
==== Front
bioRxiv
BIORXIV
bioRxiv
2692-8205
Cold Spring Harbor Laboratory

39282452
10.1101/2024.09.02.610888
preprint
1
Article
Suppression by RNA Polymerase I Inhibitors Varies Greatly Between Distinct RNA Polymerase I Transcribed Genes in Malaria Parasites
Samuel Hermela Formal Analysis Investigation Visualization 123
Campelo-Morillo Riward Conceptualization Methodology Validation Formal Analysis Investigation Writing – Original Draft Preparation Writing – Review & Editing Visualization Supervision 1*
http://orcid.org/0000-0003-0089-1096
Kafsack Björn F.C. Conceptualization Writing – Review & Editing Visualization Supervision Project Administration Funding Acquisition 1*
1 Department of Microbiology & Immunology, Weill Cornell Medicine, New York, NY, USA
2 ACCESS Summer Internship Program, Weill Cornell Medicine, New York, NY, USA
3 Carleton College, Northfield, MN, USA
* Please address correspondence to rac2032@med.cornell.edu or bjk2007@med.cornell.edu.
02 9 2024
2024.09.02.610888https://creativecommons.org/licenses/by-nc/4.0/ This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License, which allows reusers to distribute, remix, adapt, and build upon the material in any medium or format for noncommercial purposes only, and only so long as attribution is given to the creator.
nihpp-2024.09.02.610888.pdf
Transcription of ribosomal RNA (rRNA) by RNA Polymerase I (Pol I) is the rate-limiting step in ribosome biogenesis and a major determinant of cellular growth rates. Unlike virtually every other eukaryote, which express identical rRNA from large tandem arrays of dozens to hundreds of identical rRNA genes in every cell, the genome of the human malaria parasite Plasmodium falciparum contains only a handful single-copy 47S rRNA loci that differ substantially from one another in length, sequence and expression in different cell-types. We found that growth of malaria parasite was acutely sensitive to the Pol I inhibitors 9-hydroxyellipticine and BMH-21 and demonstrate that they greatly reduce the transcription of 47S rRNAs as well as transcription of other non-coding RNA genes. Surprisingly, we found that the various types of Pol I-transcribed genes differed by more than two orders of magnitude in their susceptibility to these inhibitors and explore the implications of these findings for regulation of rRNA in P. falciparum.

RNA Polymerase I
transcription
inhibitors
non-coding RNA
ribosomal RNA
malaria parasites
Plasmodium falciparum
NIAIDR01AI141965 R21AI166436
==== Body
pmcINTRODUCTION

Ribosomes are macromolecular machines that translate the genetic information within messenger RNA into proteins that carry out the vast majority of biological functions (Petrov et al. 2015; Fox 2010; Cooper 2000). Given the ribosome’s central role in cellular function, eukaryotic genomes encode hundreds of identical ribosomal RNA (rRNA) genes that are organized into large tandem arrays and ribosome composition tends to be highly uniform across cell types (Yang and Karbstein 2024; Goodfellow and Zomerdijk 2013; Sáez-Vásquez and Delseny 2019).

Malaria parasites represent a striking exception to this rule. Despite having similarly sized genomes as budding yeast, which has a single array of 150 identical rRNA copies, the genomes of malaria parasites generally contain four to six rRNA loci, each located on a different chromosome and encoding only a single 47S rRNA gene (McGee, Armache, and Lindner 2023; Rodríguez-Almonacid et al. 2023; Waters et al. 1997; Waters, Syin, and McCutchan 1989). Moreover, this small number of genes encode 2–3 distinct forms of 47 rRNAs that differ substantially from one another in length, sequence and their expression throughout the parasite lifecycle. The major human malaria parasites Plasmodium falciparum has 5 complete 47S rRNA genes. Two nearly identical A-type rRNA loci (A1 and A2 on chromosomes 5 and 7) are expressed in the liver and asexual blood stages, the S1 locus on chromosome 1 that is primarily expressed during gametocyte development, and two nearly identical S2-type loci (S2a and S2b on chromosomes 11 and 13) that are highly expressed in the mosquito stages (Waters, Syin, and McCutchan 1989; Rogers et al. 1996; Zhu et al. 1990). Regulation of the S2 loci is also quite distinct in P. falciparum. Under standard culture at 37°C, these loci are only weakly expressed but their expression increases rapidly if parasites are exposed to the same temperatures experienced in the mosquito (Fang and McCutchan 2002; Fang, Sullivan, and McCutchan 2004; Sharma et al. 2023).

