
==== Front
Jt Dis Relat Surg
Jt Dis Relat Surg
Joint Diseases and Related Surgery
2687-4784
2687-4792
Bayçınar Medical Publishing

10.52312/jdrs.2024.1247
39189559
Original Article
Estrogen receptor is involved in the osteoarthritis mediated by ATG16L1-NLRP3 activation
Liao Fa-Xue http://orcid.org/0009-0006-9667-895X
12
Yang Shuo http://orcid.org/0009-0007-1268-1594
12
Liu Zhi-Hong http://orcid.org/0009-0003-6720-4112
12
Bo Kai-Da http://orcid.org/0009-0000-5784-0236
12
Xu Peng-Fei http://orcid.org/0009-0007-8114-0636
12
Chang Jun http://orcid.org/0009-0002-6254-7872
12
1 Department of Orthopedics, the First Affiliated Hospital, Anhui Medical University, Hefei, China
2 Anhui Public Health Clinical Center, Hefei, China
Jun Chang, MD. Department of Orthopedics, the First Affiliated Hospital of Anhui Medical University, Hefei, 230000, China changjun2024@126.com.
9 2024
08 7 2024
35 3 513520
08 6 2023
14 5 2024
Copyright © 2024, Turkish Joint Diseases Foundation
2024
Turkish Joint Diseases Foundation
https://creativecommons.org/licenses/by-nc/4.0/ This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.
Objectives

This study aims to explore the mechanisms of dual regulation of osteoarthritis (OA) progression by the involvement of estrogen receptor (ER) in autophagy and inflammation.

Materials and methods

Bioinformatics methods were used to explore the relationship among associated genes. Western blot assays were used to detect related protein expression of OA in C28I2 and induced OA cellular model. Real-time quantitative polymerase chain reaction (RT-qPCR) analysis were used to detect OA related gene expression in C28I2 and induced OA cellular model. Co-immunoprecipitation (CO-IP) analysis were used to verify the direct interaction between ER and NOD-like receptor thermal protein domain associated protein 3 (NLRP3).

Results

The C28I2 cellular model of OA was induced by interleukin-1β (IL-1β). The small interfering ribonucleic acid (SiRNA)-mediated knockdown of autophagy-related 16 like 1 (ATG16L1) in C28I2 decreased the expression of MAP1LC3B (LC3B) and NLRP3. Besides, ER-beta (ERβ) agonist changed the gene expression of NLRP3 and ATG16L1. Moreover, CO-IP analysis indicated the direct interaction between ER and NLRP3.

Conclusion

Our study results revealed that ATG16L1, NLRP3, and IL-1β interacted closely and ERβ was involved in OA process by affecting autophagy and inflammatory activation.

ATG16L1
estrogen receptor
interleukin-1 beta
NLRP3
osteoarthritis.
==== Body
pmcIntroduction

Osteoarthritis (OA) is a degenerative joint disease caused by cartilage degeneration, resulting in weight-bearing joint dysfunction,[1] high disability rate, and poor postoperative results, affecting more than 300 million individuals worldwide.[2,3] Currently, early treatment of OA is focused on symptomatic relief, while the preferred treatment option for patients with end-stage disease is total knee arthroplasty. However, one-third of patients still have residual symptoms after surgery and fail to achieve a satisfactory clinical outcome. Recent studies have demonstrated that the pathogenesis of OA is cartilage degeneration caused by long-term loading of the joint, genetics and low-intensity inflammation.[4,5] Clarifying the relevant molecular roles involved in the degenerative process is of utmost importance for the effective prevention and treatment of OA.

