
==== Front
101573691
39703
Cell Rep
Cell Rep
Cell reports
2211-1247

39058590
10.1016/j.celrep.2024.114538
nihpa2019515
Article
Identification of the main barriers to Ku accumulation in chromatin
Bossaert Madeleine 124
Moreno Andrew T. 34
Peixoto Antonio 12
Pillaire Marie-Jeanne 12
Chanut Pauline 12
Frit Philippe 12
Calsou Patrick 12*
Loparo Joseph J. 3*
Britton Sébastien 125*
1 Institut de Pharmacologie et Biologie Structurale (IPBS), Université de Toulouse, CNRS, Université Toulouse III – Paul Sabatier (UT3), Toulouse, France
2 Equipe Labéllisée la Ligue contre le Cancer 2018
3 Department of Biological Chemistry and Molecular Pharmacology, Blavatnik Institute, Harvard Medical School, Boston, MA 02115, USA
4 These authors contributed equally
5 Lead contact
AUTHOR CONTRIBUTIONS

Investigation—generation of human cell models, immunoblotting, imaging, Ku foci quantification, flow cytometry, analysis, funding acquisition, and writing, M.B.; investigation—all experiments using Xenopus eggs extracts, analysis, and writing, A.T.M.; investigation—STORM acquisition and analysis and writing, A.P.; investigation—flow cytometry with the GFP reporters, analysis, and writing, M.-J.P.; investigation—generation of human cell lines, P.F.; investigation—Ku foci imaging, P. Chanut; investigation—immunoprecipitation from human cell extracts, chromatin fractionations from human cells, analysis, conceptualization, supervision, funding acquisition, and writing, P. Calsou; analysis, conceptualization, supervision, funding acquisition, and writing, J.J.L.; investigation—generated plasmids for human cell line investigations and flow cytometry analysis, conceptualization, supervision, funding acquisition, and writing, S.B.

* Correspondence: patrick.calsou@ipbs.fr (P.C.), joseph_loparo@hms.harvard.edu (J.J.L.), sebastien.britton@ipbs.fr (S.B.)
12 9 2024
27 8 2024
25 7 2024
19 9 2024
43 8 114538114538
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (https://creativecommons.org/licenses/by-nc-nd/4.0/).
SUMMARY

Repair of DNA double-strand breaks by the non-homologous end-joining pathway is initiated by the binding of Ku to DNA ends. Multiple Ku proteins load onto linear DNAs in vitro. However, in cells, Ku loading is limited to ~1–2 molecules per DNA end. The mechanisms enforcing this limit are currently unclear. Here, we show that the catalytic subunit of the DNA-dependent protein kinase (DNA-PKcs), but not its protein kinase activity, is required to prevent excessive Ku entry into chromatin. Ku accumulation is further restricted by two mechanisms: a neddylation/FBXL12-dependent process that actively removes loaded Ku molecules throughout the cell cycle and a CtIP/ATM-dependent mechanism that operates in S phase. Finally, we demonstrate that the misregulation of Ku loading leads to impaired transcription in the vicinity of DNA ends. Together, our data shed light on the multiple mechanisms operating to prevent Ku from invading chromatin and interfering with other DNA transactions.

In brief

The DNA end binding protein Ku can slide onto naked DNA, but this is limited in cells. Using human cells and Xenopus egg extracts, Bossaert, Moreno, et al. identify DNA-PKcs as the main structural barrier to Ku entry into chromatin, along with two active mechanisms that limit Ku accumulation in the absence of DNA-PKcs.

Graphical Abstract
==== Body
pmcINTRODUCTION

The DNA of living organisms is continuously exposed to endogenous and exogenous DNA damaging agents that induce a variety of DNA lesions.1 Among these lesions, DNA double-strand breaks (DSBs) are particularly toxic. Recognition of DSBs activates the DNA damage response (DDR)— an integrated response that blocks cell-cycle progression, activates a transcriptional program, and attempts to repair the lesion through several DNA repair mechanisms.1 In vertebrates, DSBs are recognized by two main sensors: the MRE11-RAD50-NBS1 complex (MRN) and the Ku complex, a ring-shaped heterodimer of Ku70-Ku80. MRN clamps onto the flank of the DNA end, recruits the ataxia-telangiectasia mutated (ATM) protein kinase, and possesses nuclease activities involved in the initiation of DNA end resection. In contrast, Ku accommodates one DNA end in its central cavity and protects it from unscheduled exonucleolytic processing.2,3 In addition to detecting and binding free DNA ends, Ku initiates non-homologous end joining (NHEJ), the main DSB repair pathway for two-ended DSBs, which tethers and ligates the two DNA ends together. Ku promotes NHEJ by serving as an assembly site for most of the NHEJ proteins, including the DNA-dependent protein kinase catalytic subunit (DNA-PKcs), the XRCC4-DNA ligase IV (LIG4) ligation complex, and the scaffold proteins XLF/Cernunnos and PAXX.4,5 The DNA-Ku-DNA-PKcs complex forms the active DNA-PK kinase that acts on numerous substrates, including itself, and is essential for the NHEJ-mediated repair of DNA ends that require processing.6–8

Ku is an abundant nuclear protein,9 with high affinity for DNA ends (binding constant of 2.4 nM).10 In vitro, multiple Ku molecules thread onto DNA from free ends, with the amount of Ku loading limited only by the size of the DNA fragment and the amount of available Ku.10,11 However, in cells, on average, only 2–3 Ku molecules are found at DSBs (~1 per end),12 indicating that there are mechanisms that prevent multiple Ku proteins from loading onto DNA. Preventing Ku entry into chromatin may be important to allow for other genome transactions. In agreement, Ku overloading in vitro blocks the association of transcription factors with their binding sites (e.g., Sp1, AP1, and Oct1/OTF1), reduces their transcription, and impairs the repair of other nearby lesions by dedicated mechanisms such as nucleotide excision repair.13–15

