
==== Front
J Cancer Res Clin Oncol
J Cancer Res Clin Oncol
Journal of Cancer Research and Clinical Oncology
0171-5216
1432-1335
Springer Berlin Heidelberg Berlin/Heidelberg

5940
10.1007/s00432-024-05940-x
Research
MYO3B promotes cancer progression in endometrial cancer by mediating the calcium ion-RhoA/ROCK1 signaling pathway
Zhang Chunmei 1
Zhang Huifeng vividiny@126.com

2
Yang Xiaofeng 3
Li Sufen 1
Wang Liang 4
Su Huancheng 1
Yang Jiaolin 1
Ding Yuanyuan 1
Zhang Xinglin 1
Qiang Bao 1
Zhang Sanyuan zhl_766880505@outlook.com

1
1 https://ror.org/02vzqaq35 grid.452461.0 0000 0004 1762 8478 Department of Gynecology, First Hospital of Shanxi Medical University, No.85, Jiefang South Road, Yingze District, Taiyuan, Shanxi Province 030001 China
2 https://ror.org/0265d1010 grid.263452.4 0000 0004 1798 4018 Department of Basic Medicine, Shanxi Medical University, No.56, Xinjian South Road, Yingze District, Taiyuan, Shanxi Province 030001 China
3 https://ror.org/02vzqaq35 grid.452461.0 0000 0004 1762 8478 Department of Urology, First Hospital of Shanxi Medical University, Taiyuan, 030001 China
4 Shanxi Inspection and Testing Center, Taiyuan, 030001 China
19 9 2024
19 9 2024
2024
150 9 4243 7 2024
4 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Purpose

This study aimed to investigate the effect of MYO3B on endometrial cancer (EC) proliferation and invasion.

Methods

The expression of MYO3B in EC tissues and cells was analyzed using TCGA database, immunohistochemical staining, real-time PCR, and western blot (WB). Cell proliferation was detected by CCK8, Annexin V-APC/PI flow cytometry was used to detect apoptosis, intracellular calcium ion (Ca2+) was detected by flow cytometry with Fluo-4 AM fluorescent probe, cell migration by scratch assay, and cell invasion by Transwell assay, and the expression of proteins related to Ca2+ homeostasis and RhoA/ROCK1 signaling pathway was detected by WB and immunofluorescence staining.

Results

The expression of MYO3B was an influential factor in EC recurrence, and the expression of MYO3B was significantly up-regulated in EC tissues and cells, but down-regulated in KLE cells, and MYO3B knockdown inhibited the proliferation, migration, and invasion ability of EC cells and promoted apoptosis, suggesting that MYO3B plays a tumor-promoting role in EC. Furthermore, MYO3B knockdown decreased Ca2+ concentration in EC cells and the RhoA/ROCK1 signaling pathway was inhibited, and the effect of MYO3B knockdown on RhoA/ROCK1 signaling was reversed by treatment with the Calmodulin agonist CALP-2, and the effects of MYO3B knockdown on cell proliferation, migration, and invasion were reversed after treatment with the RhoA agonist U-46,619.

Conclusion

MYO3B promotes the proliferation and migration of endometrial cancer cells via Ca2+-RhoA/ROCK1 signaling pathway. High expression of MYO3B may be a biomarker for EC metastasis.

Keywords

Endometrial cancer
Myosin 3B
Cell proliferation
Calcium/calmodulin
RhoA/ROCK1 signaling
Fundamental Research Program of Shanxi Province20210302124413 http://dx.doi.org/10.13039/501100004480 Natural Science Foundation of Shanxi Province 202203021222372 issue-copyright-statement© Springer-Verlag GmbH Germany, part of Springer Nature 2024
==== Body
pmcIntroduction

Endometrial cancer (EC) is one of the most common malignant tumors of the female reproductive system, accounting for 20–30% of all malignant tumors of the female reproductive tract, and is the sixth leading cause of cancer-related deaths in women worldwide (Crosbie et al. 2022; Makker et al. 2021). In recent years, the incidence of EC has been slowly increasing due to the application of menopausal hormone replacement therapy, but the onset is getting younger and younger, which is a problem and a challenge to be faced by women worldwide (Uccella et al. 2022). Currently, the five-year survival rate of patients with early-stage EC is 90%, decreasing to 20% in late-stage, and specific preventive strategies are still lacking (van den Heerik and Horeweg 2021). Therefore, revealing the key pathways of EC onset and progression will be of significance for early diagnosis and treatment.

Myosin 3B (MYO3B) belongs to the myosin III class and possesses motor and kinase domains, along with actin-activated ATPase and actin translocating activity (Komaba et al. 2003). Current research indicates that MYO3B helps maintain precise stereocilia lengths crucial for normal hearing (Cirilo et al. 2021) and the correlation between MYO3B and tumors remains unestablished. However, numerous studies indicate a significant relationship between the myosin family and tumor progression. For example, MYO3A may be closely associated with cancer metastasis (Baghel et al. 2016). Myosin II promotes tumor progression by restructuring the innate immune microenvironment (Georgouli et al. 2019). However, the molecular mechanism of MYO3B affecting the proliferation of EC remains unclear.

It has been pointed out that MYO3B binds to and regulates the activity of calmodulin (Li et al. 2020), and that ion channels are a key bridge in the interaction between tumor cells and their microenvironment. Changes in intracellular calcium ion (Ca2+) signaling pathways may not be necessary to induce tumor formation, but fluctuations in Ca2+ transport in tumor cells affect tumor progression (Patergnani et al. 2020). And intracellular Ca2+ signaling can induce epithelial mesenchymal transition in tumor cells (Adiga et al. 2022). In addition, studies have reported that intracellular Ca2+ homeostasis regulates the activity of RhoA, a member of the Rho family of small-molecule GTPases, which has a key role in the control of cellular morphology as well as invasive metastasis (Zhu et al. 2017). Ca2+ channel-mediated elevation of intracellular Ca2+ concentration regulates vascular smooth muscle contraction through activation of the RhoA/ROCK1 pathway (Chang et al. 2022). Polyamine-dependent cell migration is also partially dependent on Ca2+-regulated RhoA activity, which promotes myosin II stress fiber formation (Zhang et al. 2022).

Therefore, in this study, we proposed to analyze whether MYO3B regulates endometrial cancer cell proliferation, migration, and invasion by modulating Ca2+-dependent RhoA/ ROCK1 signaling through in vitro and in vivo experiments to provide ideas for the prevention and diagnosis of EC.