47S transcription machinery

In eukaryotes, transcription is carried out by three RNA polymerase complexes (Pol I, II, and III), that share some subunits but have distinct catalytic cores, promoter types and recruitment machinery. Protein coding genes are transcribed by Pol II to generate capped and polyadenylated messenger RNAs that are targeted to the ribosomes for translation. Pol III transcribes the 5S rRNA, transfer RNAs, and other small non-coding RNAs with a host of functions. In contrast, Pol I only generates single transcript in virtually all eukaryotes: the 47S rRNA that is processed into the 28S, 18S, and 5.8S rRNA that form the catalytic core of the ribosome. Despite this specialization transcription by Pol I comprises up to 60% of the total transcriptional activity of growing cells (Warner, Vilardell, and Sohn 2001). Transcription of the 47S rRNA is the rate limiting step in ribosome biogenesis (Moss and Stefanovsky 1995) and a major determinant of cellular growth rates (Teng, Thomas, and Mercer 2013; Hwang and Denicourt 2024; Kang et al. 2021), and commonly upregulated in a variety of cancer types. Unlike the activity of the other two RNA polymerases, transcription by Pol I is insensitive to inhibition by α-amanitin (Bensaude 2011) but Pol I-specific inhibitors have recently been developed for use in oncotherapy (Laham-Karam et al. 2020).

Since malaria parasites are highly unique in their diversity, organization, and expression of the 47S ribosomal RNA, we decided to explore the effect of these inhibitors on growth and Pol I transcription in the most wide-spread and deadly human malaria parasite P. falciparum.

MATERIALS AND METHODS

Parasite culture

In this study we used the Plasmodium falciparum parasite strain NF54 obtained from BEI Resources. Parasites were maintained following established cultured conditions (Moll et al. 2008) using 0.5% AlbuMAX II (Gibco) supplemented malaria complete media and kept at 37°C under 5% O2, 5% CO2, 90% N2.

P. falciparum growth inhibition assay

A fluorescence-based parasite growth inhibition assay was carried out according to previously described protocols with minor modifications (Johnson et al. 2007; Smilkstein et al. 2004). Briefly, ring-stage parasite cultures were adjusted to 0.5% parasitemia and 2% hematocrit before being seeded into a flat-bottom 96-well plate in the presence of increasing drug concentrations at a final volume of 200 μL. Parasites were allowed to grow at 37°C for 72 hours. Upon incubation time, 150 μL from each well was transferred to a black flat-bottom plate, and 100 μL of SYBR Green lysis buWer (20 mM Tris, pH 7.5; 5 mM EDTA, 0.008% wt/vol saponin, 0.08% vol/vol Triton X-100, and 1X SYBR Green [Invitrogen S7563]) was added to each well. The plate was then incubated with gentle agitation for 1 hour, protected from light. Fluorescence (excitation at 485 nm/emission at 538 nm) was measured using a SpectraMax iD5 plate reader. Fluorescence units (FU) from three technical replicates were normalized to Chloroquine (50 nM) and DMSO-treated controls (0.5% final concentration), averaged, and plotted using GraphPad Prism software. A four-parameter dose-response curve was fitted, and the EC50 was determined. Reported EC50 values were averaged from three independent experiments, with standard error of mean values.

RNA Polymerase I Inhibition assay

Cultures of 22 hpi ± 3 hpi trophozoites were adjusted to 1.5% parasitemia, equally split, and treated with increasing concentrations of the RNA Pol I inhibitors 9-HE (5,11-dimethyl-6H-pyrido[4,3-b]carbazol-9-ol, monohydrochloride) CAS 52238–35-4 (Cayman Chemical) and BMH-21 (N-[2-(dimethylamino)ethyl]-12-oxo-12H-benzo[g]pyrido[2,1-b]quinazoline-4-carboxamide) CAS 896705–16-1 (Cayman Chemical). Both treated and untreated parasites (with the same volume of DMSO added) were incubated for 3 hours at 26°C. In parallel, untreated control parasites were kept at 37°C. After the incubation period, the parasites were harvested and washed once with 1xPBS before proceeding to RNA isolation.