The stoichiometry of Ku at DNA ends may be regulated by a combination of passive and active mechanisms. Ku is known to interact with many DDR proteins, and these factors may sterically block additional Ku binding or recruit proteins that remove Ku from DNA ends. Prior work showed that inhibiting DNA-PKcs attenuates Ku loading within human cell extracts, suggesting that it may function as a regulatable barrier.16 This raises the question of the role of the other NHEJ factors in blocking Ku entry into chromatin. In addition, a number of active mechanisms promote Ku eviction from DNA ends and chromatin. First, the nucleolytic activities of the CtIP-MRN complex, stimulated by ATM-dependent CtIP phosphorylation, antagonize the persistence of Ku at single-ended DSBs (seDSBs) generated in S phase by the DNA topoisomerase I poison camptothecin (CPT).17 This mechanism requires the phosphorylation of the DNA-PKcs ABCDE sites by ATM and its dissociation from the NHEJ complex prior to Ku release.18 Second, the splicing factor XAB2 antagonizes Ku binding at DSBs produced by CPT and temozolomide by a mechanism that remains to be characterized.19 Third, direct Ku phosphorylation promotes its release in S phase to favor other DNA repair pathways.20 Finally, Ku undergoes polyubiquitination and release from ends by the activity of the unfoldase VCP (p97 or Cdc48).21,22 Several E3 ubiquitin ligases, including RNF8, RNF138, RNF126, and FBXL12, have been implicated in promoting Ku release through direct ubiquitination.23–27 Importantly, Ku release was shown to be largely dependent on neddylation, i.e., the conjugation of the ubiquitin-like NEDD8 to Cullins, implying that a Cullin-based ubiquitin ligase is the key Ku-releasing factor.28

Here, we investigate the cellular mechanisms regulating Ku stoichiometry on DNA using both human cells and Xenopus egg extracts. Using two complementary superresolution methods to analyze Ku foci at individual DSBs in human cells, we reveal that DNA-PKcs is a major barrier that prevents multiple Ku molecules from loading onto chromatin. Using a quantitative single-molecule assay within Xenopus egg extracts to measure the precise amount of Ku at DNA ends, we establish in another vertebrate that DNA-PKcs plays a key structural role in enforcing the 1:1 Ku:DNA end stoichiometry. We also demonstrate that without DNA-PKcs, a neddylation/FBXL12-dependent process actively prevents excessive Ku accumulation into chromatin, most likely through direct Ku ubiquitination. In addition, we reveal that a CtIP/ATM-dependent process quickly reverses aberrant Ku accumulation on chromatin during S phase, which suggests that excess Ku can also be actively removed by DNA end resection. Finally, by developing an assay to monitor in cells how Ku entry into DNA impacts transcription in the vicinity of DNA ends, we demonstrate that DNA-PKcs is essential to protect transcription from inhibition by Ku overloading. Altogether, this work identifies DNA-PKcs as the main barrier that prevents Ku overloading onto chromatin and demonstrates that additional mechanisms act to remove excess Ku molecules when needed.

RESULTS

DNA-PKcs physically limits Ku entry into chromatin in human cells

To determine the impact of LIG4 and DNA-PKcs on Ku loading at individual DSBs, we used structured illumination superresolution microscopy (SIM) to measure the intensity of Ku foci following ionizing radiation (IR) in wild-type (WT) U2OS cells and U2OS cells knocked out for DNA-PKcs (PKcs-knockout [KO]), DNA LIG4 (LIG4-KO), or both (LIG4/PKcs-KO; Figure 1A). These cell lines displayed the expected sensitivity to IR (Figure S1A). As soon as 5 min after IR, Ku foci were on average 2- to 3-fold brighter in cells lacking DNA-PKcs, and this increase persisted for 1 h after irradiation (Figure 1B). Loss of LIG4, either alone or in combination with DNA-PKcs, had no measurable impact on Ku foci, suggesting that the NHEJ defect is not responsible for the Ku accumulation observed on irradiated chromatin in PKcs-KO cells. Next, we examined the role of DNA-PKcs kinase activity on Ku foci intensity. Cells were pre-treated with a concentration of the specific DNA-PK inhibitor nedisertib29 (PKi), which strongly reduces DNA-PK activity, as measured by monitoring DNA-PKcs autophosphorylation on S2056 after treatment with the radiomimetic drug calicheamicin-γ130 (Cali), without impacting ATM activity, as evaluated through KAP-1 S824 phosphorylation (Figure S1B). One hour after IR, Ku foci were brighter in PKcs-KO cells than in WT cells, with or without PKi (Figure 1C), supporting a physical rather than a catalytic role of DNA-PKcs in limiting Ku loading at DSBs.

Given that a neddylation-dependent process is the main driver of Ku removal from chromatin after completion of DNA repair,28 we monitored the impact of the neddylation inhibitor MLN492431 (NEDi) on Ku accumulation at DSBs. In PKcs-KO cells, inhibition of neddylation led to a time-dependent increase in Ku foci intensity of up to ~2.5-fold 1 h after IR relative to PKcs-KO without NEDi (Figures 1D and S1C), suggesting that a neddylation-dependent machinery actively operates in these cells to remove excess Ku from chromatin. No effect of NEDi was observed in the absence of LIG4 alone (Figures 1E and S1D), supporting the model that the observed increase in Ku foci intensity is not the result of a DNA repair defect, but rather linked to the physical function of DNA-PKcs in antagonizing Ku entry into chromatin. Similar results were obtained in HeLa cells (Figures S1E and S1F): Ku foci were ~2 times brighter in HeLa PKcs-KO compared to HeLa WT at both 5 and 60 min after IR. Inhibition of neddylation further increased the intensity of Ku foci in HeLa PKcs-KO, which reached ~4 times the intensity of Ku foci in WT cells, while it had nearly no effect on HeLa WT cells. Our findings were further validated through rescue experiments conducted in U2OS PKcs-KO (Figures S1G and S1H): in U2OS PKcs-KO complemented with an empty plasmid, Ku foci were brighter at both 5 and 60 min after IR compared to U2OS complemented with WT DNA-PKcs, and with inhibition of neddylation, an additional increase in Ku foci intensity was observed 60 min after IR. In contrast, Ku foci intensity was similar to that of U2OS WT cells when U2OS PKcs-KO cells were complemented with a DNA-PKcs WT-expressing plasmid. Inhibiting DNA-PK activity with a validated concentration of another well-characterized catalytic inhibitor (NU744132) did not lead to an increase in Ku foci intensity in WT cells (Figure S1H, see Figure S1B for NU7441 validation).