Materials and methods

Gathering patient data

Prognostic analysis of immune senescence-associated genes in EC was screened using TCGA database (https://cancergenome.nih.gov/), providing clinical data on 388 patients with EC and identifying genes differentially expressed in normal endometrial and cancerous tissues.

EC tissue specimens

Thirty patients with confirmed EC were collected through the medical records of the inpatient and outpatient departments of the First Hospital of Shanxi Medical University, and normal adjacent tissues of the same patients were used as the control group. Paraformaldehyde (4%) was used to fix the sample; sections were prepared and routinely dewaxed for immunohistochemical staining. The experimental protocol involving humans was approved by the Medical Ethics Committee of the First Hospital of Shanxi Medical University (KYLL-2024-118). Inclusion criteria for the study population: pathologically confirmed diagnosis of EC; no neoadjuvant radiotherapy or endocrine therapy prior to surgery; informed consent of the patients or their families. Exclusion criteria: previous or current comorbidity with other tumors; comorbidity with severe medical or surgical diseases, autoimmune diseases or other contraindications to surgery. Patient survival time: number of days of survival after surgery until 11 June 2024. Patients with postoperative recurrence confirmed by imaging and pathological examination.

The grouping of MYO3B low and high expression groups was based on the following: the staining intensity of cells was classified as none (0 points), low (1 point), medium (2 points), and high (3 points) by semi-quantitative method. The staining intensity and the proportion of tissue expression were 0–25% (1 point), 26–50% (2 points), 51–75% (3 points) and 76-100% (4 points), and the result of multiplying the two indexes was the final score. The expression of MYO3B was graded according to the scoring results: grade 0 (0–3 points), grade 1 (4–6 points), grade 2 (6–9 points), and grade 3 (9–12 points), with grades 0–1 classified as the low-expression group, and grades 2–3 classified as the high-expression group.

Cell experiments

Human endometrial epithelial cells (EECs, iCell, Shanghai), EC cells (KLE, AN3 CA, HEC-1-B, RL95-2, Ishikawa (IK), iCell, Shanghai) were routinely resuscitated and incubated in DMEM medium containing 10% fetal bovine serum and 100 mg/mL penicillin-streptomycin (Invitrogen, USA) at 37℃ in a 5% CO2 incubator, and then passaged until the cells reached 80% growth.

Set up cell grouping: (i) Control, sh-NC, sh-MYO3B-1, sh-MYO3B-2, sh-MYO3B-3, sh-MYO3B-4, sh-MYO3B-5, and sh-MYO3B-6; (ii) Control, pcDNA-NC, pcDNA-MYO3B; (iii) IK sh-NC, IK sh-MYO3B, KLE pcDNA-NC, KLE pcDNA-MYO3B; (iv) IK sh-NC, IK sh-MYO3B, IK sh-NC + Calmodulin agonist (CALP-2), IK sh-MYO3B + Calmodulin agonist (CALP-2), KLE pcDNA-NC, KLE pcDNA-MYO3B, KLE pcDNA-NC + Calmodulin antagonist (W-7), KLE pcDNA-MYO3B + antagonist (W-7); (v) IK sh-NC, IK sh-MYO3B, IK sh-NC + RhoA agonist (U-46619), IK sh-MYO3B + RhoA agonist (U-46619), KLE pcDNA-NC, KLE pcDNA-MYO3B, KLE pcDNA-NC + RhoA inhibitor (Y27632), KLE pcDNA-MYO3B + RhoA inhibitor (Y27632).

MYO3B knockdown (sh-MYO3B), overexpression (pcDNA-MYO3B), and corresponding negative controls (sh-NC, pcDNA-NC) were produced by GenePharma (Shanghai, China). According to the above grouping, the cells were transfected using Lipofectamine®2000 Transfection Reagent (Invitrogen, Shanghai, China). CALP-2 (57.9 µM, APExBIO, Shanghai, China), W-7 (28 µM, MCE, Shanghai, China), U-46,619 (0.1 µM, MCE, Shanghai, China), and Y27632 (10 µM, MCE, Shanghai, China) were added after cell apposition for 1 h after pretreatment. The cells in each group were cultured for 24 h.

Mouse EC transplantation tumor model

Male BALB/C-NUD mice (4–5 weeks old) were purchased from GemPharmatech Co., Ltd (SCXK (Chuan) 2020-0034) and housed in an SPF-grade environment. After 1 week of acclimatization, the mice were randomly divided into the shRNA-control group (sh-NC, n = 6), shRNA-MYO3B group (sh-MYO3B, n = 6). Ishikawa (IK) cells were transfected with a MYO3B silencing virus (sh-MYO3B; GenePharma) or a negative control (sh-NC; GenePharma). A disposable sterile insulin syringe was used to inject 100 µL of cell suspension into the right axilla of each mouse (1 × 107 cells/mouse); if the maximum diameter of the mass was found to be > 15 mm or the skin on the surface of the tumor was broken in the process of tumor growth, the mice had to be disarticulated and executed immediately (the diameter of the tumor mass could not exceed 15 mm and the volume could not exceed 1500 mm³), and the animals of all the groups on the 28th day of tumor formation, mice were executed by cervical dislocation, and the mice were photographed by peeling out the transplanted tumors. The study complied with the regulations of the Animal Control Committee of First Hospital of Shanxi Medical University (KYLL-2024-118).

Immunohistochemical staining

Endometrial cancer tissue and mouse tumor tissue Sect. (5 μm) were deparaffinized, antigenically repaired, endogenous peroxidase blocked with 3% hydrogen peroxide, serum blocked, and incubated overnight at 4℃ with the addition of primary antibody Ki-67 (1:400, HuaBio, Hangzhou, China), MYO3B (1:600, Affinity, Suzhou, China), ROCK1 (1:200, Abcam, UK), RhoA (1:100, ABclonal, Wuhan, China), and F-actin (1:200, GeneTex, Shanghai, China). Add secondary antibody (HRP labeled goat anti-rabbit, 1:100, Servicebio, Wuhan, China) and incubate at 37℃ for 30 min. DAB color development, hematoxylin re-staining, sealing, digital trinocular camera microcamera system (BA400Digital, Motic, Xiamen, China) for image acquisition, and Halo data analysis system (Indica labs, USA) was used to calculate the percentage of positive area (% DAB Positive Tissue) in each image.