Chondrocytes, as the unique type of cell in cartilage tissue, can express a variety of receptor proteins associated with innate immunity, and produce inflammatory and catabolic mediators, which promote local chronic inflammation in arthrosis, and ultimately induce cartilage aging and degeneration.[6] However, the refined molecular mechanism of the degeneration development is not acclaimed. Interleukin-1 beta (IL-1β) is important in the process of cartilage senescence and degeneration, as it not only directly participates in cartilage degeneration, but also drives the chondrocyte inflammatory cascade.[7] Nevertheless, in clinical and animal experiments, local treatment of OA with IL-1β inhibitors has not achieved convincing results yet.[8,9]

The NOD-like receptor thermal protein domain associated protein 3 (NLRP3) expression was identified to be enhanced in human and mouse OA cartilage, and by blocking NLRP3 expression in mice, cartilage degeneration and chondrocyte damage could be attenuated and cartilage degeneration prevented.[10] The NLRP3 inflammasome is a key cytoplasmic sensor in innate immunity, which is a filamentous signaling platform composed of the sensor protein NLRP3, the adaptor protein apoptosis-associated speck-like protein (ASC) and the protease Caspase-1.[11,12] The NLRP3 and ASC is combined to recruit pro-caspase-1 forming a complex and generates biologically active caspase-1, which acts on the pro-IL-1β inflammatory factor precursor to activate IL-1β. Therefore, activation of the NLRP3 inflammasome may be a capable marker of OA development.

Recently, autophagy may be involved in the entire process of chondrocyte senescence and related to NLRP3 inflammatory vesicles, in which the autophagy-like protein autophagyrelated 16 like 1 (ATG16L1) as s major participants in autophagy encoded by the autophagy gene is a pivotal component in the formation of the ATG16L1-Atg5-Atg12 complex, which can also recruit MAP1LC3 (LC3) protein to regulate the initiation and maturation of autophagosomes.[13,14] Estrogen receptor (ER) α and β genes have shown expression in human chondrocytes, which affect osteoblasts through the NLRP3/Caspase-1 pathway, and the risk of OA occurrence and progression and improves its clinical symptoms can be reduced by estrogen replacement therapy.[15,16] Self-reported OA showed 46% and 21% of women and men aged 45 years and over in the region, respectively indicating the sexual dimorphism effect of OA and the potential effectiveness of estrogen therapy. [17] However, dual regulation of ER in OA process through autophagy and inflammasome activation has not been reported, which needs further investigation.

In the present study, we hypothesized that whether ER acted on autophagy-like protein ATG16L1 to activate NLRP3 inflammasome directly and affected the process of OA cartilage degeneration. We, therefore, aimed to explore the mechanisms of dual regulation of OA progression by the involvement of ER in autophagy and inflammation.

Patients and Methods

Study design

The Western blot, real-time quantitative polymerase chain reaction (RT-qPCR) and immunofluorescence assays were performed in Human Chondrocyte Cell Line (C28/I2) and its induced OA cell models. Experiments were performed in triplicate and repeated three times with similar results.

Pathway analysis

The STRING database collected multiple public databases, including Kyoto Encyclopedia of Genes and Genomes (KEGG), National Center for Biotechnology Information (NCBI) and Gene Ontology, integrated these data to generate a comprehensive protein-protein interaction network database. The STRING database provides visualization of protein interaction networks, and information on protein families, pathways, and subcellular localization. The Welch’s t-test was applied to investigate the significantly interactions between ATG16L1, NLRP3 and IL-1β. Cytoscape 3.9.1 was used for network diagrams creation of functional pathway, possible extracellular and extracellular signaling pathways. Imported STRING database interaction analysis data, where node1 and node2 are a pair of nodes and the combined score is the interaction score. Then, perform node and network analyzed of imported data were selected. When the size of node as a continuous variable is changed with more interaction lines between nodes, the node becomes larger. Besides, the strength of interaction between nodes is reflected by the combined score.

Cell culture and treatment

The C28/I2 cell line was a kindly gift from Doctor Huiyao Lan. This cell line was cultured in 10 cm culture dishes with F12 medium (GIBCO, USA) with 10% fetal bovine serum (Sijiqing Biological Engineering Materials Co., Hangzhou, China). Cells were stimulated with the indicated amount of recombinant human IL-1β (PeproTech, DE, USA) for 12 h with serum-starved, when approximately 50% confluence was reached, and followed by incubation with recombinant TGF-β1 (10 ng/mL; R&D Systems, Minneapolis, MN, USA) for the indicated time period.