Since the resolution of our 3D-SIM imaging setup is ~150 nm, we adapted our imaging protocol to 3D stochastic optical microscopy (STORM) with a theoretical resolution of ~50 nm (20 nm plus the ~30 nm resolution lost as a result of using primary-secondary immunocomplexes for detection).33 While the size of the longest side of a single Ku molecule (~10 nm) or of two Ku molecules (~21 nm) in the long-range synaptic complex are below the resolution of our setup,34 we hypothesized that, under conditions of Ku overloading, STORM imaging may reveal differences in foci size and organization not accessible to our 3D-SIM imaging approach. For this purpose, Ku foci were analyzed 5 min after IR in WT cells or 1 h after IR in NHEJ-deficient cells (LIG4-KO), co-inactivated or not for DNA-PKcs (LIG4/PKcs-KO). Where indicated, the cells were also treated with NEDi. To identify Ku foci from the coordinates of localized molecules obtained by STORM, we used a previously described approach based on Voronoï tessellation.35,36 Our analysis shows that the loss of DNA-PKcs leads to larger Ku foci, with a mean size of ~67 nm, in contrast to WT and LIG4-KO conditions, in which the mean size is ~60 nm (Figure S2A). Ku foci size in LIG4/PKcs-KO was further increased with NEDi (mean size ~83 nm). In line with an increase in the size of Ku foci, the number of localizations per cluster was also increased in the absence of DNA-PKcs and further exacerbated upon NEDi treatment (Figure S2B), supporting the fact that a higher number of Ku molecules is present at DSB sites in the absence of DNA-PKcs and that this level is further enhanced when neddylation is blocked. Ku foci in the absence of DNA-PKcs have a lower density than in the WT condition, both without and with NEDi (Figure S2C), and form elongated structures (Figures S2D and S2E), suggesting the spreading of Ku molecules along the DNA. Altogether, these data provide additional evidence that, upon loss of DNA-PKcs, Ku invades the chromatin on the flank of each DSB.

To complement our observations on the mechanisms controlling Ku hyperaccumulation at DSBs, we used an orthogonal biochemical fractionation assay37 to monitor the association of NHEJ proteins with chromatin in response to the radiomimetic drug Cali. WT, PKcs-KO, and LIG4-KO U2OS cell lines were pre-treated with PKi to equally neutralize their NHEJ capacities (Figure 1F). Similar to our SIM imaging results, loss of DNA-PKcs led to a strong increase in Ku association with chromatin upon Cali treatment compared to WT and LIG4-KO cells, even resulting in Ku partial depletion from the soluble protein fraction (Figure 1F). Of note, LIG4 association with damaged chromatin was decreased in PKcs-KO cells, reflecting the stabilization of LIG4 at DSBs mediated by DNA-PKcs.37,38 Addition of NEDi to the cells resulted in a further increase in the amount of Ku associated with chromatin only in the absence of DNA-PKcs, highlighting the role of neddylation in limiting Ku accumulation onto chromatin. Notably, when Ku was immunoprecipitated from the soluble fraction from PKcs-KO cells, a ubiquitination signal was detected above the Ku80 band after Cali treatment, which disappeared with NEDi (Figure 1G), supporting the involvement of a Cullin-based ubiquitin ligase in promoting Ku release from the damaged chromatin through direct Ku ubiquitination.

DNA-PKcs controls Ku stoichiometry at DSB ends

To quantitatively assess the function of DNA-PKcs in regulating the Ku stoichiometry at DSBs, we developed a single-molecule assay in Xenopus egg extracts to measure the number of fluorescently labeled Ku molecules loaded onto surface-attached DNA substrates (Figure 2A). Ku was visualized by complementing Ku70/Ku80-immunodepleted extracts with purified Xenopus laevis Halo-Ku80:Ku70 (Figures S3A and S3B), which was efficiently labeled with HaloTag-Cy5 ligand (85%) and retained WT activity in NHEJ assays (Figure S3C). To determine the maximum number of Ku molecules that can load onto a 100 bp Cy3-labeled DNA substrate tethered to the surface of a microfluidic flow cell, we first incubated Cy5-labeled Halo-Ku80:Ku70 with the tethered DNA for 60 min in wash buffer. Next, we imaged both the surface-bound DNAs and the Ku molecules using total internal reflection fluorescence imaging (Figure 2A). Ku intensity trajectories were generated by integrating the signal arising from each surface-tethered DNA (Figure 2B). These trajectories displayed step-like drops in intensity due to the photobleaching of Cy5 fluorophores. The observed number of photobleaching events from each Ku intensity trajectory was then used to generate a stoichiometric distribution of fluorescently labeled Ku molecules bound to DNA.39

Photobleaching analysis of co-localized Ku foci found that multiple Ku molecules would load onto individual substrates with a mean of 3 ± 2.2 Ku molecules per DNA (Figure 2C; see for each condition Figures S3G–S3J, corresponding respectively to single-molecule probability distributions and representative trajectories). In contrast, when tethered DNA was incubated with Xenopus egg extracts in which endogenous Ku was replaced by Halo-Ku80:Ku70 (Figure S3B), only 1 ± 0.4 Ku molecule loaded per DNA substrate (Figure 2D), showing that a mechanism exists to prevent multiple Ku molecules from threading onto DNA under physiological conditions. In further support of a single Ku molecule loading per DNA end, we found that the mean fraction of DNAs with a labeled Ku molecule was 0.83 ± 0.079, as expected given the independently measured degree of Ku labeling. Notably, immunodepletion of DNA-PKcs from the egg extract (Figure S3D) resulted in overloading of Ku molecules (2 ±1.5) (Figure 2E), consistent with DNA-PKcs acting as a critical regulator of Ku loading. In contrast, immunodepletion of the core factors XLF and XRCC4-LIG4 from egg extract (Figure S3E) had no significant impact on Ku stoichiometry (1 ± 0.5) (Figure 2F).

DNA-PKcs may play a direct structural role in limiting Ku stoichiometry by retaining Ku at the DNA end and sterically blocking additional Ku molecules from loading. Alternatively, DNA-PKcs may recruit additional factors that regulate Ku binding. To distinguish between these two scenarios, we pre-incubated fluorescently labeled Ku with purified Xenopus NHEJ factors and then added them to the flow cell. The numbers of DNA-bound Ku molecules were then counted after 60 min of incubation. While the addition of XLF and XRCC4-LIG4 had no noticeable effect on Ku loading compared to the Ku-only control (3 ± 1.2) (Figure 2G), pre-mixing Ku and DNA-PKcs purified from extract (Figure S3F) led to a substantial reduction in Ku stoichiometry (1 ± 0.6) (Figure 2H), which mimicked observations of undepleted egg extract. To determine if DNA-PKcs kinase activity was necessary for limiting Ku stoichiometry, we pre-incubated fluorescently labeled Ku with purified Xenopus DNA-PKcs in the presence of 125 μM PKi NU7441, an effective concentration to inhibit NHEJ in Xenopus extract.40 The addition of PKi did not alter Ku stoichiometry (1 ± 0.4) (Figure S4D; see Figures S4G–S4J, corresponding respectively to single-molecule probability distributions and representative trajectories). These results demonstrate that DNA-PKcs acts as a structural barrier to Ku loading that is independent of its kinase activity.