RNA isolation, cDNA synthesis and qPCR

Total RNA from saponin-lysed parasites was extracted by TRIzol reagent (Invitrogen) and using the PureLink RNA Mini Kit (Invitrogen) following manufactures instructions. cDNA was synthesized from 500ng of total RNA pretreated with DNAse I (amplification grade, ThermoScientific) using SuperScript III reverse transcriptase (Invitrogen) and random hexamers. Ǫuantitative PCR was performed on the Ǫuant Studio 6 Flex (Thermo Fisher) using iTaq SYBR Green (BioRad) with specific primers for selected targets (Table 1) and normalized to seryl-tRNA synthetase (PF3D7_0717700).

RESULTS AND DISCUSSION

Inhibition of P. falciparum RNA polymerase I activity by 9-HE and BMH-21.

We decided to test the effect of 9-hydroxyellipticine (9-HE) and BMH-21, two compounds that inhibit RNA Pol I in mammalian cells (Jacobs et al. 2022; Andrews et al. 2013; Kerry et al. 2017). 9-HE was previously shown to have activity against Plasmodium falciparum (Montoia et al. 2014) and Trypanosoma cruzi (Bénard, Dat-Xuong, and Riou 1975). BMH-21 was shown to inhibit growth and RNA Pol I transcription in African trypanosomes (Kerry et al. 2017) but its anti-malarial activity has not been reported. We found that both compounds were able to inhibit intraerythrocytic replication of P. falciparum at sub-micromolar concentrations with EC50 values of 56 ± 3 nM for 9-HE and 352±64 nM BMH-21 (Figure 1).

To test if these compounds can inhibit RNA Pol I transcription specifically we monitored transcription of 47S rRNAs, the RNA Pol III-transcribed 5S rRNA, and mRNA transcribed by RNA Pol II. Under standard conditions, only the nearly identical A1 and A2 loci are actively transcribed in asexual blood stages while the S1 and S2a/b loci are expressed in gametocytes and mosquito stages (McGee, Armache, and Lindner 2023). However, transcription of the S2 loci can be induced in asexual blood stage by simply shifting parasite cultures to temperature experienced in the mosquito host thus allowing us to monitor new transcription by RNA Pol I (Fang and McCutchan 2002; Fang, Sullivan, and McCutchan 2004; Sharma et al. 2023). To monitor nascent transcription of 47S rRNA, we used primers the bind within the 5’ External Spacer (5’ETS) that sits upstream of the 18S sequence and is rapidly cleaved and degraded during ribosomal biogenesis (Hughes and Ares 1991; Aubert et al. 2018).

Consistent with these earlier reports (Fang, Sullivan, and McCutchan 2004; Sharma et al. 2023), we found that shifting parasite cultures to 26°C for 3 hours greatly induced expression of S2 47S rRNA and the long non-coding truRNA relative to their expression at 37°C (Figure 2A). Transcription of A1 and A2 47S rRNA decreased 2 to 4-fold while transcription of S1 47S rRNA remained largely unchanged. The temperature shift had only minor effects on the 5S and uce genes that are transcribed by RNA Pol II and Pol III, respectively. Concurrent treatment with 12.8 μM 9-HE or BMH-21 substantially reduced expression of RNA Pol I transcripts but had no significant effect on the representative Pol II and Pol III transcripts, indicating that both compounds specifically inhibit transcription by RNA Pol I in P. falciparum (Figure 2B).

Susceptibility to inhibitors of RNA Pol I activity differs greatly between Pol I transcribed genes.

Interestingly, we found that transcription of S1 rRNA was less effected by 9-HE and BMH-21 relative to the other four Pol I transcripts (Figure 2B). To test if these other transcripts might also be differentially susceptible to inhibition by either inhibitor, we measured their effect on Pol I transcribed genes across a wider range of concentrations. Indeed, treatment with increasing concentrations of 9-HE or BMH-21 revealed substantially different responses between these RNA Pol I transcribed genes (Figure 3). Transcription of A-type 47S rRNAs was acutely sensitive with half-maximal inhibition concentrations in 30nM range for 9-HE and 140 nM for BMH-21. These concentrations are a close match to those inhibiting growth, strongly suggesting the mechanism of action of 9-HE and BMH-21 is indeed the inhibition of A-type rRNA transcription, which form the vast majority of ribosomes in asexual blood stages. Strikingly, inhibiting the transcription of the other genes required much higher concentrations of 9-HE with half-maximal concentrations of 290 nM, 720 nM, and 4.9 μM for truRNA, S2 rRNA, and S1 rRNA respectively. Inhibition of transcription by BMH-21 at these loci followed the same pattern (A > S2 = truRNA > S1) but was approximately 4-fold less susceptible compared to 9-HE.