Western blot and immunoprecipitation

The cells were washed with ice-cold phosphate-buffered saline (PBS) and were solubilized in lysis buffer complemented with protease inhibitors and centrifuged at 12,000 rpm for 15 min at 4°C. The protein concentration of the supernatant was determined by bicinchoninic acid assay (BCA) assay kit (Epizyme Biotech, Shanghai, China). For Western blotting, 20 to 30μg of protein was separated in 7.5 to 12% acrylamide Sodium dodecyl sulfate - polyacrylamide gel electrophoresis (SDS-PAGE) gel (Epizyme Biotech, Shanghai, China), and proteins were detected using the primary antibodies and horseradish peroxidase-conjugated secondary antibodies. Protein expression levels were visualized by enhanced chemiluminescence. Antibody information is summarized in Table I.

Table 1 List of antibodies used in this experiment

Antibodies	Source	Dilution	
NLRP3	Abcam (ab15101)	1:1000 for WB, 1:100 for IF	
ER-a	Proteintech (21244-1-AP)	1:800 for WB, 1:100 for IF	
ER-b	Proteintech (14007-1-APC)	1:800 for WB	
LC-3B	Abcam (ab192890)	1:1000 for WB	
MMP	Abcam (ab134184)	1:1000 for WB	
Atg16L1	Abcam (ab187671)	1:1000 for WB	
TNF-a	Abcam (ab66579)	1:1000 for WB	
GAPDH	Cell Signaling Technology (5174)	1:1000 for WB	
NLRP3: NOD-like receptor thermal protein domain associated protein 3; ER: Estrogen receptor; MMP13: Matrix metalloproteinase 13; ATG16L1: Autophagy-related 16 like 1; TNF-a: Tumor necrosis factor alpha; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.	

For immunoprecipitation, the sample with 700 μg of protein was diluted to 1 mg/mL in non-denaturing lysis buffer with protease inhibitors, of which 60 μL was taken out as input. A total of 20 μL of protein A/G Magnetic Beads was washed by washing buffer three times and mixed with respective antibodies on a rotating platform at room temperature for 30 min. The precipitate was incubated with remaining lysate overnight at 4°C. Beads were, then, washed three times with washing buffer and boiled for 5 min with 1x loading dye. The supernatant obtained after centrifugation was analyzed using the Western blot assay.

RT-qPCR

Total ribonucleic acid (RNA) was converted to complementary deoxyribonucleic acid (cDNA) using a one-step reverse transcription PCR kit according to the manufacturer's instructions. The cDNA was subject to qPCR amplification using the CFX96 RT-PCR detection system (Bio-Rad, Hercules, California, USA). Primer sequences are included in Table II.

Table 2 List of primers used in this experiment

Primer name	Sequence (5-3’)	Primer	
NLRP3	GATCTTCGCTGCGATCAACAG	Forward primer	
CGTGCATTATCTGAACCCCAC	Reverse primer	
Atg16L1	AACGCTGTGCAGTTCAGTCC	Forward primer	
AGCTGCTAAGAGGTAAGATCCA	Reverse primer	
GAPDH	GGAGCGAGATCCCTCCAAAAT	Forward primer	
GGCTGTTGTCATACTTCTCATGG	Reverse primer	
NLRP3: NOD-like receptor thermal protein domain associated protein; ATG16L1: Autophagy-related 16 like 1; GAPDH: Glyceraldehyde-3-phosphate dehydrogenase.	

Immunofluorescence

The cells in the treated and untreated groups were fixed in 4% paraformaldehyde solution for 20 min, washed three times with PBS, permeabilized with 0.5% Triton X-100 for 5 min, and washed three times with PBS. The cells were closed with immunofluorescence blocking solution for 30 min at room temperature, incubated overnight with anti-ER primary antibody and anti-NLRP3 primary antibody (1:100), washed three times with PBS and incubated for 60 min with secondary antibody (1:100), washed three times with PBS, and nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min, and washed three times with PBS.