Next, we examined if active removal of Ku via ubiquitination contributes to limiting Ku stoichiometry in egg extract. To determine if Ku was undergoing polyubiquitination under our assay conditions, we bound the 100 bp DNA substrate to streptavidin magnetic beads and incubated with extracts to monitor association of the DNA-PK complex (Figure S4A). Ku and DNA-PKcs rapidly associated with DNA ends, while a slower-migrating Ku80 species appeared over time that was sensitive to treatment with the deubiquitinase (DUB) USP2 (Figure S4B). Addition of the neddylation inhibitor NEDi, which did not impact end joining (Figure S4C), resulted in loss of these modified Ku species and stabilized Ku at DNA ends (Figure S4B). Together these results demonstrate that a neddylation-dependent polyubiquitinated form of Ku80 is generated in our experiments. However, our single-molecule imaging revealed that the addition of NEDi did not significantly alter Ku stoichiometry in the presence (1 ± 1.1 Ku molecule per DNA) (Figure S4E) or absence of DNA-PKcs (2 ± 1.2) (Figure S4F) compared to the relevant conditions in the absence of inhibitor (see Figures S4G–S4J, respectively, for single-molecule probability distributions and representative trajectories). Collectively, these results provide further evidence that DNA-PKcs plays a prominent role in limiting Ku entry onto DNA in vertebrates. Importantly, this regulation of Ku stoichiometry appears unique to DNA-PKcs, as loss of the core factors XLF and XRCC4-LIG4 had no significant impact on Ku stoichiometry.

In S phase, an ATM-dependent mechanism overcomes Ku accumulation

Multiple mechanisms function in S phase to antagonize Ku loading on DSBs, with ATM playing a prominent role in controlling these mechanisms.17–19 To evaluate the relative contributions of neddylation and ATM in regulating Ku entry into chromatin in and outside of S phase, we used the specific ATM inhibitor KU-5593341 (ATMi) alone or in combination with NEDi and monitored Ku accumulation at DSBs post-IR in PKcs-KO cells, in which Ku overloading is expected. PCNA (proliferating cell nuclear antigen) co-staining was used to identify cells in S phase. DNA-PKcs KO led to the expected Ku overloading 5 min after IR in both replicating and non-replicating cells. However, the mean Ku foci intensity decreased over time in PCNA-positive cells (Figure 3A), suggesting an S-phase-specific mechanism for Ku removal from chromatin. Inhibiting neddylation led to a time-dependent increase in Ku loading in both non-replicating and replicating cells. However, in replicating cells, Ku foci intensity was ~2 times lower at 4 h compared to non-replicating cells, implying that a Ku release mechanism operates in S phase independent of the neddylation-dependent removal from damaged chromatin. Notably, inhibiting ATM prevented the preferential removal of Ku in S phase, either with or without NEDi, suggesting that ATM controls Ku eviction from chromatin in S phase. This supports the idea that two active mechanisms operate to limit Ku accumulation in DNA-PKcs-deficient cells: a neddylation-dependent mechanism operating throughout the cell cycle and an ATM-dependent mechanism operating in S phase. We therefore attempted to provide additional insights into these two mechanisms removing Ku from chromatin when DNA-PKcs is absent.

FBXL12 mediates the neddylation-dependent removal of Ku from chromatin

Given that FBXL12 is the substrate receptor a Cullin-dependent E3 ubiquitin ligase implicated in Ku removal after repair,25,26 we used small interfering RNA (siRNA)-mediated depletion to test its role in the neddylation-dependent removal of Ku from chromatin in DNA-PKcs-KO cells. Depletion of FBXL12 in U2OS PKcs-KO resulted in an increase in the intensity of Ku foci induced by IR in PKcs-KO cells similar to what was observed with NEDi (Figure 3B; see Figure S5A for the siRNA-mediated depletion). This effect was observed both in and outside of S phase; however, Ku foci were consistently less intense in S phase, in agreement with the ATM-dependent mechanism operating in this phase of the cell cycle. Adding NEDi to FBXL12-depleted cells had no additional effect on Ku foci intensity, supporting the model that FBXL12 mediates the neddylation-dependent Ku release. The effect of FBXL12 depletion on Ku foci intensity was not observed in DNA-PKcs-proficient cells (Figure S5B), indicating that FBXL12 removes Ku only once it accumulates in chromatin. Considering that excessive Ku accumulation in chromatin can be deleterious to other DNA transactions such as transcription or replication, we analyzed the impact of FBXL12 depletion on the fitness of WT or DNA-PKcs-deficient cells. While depletion of FBXL12 had no measurable effect on WT cells, it significantly reduced the cell fitness of DNA-PKcs-deficient cells (Figure S5C), suggesting that excessive Ku accumulation in chromatin is deleterious to cells. This strong effect of FBXL12 depletion on cell fitness was not observed in LIG4-KO cells (Figure S5C) or upon inhibition of DNA-PK kinase activity (Figure S5D). Together, these data identify FBXL12 as the mediator of the neddylation-dependent mechanism preventing Ku accumulation in chromatin in cells deficient for DNA-PKcs.

CtIP-dependent DNA end resection overcomes Ku entry into chromatin in S phase

ATM has a dual role in limiting Ku accumulation at single-ended DSBs induced by CPT: (1) it promotes DNA-PKcs removal from ends through phosphorylation of the ABCDE cluster and (2) it promotes the initiation of DNA end resection through phosphorylation of CtIP.17,18 To test whether the role of ATM in antagonizing Ku loading on IR-induced DSBs in S phase was dependent on DNA end resection, we used siRNA to deplete CtIP, a key activator of DNA end resection (Figure 3C; see Figure S5E for the depletion). Depletion of CtIP in PKcs-KO cells resulted in a strong increase in IR-induced Ku foci intensity in replicating cells treated with NEDi, thereby mimicking the effect of ATM inhibition. Strikingly, inhibiting ATM in the siCtIP conditions did not further increase Ku foci intensity, supporting the idea that ATM functions in the same pathway as CtIP to counteract Ku accumulation at DSBs in S phase (Figure 3C). These results suggest that, in S phase, the ATM-CtIP axis antagonizes Ku overloading induced by the absence of DNA-PKcs, thereby limiting Ku entry into chromatin independent of its neddylation-dependent eviction. In response to IR, DNA resection occurs mainly in the G2 phase of the cycle (Figure S5F, WT + IR condition).42 However, we observed that both LIG4 and DNA-PKcs loss resulted in IR-induced DSBs being resected in S phase (Figure S5F), supporting the model that blocking fast NHEJ-dependent DSB repair stimulates DSB-end resection.

