screened compounds, Pelitinib, was predicted to interact with the S301 and bind to an allosteric site situated between the 3CLpro monomers48. Notably, Pelitinib exhibited a dose-dependent inhibition of WT virus replication but not the mutant virus. This confirms that the S301 residue is essential for Pelitinib's antiviral activity. Compared with 172, however, Pelitinib showed considerable high cytotoxicity and off-target effects as a repurposed anti-cancer treatment. Molecular docking predicted that compound 172 binds to an allosteric site different from Pelitinib (Fig. 4G and H). The C-terminal sequence of 3CLpro forms an alpha helix (Fig. 4H). Since proline is known to destabilize alpha helix structure56, S301P could alter the secondary structure of the C-terminal sequences, thus disrupting the binding pocket of 172. Several previous studies have reported that substrate-binding is a crucial factor for 3CLpro dimerization57, 58, 59, 60, inducing the opposite effect of compound 172. Therefore, there is a negative feedback relationship between substrate-binding and 172-binding, which explains the low competitiveness of compound 172. Taken together, these findings indicate compound 172 inhibits 3CLpro via disrupting 3CLpro dimerization, by binding to a novel allosteric site associated with S301. Three out of five fully conserved and two out of five highly similar amino acids are found within the 172 binding pocket (Fig. S8), which explains the pan-coronavirus activity of the compound. Lastly, the monomeric form of 3CLpro was expressed and purified for affinity assay. Compound 172 was discovered to have 46-fold higher affinity towards the monomer, further validating 172 binding to the dimeric interface of 3CLpro (Fig. S6B).

There are limitations in this study. Firstly, only one concentration was measured for CPE inhibition of each compound in SMART™ library, which may overlook compounds with antiviral activity at higher concentrations than 5 μmol/L. Secondly, primary screening was performed on VeroE6, which may miss human-specific compounds. In general, a small molecule should follow the Lipinski's Rule of Five with a suitable adsorption/distribution/metabolism/excretion (ADME) profile to be effective in vivo. Although compound 172 was effective against multiple coronaviruses in vitro, its antiviral activity was not as potent, likely due to its unoptimized structure for in vivo application. The high hydrophobicity of compound 172 may pose challenges in drug absorption and increase the likelihood of bioaccumulation in fat tissue. Therefore, the structure of compound 172 should be ADME-optimized to fully unlock its clinical potential. To fully understand the mechanism of compound 172 binding with 3CLpro, X-ray crystallography or Cryo-electron microscopy is recommended for follow-up study. Nevertheless, our work facilitates the design of novel antivirals for emerging coronaviruses and the primary screening data would be shared in the public domain for artificial intelligence training.

5 Conclusions

Compound 172 is an allosteric inhibitor that targets the 3CLpro dimerization domain with pan-coronavirus antiviral activity. Notably, it exhibited in vivo antiviral activity and drug synergism with Nirmatrelvir, which could lower the risk of antiviral resistance.

Acknowledgments

This study was partly supported by National Natural Science Foundation of China (NSFC)/Research Grants Council (RGC) Joint Research Scheme (N_HKU767/22 and 82261160398); Health and Medical Research Fund (COVID190121), the Food and Health Bureau, The Government of the Hong Kong Special Administrative Region; the National Natural Science Foundation of China (32322087, 32300134, and 82272337); Guangdong Natural Science Foundation (2023A1515012907); Health@InnoHK, Innovation and Technology Commission, the Government of the Hong Kong Special Administrative Region; the Collaborative Research Fund (C7060-21G and C7002-23Y) and Theme-Based Research Scheme (T11-709/21-N) of the Research Grants Council, The Government of the Hong Kong Special Administrative Region; Partnership Programme of Enhancing Laboratory Surveillance and Investigation of Emerging Infectious Diseases and Antimicrobial Resistance for the Department of Health of the Hong Kong Special Administrative Region Government; Sanming Project of Medicine in Shenzhen, China (SZSM201911014); the High Level-Hospital Program, Health Commission of Guangdong Province, China; the research project of Hainan Academician Innovation Platform (YSPTZX202004); Emergency Collaborative Project of Guangzhou Laboratory (EKPG22-01); and the National Key R&D Program of China (projects 2021YFC0866100 and 2023YFC3041600); The University of Hong Kong Seed Fund for Collaborative Research (2207101537); and Hunan University (521119400156), and donations of Providence Foundation Limited (in memory of the late Lui Hac Minh). The funding sources had no role in the study design, data collection, analysis, interpretation, or writing of the report.