Statistical analysis

Statistical significance was calculated with a one-way ANOVA corrected for multiple comparisons. Statistical analyses were performed on GraphPad Prism version 9 (GraphPad Software, La Jolla, CA, USA). The Student t-test was used to compare variables between the groups. A p value of <0.05 was considered statistically significant.

Results

ER-ATG16L1-NLRP3 signaling pathway and interaction analysis with bioinformatics software

To detect the effect of ATG16L1 gene on NLRP3 in the pathogenesis of OA, bioinformatics methods were employed for the interaction and pathway analysis, and interactions among ATG16L1, NLRP3, and IL-1β were discovered. These genes constitute a complete functional pathway and possible extracellular and extracellular signaling pathways were speculated: Nucleotide-binding domain leucine-rich receptor signaling pathway and NF-κB signaling pathway, which significantly induced the expression of inflammatory cytokines; i.e., IL-1β and IL-1 (Figure 1).

Figure 1 Analysis of the relationship between Atgl6L1 and NLRP3 using bioinformatics software.<br> Atg16L1: Autophagy-related 16 like 1; NLRP3: NOD-like receptor thermal protein domain associated protein.

Effects of ER for autophagy and inflammation proteins

The increased expression of inflammatory protein was detected after the IL-1β treatment in C28I2 cells (Figure 2). The expression differences of ER were exhibited between normal and inflammatory cell groups. After treatment with selective ER-α (A) and β (B) agonist, the decreased expression of related autophagy and inflammatory proteins were detected. Besides, the estrogen α and β receptor agitator agonist treatment induced the different decreased degree of related autophagy and inflammatory protein expression, which indicated the effect of ER on OA process.

Figure 2 The expression of autophagy and inflammatory related proteins before and after ER intervention. NLRP3, MMP1, TNF-&alpha;, AtgI6L1, LC3B, ER-&alpha; and ER-&beta; were involved in western blot analysis.<br>ER: Estrogen receptor; NLRP3: NOD-like receptor thermal protein domain associated protein; MMP1: Matrix metalloproteinase 1; TNF-&alpha;: Tumor necrosis factor alpha; AtgI6L1: Autophagy-related 16 like 1; LC3B: Light chain 3 beta; ER-&alpha;: Estrogen receptor-alpha; ER-&beta;:Estrogen receptor-beta.

Effects of siRNA-mediated knockdown of ATG16L1 for autophagy and inflammation proteins

As showed in Figure 3a, the fluorescence intensities of ATG16L1 decreased after transfection, which was consistent with results of Western blot. Besides, compared to the model group, both NLRP3 and LC3B expressions were reduced (Figure 3b), indicating the regulatory role of ATG16L1 on autophagy and inflammation process in C28I2 cells.

Figure 3 The expression of autophagy and inflammatory related proteins before and after Atg16L1 protein silencing treatment. (a) LC3B, Atgl6L1 and NLRP3 were involved in WB analysis; (b) The expression Atg16L1 was detected by Confocal laser analysis.<br> LC3B: Light chain 3 beta; Atg16L1: Autophagy-related 16 like 1; NLRP3: NOD-like receptor thermal protein domain associated protein; GAPDH: Glyceraldehyde-3- phosphate dehydrogenase; DAPI: Diamidino-2-phenylindole; Ctrl: Control; Si-Atg16L1: SiRNA-Autophagy-related 16 like 1.

Direct protein-protein interaction by ER and NLRP3

The RT-qPCR analysis exhibited the increased gene expression of ATG16L1 and NLRP3 after treated with IL-1β in C28I2 cells. However, in the IL-1β and ER-β agonist combined treatment group, the expression of ATG16L1 was upregulated with a downregulated expression change for NLRP3 (Figure 4a). Further CO-IP analysis confirmed the direct interaction between ER and NLRP3 protein (Figure 4b), which indicated the effect of ER β on autophagy and inflammation process.