Intriguingly, transcription of S1 and S2 rRNAs increased at lower concentrations that effectively inhibit transcription of A-type rRNAs but not transcription of the truRNA. We therefore observed four distinct patterns of susceptibility to these Pol I inhibitors: (i) high susceptibility for A-type rRNA, (ii) intermediate susceptibility with enhanced transcription at concentrations that already inhibit A-type rRNA for S2 rRNA, (iii) intermediate susceptibility without enhancement for the truRNA, and (iv) low susceptibility with enhancement for S1 rRNA.

The observation that transcription of these genes differs substantially in their susceptibly to Pol I inhibitors argues for a sequence dependence of this activity, though it could also be explained to differences in the Pol I complex composition that alters inhibitor susceptibility.

Both inhibitors have been shown to intercalate into GC-rich DNA (Elcock, Rodger, and Richards 1996; Jacobs et al. 2022) but with different effects. Treatment with BMH-21 most strongly alters transcription elongation by Pol I and leads to stalling of Pol I upstream of G-rich stretches in the template (Jacobs et al. 2022) while 9-HE specifically altered promoter binding of the SL1 promoter recognition complex required for recruitment of Pol I and transcription initiation (Andrews et al. 2013). Fang and colleagues noted that the transcription start site of A1 and A2 rRNA genes is immediately preceded by a 20nt stretch of 75% GC content that is absent from the S1 and S2a/b promoters (Fang, Sullivan, and McCutchan 2004), providing a likely explanation for the greater inhibitors sensitivity of A-type transcription we observed. Interestingly, the 100bp immediately upstream of the S2a and S2b transcription start sites contains six regularly spaced deoxyguanosine di-nucleotides (14,16,16,17, and 19 bp apart) that stand out within this region of only 18% GC content, while no such evenly spaced repeats could be found close to the truRNA or S1 rRNA transcription start sites.

The observed enhancement of S1 and S2a/b transcription at concentrations that inhibited A1/A2 transcription suggests a limited supply of a shared component of the transcriptional machinery that is not targeted by the inhibitors. Reduced transcription at the more susceptible A-type loci at lower temperatures then frees these up for additional transcription of S1 and S2. Intriguingly, the lack of enhancement at the same concentrations would imply that this shared component is not limiting for truRNA transcription. The importance of such repeats for S2 rRNA transcription warrants further study.

lncRNAs downstream of the truRNA likely derive from a single longer transcript.

The current P. falciparum genome annotations (PlasmoDB release 68) include three non-coding RNA genes (PF3D7_1148100/200/300, referred to as regions a/b/c hereafter) immediately upstream of the S2b locus and three additional non-coding RNA genes (PF3D7_1370500/600/700, referred to as regions d/e/f hereafter) upstream of the S2a locus. Of these, regions b-f lie upstream of the S2a and S2b rRNA genes on chromosomes 13 and 11 within 15.4 kb regions that share 98.6% sequence identity (Figure 4A). Regions a and d are contained within the gene that produces the recently described 2.8 kb truRNA (Sharma et al. 2023) and region c is homologous to sequences within region e.

Since both the S2-type rRNA and the truRNA are rapidly upregulated by exposure to lower temperatures, we wanted to test whether the transcripts from regions a, b/d, c/e, or f might be similarly regulated. We detected substantial transcript being made from all regions (Figure 4A but found that only the regions overlapping with or downstream of the truRNA were cold-inducible while expression of PF3D7_1148100 was effectively unchanged (Figure 4B). Transcription of PF3D7_1148100 was also not sensitive to RNA Pol I inhibitors, while the inhibition patters for the other mirrored that of truRNA. While regions c/e and f had distinct steady state levels from the truRNA (Figure 4B), the fact that they exhibited highly similar upregulation in response to temperature shift and their susceptibility to RNA Pol I inhibitors lead us to wonder whether they might be transcribed from a single promoter prior to subsequent processing into fragments with variable stability. Indeed, we were able to amplify transcripts bridging from the truRNA to region c/e and from region c/e to region f but not from the truRNA to region f or from region f into the S2a rRNA (Figure 4E), supporting a single, rapidly processed transcript extending from the truRNA into region f. The truRNA itself was already shown to be processed from a 2.8 kb to a mature 1.3 kb (Sharma et al. 2023). We plan to use long-read RNA sequencing to map the full length transcript in future studies.