Author contributions

Chris Chun-Yiu Chan: Data curation, Formal analysis, Investigation, Methodology, Visualization, Writing – original draft, Writing – review & editing. Qian Guo: Data curation, Formal analysis, Investigation, Methodology, Visualization, Writing – review & editing. Jasper Fuk-Woo Chan: Formal analysis, Funding acquisition, Methodology, Resources, Supervision. Kaiming Tang: Investigation. Jian-Piao Cai: Investigation. Kenn Ka-Heng Chik: Investigation. Yixin Huang: Investigation. Mei Dai: Methodology. Bo Qin: Methodology. Chon Phin Ong: Investigation, Visualization. Allen Wing-Ho Chu: Investigation. Wan-Mui Chan: Investigation. Jonathan Daniel Ip: Investigation. Lei Wen: Investigation, Visualization. Jessica Oi-Ling Tsang: Investigation. Tong-Yun Wang: Investigation. Yubin Xie: Investigation. Zhenzhi Qin: Investigation. Jianli Cao: Investigation. Zi-Wei Ye: Investigation. Hin Chu: Resources, Supervision. Kelvin Kai-Wang To: Resources, Supervision. Xing-Yi Ge: Resources. Tao Ni: Resources, Supervision. Dong-Yan Jin: Resources, Supervision. Sheng Cui: Funding acquisition, Supervision. Kwok-Yung Yuen: Funding acquisition, Resources, Supervision. Shuofeng Yuan: Conceptualization, Formal analysis, Funding acquisition, Methodology, Resources, Supervision, Writing – original draft, Writing – review & editing.

Conflicts of interest

The authors have no conflict to declare.

Appendix A Supplementary information

The following is the Supporting Information to this article:Multimedia component 1

Multimedia component 1

Peer review under the responsibility of Chinese Pharmaceutical Association and Institute of Materia Medica, Chinese Academy of Medical Sciences.

Appendix A Supporting information to this article can be found online at https://doi.org/10.1016/j.apsb.2024.05.026.
==== Refs
References