Figure 4 The effect of ER on the related gene expression and the direct interaction between ER and NLRP3. (a) Atg16L1 and NLRP3 were involved in RT-qPCR analysis; (b) The direct interaction between ER and NLRP3 was implied by CO-IP analysis.<br> Atg16L1: Autophagy-related 16 like 1; Ctrl: Control; NLRP3: NOD-like receptor thermal protein domain associated protein; IP: Immunoprecipitation; ER: Estrogen receptor; RT-qPCR: Real-time quantitative polymerase chain reaction.

Discussion

Autophagy is the central mechanism that modulates homeostasis, participating in the progress of multiple diseases including OA with increasingly attention and is negatively correlated with the NLRP3 inflammasome.[18,19] The enhancement of the autophagy response in Wistar rats not only enhances the expression of autophagy proteins such as LC3B, but also inhibits the expression of NLRP3 and its mediated secretion of IL-1β.[20]

Through the enrichment analysis of biological informatics pathway and cell biology experiments, we revealed that autophagy protein ATG16L1 played a critical role in the onset of OA. The cell autophagy takes part in the metabolic regulation of chondrocytes in the entire process. In the early stage of OA, cell autophagy acts on joint cartilage as a protective effect; however, in the late OA stage, excessive autophagy induces cartilage cell death,[21] which provides new insights into exploring the intervention of OA. Based on the crucial importance of autophagy, improving OA in regulation of cell autophagy could be beneficial. Recently, Vinatier et al.[22] revealed that autophagy, a protective mechanism in normal cartilage to avoid cell death driven by aging and trauma, was engaged in the OA cartilage aging and degeneration. Chen et al.[23] proposed that autophagy was a cellular homeostasis mechanism that clear dysfunctional organelles and macromolecules, which alleviate OA and delay joint aging by activating chondrocyte autophagy. Zuo et al.[24] validated that chondrocyte autophagy modulated the generation of reactive oxygen species (ROS) in chondrocytes and the expression of OA-related proteins: Aggrecan, collagen type 2 alpha 1 (COL2A1), matrix metalloproteinase 13 (MMP13), recombinant A disintegrin and metalloproteinase with thrombospondin 5 (ADAMTS5). Cai et al.[25] confirmed the coexistence of autophagy and apoptosis in the cell death of chondrocytes. Briefly, moderate autophagy is beneficial to the human body with the function of obliterating mitochondria damaged by ROS and maintaining the cell morphology of chondrocytes and other cells. Furthermore, the activation of NLRP3 can be induced with the defective autophagy, which promoted the production of ROS, accumulation of damaged mitochondria and release of mitochondrial DNA. From previously published studies, the internal biological clocks in the chondrocytes have dramatic influence on the cartilage repair and remodeling. Knockout of the clock associated genes improve antioxidants enzyme activity, mitigate the generation of ROS to restore autophagy, and attenuate the aging of chondrocytes.[26] Transcription factor EB (TFEB) is the main regulator of the autophagy flux with initiation of autophagy related genes lysosomal biogenesis.[27] However, little is known about its relevance with autophagy protein ATG16L1, which may be a potential target for the treatment of OA.