When combined with the inability to amplify a product bridging region f and the S2 transcript, the distinct inhibitor susceptibility patters of the upstream transcripts and the S2 strongly supports their transcription from distinct promoters (Figure 4D). Current annotations also include a non-coding RNA gene (PF3D7_0531500) immediately upstream of the region encoding the A2 18S rRNA on chromosome 5. However, this annotation should be removed as it is downstream of the A2 rRNA transcription start site and thus part to the A2 5’ETS of the (Fang, Sullivan, and McCutchan 2004).

P. falciparum lacks identifiable homologs to many RNA Pol I-specific components.

A search for components of Pol I found in mammals, budding yeast or the protozoan Trypanosoma brucei, found only orthologs to RPA1 and RPA2, the two subunits that form the catalytic core (Figure 5). While orthologs to the Pol I subunits shared with Pol II and Pol III were all present, none of Pol I-specific subunits could be identified. Promoter recognition by Pol I depends on distinct complexes in the these other systems (the SL1 complex in humans, CF complex in budding yeast and the CITFA complex in T.brucei) but again none of the Pol I specific components appear to be present in the malaria parasites. Pol I transcriptional machinery in malaria parasites therefor is either highly divergent or substantially reduced and warrants further investigation.

Funding:

This work was supported by Weill Cornell Medicine internal funds, NIAID R01AI141965 and NIAID R21AI166436 to BK. HS was supported by Weill Cornell ACCESS Summer Internship Program.

Data Availability Statement:

All Data are contained within the manuscript.

Figure 1. Growth inhibition of P. falciparum asexual blood stages by 9-HE (red) and BMH-21 (blue).

Half maximal effective concentration (EC50) ± SEM were calculated from 3 independent biological replicates 72-hour SYBR Green Growth assays. The inhibition curves shown are representative replicates with data points indicating the mean and SEM from 3 technical replicates.

Figure 2. Validation of 9-HE & BMH-21 as specific inhibitors of RNA Polymerase activity in P. falciparum.

(A) Growth at 26°C for 3 hours reduced transcription of A1 and A2 47S rRNA and greatly induces transcription of S2 47S rRNA and the long non-coding truRNA but has negligible effects on S1 47S rRNA, uce mRNA, and 5S rRNA transcription. Expression changes of RNA Pol I (turquois), Pol II (grey) and Pol III (red) transcription after 3 hour shift to 26°C relative to expression at 37°C were measured by qRT-PCR. To measure new transcription rather than steady state levels, primers were targeted to the 5’ETS of the 47S rRNAs, which are rapidly cleaved and degraded. (B) Concurrent treatment of samples shown in a) with 12.8 μM 9-HE (left panel) or BMH-21 (right panel) inhibits transcription of RNA Pol I transcripts (turquois) but not RNA Pol II (grey) or RNA Pol III (red). The means and non-parametric 95% confidence intervals based on 3 biological replicates are shown throughout.

Figure 3. Inhibitor susceptibility of RNA Pol I transcription differs substantially between loci.

Transcription of A1, A2, S1, and S2 47S rRNA or truRNA in the presence of five different concentrations of 9-HE (A) or BMH-21 (B) was measured by qRT-PCR and compared to solvent control (dotted line). Bars indicate the mean change relative to solvent control, the error bars indicate the 95% confidence interval and the numerical values shown are the mean half-maximal concentrations (IC50) based on 3 independent biological replicates.

Figure 4. Regulation of S2-locus associated lncRNAs.

(A) Organization of the S2a and S2b rRNA loci (purple) on chromosomes 13 and 11 along with annotated upstream non-coding RNAs. Six regions (a/b/c on chr. 11 and d/e/f on chr. 13) are annotated as non-coding RNA genes PF3D7_1148100/200/300 and PF3D7_1370500/600/700, respectively, in the current version of PlasmoDB (release 68). Of these, regions b-f fall within a 15 kb span of very high homology (grey) while region a is only found on chromosome 11 immediately upstream. Regions b and d (orange) are contained within the gene that produces the recently described 2.8 kb truRNA. The nearest protein coding genes are indicated in black. (B) Transcript levels relative to seryl-tRNA-synthase. (C) Change in expression from regions a-f and S2 rRNA after a 3 hour shift to 26°C. (D) Transcription from regions a-f and S2 rRNA in the presence of five diLerent concentrations of 9-HE (top) and BMH-21 (bottom) was measured by qRT-PCR and compared to solvent control (dotted line). (E) RT-PCR products from primers spanning the indicated regions amplifying cDNA from the solvent control sample. Expected size are indicated below each lane and primers targeting the nascent S2 47S rRNA were used a positive control. Amplification from a “no RT” control yielded no products (not shown). All bars indicate the mean and the error bars show the 95% confidence interval based on 3 independent biological replicates.