We also analyzed whether DNA-PKcs prevents Ku overloading on seDSBs induced by CPT in S phase (Figure S5G). To that aim, WT, PKcs-KO, LIG4-KO, and LIG4/PKcs-KO U2OS cells were treated with CPT in the presence of ATMi to block the CtIP/ATM-dependent mechanisms removing Ku from seDSBs in S phase. Under these conditions, we confirmed that loss of DNA-PKcs increased Ku foci intensity by ~4 times (Figure S5G). Ku overloading did not result from NHEJ inhibition, since it was not observed in response to LIG4 KO alone. Altogether, these data support the model that DNA-PKcs functions to block Ku overloading at DSBs throughout the cell cycle, but that, in S phase, DNA resection is able to quickly overcome Ku overloading when DNA-PKcs is absent.

DNA-PKcs physically protects transcription at the vicinity of DNA ends

Prior biochemical experiments in cell extracts suggested that excess Ku loading at DNA ends could impede transcription from a nearby promoter in vitro.13,15 To test whether unscheduled Ku entry on DNA can affect transcription at the vicinity of DNA ends in cells, we developed an assay in which U2OS cells were transfected with a linear double-stranded substrate carrying the small simian virus 40 promoter (SV40 Pro, 314 bp) followed by the GFP cDNA (720 bp) and the bovine growth hormone polyadenylation sequence (BGH Poly(A), 234 bp; Figure 4A). Ku entry onto the promoter or the GFP coding unit is expected to reduce GFP expression. This substrate was co-transfected with a circular mCherry-coding plasmid to restrict the analysis to transfected cells. In the absence of DNA-PKcs, the amount of GFP-positive cells was reduced by 50% compared to WT or to LIG4-KO cells (Figure 4B, left), demonstrating that the decrease in GFP expression was not due to loss of NHEJ in PKcs-KO cells. Importantly, the expression of the same substrate integrated into a circular plasmid was not affected (Figure 4B, right), showing that DNA ends are required to observe the effect of DNA-PKcs on transcription. In addition, DNA-PK kinase inhibition did not impact the percentage of GFP-positive cells with either the linear or the plasmid substrate (Figure 4C), showing that this function of DNA-PKcs is not mediated by its catalytic activity nor its role in NHEJ. To correlate this with Ku overloading, we transfected the LIG4-KO and LIG/PKcs-KO cells with the linear substrate biotinylated at both 5′ ends (biotin does not block Ku loading43) and recovered it 4 h after transfection using streptavidin beads. Analysis by immunoblotting of the amount of Ku associated with the beads established that ~3.5 times more Ku is found associated with the linear substrate in LIG4/PKcs-KO cells compared to LIG4-KO cells (Figure 4D). These data show that (1) Ku overloading in the absence of DNA-PKcs is observed on the linear reporter and (2) substrate degradation is unlikely to account for the decreased GFP expression observed in PKcs-KO cells, since it can be recovered from cells along with associated proteins. To substantiate that it is actually Ku overloading that reduces GFP expression, we inactivated DNA-PKcs in U2OS derivatives in which endogenous Ku70 is depleted with a constitutively expressed short hairpin RNA (shRNA) and replaced it with a Ku70 construct N-terminally fused to a mini-auxin-inducible degron (mAID).34 In these cells, addition of the indole-3-acetic acid (IAA) auxin resulted in the quick degradation of both mAID-Ku70 and Ku80 subunits (Figure 4E). Without IAA, transfection with the GFP reporters confirmed that transcription of the linear GFP reporter is reduced by ~62% in PKcs-KO compared to WT cells (Figure 4F, left). This was not due to DNA-PK kinase activity, since the PKi was included in all conditions. Degrading Ku with IAA reduced GFP expression by ~68%, in line with Ku protecting DNA ends from cellular exonucleases.3 However, in contrast to what is observed under Ku-proficient conditions, no further reduction in GFP expression resulted from DNA-PKcs KO without Ku (+IAA). Importantly, no impact of DNA-PKcs presence nor Ku degradation was observed with the circular reporter (Figure 4F, right). Altogether, these data support the notion that DNA-PKcs physically protects transcription at the DNA end vicinity from Ku-mediated interference.

DISCUSSION

This study establishes in human cells and in Xenopus laevis egg extracts that DNA-PKcs acts as a key regulator of Ku entry into chromatin from DNA ends. This corresponds to a direct, structural role, independent of its kinase activity, and likely relies on DNA-PKcs retaining Ku at the DNA end, occluding further Ku loading (Figure 5A).

This study also shows that an FBXL12/neddylation-dependent process actively counteracts Ku overloading onto chromatin throughout all phases of the cell cycle, most likely through direct ubiquitination of Ku by an Skp1-Cul1-F-box (SCF) ubiquitin-ligase complex in which FBXL12 is the F-box protein (Figure 5B, left). The ubiquitination-dependent removal of Ku in this context is supported by the appearance of a ubiquitinated form of Ku both in response to DNA damage in human cell extracts and upon incubation of Xenopus egg extracts with DNA ends. In both cases, Ku ubiquitination was blocked by a neddylation inhibitor. What controls FBXL12 recruitment and which signal triggers Ku ubiquitination remain to be investigated. Other E3 ubiquitin ligases have been shown to mediate Ku ubiquitination and/or release, including RNF8, RNF138, and RNF126.23,24,27 Their contribution in antagonizing Ku accumulation on chromatin remains to be tested.

This study also establishes that ATM/CtIP-dependent resection can overcome Ku accumulation on chromatin in replicating DNA-PKcs-deficient cells (Figure 5B, right). Since most DSBs induced by IR are repaired by NHEJ, this suggests that excessive Ku accumulation resulting from DNA-PKcs loss still allows end-resection in S phase. However, as a consequence of Ku molecules covering a larger region of DNA in the absence of DNA-PKcs, one might expect that resection is initiated farther from the end, since protein blocks play a role in defining the position of the MRX/MRN-dependent incision.44,45 Supporting this model, loss of DNA-PKcs was found to stimulate the resection of DSBs induced by the restriction enzyme AsiSI, resulting in larger regions of single-stranded DNA (ssDNA) being produced in HCT116 PKcs-KO compared to WT cells.46 Intriguingly, in the G0 phase of the cell cycle, DNA-PK kinase activity is essential for the resection of some DSBs, potentially by phosphorylating CtIP,47 and in that context, depletion of FBXL12 leads to hyperresection.25 This further supports our finding that shows that DNA end resection can overcome Ku accumulation in chromatin, but potentially at the expense of extended DNA resection.