CCK-8 assay

After the cells were incubated for 24 h, the medium was replaced with fresh medium, and 10 µL of CCK-8 reagent (Biosharp, Guangzhou, China) was added to each well. The plates were incubated in the dark, and cell survival was calculated based on the absorbance at 450 nm detected via a microplate reader (ELx800, BioTek, USA).

Flow cytometry assay

Cells were collected, centrifuged at 1000 r/min for 5 min, resuspended with 500 µL Binding Buffer, add 5 µL of Annexi V (KeyGEN, Nanjing, China), and add 5 µL of PI (KeyGEN, Nanjing, China), mix gently, and incubate for 15 min at room temperature under the condition of avoiding light, and then apoptosis was detected by Cytoflex flow cytometer (Beckman Coulter, USA) within 1 h. Ca2+ content analysis: Cell precipitates were obtained, cells were resuspended by adding 500 µL Fluo-4 AM (Beyotime, Beijing, China) dilution, incubated for 40 min at 37℃ away from light, and the supernatant was discarded by centrifugation at 1000 r/min. Subsequently, 500 µL PBS was added and washed twice, incubated at 37℃ for 20 min, centrifuged at 1000 r/min for 5 min, resuspended in 300 µL PBS, and analyzed by flow cytometry.

Scratch assay

When the cells were full grown to monolayer, the supernatant was aspirated, the pipette gun was scratched, the cells were washed twice with PBS, the scratched cells were removed, and the cells were cultured in 37℃ and 5% CO2 incubator according to the grouping. Samples were taken at the time points of 0 h and 24 h, and the scratched state of the cells was photographed with a microscope (DMI1, LEICA, Germany).

Transwell assay

Pre-chilled at 4℃ with 1:8 dilution of Matrigel (Corning, Suzhou, China) was added to the Transwell upper chamber, spread well, and dried at 37℃ for 70 min. Groups were prepared with cell suspensions, and the cell concentration was adjusted to 5 × 104 cells/mL, 200 µL of cell suspension was added to the upper chamber, and 600 µL of medium containing 20% FBS was added to the lower chamber as a chemotactic factor. The small chambers were incubated at 5% CO2 and 37℃ for 24 h. The cells in the upper chamber were wiped off with cotton swabs, rinsed with PBS, fixed with methanol, and stained with 0.1% crystal violet (Bomei, Hefei, China). Three fields of view of each well were selected and photographed under a light microscope, and the number of migrated cells in each group was counted.

Immunofluorescence staining

Cell crawls were washed 3 times with PBS, membrane-breaking solution (Servicebio, Wuhan, China) was added to cover the cells and incubated at room temperature for 10 min, bovine serum (Servicebio, Wuhan, China) was closed at room temperature for 20 min, and antibodies to F-actin (1:200, Abcam, UK) and Paxinllin (1:50, Abcam, UK) was incubated overnight at 4℃, and the antibody was added dropwise for 30 min at 37℃. Subsequently, DAPI (Servicebio, Wuhan, China) was added dropwise and incubated for 10 min at room temperature, and then sealed with anti- fluorescence quenching sealer. Images of the sections were captured using scanning and browsing software (OlyVIA, OLYMPUS, Japan), and the fluorescence intensity of all the captured images was measured using Image-J (National Institutes of Health, USA).

Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from the cells using an ultra-pure RNA extraction kit (YEASEN, Shanghai, China), and 5 µL of RNA was taken to detect the integrity of RNA. The residual genomic DNA in the RNA was digested with a DNase I kit (Takara, Japan) and reverse transcription was performed using a reverse transcription kit (Takara, Japan). Amplification was performed using TB Green TM Premix Ex Taq™ II (Takara, Japan). The primer sequence: MYO3B, Forward sequences (5’-3’): TGAATCACTTCCAGATCCCACAG AC, Reverse sequences (5’-3’): CCAGGCTCCCATCTCTCTTGTTAG; GAPDH, Forward sequences (5’-3’): TGACTTCAACAGCGACACCCA, Reverse sequences (5’-3’): CACCCT GTTGCTGTAGCCAAA. GAPDH was used as an internal control. The relative expression of each target gene was quantified by the 2−ΔΔCt method; where ΔCt = Ct target gene – Ct internal reference and ΔΔCt = ΔCt experiment -ΔCt control.

Western blot analysis

RIPA cell lysis buffer was added to lyse the cells and tissue, which were subsequently centrifuged to collect the protein supernatant. SDS loading buffer was added, and the samples were boiled in boiling water. SDS-PAGE was used to separate proteins, which were transferred to PVDF membranes. Membranes were then blocked with 5% skim milk powder at room temperature. After incubation with primary antibodies at 4℃ overnight, including anti-MYO3B (1:2000), anti-RhoA (1:1000), anti-RhoB (1:2000), anti-RhoC (1:1000), anti-ROCK1 (1:1000), anti-LIMK (1:5000), anti-p-LIML (1:2000), anti-cofilin (1:1000), anti-p-cofilin (1:2000), and anti-β-actin (1:50000); Antibody from ABclonal (Wuhan, China), the membranes were washed with PBS three times, and incubated with goat anti-rabbit IgG (H + L) secondary antibody (1:5000; Affbiotech, Wuhan, China) for 1 h at room temperature. Developed by enhanced chemiluminescence (ECL, Zenbio, Shanghai, China), and the bands were exposed with Fluorescence Image Analysis System Software V2.0 (Tanon, Shanghai), and the results were scanned by Gel-Pro analyzer4 software and expressed as the integrated optical density (IOD) of the target protein.

Statistical analysis

Factors affecting recurrence in patients with EC (age, survival time, tumor size, metastasis, muscle layer, infiltration, histologic grade, and MYO3B expression) were analyzed using a logistic regression model with SPSS 20.0 software (IBM, USA). And the independent influencing factors affecting EC recurrence and MYO3B expression were also analyzed using binary logistic regression equations. Data were expressed as mean ± standard deviation (SD). Comparisons of data among groups were carried out by one-way ANOVA; the LSD test was used if the variance was homogeneous, and Tamhane’s T2 test was used if the variance was not homogeneous. A P-value < 0.05 was considered significant.