1 Peiris J.S. Lai S.T. Poon L.L. Guan Y. Yam L.Y. Lim W. Coronavirus as a possible cause of severe acute respiratory syndrome Lancet 361 2003 1319 1325 12711465
2 Zaki A.M. van Boheemen S. Bestebroer T.M. Osterhaus A.D. Fouchier R.A. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia N Engl J Med 367 2012 1814 1820 23075143
3 Zhou P. Yang X.L. Wang X.G. Hu B. Zhang L. Zhang W. A pneumonia outbreak associated with a new coronavirus of probable bat origin Nature 579 2020 270 273 32015507
4 Chan J.F. Yuan S. Kok K.H. To K.K. Chu H. Yang J. A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: a study of a family cluster Lancet 395 2020 514 523 31986261
5 Guan W.J. Ni Z.Y. Hu Y. Liang W.H. Ou C.Q. He J.X. Clinical characteristics of coronavirus disease 2019 in China N Engl J Med 382 2020 1708 1720 32109013
6 Chen N. Zhou M. Dong X. Qu J. Gong F. Han Y. Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study Lancet 395 2020 507 513 32007143
7 Huang C. Wang Y. Li X. Ren L. Zhao J. Hu Y. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China Lancet 395 2020 497 506 31986264
8 Menni C. Valdes A.M. Polidori L. Antonelli M. Penamakuri S. Nogal A. Symptom prevalence, duration, and risk of hospital admission in individuals infected with SARS-CoV-2 during periods of omicron and delta variant dominance: a prospective observational study from the ZOE COVID Study Lancet 399 2022 1618 1624 35397851
9 Zhang L. Lin D. Sun X. Curth U. Drosten C. Sauerhering L. Crystal structure of SARS-CoV-2 main protease provides a basis for design of improved α-ketoamide inhibitors Science 368 2020 409 412 32198291
10 Owen D.R. Allerton C.M.N. Anderson A.S. Aschenbrenner L. Avery M. Berritt S. An oral SARS-CoV-2 Mpro inhibitor clinical candidate for the treatment of COVID-19 Science 374 2021 1586 1593 34726479
11 Gao Y. Yan L. Huang Y. Liu F. Zhao Y. Cao L. Structure of the RNA-dependent RNA polymerase from COVID-19 virus Science 368 2020 779 782 32277040
12 Liu L. Iketani S. Guo Y. Chan J.F.W. Wang M. Liu L. Striking antibody evasion manifested by the Omicron variant of SARS-CoV-2 Nature 602 2022 676 681 35016198
13 Gordon C.J. Tchesnokov E.P. Woolner E. Perry J.K. Feng J.Y. Porter D.P. Remdesivir is a direct-acting antiviral that inhibits RNA-dependent RNA polymerase from severe acute respiratory syndrome coronavirus 2 with high potency J Biol Chem 295 2020 6785 6797 32284326
14 Gordon C.J. Tchesnokov E.P. Schinazi R.F. Götte M. Molnupiravir promotes SARS-CoV-2 mutagenesis via the RNA template J Biol Chem 297 2021 100770
15 Mukae H. Yotsuyanagi H. Ohmagari N. Doi Y. Sakaguchi H. Sonoyama T. Efficacy and safety of ensitrelvir in patients with mild-to-moderate coronavirus disease 2019: the phase 2b part of a randomized, placebo-controlled, phase 2/3 study Clin Infect Dis 76 2022 1403 1411
16 Beigel J.H. Tomashek K.M. Dodd L.E. Mehta A.K. Zingman B.S. Kalil A.C. Remdesivir for the treatment of Covid-19―final report N Engl J Med 383 2020 1813 1826 32445440
17 Jayk Bernal A. Gomes da Silva M.M. Musungaie D.B. Kovalchuk E. Gonzalez A. Delos Reyes V. Molnupiravir for oral treatment of Covid-19 in nonhospitalized patients N Engl J Med 386 2022 509 520 34914868
18 Xie Y. Yin W. Zhang Y. Shang W. Wang Z. Luan X. Design and development of an oral remdesivir derivative VV116 against SARS-CoV-2 Cell Res 31 2021 1212 1214 34584244
19 Zhang J.L. Li Y.H. Wang L.L. Liu H.Q. Lu S.Y. Liu Y. Azvudine is a thymus-homing anti-SARS-CoV-2 drug effective in treating COVID-19 patients Signal Transduct Target Ther 6 2021 414 34873151
20 Merches K. Breunig L. Fender J. Brand T. Batz V. Idel S. The potential of remdesivir to affect function, metabolism and proliferation of cardiac and kidney cells in vitro Arch Toxicol 96 2022 2341 2360 35579693