In addition, our data demonstrate that the absence of DNA-PKcs also leads to Ku overloading at single-ended DSBs induced by CPT when ATM is inhibited. ATM promotes Ku release from seDSBs by stimulating nuclease activities of the CtIP-MRN complex and through direct phosphorylation of DNA-PKcs.17,18 Under these conditions, it was previously shown that seDSBs are repaired unfaithfully by NHEJ, resulting in chromosomal aberrations and cell death, which can be prevented by inhibiting NHEJ.18,48 It was postulated that under these conditions (CPT + ATMi + NHEJi), homologous recombination (HR) still operates, albeit at a slower rate.48 We speculate that excessive Ku accumulation in the absence of DNA-PKcs impacts the ability of HR to proceed. This could explain why the sensitivity to CPT of ATM-deficient mouse embryonic stem cells could be rescued by knocking out LIG4, XRCC4, XLF, or Ku, but, strikingly, not by inactivating DNA-PKcs.48

Our findings also raise the question of the length of DNA covered by Ku in the absence of DNA-PKcs and how chromatin boundaries limit Ku spreading or whether they are affected by excessive Ku accumulation. Consistent with chromatin acting as a barrier, inhibition or depletion of KDAC1/2, which promotes chromatin opening, increases Ku loading onto DNA breaks while reducing NHEJ and HR efficiency.49 Chromatin boundaries also determine how DNA damage signaling spreads onto chromatin and could therefore impact the ability of Ku to thread onto DNA.50 Conversely, Ku threading could impact chromatin organization. In agreement, it was previously shown in vitro that Ku can evict the H1 linker histone and “peel off” the DNA from the nucleosome to associate with chromatinized DNA substrates; however, this accommodated only 1–2 Ku molecules.51

The spreading of Ku molecules into chromatin also impacts the genomic processes occurring in the vicinity of the DNA end. In line with previous in vitro studies,13,15 we established here that the presence of DNA-PKcs is important for enabling transcription of a linear substrate. Since this effect was not dependent on DNA-PK kinase activity and observed only on a linear substrate, without impacting transcription on the same substrate integrated into a circular plasmid, and not observed in the absence of Ku, these data support the idea that Ku sliding from the DNA ends in the absence of DNA-PKcs impedes transcription. The deleterious impact of Ku accumulation on chromatin is also supported by the specific reduction of cell fitness induced by FBXL12 depletion in DNA-PKcs-deficient cells. The lack of a DNA-PKcs homolog in several organisms, such as yeast, raises the question of how this protective role of DNA-PKcs is fulfilled there, especially considering that Ku overloading would likely be even more detrimental to the compact yeast genome. It is possible that in yeast the ability of Ku to thread onto DNA is more restricted, as suggested in an elegant study in which mutants of yKu70 with an increased ability to slide into DNA were identified.52 Another possibility is that another Ku partner in yeast substitutes for DNA-PKcs in this function.

To conclude, our work unveils a conserved function for DNA-PKcs in regulating the loading of Ku at DNA DSBs, along with two active mechanisms that can limit or overcome Ku overloading. Given this role, targeting DNA-PKcs for degradation by small molecules, such as anti-DNA-PKcs proteolysis-targeting chimeras (PROTACs), or blocking its interaction with Ku could be exploited to induce synthetic lethal situations in cells with specific defects, for example, in the FBXL12/neddylation-dependent mechanism that actively extracts Ku from chromatin.

Limitations of the study

We used a linear substrate to monitor how transcription is affected in cells in the absence of DNA-PKcs. While supporting our model, the data obtained with this system could find other explanations, such as a modulation of GFP expression as the result of a Ku-dependent change in the subcellular localization of the linear substrates in the absence of DNA-PKcs. In addition, the substrate is non-chromatinized and therefore is only the readout of a subset of the cellular mechanisms that can control Ku accumulation. Ultimately, the impact of Ku overloading at DSBs on other DNA transactions, as well as on chromatin organization, will need to be studied at endogenous loci.

STAR★METHODS

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Sébastien Britton (sebastien.britton@ipbs.fr).

Materials availability

Plasmids generated in this study have been deposited to Addgene: eSpCas9 plasmids to inactivate LIG4 (#220494) or DNA-PKcs (#220493), pUC18-GFP plasmid (#220495) and pUC18-LucFF plasmid (#220496). Cell lines generated in this study are available upon request.

Data and code availability

All data reported in this paper will be shared by the lead contact upon request.

This paper does not report original code.

Any additional information required to reanalyse the data in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Cell lines

Human U2OS (sex of cell: female) and HeLa cells (sex of cell: female) were grown in Dulbecco’s Modified Eagle Medium (Gibco) supplemented with 10 % feal bovine serum (Eurobio), 100 U/ml penicillin (Gibco) and 100 μg/ml streptomycin (Gibco) in a humidified incubator at 37°C and 5 % CO2.

Animal models

The female frogs used to produce oocytes were cared for by the Center for Animal Resources and Comparative Medicine at Harvard Medical School (AAALAC accredited). Work performed for this study was in accordance with the rules and regulations set by AAALAC. The Institutional Animal Care and Use Committee (IACUC) of Harvard Medical School approved the work.

METHOD DETAILS

Cell Constructions and transfections

U2OS PKcs-KO complemented with DNA-PKcs or an empty plasmid and U2OS cells in which endogenous Ku70 is replaced by a mAID-Ku70 construct (the degradation of which being triggered by addition of indole-3-acetic acid, herein referred to as IAA) were previously described.18,34 CRISPR/Cas9 was used to inactivate LIG4 and/or DNA-PKcs in the original U2OS background or in the mAID-Ku70 expressing derivative using the eSpCas9 (1.1) mutant engineered to display reduced off-target.53 Cells were transfected according to the manufacturer’s instructions using lipofectamine 2000 (Thermo Fisher Scientific) with the pCAG-eSpCas9–2A-GFP (generous gift from Jizhong Zou, Addgene plasmid #79145; http://n2t.net/addgene:79145; RRID:Addgene_79145) plasmid co-expressing the S. pyogenes Cas9 variant K848A K1003A R1060A and a guide against LIG4 (target sequence GGGGTAAGAGAA CCTTCAGT) and/or DNA-PKcs (target sequence GGTACCCACCCAGCACCGCG) cloned using BbsI digestion. One week after transfection, cells were plated at limiting dilution to perform selection of individual clones, which were analyzed for proper target inactivation. For RNA interference experiments, cells were transfected twice (24 h and 48 h after seeding) with lipofectamine RNAiMAX Reagent (Thermo Fisher Scientific) at a final concentration of 50 nM per well. Experiments were done 48 h after the second round of transfection. Target sequences of siRNA used against FBXL1254 and CtIP are described in Table S1.