Results

Expression of MYO3B in clinical tissue samples of endometrial cancer and its clinical significance

Firstly, we preliminarily succeeded in identifying six important model genes associated with prognosis (Fig. 1A), including NOG, MYO3B, ASPM, FBN3, MMP1 and GRB7. Subsequently, we found that the expression of MYO3B in EC tissues showed high expression (Fig. 1B and C, P < 0.01), suggesting that MYO3B may be associated with EC progression. In addition, we found that MYO3B expression was an influential factor in the recurrence of EC (Table 1). Metastasis was included in the binary logistic regression equation, and the analysis showed that metastasis was an independent risk factor for recurrence in patients (Table 2). Finally, factors with significant differences were included in the binary logistic regression equation, and the results of the analyses showed that Age, Survival time, and Tumor size were not independent influences on MYO3B expression (Table 3).

Fig. 1 Expression of MYO3B in clinical tissue samples of endometrial cancer and its clinical significance. (A) Important model genes from databases associated with prognosis. (B) Expression of MYO3B in tissues. (C) Immunohistochemical staining of MYO3B in tissues (200×, Scale bar, 50 μm). The data are expressed as the mean ± SD. **P < 0.01

Table 1 Analysis of factors influencing EC recurrence

Parameters	Patients	No recurrence	Recurrence	t/Z/χ2-value	P-value	
Age					0.304	
 ≥ 49.5	23	18	5			
 < 49.5	7	7	0			
Survival time/day		415.40 ± 86.40	372.80 ± 132.92	0.921	0.365	
Tumor size/mm3		13.125(6.250,21.063)	9.000(4.500,30.375)	-0.306	0.759	
Metastasis				——	0.019	
 Yes		5	4			
 No		20	1			
Muscle layer				——	0.336	
 Superficial muscle layer		13	1			
 Deep muscular layer		12	4			
Infiltration				1.975	0.578	
 No vascular infiltration		9	1			
 Individual vascular infiltration		11	2			
 Diffuse vascular infiltration		4	1			
 Visible (not specific)		1	1			
Histologic grade					0.428	
 G1		7	3			
 G1-2		13	1			
 G2		2	1			
 G2-3		2	0			
 G3		1	0			
MYO3B expression				——	0.045	
 Low expression		14	0			
 High expression		11	5			

Table 2 Analysis of independent factors affecting EC recurrence

Factors	B	SE	Wald	P	EXP(B)(95%CI)	
Metastasis	2.773	1.225	5.125	0.024	16(1.451-176.451)	

Table 3 Analysis of factors influencing the expression of MYO3B

Parameters	MYO3B expression	t/Z/χ2-value	P-value	
Low expression	High expression	
Age	53.21 ± 10.19	58.88 ± 7.92	-0.804	0.428	
Survival time/day	428.36 ± 89.20	390.75 ± 97.77	1.095	0.283	
Tumor size/mm3	15.00(7.55,20.66)	10.43(5.25,28.50)	-0.187	0.851	
Metastasis			——	0.001	
 Yes	0	9			
 No	14	7			
Muscle layer			6.467	0.011	
 Superficial muscle layer	10	4			
 Deep muscular layer	4	12			
Infiltration				0.255	
 No vascular infiltration	5	5			
 Individual vascular infiltration	8	5			
 Diffuse vascular infiltration	1	4			
 Visible (not specific)	0	2			
Histologic grade				0.123	
 G1	5	5			
 G1-2	9	5			
 G2	0	3			
 G2-3	0	2			
 G3	0	1			
Recurrence			——	0.045	
 Yes	0	5			
 No	14	11			

Effect of MYO3B expression on proliferation, apoptosis, invasion, and migration of endometrial cancer

Here, we analyzed the effects of MYO3B expression on endometrial cancer proliferation, apoptosis, invasion and migration. We first examined the expression of MYO3B in endometrial cancer cell lines, and the results showed that the expression of MYO3B was significantly lower in KLE cells compared with EECs cells, but its expression was significantly increased in IK cells (Fig. 2A and D, P < 0.01), so IK and KLE cells were used for the subsequent experiments. Next, we screened the MYO3B knockdown sequences, as shown in Fig. 2B and D, the knockdown effect of sh-MYO3B-6 was better (P < 0.01). The effect of MYO3B overexpression vector was identified as shown in Fig. 2C and D, the expression of MYO3B was significantly enhanced after overexpressing MYO3B (P < 0.01). Moreover, knockdown of MYO3B inhibited endometrial cancer cell proliferation, promoted apoptosis, and attenuated cell invasion and migration (Fig. 2E-H, P < 0.01), and then, overexpression of MYO3B had the opposite effect to knockdown of MYO3B.

Fig. 2 Effect of MYO3B expression on proliferation, apoptosis, invasion, and migration of endometrial cancer. (A) MYO3B mRNA and protein expression in cells. (B) MYO3B mRNA and protein expression in the knockdown group. (C) MYO3B mRNA and protein expression in overexpression group. (D) Western blot protein bands, protein band calculated as a ratio relative to β-actin protein levels. (E) Cell proliferation, apoptosis, migration, and invasion analysis. (F) Apoptosis flow cytogram. (G) Representative pictures of cellular invasion (crystal violet stain, 100×, Scale bar, 100 μm). (H) Representative images of cell migration (40×, Scale bar, 250 μm). The data are expressed as the mean ± SD. *P < 0.05, **P < 0.01

Effect of MYO3B expression on Ca2+ homeostasis and RhoA/ROCK1 signaling in endometrial cancer cells

Next, we examined the effects of MYO3B expression on Ca2+ homeostasis and RhoA/ROCK1 signaling in endometrial cancer cells. The results revealed that knockdown of MYO3B expression significantly reduced intracellular Ca2+ content (Fig. 3A and D, P < 0.05) and inhibited the expression of Paxinllin and F-actin (Fig. 3B and C, P < 0.01), while overexpression of MYO3B had the opposite effect. Addition of the agonist CALP-2 significantly increased intracellular Ca2+ content compared with knockdown of MYO3B (Fig. 3D and E, P < 0.01). In addition, knockdown of MYO3B expression significantly decreased the protein expression of RhoA and ROCK1, in contrast, overexpression of MYO3B promoted the protein expression of RhoA and ROCK1 (Fig. 3F, P < 0.05). Compared with sh-MYO3B, sh-MYO3B + CALP-2 significantly enhanced the protein expression of RhoA, ROCK1, and p-LIMK, and compared with pcDNA-MYO3B, pcDNA-MYO3B + W-7 significantly decreased the protein expression of RhoA, ROCK1, and p-LIMK (Fig. 3G, P < 0.05), indicating that MYO3B may be dependent on Ca2+/calmodulin-dependent protein kinase signaling to activate RhoA/ROCK1 signaling.