By exploring the expression of autophagy-like protein ATG16L1 in chondrocytes in vitro, we confirmed that ER acts on ATG16L1 to mediate autophagy. Further CO-IP analysis confirmed the direct interaction between ER and NLRP3 protein, which indicated the effect of ER-β on autophagy and inflammation process. Estrogen is a major steroid hormone that plays a crucial role in regulating many physiological functions, including cell growth, differentiation, metabolism, and death. Since the early 20th century, studies have demonstrated that estrogen deficiency is inseparable from OA, and ER α and β genes are expressed in human chondrocytes, indicating that articular cartilage is one of the target tissues of estrogen.[15] Moreover, estrogen replacement therapy can reduce the occurrence of OA, alleviate its development, and improve its clinical symptoms. Different subtypes of ER inhibitors differentiated on autophagy and inflammation-related protein expression, among which the augment in ER-α expression have significant relevance with the aging and degeneration and negatively correlated with proliferative chondrocytes.[28] In addition to ERs α and β, ER-γ directly induce the expression of MMP3 and MMP13 in articular chondrocytes, which is critical for cartilage destruction. The ER gamma (ER-γ) is a novel catabolic regulator of OA pathogenesis and may also regard as a therapeutic target for OA.[29] In addition, miR-203 combines and negatively regulates ER-α in postmenopausal OA rats, resulting in cellular inflammation and cartilage destruction. After ovariectomy, the expression of miR-140-5p levels is significantly attenuated.[30] Therefore, miRNA can be a therapeutic target for women with OA. The expression of ER protein affects the expression of autophagy and inflammation-related proteins, and different subtypes of receptors can also participate in OA through disparate pathways. Further investigation should focus on the chondrocyte autophagy-like protein ATG16L1 and miRNA as a promising target for OA therapy.

In conclusion, through bioinformatics methods and molecular biology experiments, we demonstrate that through autophagy and inflammasome activation ER modulate the progress of OA, which are connected by the autophagy-like protein ATG16L1 in articular cartilage degeneration. Although several works have been completed, we still need to investigate the role of inflammation in OA autophagy process, The direct interaction between ER and NLRP3 also needs to be confirmed by other methods. In addition, autophagy is closely bound up with OA and there are plentiful potential targets for further exploration.

Acknowledgments

We would like to thank the scientific research project of Anhui Province Health Commission (No.AHWJ2021b112), the research fund of Anhui Institute of Translational Medicine (NO. 2022zhyx-C91) and the scientific research fund of Anhui Medical University (No.2022xkj201) for supporting the research of this project.

Financial Disclosure

This research was funded by the scientific research project of Anhui Province Health Commission (No. AHWJ2021b112), the research fund of Anhui Institute of Translational Medicine (NO. 2022zhyx-C91) and the scientific research fund of Anhui Medical University (No.2022xkj201) for supporting the research of this project.

Data Sharing Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Ethics Committee Approval: This project was approved by the ethics committee of Anhui Public Health Clinical Center (North District of The First Affiliated Hospital of Anhui Medical University) in accordance with the principles of the Declaration of Helsinki and Guide for the Care and Use of Laboratory Ani-mals (date: 02.29.2024, no: PJ-YX2024-014). The study was conducted in accordance with the principles of the Declaration of Helsinki.

Conflict of Interest: The authors declared no conflicts of interest with respect to the authorship and/or publication of this article.

Author Contributions: Writing-original draft, conceptualization, investigation, methodology, validation: F.X.L.; Investigation, methodology, formal analysis, resources, data curation: S.Y.; Software, formal analysis, visualization: Z.H.L.; Methodology, Investigation: K.D.B.; Formal analysis, validation, conceptualization: P.F.X.; Writing-review & editing, supervision, funding acquisition, conceptualization, project administration: J.C.

* The two authors contributed equally to this study.