Figure 5. P. falciparum lacks identifiable homologs to many RNA Pol I-specific components.

Subunits specific to RNA Polymerase I holoenzyme or the promoter recognition complexes are shown in yellow, those shared with RNA Pol III in green, and those shared by RNA Pol I, II and III in purple. Black names indicate subunits with identifiable orthologs in P. falciparum while no clear ortholog exists for those with red names.

Table 1: List of primers used in this study.

Primer	Sequence	Strand	Gene(s)	binds within	
	
BKO_2666	TTGGTATATGCAAAAATTAATATGTTT	F	A1 47S rRNA	5’ ETS	
BKO_2667	TAATTCTATGAAAAGACATAGAACAC	R	A1 47S rRNA	5’ ETS	
BKO_2668	TTCGCTAATATTGGAAAATTCAG	F	A2 47S rRNA	5’ ETS	
BKO_2669	CATTTGATGTTTTATTAATGTTATTATCTT	R	A2 47S rRNA	5’ ETS	
BKO_2670	CATCAATTGGCGTTGTCGTTT	F	S1 47S rRNA	5’ ETS	
BKO_2671	AACGATTAAACACACTATCAC	R	S1 47S rRNA	5’ ETS	
BKO_2672	TACGTACAAAGTACAAACTTA	F	S2a/b 47S rRNA	5’ ETS	
BKO_2673	ATGAAAAACTCATATTACATATTC	R	S2a/b 47S rRNA	5’ ETS	
BKO_2674	ATGAAAAAGACTACGTCATATAT	F	truRNA a/b, PF3D7_1148200, PF3D7_1370700		
BKO_2675	TTAATGATTGAGTTTGTTATACTT	R	truRNA a/b, PF3D7_1148200, PF3D7_1370700		
BKO_2322	GGTGTTAGTGGCTCACCAATAGGA	F	PF3D7_0812600, ubiquitin-conjugating enzyme	CDS	
BKO_2323	GTACCACCTTCCCATGGAGTA	R	PF3D7_0812600, ubiquitin-conjugating enzyme	CDS	
BKO_2697	TCGTTCATACTACAGTGGCCA	F	5S rRNA		
BKO_2698	GGTGTTCCCGAGCGGTCT	R	5S rRNA		
BKO_1626	AAGTAGCAGGTCATCGTGGTT	F	PF3D7_0717700, seryl-tRNA synthetase	CDS	
BKO_1627	TTCGGCACATTCTTCCATAA	R	PF3D7_0717700, seryl-tRNA synthetase	CDS	
BKO_2733	ACATTTTGGGAAGCAAATTTACCA	F	PF3D7_1148100		
BKO_2734	CATCCCAATCATGTGTTCAATTAAAA	R	PF3D7_1148100		
BKO_2735	TCAGATTTACAAATTGAACAAGATTCA	F	PF3D7_1148300 / PF3D7_1370800		
BKO_2736	TCAATTTACATAAACTTACACATGGA	R	PF3D7_1148300 / PF3D7_1370800		
BKO_2737	TGAACGAATATGTGCAGTTATACA	F	PF3D7_1370900		
BKO_2738	TCCAAGGTTAATACACAAATATATTTCT	R	PF3D7_1370900		
BKO_2694	CAAAAATTGGCCTTGCATTGTT	R	A-type (A1/A2) 47S rRNA	18S	
BKO_2696	GCAGTAGTCCGTCTCCAGAA	R	S-type (S1/S2a/S2b) 47S rRNA	18S	

Conflicts of Interest:

The authors declare no conflicts of interest.
==== Refs
REFERENCES

Andrews William J. , Panova Tatiana , Normand Christophe , Gadal Olivier , Tikhonova Irina G. , and Panov Konstantin I. . 2013. “Old Drug, New Target: ELLIPTICINES SELECTIVELY INHIBIT RNA POLYMERASE I TRANSCRIPTION.” The Journal of Biological Chemistry 288 (7 ): 4567–82.23293027
Aubert Maxime , O’Donohue Marie-Françoise , Lebaron Simon , and Gleizes Pierre-Emmanuel . 2018. “Pre-Ribosomal RNA Processing in Human Cells: From Mechanisms to Congenital Diseases.” Biomolecules 8 (4 ): 123.30356013
Bénard J. , Dat-Xuong N. , and Riou G. . 1975. “Trypanocidal activity of some ellipticine derivatives against Trypanosoma cruzi cultured in vitro.” Comptes rendus hebdomadaires des seances de l’Academie des sciences. Serie D: Sciences naturelles 280 (9 ): 1177–80.
Bensaude Olivier . 2011. “Inhibiting Eukaryotic Transcription: Which Compound to Choose? How to Evaluate Its Activity?” Transcription 2 (3 ): 103–8.21922053
Cooper Geoffrey M. 2000. Translation of MRNA. Sinauer Associates.
Elcock A. H. , Rodger A. , and Richards W. G. . 1996. “Theoretical Studies of the Intercalation of 9-Hydroxyellipticine in DNA.” Biopolymers 39 (3 ): 309–26.8756512
Fang Jun , and McCutchan Thomas F. . 2002. “Thermoregulation in a Parasite’s Life Cycle.” Nature 418 (6899 ): 742.12181557
Fang Jun , Sullivan Margery , and McCutchan Thomas F. . 2004. “The Effects of Glucose Concentration on the Reciprocal Regulation of RRNA Promoters in Plasmodium Falciparum.” The Journal of Biological Chemistry 279 (1 ): 720–25.14570919
Fox George E. 2010. “Origin and Evolution of the Ribosome.” Cold Spring Harbor Perspectives in Biology 2 (9 ): a003483.20534711
Goodfellow Sarah J. , and Zomerdijk Joost C. B. M. . 2013. “Basic Mechanisms in RNA Polymerase I Transcription of the Ribosomal RNA Genes.” Sub-Cellular Biochemistry 61 : 211–36.23150253
Hughes J. M. , and Ares M. Jr . 1991. “Depletion of U3 Small Nucleolar RNA Inhibits Cleavage in the 5’ External Transcribed Spacer of Yeast Pre-Ribosomal RNA and Impairs Formation of 18S Ribosomal RNA.” The EMBO Journal 10 (13 ): 4231–39.1756730
Hwang Sseu-Pei , and Denicourt Catherine . 2024. “The Impact of Ribosome Biogenesis in Cancer: From Proliferation to Metastasis.” NAR Cancer 6 (2 ): zcae017.38633862
Jacobs Ruth Q. , Huffines Abigail K. , Laiho Marikki , and Schneider David A. . 2022. “The Small-Molecule BMH-21 Directly Inhibits Transcription Elongation and DNA Occupancy of RNA Polymerase I in Vivo and in Vitro.” The Journal of Biological Chemistry 298 (1 ): 101450.34838819
Johnson Jacob D. , Dennull Richard A. , Gerena Lucia , Lopez-Sanchez Miriam , Roncal Norma E. , and Waters Norman C. . 2007. “Assessment and Continued Validation of the Malaria SYBR Green I-Based Fluorescence Assay for Use in Malaria Drug Screening.” Antimicrobial Agents and Chemotherapy 51 (6 ): 1926–33.17371812
Kang Jian , Brajanovski Natalie , Chan Keefe T. , Xuan Jiachen , Pearson Richard B. , and Sanij Elaine . 2021. “Ribosomal Proteins and Human Diseases: Molecular Mechanisms and Targeted Therapy.” Signal Transduction and Targeted Therapy 6 (1 ): 323.34462428
Kerry Louise E. , Pegg Elaine E. , Cameron Donald P. , Budzak James , Poortinga Gretchen , Hannan Katherine M. , Hannan Ross D. , and Rudenko Gloria . 2017. “Selective Inhibition of RNA Polymerase I Transcription as a Potential Approach to Treat African Trypanosomiasis.” PLoS Neglected Tropical Diseases 11 (3 ): e0005432.28263991
Laham-Karam Nihay , Pinto Gaspar P. , Poso Antti , and Kokkonen Piia . 2020. “Transcription and Translation Inhibitors in Cancer Treatment.” Frontiers in Chemistry 8 (April ): 276.32373584