Fig. 3 Effect of MYO3B expression on Ca2+ homeostasis and RhoA/ROCK1 signaling in endometrial cancer cells. (A) Flow cytometric detection of intracellular Ca2+ content. (B) Fluorescence intensity of Paxinllin and F-actin. (C) Immunofluorescence co-staining of Paxinllin and F-actin (60×, Scale bar, 10 μm). (D) Flow cytogram of Ca2+ content. (E) Ca2+ content. (F) Western blot results of RhoA, RhoB, RhoC, and ROCK1 expression in cells, protein band calculated as a ratio relative to β-actin protein levels. (G) Western blot results of RhoA, ROCK1, LIMK, and p-LIMK expression in cells, protein band calculated as a ratio relative to β-actin protein levels. The data are expressed as the mean ± SD. *P < 0.05, **P < 0.01

MYO3B promotes endometrial cancer cell proliferation, migration, and invasion through activation of RhoA/ROCK1 signaling

In this part, we analyzed whether MYO3B promotes EC cell proliferation, migration, and invasion through activation of RhoA/ROCK1 signaling. Compared with sh-MYO3B group, sh-MYO3B + U-46,619 significantly promoted cell proliferation (Fig. 4A, P < 0.05), remarkably attenuated apoptosis (Fig. 4B and C, P < 0.01), and significantly increased cell migration and invasion (Fig. 4D-G, P < 0.01). In contrast, pcDNA-MYO3B + Y27632 observably inhibited cell proliferation (Fig. 4A, P < 0.05), significantly increased apoptosis (Fig. 4B and C, P < 0.01), and memorably attenuated cell migration and invasion (Fig. 4D-G, P < 0.01), as compared to the pcDNA-MYO3B group. Furthermore, the expression of Paxinllin, F-actin, RhoA, ROCK1, p-LIMK, and p-cofilin was significantly elevated in the sh-MYO3B + U-46,619 group compared to the sh-MYO3B group (Fig. 5, P < 0.05), however, the opposite effect was associated with pcDNA-MYO3B + Y27632, demonstrating that MYO3B promotes endometrial cancer cell proliferation, migration, and invasion through activation of RhoA/ROCK1 signaling.

Fig. 4 MYO3B promotes endometrial cancer cell proliferation, migration, and invasion through activation of RhoA/ROCK1 signaling. (A) Cell proliferation analysis. (B) Cell apoptosis analysis. (C) Apoptosis flow cytogram. (D) Representative images of cell migration (40×, Scale bar, 250 μm). (E) Representative pictures of cellular invasion (crystal violet stain, 100×, Scale bar, 100 μm). (F) Cell migration analysis. (G) Cell invasion analysis. The data are expressed as the mean ± SD. *P < 0.05, **P < 0.01

Fig. 5 MYO3B promotes endometrial cancer cell proliferation, migration, and invasion through activation of RhoA/ROCK1 signaling. (A) Fluorescence intensity of Paxinllin and F-actin. (B) Immunofluorescence co-staining of Paxinllin and F-actin (60×, Scale bar, 10 μm). (C) Western blot results of RhoA, ROCK1, LIMK, p-LIMK, cofilin and p-cofilin expression in cells, protein band calculated as a ratio relative to β-actin protein levels. The data are expressed as the mean ± SD. *P < 0.05, **P < 0.01

Effect of knockdown of MYO3B on endometrial cancer cell growth in vivo

Additionally, the effect of knockdown of MYO3B on the growth of EC cells in vivo was observed. In vivo experiments showed that knockdown of MYO3B significantly suppressed tumor size and tumor volume in endometrial cancer compared with the sh-NC group (Fig. 6A, P < 0.05). In addition, knockdown of MYO3B significantly attenuated the expression of Ki-67, MYO3B, ROCK1, RhoA, and F-actin in the tumor tissues (Fig. 6B and C, P < 0.05), showing that knockdown of MYO3B inhibited the growth of endometrial cancer in mice.

Fig. 6 Effect of knockdown of MYO3B on endometrial cancer cell growth in vivo. (A) Tumor size and Tumor volume. (B) Expression of Ki-67, MYO3B, ROCK1, RhoA, and F-actin in tumor tissues. (C) Immunohistochemical staining of Ki-67, MYO3B, ROCK1, RhoA, and F-actin in tumor tissues (40×, Scale bar, 50 μm). The data are expressed as the mean ± SD. *P < 0.05, **P < 0.01

Discussions

Distant metastasis is a key determinant of EC prognosis (Nees et al. 2022), and MYO3B may be associated with EC progression. However, the molecular mechanisms by which MYO3B affects EC remain unclear. The present study provides insights into this issue. We demonstrated that the expression of MYO3B was an influential factor in EC recurrence, and the expression of MYO3B was significantly up-regulated in EC tissues and cells, but down-regulated in KLE cells, and MYO3B knockdown inhibited the proliferation, migration, and invasion ability of EC cells and promoted apoptosis, suggesting that MYO3B plays a tumor-promoting role in EC. Additionally, we provide evidence that MYO3B knockdown decreased Ca2+ concentration in EC cells and the RhoA/ROCK1 signaling pathway was inhibited, and the effect of MYO3B knockdown on RhoA/ROCK1 signaling was reversed by treatment with the Calmodulin agonist CALP-2, and the effects of MYO3B knockdown on cell proliferation, migration, and invasion were reversed after treatment with the RhoA agonist U-46,619.

Currently, the correlation between MYO3B and tumor is still undetermined, in order to explore the significance of MYO3B in EC, we firstly analyzed the expression of MYO3B in EC tissues, MYO3B was presented as a high expression in EC tissues, and the results of fresh tissues were consistent with the database data. Moreover, the results of EC cell lines were similar to the tissue results, the expression of MYO3B was elevated in Ishikawa, RL95-2 cells, but the expression of MYO3B in KLE cells presented a low expression, which may be due to the different local environments and differentiation states within the tumor (Pei et al. 2022). Meanwhile, the analysis of MYO3B expression and patients’ clinical characteristics showed that MYO3B expression was an influencing factor for EC recurrence, and patients’ age, survival time, tumor size, infiltration, and histologic grade were not independent influencing factors for MYO3B expression. This suggests that MYO3B can be used as an independent factor to predict poor prognosis of EC.