>Citation: Liao FX, Yang S, Liu ZH, Bo KD, Xu PF, Chang J. Estrogen receptor is involved in the osteoarthritis mediated by Atg16L1- NLRP3 activation. Jt Dis Relat Surg 2024;35(3):513-520. doi: 10.52312/ jdrs.2024.1247.
==== Refs
1 Xiong A Li G Liu S Chen Y Xu C Weng J Anterolateral approach may be superior to posterolateral approach in controlling postoperative lower limb discrepancy in primary total hip arthroplasty: A singlecenter, retrospective cohort study Jt Dis Relat Surg 2023 34 32 41 10.52312/jdrs.2022.763 36700261
2 Wu L Zhao X Lu ZD Yang Y Ma L Li P Accuracy analysis of artificial intelligence-assisted three-dimensional preoperative planning in total hip replacement Jt Dis Relat Surg 2023 34 537 547 10.52312/jdrs.2023.1059 37750257
3 Wu D Wong P Guo C Tam LS Gu J Pattern and trend of five major musculoskeletal disorders in China from 1990 to 2017: Findings from the Global Burden of Disease Study 2017 BMC Med 2021 19 34 34 10.1186/s12916-021-01905-w 33536019
4 Yoon DS Lee KM Choi Y Ko EA Lee NH Cho S TLR4 downregulation by the RNA-binding protein PUM1 alleviates cellular aging and osteoarthritis Cell Death Differ 2022 29 1364 1378 10.1038/s41418-021-00925-6 35034101
5 Calvo J Santiago L Arias M Pardo J Albareda J MartínezLostao L Granzyme-A deficiency attenuates experimental osteoarthritis in mice, but perforin deficiency does not Jt Dis Relat Surg 2023 34 271 278 10.52312/jdrs.2023.892 37462629
6 Rellmann Y Eidhof E Dreier R Review: ER stressinduced cell death in osteoarthritic cartilage Cell Signal 2021 78 109880 109880 10.1016/j.cellsig.2020.109880 33307190
7 Dubey NK Wei HJ Yu SH Williams DF Wang JR Deng YH Adipose-derived Stem Cells Attenuates Diabetic Osteoarthritis via Inhibition of Glycation-mediated Inflammatory Cascade Aging Dis 2019 10 483 496 10.14336/AD.2018.0616 31164994
8 Qiu WJ Xu MZ Zhu XD Ji YH MicroRNA-27a alleviates IL-1β-induced inflammatory response and articular cartilage degradation via TLR4/NF-κB signaling pathway in articular chondrocytes Int Immunopharmacol 2019 76 105839 105839 10.1016/j.intimp.2019.105839 31520995
9 Wang BW Jiang Y Yao ZL Chen PS Yu B Wang SN Aucubin protects chondrocytes against IL-1β-induced apoptosis in vitro and inhibits osteoarthritis in mice model Drug Des Devel Ther 2019 13 3529 3538 10.2147/DDDT.S210220
10 Ni B Pei W Qu Y Zhang R Chu X Wang Y MCC950, the NLRP3 Inhibitor, protects against cartilage degradation in a mouse model of osteoarthritis Oxid Med Cell Longev 2021 2021 4139048 4139048 10.1155/2021/4139048 34777685
11 Sharma M de Alba E Structure, activation and regulation of NLRP3 and AIM2 inflammasomes Int J Mol Sci 2021 22 872 872 10.3390/ijms22020872 33467177
12 Shao BZ Xu ZQ Han BZ Su DF Liu C NLRP3 inflammasome and its inhibitors: A review Front Pharmacol 2015 6 262 262 10.3389/fphar.2015.00262 26594174
13 Moss JJ Wirth M Tooze SA Lane JD Hammond CL Autophagy coordinates chondrocyte development and early joint formation in zebrafish FASEB J 2021 35 e22002 10.1096/fj.202101167R
14 Feng X Zhang H Meng L Song H Zhou Q Qu C Hypoxia-induced acetylation of PAK1 enhances autophagy and promotes brain tumorigenesis via phosphorylating ATG5 Autophagy 2021 17 723 742 10.1080/15548627.2020.1731266 32186433
15 Jin LY Guo C Xu S Liu HY Li XF The role of estrogen receptor α in response to longitudinal bone growth in ob/ ob mice Front Endocrinol (Lausanne) 2021 12 749449 749449 10.3389/fendo.2021.749449 34925230