Cell fitness assay

For cell fitness assays, U2OS WT, PKcs-KO or LIG4-KO cells were seeded the day after the 2nd siRNA transfection in 96-well plates. For each cell line, serial two-fold dilutions were performed to seed from 20000 to 156 cells per well. Cells were allowed to grow for 3 days, fixed 1 h at 4°C by adding 10 % trichloroacetic acid to reach a 3.33 % final concentration and washed with tap water. After drying the plates, cells were stained 30 min at room temperature with 0.057 % sulforhodamin B in 1 % acetic acid, washed four times with 1 % acid acetic and dried again. Finally, the dye was resuspended by a 1 h incubation in 200 μL of 10 mM Tris-base solution, and SRB levels were measured by absorbance at 490 nm using a μQuant microplate spectrophotometer (Bio-Tek Instruments). Percentages of cell growth are expressed after normalization relative to the well with the maximum cell concentration of each cell line transfected with Ctrl siRNA.

Ku foci immunodetection

Cell treatments

Cells were exposed to the indicated dose of X-Ray irradiation using a calibrated irradiation system Faxitron RX-650 (130 kV, 5 mA). Nedisertib (M3814, DNA-PKi, 0.25 μM, Selleckchem), KU-55933 (ATMi, 10 μM, Selleckchem), MLN4924 (NEDi, 3 μM, Selleckchem), or NU7441 (3 μM, Tocris) were added when specified 1 h prior to irradiation. Camptothecin (CPT, Sigma-Aldrich) was used at 1 μM for 1h.

Staining procedure

Immunodetection of Ku foci was performed as previously described.12 U2OS and HeLa cells were seeded in 24-well plate on #1.5 glass coverslips (VWR), irradiated and/or treated 24 h later. For STORM experiments, U2OS cells were seeded in 12-well plate on #1.5H glass coverslips (18 mm diameter, Marienfeld, ref. 0117580). Cells were washed twice with PBS and incubated 3 min at room temperature in CSK buffer (10 mM PIPES pH 7.0, 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2) containing 0.7 % Triton X-100 and 0.3 mg/mL Ribonuclease A (CSK+R). After three PBS washes, cells were again incubated 3 min in CSK+R. Cells were then washed three times and fixed with 2% paraformaldehyde in PBS for 20 min at room temperature. Cells were washed with PBS, permeabilized 5 min with PBS containing 0.2 % Triton X-100, washed again and incubated 10 min at room temperature in blocking buffer (PBS 0.1 % Tween-20, 5 % bovine serum albumin). Cells were incubated 75 min at room temperature with primary anti-Ku80 (111, 1:100) and/or PCNA (1:2000) antibody diluted in blocking buffer, washed with PBS 0.1 % Tween-20 (PBS-T), and incubated again 45 min with secondary antibody coupled to respectively Alexa Fluor 488 or 594 in blocking buffer (1:1000 for both). Cells were finally washed with PBS 0.1 % Tween-20 and stained with 2 μg/mL DAPI in PBS for 15 min at room temperature. Coverslips were mounted with Vectashield (Vector laboratories). For STORM experiments, AlexaFluor 647-coupled donkey anti-mouse antibodies (1:1000) were used to immunodetect Ku.

3D-SIM imaging and analysis

Images were acquired with a Zeiss Elyra 7 3D Lattice SIM super-resolution microscope with a 63x objective (PLANAPO NA 1.4, Zeiss) and dual sCMOS cameras (pco.edge). 3D-SIM reconstructions were performed on 2 μm depth-images (interval 0.091 μm) with Zen Blue 3.3 (Zeiss). Threshold for PCNA positive/negative cell was chosen each experiment based on the cell population geometric mean of nuclear PCNA-integrated density staining. Ku foci number and intensity quantifications were performed on maximum intensity projection using the find maxima function of Image J software (v1.53t). To circumvent quantification bias associated with large intensity variation, each nucleus was automatically contrasted based on the image’s histogram (auto B&C function) and the returning maximal threshold value (x) was used to adjust the prominence of the find maxima function. The prominence was calculated using the following experimentally determined two-phase decay model: f(x)=1132+((18:661132×8:908×0:01)×exp(−0:00252x)+((18:66−1132)×3(100–8:908)×0:01)×exp(−0:00005977x).

STORM imaging and analysis

3D Stochastic Optical Microscopy (STORM) was performed on an inverted i-SPT Nikon Ti-E/B microscope equipped with an Apo TIRF 100X, NA1.49 oil DIC objective and an adaptive optics system (MicAO 3D-SR, Imagine Optic) that was used to introduce an optical astigmatism during image acquisition. Excitation was performed in HILO configuration with a 647 nm laser line (300 mW) from MPB Communications Inc. The excitation light signal was filtered by a quad-band dichroic mirror (Nikon N-STORM TIRF Filter Set, 97335) whereas the emission light was filtered by 705/72 nm filter (Chroma, ET705/72 nm) and detected on a iXon Ultra DU897 EM-CCD camera (Andor). Microscopy slides were fitted with a 13 mm × 0.6 mm Coverwell modular hybridization system (Citi-Fluor EMS) that was filled with STORM buffer (Smart Buffer Kit, Abbelight) and sealed with a glass coverslip coated with TetraSpeck™ 0.1 μm beads (ThermoFischer, T7279). Image acquisition was performed for 30,000 frames at 512 × 512 pixels with an exposure time of 30 ms at full power of the 647 nm laser. After acquisition, the localization of individual fluorophores was performed with the ThunderSTORM plugin on ImageJ. 55,56 Individual localizations with an uncertainty above 40 nm and intensity above 5000 were discarded from further analysis. The remaining localizations were loaded into the Point Cloud Analyst software for visualization and cluster analysis purposes.36 For the identification of individual cluster we used the SR-Tesseler method of the PoCA software with the following settings: minimal number of localizations = 10, maximal number of localizations = 10000, Cut distance = 100 nm, coefficient factor = 2. The characteristics of each cluster (size, volume and number of localizations) were exported and used for further analysis in GraphPad Prism. For visualization of individual clusters, only the localizations within identified clusters were used for rendering using the Heatmap function of the PoCA software.