Studies have shown that sustained proliferation, evasion of apoptosis, and genomic instability are three of the most prevalent characteristics in human cancers that can drive cancer progression (Wang et al. 2023). Therefore, inhibiting the proliferation, migration, and invasion of cancer cells is of significance in attenuating cancer progression (Garrett et al. 2024). Studies have reported that silencing of S100A4 significantly attenuated the migration and invasion of EC cells (Hua et al. 2016). The results of the present study were consistent with the report, and we found that knockdown of MYO3B inhibited the proliferation, migration, and invasion ability of EC cells and promoted apoptosis. Similarly, knockdown of MYO3B in EC model mice significantly inhibited tumor size, volume and proliferation, suggesting that knockdown of MYO3B inhibited EC progression. Ca2+ plays an important role in endoplasmic reticulum cellular responses, signal transduction pathways, and transcriptional regulation, and its balance is a prerequisite and basis for maintaining normal cellular structure and function (Prevarskaya et al. 2014). It has been reported that in the resting state, intracellular Ca2+ is maintained at a low level, and when the cells respond to stimuli, the intracellular Ca2+ concentration rises rapidly (Zheng et al. 2023). The Ca2+ concentration can influence tumor progression, e.g., in prostate cancer, inhibition of TRPV2 reduces the Ca2+ concentration, and invasive ability is attenuated (Liberati et al. 2014). In this experiment, MYO3B knockdown down-regulated Ca2+ concentration in EC cells, Calmodulin is one of the major Ca2+-binding proteins in cells and plays multiple roles in a variety of Ca2+-signaling pathways, regulating the activity of other proteins (Tokumitsu and Sakagami 2022). The attenuating effect of knockdown of MYO3B on Ca2+ in EC cells was reversed by the addition of the Calmodulin agonist CALP-2, suggesting that MYO3B regulates Ca2+ signaling in EC.

It has been noted that RhoA/ROCK1 signaling is an important intracellular signaling pathway involved in the regulation of a wide range of cellular functions (Dong et al. 2023). Rho GTPases are frequently activated in human cancers and play a key role in cancer cell invasion and metastasis through the regulation of cell motility and the dynamic organization of the actin cytoskeleton (Yin et al. 2016). Previous studies have shown that overexpression of RhoA together with ROCK1 and ROCK2 supports spreading and migration of HeLa cells (Tang et al. 2021). In addition, the study reported that intracellular Ca2+ homeostasis regulates RhoA activity (Zhu et al. 2017). In EC, TRPV4 and calcium regulate cytoskeletal-induced metastasis via the RhoA/ROCK/LIMK/cofilin pathway (Li et al. 2020), and our results are similar to it. Our findings suggest that knockdown of MYO3B inhibited RhoA/ROCK1 signaling pathway activation in EC cells, and the effect of MYO3B knockdown on the RhoA/ROCK1 signaling pathway was reversed with the Calmodulin agonist CALP-2, suggesting that MYO3B may mediate the activation of the RhoA/ROCK1 signaling pathway by affecting Ca2+ release and that RhoA/ROCK1 occurs in a Ca2+-dependent manner. Furthermore, our results showed that activation of RhoA/ROCK reduced the inhibitory effect of MYO3B knockdown on EC cell migration and invasion, which demonstrated that MYO3B may be involved in the EC process through Ca2+-mediated RhoA/ROCK1 pathway.

Conclusion

In conclusion, MYO3B mediated the RhoA/ROCK1 signaling pathway by regulating Ca2+ levels, promoted EC cell proliferation, enhanced cell migration and invasion, and inhibited apoptosis, suggesting that MYO3B promotes the progression of EC and can be used as a target for further study of EC therapy.

Acknowledgements

Not applicable.

Author contributions

Sanyuan Zhang, Huifeng Zhang ang Xiaofeng Yang contributed in the project development and the manuscript revision. Chunmei Zhang contributed in the manuscript writing. Chunmei Zhang, Huancheng Su, Jiaolin Yang, Yuanyuan Ding, Xinglin Zhang and Bao Qiang contributed in the tissue sample collection. Sufen Li and Liang Wang contributed in the data analysis.

Funding

This study was Surpported by Fundamental Research Program of Shanxi Province and Natural Science Foundation of Shanxi Province (no. 20210302124413 and 202203021222372).

Data availability

The data used to support the findings of this stdy are available from the corresponding author .