21 Zhou S. Hill C.S. Sarkar S. Tse L.V. Woodburn B.M.D. Schinazi R.F. Beta-d-N4-hydroxycytidine inhibits SARS-CoV-2 through lethal mutagenesis but is also mutagenic to mammalian cells J Infect Dis 224 2021 415 419 33961695
22 Unoh Y. Uehara S. Nakahara K. Nobori H. Yamatsu Y. Yamamoto S. Discovery of S-217622, a noncovalent oral SARS-CoV-2 3CL protease inhibitor clinical candidate for treating COVID-19 J Med Chem 65 2022 6499 6512 35352927
23 Zhan Y. Lin Z. Liang J. Sun R. Li Y. Lin B. Leritrelvir for the treatment of mild or moderate COVID-19 without co-administered ritonavir: a multicentre randomised, double-blind, placebo-controlled phase 3 trial EClinicalMedicine 67 2024 102359
24 Wang F. Xiao W. Tang Y. Cao M. Shu D. Asakawa T. Efficacy and safety of SIM0417 (SSD8432) plus ritonavir for COVID-19 treatment: a randomised, double-blind, placebo-controlled, phase 1b trial Lancet Reg Health West Pac 38 2023 100835
25 Hu Y. Lewandowski E.M. Tan H. Zhang X. Morgan R.T. Zhang X. Naturally occurring mutations of SARS-CoV-2 main protease confer drug resistance to nirmatrelvir ACS Cent Sci 9 2023 1658 1669 37637734
26 Stevens L.J. Pruijssers A.J. Lee H.W. Gordon C.J. Tchesnokov E.P. Gribble J. Mutations in the SARS-CoV-2 RNA-dependent RNA polymerase confer resistance to remdesivir by distinct mechanisms Sci Transl Med 14 2022 eabo0718
27 Iketani S. Mohri H. Culbertson B. Hong S.J. Duan Y. Luck M.I. Multiple pathways for SARS-CoV-2 resistance to nirmatrelvir Nature 613 2023 558 564 36351451
28 Kiso M. Furusawa Y. Uraki R. Imai M. Yamayoshi S. Kawaoka Y. In vitro and in vivo characterization of SARS-CoV-2 strains resistant to nirmatrelvir Nat Commun 14 2023 3952 37402789
29 Choi H. Kim J.Y. Chang Y.T. Nam H.G. Forward chemical genetic screening Methods Mol Biol 1062 2014 393 404 24057378
30 Cong F. Cheung A.K. Huang S.M. Chemical genetics-based target identification in drug discovery Annu Rev Pharmacol Toxicol 52 2012 57 78 21819237
31 Zhao Y. Fang C. Zhang Q. Zhang R. Zhao X. Duan Y. Crystal structure of SARS-CoV-2 main protease in complex with protease inhibitor PF-07321332 Protein Cell 13 2022 689 693 34687004
32 Yuan S. Yin X. Meng X. Chan J.F. Ye Z.W. Riva L. Clofazimine broadly inhibits coronaviruses including SARS-CoV-2 Nature 593 2021 418 423 33727703
33 Yuan S. Chu H. Huang J. Zhao X. Ye Z.W. Lai P.M. Viruses harness YxxØ motif to interact with host AP2M1 for replication: a vulnerable broad-spectrum antiviral target Sci Adv 6 2020 eaba7910
34 Lewandowski K. Xu Y. Pullan S.T. Lumley S.F. Foster D. Sanderson N. Metagenomic nanopore sequencing of influenza virus direct from clinical respiratory samples J Clin Microbiol 58 2019 e00963-19
35 Artic network-nCoV 2019 sequencing protocol. Available from: https://artic.network/ncov-2019 (Accessed 26/3).
36 Liang R. Ye Z.W. Ong C.P. Qin Z. Xie Y. Fan Y. The spike receptor-binding motif G496S substitution determines the replication fitness of SARS-CoV-2 Omicron sublineage Emerg Microbes Infect 11 2022 2093 2101 35943779
37 Yuan S. Chu H. Chan J.F. Ye Z.W. Wen L. Yan B. SREBP-dependent lipidomic reprogramming as a broad-spectrum antiviral target Nat Commun 10 2019 120 30631056
38 Copeland R.A. Evaluation of enzyme inhibitors in drug discovery: a guide for medicinal chemists and pharmacologists. 2013 John Wiley & Sons
39 Kim S. Chen J. Cheng T. Gindulyte A. He J. He S. PubChem 2023 update Nucleic Acids Res 51 2023 D1373 D1380 36305812
40 Berman H.M. Westbrook J. Feng Z. Gilliland G. Bhat T.N. Weissig H. The protein data bank Nucleic Acids Res 28 2000 235 242 10592235
41 Gordon J.C. Myers J.B. Folta T. Shoja V. Heath L.S. Onufriev A. H++: a server for estimating pKa s and adding missing hydrogens to macromolecules Nucleic Acids Res 33 2005 W368 W371 15980491
42 MetaPocket: a meta approach to improve protein ligand binding site prediction OMICS 13 2009 325 330 19645590