16 Shi J Zhao W Ying H Zhang Y Du J Chen S Estradiol inhibits NLRP3 inflammasome in fibroblastlike synoviocytes activated by lipopolysaccharide and adenosine triphosphate Int J Rheum Dis 2018 21 2002 2010 10.1111/1756-185X.13198 29105345
17 Prieto-Alhambra D Judge A Javaid MK Cooper C Diez-Perez A Arden NK Incidence and risk factors for clinically diagnosed knee, hip and hand osteoarthritis: Influences of age, gender and osteoarthritis affecting other joints Ann Rheum Dis 2014 73 1659 1664 10.1136/annrheumdis-2013-203355 23744977
18 Xu F Hu QF Li J Shi CJ Luo JW Tian WC SOX4- activated lncRNA MCM3AP-AS1 aggravates osteoarthritis progression by modulating miR-149-5p/Notch1 signaling Cytokine 2022 152 155805 155805 10.1016/j.cyto.2022.155805 35202986
19 Huang L Su W Wu Z Zheng L Lv C Glucosamine suppresses oxidative stress and induces protective autophagy in osteoblasts by blocking the ROS/Akt/mTOR signaling pathway Cell Biol Int 2022 46 829 839 10.1002/cbin.11783 35191133
20 Zhu X Dai S Xia B Gong J Ma B Activation of the alpha 7 nicotinic acetylcholine receptor mitigates osteoarthritis progression by inhibiting NF-κB/NLRP3 inflammasome activation and enhancing autophagy PLoS One 2021 16 e0256507 10.1371/journal.pone.0256507
21 Kuwahara M Akasaki Y Kurakazu I Sueishi T Toya M Uchida T C10orf10/DEPP activates mitochondrial autophagy and maintains chondrocyte viability in the pathogenesis of osteoarthritis FASEB J 2022 36 e22145 10.1096/fj.202100896R
22 Vinatier C Domínguez E Guicheux J Caramés B Role of the inflammation-autophagy-senescence integrative network in osteoarthritis Front Physiol 2018 9 706 706 10.3389/fphys.2018.00706 29988615
23 Chen W Zheng H Zhang X Xu Y Fu Z Ji X Columbianetin alleviates lipopolysaccharides (LPS)- induced inflammation and apoptosis in chondrocyte through activation of autophagy by inhibiting serum and glucocorticoid-induced protein kinase 1 (SGK1) expression Bioengineered 2022 13 4051 4062 10.1080/21655979.2022.2032970 35129051
24 Zuo R Wang Y Li J Wu J Wang W Li B Rapamycin induced autophagy inhibits inflammation-mediated endplate degeneration by enhancing Nrf2/Keap1 signaling of cartilage endplate stem cells Stem Cells 2019 37 828 840 10.1002/stem.2999 30840341
25 Cai C Min S Yan B Liu W Yang X Li L MiR-27a promotes the autophagy and apoptosis of IL-1β treatedarticular chondrocytes in osteoarthritis through PI3K/ AKT/mTOR signaling Aging (Albany NY) 2019 11 6371 6384 10.18632/aging.102194 31460867
26 Zhong J Wang B Wu B Shang J Jiang N Cui A Clock knockdown attenuated reactive oxygen speciesmediated senescence of chondrocytes through restoring autophagic flux Life Sci 2021 269 119036 119036 10.1016/j.lfs.2021.119036 33450259
27 Zheng G Zhan Y Li X Pan Z Zheng F Zhang Z TFEB, a potential therapeutic target for osteoarthritis via autophagy regulation Cell Death Dis 2018 9 858 858 10.1038/s41419-018-0909-y 30154423
28 Hughbanks ML Rodriguez-Fontan F Kleck CJ BurgerVan der Walt E Estrogen receptor Alpha in human knee articular cartilage of healthy and osteoarthritic females J Orthop 2021 27 1 8 10.1016/j.jor.2021.08.005 34413582
29 Son YO Chun JS Estrogen-related receptor γ is a novel catabolic regulator of osteoarthritis pathogenesis BMB Rep 2018 51 165 166 10.5483/bmbrep.2018.51.4.019 29366446
30 Xu X Li X Liang Y Ou Y Huang J Xiong J Estrogen modulates cartilage and subchondral bone remodeling in an ovariectomized rat model of postmenopausal osteoarthritis Med Sci Monit 2019 25 3146 3153 10.12659/MSM.916254 31031401