Declarations

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

Adiga D Radhakrishnan R Chakrabarty S Kumar P Kabekkodu SP The role of Calcium Signaling in Regulation of epithelial-mesenchymal transition Cells Tissues Organs 2022 211 2 134 156 10.1159/000512277 33316804
Adiga D, Radhakrishnan R, Chakrabarty S, Kumar P, Kabekkodu SP (2022) The role of Calcium Signaling in Regulation of epithelial-mesenchymal transition. Cells Tissues Organs 211(2):134–156. 10.1159/00051227733316804
Baghel KS Tewari BN Shrivastava R Malik SA Lone MU Jain NK Tripathi C Kanchan RK Dixit S Singh K Mitra K Negi MP Srivastava M Misra S Bhatt ML Bhadauria S Macrophages promote matrix protrusive and invasive function of breast cancer cells via MIP-1β dependent upregulation of MYO3A gene in breast cancer cells Oncoimmunology 2016 5 7 e1196299 10.1080/2162402x.2016.1196299 27622050
Baghel KS, Tewari BN, Shrivastava R, Malik SA, Lone MU, Jain NK, Tripathi C, Kanchan RK, Dixit S, Singh K, Mitra K, Negi MP, Srivastava M, Misra S, Bhatt ML, Bhadauria S (2016) Macrophages promote matrix protrusive and invasive function of breast cancer cells via MIP-1β dependent upregulation of MYO3A gene in breast cancer cells. Oncoimmunology 5(7):e1196299. 10.1080/2162402x.2016.119629927622050
Chang GQ Bai SZ Sun FQ Wu R Wei C Wen X Xi YX Hao JH Zaid A Li HZ SKF38393 prevents high glucose (HG)-induced endothelial dysfunction by inhibiting the effects of HG on cystathionine γ-lyase/hydrogen sulfide activity and via a RhoA/ROCK1 pathway Front Bioscience (Landmark Edition) 2022 27 2 49 10.31083/j.fbl2702049
Chang GQ, Bai SZ, Sun FQ, Wu R, Wei C, Wen X, Xi YX, Hao JH, Zaid A, Li HZ (2022) SKF38393 prevents high glucose (HG)-induced endothelial dysfunction by inhibiting the effects of HG on cystathionine γ-lyase/hydrogen sulfide activity and via a RhoA/ROCK1 pathway. Front Bioscience (Landmark Edition) 27(2):49. 10.31083/j.fbl2702049
Cirilo JA Jr Gunther LK Yengo CM Functional role of Class III myosins in Hair cells Front cell Dev Biology 2021 9 643856 10.3389/fcell.2021.643856
Cirilo JA Jr., Gunther LK, Yengo CM (2021) Functional role of Class III myosins in Hair cells. Front cell Dev Biology 9:643856. 10.3389/fcell.2021.643856
Crosbie EJ Kitson SJ McAlpine JN Mukhopadhyay A Powell ME Singh N Endometrial cancer Lancet (London England) 2022 399 10333 1412 1428 10.1016/s0140-6736(22)00323-3 35397864
Crosbie EJ, Kitson SJ, McAlpine JN, Mukhopadhyay A, Powell ME, Singh N (2022) Endometrial cancer. Lancet (London England) 399(10333):1412–1428. 10.1016/s0140-6736(22)00323-335397864
Dong Q Luo Y Yin Y Ma Y Yu Y Wang L Yang H Pan Y Zhang D RhoA/ROCK1 regulates the mitochondrial dysfunction through Drp1 induced by Porphyromonas gingivalis in endothelial cells J Cell Mol Med 2023 27 15 2123 2135 10.1111/jcmm.17796 37278388
Dong Q, Luo Y, Yin Y, Ma Y, Yu Y, Wang L, Yang H, Pan Y, Zhang D (2023) RhoA/ROCK1 regulates the mitochondrial dysfunction through Drp1 induced by Porphyromonas gingivalis in endothelial cells. J Cell Mol Med 27(15):2123–2135. 10.1111/jcmm.1779637278388
Garrett AA Bai S Cascio S Gupta N Yang D Buckanovich RJ EGFL6 promotes endometrial cancer cell migration and proliferation Gynecol Oncol 2024 185 75 82 10.1016/j.ygyno.2024.02.016 38368816
Garrett AA, Bai S, Cascio S, Gupta N, Yang D, Buckanovich RJ (2024) EGFL6 promotes endometrial cancer cell migration and proliferation. Gynecol Oncol 185:75–82. 10.1016/j.ygyno.2024.02.01638368816
Georgouli M Herraiz C Crosas-Molist E Fanshawe B Maiques O Perdrix A Pandya P Rodriguez-Hernandez I Ilieva KM Cantelli G Karagiannis P Mele S Lam H Josephs DH Matias-Guiu X Marti RM Nestle FO Orgaz JL Malanchi I Fruhwirth GO Karagiannis SN Sanz-Moreno V Regional activation of myosin II in Cancer cells drives Tumor Progression via a secretory cross-talk with the Immune Microenvironment Cell 2019 176 4 757 774e723 10.1016/j.cell.2018.12.038 30712866
Georgouli M, Herraiz C, Crosas-Molist E, Fanshawe B, Maiques O, Perdrix A, Pandya P, Rodriguez-Hernandez I, Ilieva KM, Cantelli G, Karagiannis P, Mele S, Lam H, Josephs DH, Matias-Guiu X, Marti RM, Nestle FO, Orgaz JL, Malanchi I, Fruhwirth GO, Karagiannis SN, Sanz-Moreno V (2019) Regional activation of myosin II in Cancer cells drives Tumor Progression via a secretory cross-talk with the Immune Microenvironment. Cell 176(4):757–774e723. 10.1016/j.cell.2018.12.03830712866
Hua T Liu S Xin X Cai L Shi R Chi S Feng D Wang H S100A4 promotes endometrial cancer progress through epithelial-mesenchymal transition regulation Oncol Rep 2016 35 6 3419 3426 10.3892/or.2016.4760 27109209
Hua T, Liu S, Xin X, Cai L, Shi R, Chi S, Feng D, Wang H (2016) S100A4 promotes endometrial cancer progress through epithelial-mesenchymal transition regulation. Oncol Rep 35(6):3419–3426. 10.3892/or.2016.476027109209
Komaba S Inoue A Maruta S Hosoya H Ikebe M Determination of human myosin III as a motor protein having a protein kinase activity J Biol Chem 2003 278 24 21352 21360 10.1074/jbc.M300757200 12672820
Komaba S, Inoue A, Maruta S, Hosoya H, Ikebe M (2003) Determination of human myosin III as a motor protein having a protein kinase activity. J Biol Chem 278(24):21352–21360. 10.1074/jbc.M30075720012672820
Li X Cheng Y Wang Z Zhou J Jia Y He X Zhao L Dong Y Fan Y Yang X Shen B Wu X Wang J Xiong C Wei L Li X Wang J Calcium and TRPV4 promote metastasis by regulating cytoskeleton through the RhoA/ROCK1 pathway in endometrial cancer Cell Death Dis 2020 11 11 1009 10.1038/s41419-020-03181-7 33230171