43 Stroganov O.V. Novikov F.N. Stroylov V.S. Kulkov V. Chilov G.G. Lead finder: an approach to improve accuracy of protein‒ligand docking, binding energy estimation, and virtual screening J Chem Inf Model 48 2008 2371 2385 19007114
44 Maier J.A. Martinez C. Kasavajhala K. Wickstrom L. Hauser K.E. Simmerling C. ff14SB: improving the accuracy of protein side chain and backbone parameters from ff99SB J Chem Theory Comput 11 2015 3696 3713 26574453
45 Wang J. Wolf R.M. Caldwell J.W. Kollman P.A. Case D.A. Development and testing of a general amber force field J Comput Chem 25 2004 1157 1174 15116359
46 Case D.A. Cheatham T.E. 3rd Darden T. Gohlke H. Luo R. Merz K.M. Jr. The amber biomolecular simulation programs J Comput Chem 26 2005 1668 1688 16200636
47 Yoshimura N. Kudoh S. Kimura T. Mitsuoka S. Matsuura K. Hirata K. EKB-569, a new irreversible epidermal growth factor receptor tyrosine kinase inhibitor, with clinical activity in patients with non-small cell lung cancer with acquired resistance to gefitinib Lung Cancer 51 2006 363 368 16364494
48 Günther S. Reinke P.Y.A. Fernández-García Y. Lieske J. Lane T.J. Ginn H.M. X-ray screening identifies active site and allosteric inhibitors of SARS-CoV-2 main protease Science 372 2021 642 646 33811162
49 Chan J.F. Kok K.H. Zhu Z. Chu H. To K.K. Yuan S. Genomic characterization of the 2019 novel human-pathogenic coronavirus isolated from a patient with atypical pneumonia after visiting Wuhan Emerg Microbes Infect 9 2020 221 236 31987001
50 Hoffman R.L. Kania R.S. Brothers M.A. Davies J.F. Ferre R.A. Gajiwala K.S. Discovery of ketone-based covalent inhibitors of coronavirus 3CL proteases for the potential therapeutic treatment of COVID-19 J Med Chem 63 2020 12725 12747 33054210
51 Gorbalenya A.E. Donchenko A.P. Blinov V.M. Koonin E.V. Cysteine proteases of positive strand RNA viruses and chymotrypsin-like serine proteases: a distinct protein superfamily with a common structural fold FEBS Lett 243 1989 103 114 2645167
52 Chou C.Y. Chang H.C. Hsu W.C. Lin T.Z. Lin C.H. Chang G.G. Quaternary structure of the severe acute respiratory syndrome (SARS) coronavirus main protease Biochemistry 43 2004 14958 14970 15554703
53 Hsu W.C. Chang H.C. Chou C.Y. Tsai P.J. Lin P.I. Chang G.G. Critical assessment of important regions in the subunit association and catalytic action of the severe acute respiratory syndrome coronavirus main protease J Biol Chem 280 2005 22741 22748 15831489
54 Tan J. Verschueren K.H. Anand K. Shen J. Yang M. Xu Y. pH-dependent conformational flexibility of the SARS-CoV main proteinase (Mpro) dimer: molecular dynamics simulations and multiple X-ray structure analyses J Mol Biol 354 2005 25 40 16242152
55 Shi J. Sivaraman J. Song J. Mechanism for controlling the dimer-monomer switch and coupling dimerization to catalysis of the severe acute respiratory syndrome coronavirus 3C-like protease J Virol 82 2008 4620 4629 18305031
56 Nilsson I. Sääf A. Whitley P. Gafvelin G. Waller C. von Heijne G. Proline-induced disruption of a transmembrane alpha-helix in its natural environment J Mol Biol 284 1998 1165 1175 9837734
57 Noske G.D. Song Y. Fernandes R.S. Chalk R. Elmassoudi H. Koekemoer L. An in-solution snapshot of SARS-CoV-2 main protease maturation process and inhibition Nat Commun 14 2023 1545 36941262
58 Ferreira G.M. Kronenberger T. Tonduru A.K. Hirata R.D.C. Hirata M.H. Poso A. SARS-CoV-2 Mpro conformational changes induced by covalently bound ligands J Biomol Struct Dyn 40 2022 12347 12357 34516349
59 Li C. Qi Y. Teng X. Yang Z. Wei P. Zhang C. Maturation mechanism of severe acute respiratory syndrome (SARS) coronavirus 3C-like proteinase J Biol Chem 285 2010 28134 28140 20489209
60 Cheng S.C. Chang G.G. Chou C.Y. Mutation of Glu-166 blocks the substrate-induced dimerization of SARS coronavirus main protease Biophys J 98 2010 1327 1336 20371333