McGee James P. , Armache Jean-Paul , and Lindner Scott E. . 2023. “Ribosome Heterogeneity and Specialization of Plasmodium Parasites.” PLoS Pathogens 19 (4 ): e1011267.37053161
Moll K. , Ljungström I. , Perlmann H. , and Scherf A. . 2008. “Methods in Malaria Research.” Manassas, January. http://kisefront02.ki.se/sites/default/files/methods_in_malaria_research.pdf.
Montoia Andreia , Silva Luiz F. Rocha E , Torres Zelina E. , Costa David S. , Henrique Marycleuma C. , Lima Emerson S. , Vasconcellos Marne C. , 2014. “Antiplasmodial Activity of Synthetic Ellipticine Derivatives and an Isolated Analog.” Bioorganic & Medicinal Chemistry Letters 24 (12 ): 2631–34.24813729
Moss T. , and Stefanovsky V. Y. . 1995. “Promotion and Regulation of Ribosomal Transcription in Eukaryotes by RNA Polymerase I.” Progress in Nucleic Acid Research and Molecular Biology 50 : 25–66.7754036
Petrov Anton S. , Gulen Burak , Norris Ashlyn M. , Kovacs Nicholas A. , Bernier Chad R. , Lanier Kathryn A. , Fox George E. , 2015. “History of the Ribosome and the Origin of Translation.” Proceedings of the National Academy of Sciences of the United States of America 112 (50 ): 15396–401.26621738
Rodríguez-Almonacid Cristian Camilo , Kellogg Morgana K. , Karamyshev Andrey L. , and Karamysheva Zemfira N. . 2023. “Ribosome Specialization in Protozoa Parasites.” International Journal of Molecular Sciences 24 (8 ). 10.3390/ijms24087484.
Rogers M. J. , Gutell R. R. , Damberger S. H. , Li J. , McConkey G. A. , Waters A. P. , and McCutchan T. F. . 1996. “Structural Features of the Large Subunit RRNA Expressed in Plasmodium Falciparum Sporozoites That Distinguish It from the Asexually Expressed Subunit RRNA.” RNA 2 (2 ): 134–45.8601280
Sáez-Vásquez Julio , and Delseny Michel . 2019. “Ribosome Biogenesis in Plants: From Functional 45S Ribosomal DNA Organization to Ribosome Assembly Factors.” The Plant Cell 31 (9 ): 1945–67.31239391
Sharma Indu , Fang Jun , Lewallen Eric A. , Deitsch Kirk W. , and McCutchan Thomas F. . 2023. “Identification of a Long Noncoding RNA Required for Temperature Induced Expression of Stage-Specific RRNA in Malaria Parasites.” Gene 877 (August ): 147516.37286021
Smilkstein Martin , Sriwilaijaroen Nongluk , Kelly Jane Xu , Wilairat Prapon , and Riscoe Michael . 2004. “Simple and Inexpensive Fluorescence-Based Technique for High-Throughput Antimalarial Drug Screening.” Antimicrobial Agents and Chemotherapy 48 (5 ): 1803–6.15105138
Teng Teng , Thomas George , and Mercer Carol A. . 2013. “Growth Control and Ribosomopathies.” Current Opinion in Genetics & Development 23 (1 ): 63–71.23490481
Warner J. R. , Vilardell J. , and Sohn J. H. . 2001. “Economics of Ribosome Biosynthesis.” Cold Spring Harbor Symposia on Ǫuantitative Biology 66 (0 ): 567–74.
Waters A. P. , van Spaendonk R. M. , Ramesar J. , Vervenne R. A. , Dirks R. W. , Thompson J. , and Janse C. J. . 1997. “Species-Specific Regulation and Switching of Transcription between Stage-Specific Ribosomal RNA Genes in Plasmodium Berghei.” The Journal of Biological Chemistry 272 (6 ): 3583–89.9013609
Waters A. P. , Syin C. , and McCutchan T. F. . 1989. “Developmental Regulation of Stage-Specific Ribosome Populations in Plasmodium.” Nature 342 (6248 ): 438–40.2586613
Yang Yoon-Mo , and Karbstein Katrin . 2024. “Ribosome Assembly and Repair.” Annual Review of Cell and Developmental Biology, May. 10.1146/annurev-cellbio-111822-113326.
Zhu J. D. , Waters A. P. , Appiah A. , McCutchan T. F. , Lal A. A. , and Hollingdale M. R. . 1990. “Stage-Specific Ribosomal RNA Expression Switches during Sporozoite Invasion of Hepatocytes.” The Journal of Biological Chemistry 265 (21 ): 12740–44.2373710