Li X, Cheng Y, Wang Z, Zhou J, Jia Y, He X, Zhao L, Dong Y, Fan Y, Yang X, Shen B, Wu X, Wang J, Xiong C, Wei L, Li X, Wang J (2020) Calcium and TRPV4 promote metastasis by regulating cytoskeleton through the RhoA/ROCK1 pathway in endometrial cancer. Cell Death Dis 11(11):1009. 10.1038/s41419-020-03181-733230171
Liberati S Morelli MB Amantini C Farfariello V Santoni M Conti A Nabissi M Cascinu S Santoni G Loss of TRPV2 homeostatic control of cell proliferation drives Tumor Progression Cells 2014 3 1 112 128 10.3390/cells3010112 24709905
Liberati S, Morelli MB, Amantini C, Farfariello V, Santoni M, Conti A, Nabissi M, Cascinu S, Santoni G (2014) Loss of TRPV2 homeostatic control of cell proliferation drives Tumor Progression. Cells 3(1):112–128. 10.3390/cells301011224709905
Makker V MacKay H Ray-Coquard I Endometrial cancer 2021 7 1 88 10.1038/s41572-021-00324-8
Makker V, MacKay H, Ray-Coquard I (2021) Endometrial cancer 7(1):88. 10.1038/s41572-021-00324-8
Nees LK Heublein S Steinmacher S Juhasz-Böss I Brucker S Tempfer CB Wallwiener M Endometrial hyperplasia as a risk factor of endometrial cancer Arch Gynecol Obstet 2022 306 2 407 421 10.1007/s00404-021-06380-5 35001185
Nees LK, Heublein S, Steinmacher S, Juhasz-Böss I, Brucker S, Tempfer CB, Wallwiener M (2022) Endometrial hyperplasia as a risk factor of endometrial cancer. Arch Gynecol Obstet 306(2):407–421. 10.1007/s00404-021-06380-535001185
Patergnani S, Danese A, Bouhamida E, Aguiari G, Previati M (2020) Various aspects of Calcium Signaling in the regulation of apoptosis, Autophagy, Cell Proliferation, and Cancer. 21(21). 10.3390/ijms21218323
Pei T Luo B Huang W Liu D Li Y Xiao L Huang X Ouyang Y Zhu H Increased expression of YAP inhibited the Autophagy Level by Upregulating mTOR Signal in the eutopic ESCs of endometriosis Front Endocrinol 2022 13 813165 10.3389/fendo.2022.813165
Pei T, Luo B, Huang W, Liu D, Li Y, Xiao L, Huang X, Ouyang Y, Zhu H (2022) Increased expression of YAP inhibited the Autophagy Level by Upregulating mTOR Signal in the eutopic ESCs of endometriosis. Front Endocrinol 13:813165. 10.3389/fendo.2022.813165
Prevarskaya N Ouadid-Ahidouch H Skryma R Shuba Y Remodelling of Ca2 + transport in cancer: how it contributes to cancer hallmarks? Philos Trans R Soc Lond B Biol Sci 2014 369 1638 20130097 10.1098/rstb.2013.0097 24493745
Prevarskaya N, Ouadid-Ahidouch H, Skryma R, Shuba Y (2014) Remodelling of Ca2 + transport in cancer: how it contributes to cancer hallmarks? Philos Trans R Soc Lond B Biol Sci 369(1638):20130097. 10.1098/rstb.2013.009724493745
Tang J, Fang K, Li C, Chang X (2021) ARHGEF10L promotes cervical tumorigenesis via RhoA-Mediated signaling. Evid Based Complement Alternat Med 2021(6683264). 10.1155/2021/6683264
Tokumitsu H, Sakagami H (2022) Molecular mechanisms underlying ca(2+)/Calmodulin-Dependent Protein Kinase Kinase Signal Transduction. Int J Mol Sci 23(19). 10.3390/ijms231911025
Uccella S, Zorzato PC, Dababou S (2022) Conservative management of atypical endometrial hyperplasia and early endometrial Cancer in Childbearing Age women. 58(9). 10.3390/medicina58091256
van den Heerik A, Horeweg N (2021) Adjuvant therapy for endometrial cancer in the era of molecular classification: radiotherapy, chemoradiation and novel targets for therapy. 31(4):594–604. 10.1136/ijgc-2020-001822
Wang Z Shu W Zhao R Liu Y Wang H Sodium butyrate induces ferroptosis in endometrial cancer cells via the RBM3/SLC7A11 axis Apoptosis: Int J Program cell Death 2023 28 7–8 1168 1183 10.1007/s10495-023-01850-4
Wang Z, Shu W, Zhao R, Liu Y, Wang H (2023) Sodium butyrate induces ferroptosis in endometrial cancer cells via the RBM3/SLC7A11 axis. Apoptosis: Int J Program cell Death 28(7–8):1168–1183. 10.1007/s10495-023-01850-4
Yin M Lu Q Liu X Wang T Liu Y Chen L Silencing Drp1 inhibits glioma cells proliferation and invasion by RHOA/ ROCK1 pathway Biochem Biophys Res Commun 2016 478 2 663 668 10.1016/j.bbrc.2016.08.003 27495873
Yin M, Lu Q, Liu X, Wang T, Liu Y, Chen L (2016) Silencing Drp1 inhibits glioma cells proliferation and invasion by RHOA/ ROCK1 pathway. Biochem Biophys Res Commun 478(2):663–668. 10.1016/j.bbrc.2016.08.00327495873
Zhang D Zhu Y Li Z Luo M Liang X Wang A Zhu H Hu L Li R The role of Astragalus polysaccharides in promoting IEC-6 cell migration from polyamine-mediated ca(2+) regulation Int J Biol Macromol 2022 207 179 192 10.1016/j.ijbiomac.2022.02.109 35217086
Zhang D, Zhu Y, Li Z, Luo M, Liang X, Wang A, Zhu H, Hu L, Li R (2022) The role of Astragalus polysaccharides in promoting IEC-6 cell migration from polyamine-mediated ca(2+) regulation. Int J Biol Macromol 207:179–192. 10.1016/j.ijbiomac.2022.02.10935217086
Zheng S Wang X Zhao D Liu H Hu Y Calcium homeostasis and cancer: insights from endoplasmic reticulum-centered organelle communications Trends Cell Biol 2023 33 4 312 323 10.1016/j.tcb.2022.07.004 35915027
Zheng S, Wang X, Zhao D, Liu H, Hu Y (2023) Calcium homeostasis and cancer: insights from endoplasmic reticulum-centered organelle communications. Trends Cell Biol 33(4):312–323. 10.1016/j.tcb.2022.07.00435915027
Zhu S Zhou HY Deng SC Deng SJ He C Li X Chen JY Jin Y Hu ZL Wang F Wang CY Zhao G ASIC1 and ASIC3 contribute to acidity-induced EMT of pancreatic cancer through activating ca(2+)/RhoA pathway Cell Death Dis 2017 8 5 e2806 10.1038/cddis.2017.189 28518134
Zhu S, Zhou HY, Deng SC, Deng SJ, He C, Li X, Chen JY, Jin Y, Hu ZL, Wang F, Wang CY, Zhao G (2017) ASIC1 and ASIC3 contribute to acidity-induced EMT of pancreatic cancer through activating ca(2+)/RhoA pathway. Cell Death Dis 8(5):e2806. 10.1038/cddis.2017.18928518134