Whole cell extracts

Cells were washed with PBS, scrapped in a lysis buffer containing 120 mM Tris-HCL pH 6.8, 4 % SDS, 20 % glycerol and further lysed with 10 strokes through a 24G needle. Protein concentration was determined with a Nanodrop (Thermo Fisher Scientific) by measuring absorbance at 280 nm. Immunoblotting, as described below, was then performed.

Cell fractionation assay

Stock solution of Calicheamicin γ1 (Cali), gift from P. R. Hamann (Wyeth Research, Pearl River, NY, USA), was made at 40 μM in ethanol and stored at −20°C. For drug-exposure, exponentially growing cells in 60 cm diameter dishes were either mock-treated or treated with Cali in fresh medium for 1 h at 37 °C. Then cells were washed with phosphate-buffered saline (PBS) and trypsinized. Pellets were fractionated as follows. Cells were first resuspended for 7 min on ice in 120 μL of extraction buffer 1 (50 mM Hepes pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.1 % Triton X-100, 1X HALT protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific)) with intermittent gentle vortexing. Following centrifugation at 14 000 rpm for 3 min, the supernatant 1 was removed and stored, pellets were gently resuspended with pipette tips in 120 μL of extraction buffer 2 (50 mM Hepes pH 7.5, 75 mM NaCl, 1 mM EDTA, 0.025 % Triton X-100, 30 U RNAseA/T1 (Thermo Fisher Scientific)), incubated for 15 min at 25°C under agitation and centrifuged as above. Supernatants 2 were pooled with supernatants 1 (soluble protein fraction). Pellets (chromatin fraction) were resuspended in 120 μL lysis buffer (50 mM Tris pH 8.1, 10 mM EDTA, 0.1 % Triton X-100, 0.3 % SDS) and sonicated (Vibracel, Bioblock Scientific). Protein content was measured with BCA reagent (Pierce). Immunoblotting was then performed as described below.

Ku immunoprecipitation from human cells

M280 anti-mouse magnetic beads were coupled to control mouse IgG2a (Dako) or mouse monoclonal anti-Ku antibodies (Thermo Scientific, clone 162) with a ratio of 1.25 μg protein to 50 μL beads suspension, in PBS 0.1 % Tween-20 (Sigma-Aldrich) (PBS-T) under rotation at 4°C overnight, followed by 3 washes in PBS-T and storage at 4°C in PBS-T supplemented with sodium azide 0.02 %. For immunoprecipitation, 10 μL of anti-Ku or control magnetic beads suspension were washed 3 times in PBS-T, dried over a magnet and incubated in 250 μL microtubes (Eppendorf) under rotation at 4°C overnight in 100 μL extraction buffer 1 with 30 μg of proteins from soluble fraction as indicated, then transferred to clean tubes, washed 3 times in PBS-T, resuspended in lysis buffer supplemented with 1X loading buffer (50 mM Tris–HCl pH 6.8, 10 % glycerol, 1 % SDS, 300 mM 2-mercaptoethanol, 0.01 % bromophenol blue) and denaturated 5 min at 95°C before protein separation by SDS–PAGE on 4–15 % precast gels (Biorad). HRP-coupled TrueBlot secondary antibodies were used for detection.

Immunoblotting of human cell extracts

Equivalent protein amounts were denaturated in loading buffer at 1X final concentration at 95 °C for 5 min, separated on SDS-PAGE gels (BioRad 4–15 % TGX pre-cast gels) before transfer overnight onto Immobilon-P polyvinylidene difluoride (PVDF, Millipore) or nitrocellulose (0.45 μm pore, Bio-Rad or Protran, GE Healthcare) membranes. Staining with AdvanStain Iris (Advansta), or Ponceau S, controlled homogeneous loading and prestained protein ladder allowed cutting the membrane into stripes to simultaneously blot multiple antibodies. Membranes were blocked for 60 min with 5 % non-fat dry milk in PBS-T buffer, incubated as necessary with primary antibody (αTubulin, 1:25000; CtIP, 1:100; PhS2056-DNA-PKcs, 1:1000; DNA-PK (18.2), 1:2000; FBXL12, 1:1000; γH2AX, 1:1000; GAPDH, 1:1000; Ku70 (N3H10), 1:1000; KAP-1, 1:1000; PhS824-KAP-1, 1:1000; Ku70 (A11223), 1:2000; Ku80 (111), 1:1000; LIG4, 1:1000; nucleolin, 1:1000; SAF-A, 1:500; Ubiquitin, 1:1000; Vinculin, 1:1000) diluted in PBS-T containing 1 % or 2.5 % bovine serum albumin (immunoglobulin- and lipid-free fraction V, Sigma-Aldrich) and washed 3 times with PBS-T; membranes were incubated for at most 1 h with HRP-conjugated secondary antibodies (1:10000) in PBS-T and washed three times with PBS-T. Immuno-blots were either visualized using autoradiography films or a ChemiDoc CCD imager (Bio-Rad) together with enhanced chemiluminescence (WesternBright ECl, Advansta), or by imaging membranes on an Amersham Imager 600 (GE Healthcare) with HyGLO Quick Spray (Denville Scientific).

Transcription assay

The pUC18-GFP plasmid (deposited on Addgene) was produced by cloning using a EcoRI+BamHI digestion a minimal transcription unit for GFP expression, consisting of the small SV40 promoter, the GFP ORF and the BGH polyadenylation signal, generated by PCR assembly. For use as a control, a pUC18-LucFF plasmid (deposited on Addgene) was also generated by replacing the GFP ORF by the firefly luciferase ORF. The linear GFP substrate was generated from the pUC18-GFP by PCR with DreamTaq (Thermo Fisher Scientific) according to manufacturer’s instructions using the following amplification program: 95°C 90 s, 36 cycles (95°C 30 s, 68C 30 s, 72°C 76 s) and 72°C 5 min and the phosphorothioate-modified SV40-F and BGH-R primers (see Table S1). The PCR product was purified after migration on a 1 % agarose TAE 0.5X gel using the Wizard PCR Clean-Up system (Promega) according to manufacturer’s instructions. For transfections, U2OS cells were seeded in 60 mm dishes (800,000 cells for U2OS WT and LIG4-KO, and 900,000 cells for LIG4/PKcs-KO) 24 h prior transfection using lipofectamine 2000 (Thermo Fisher Scientific) following manufacturer’s instructions. When indicated, cells were treated with the PKi nedisertib added after transfection and maintained until cell collection. When specified, mAID-Ku70 degradation was induced with 100 μM IAA, added 19 h before transfection. IAA was maintained after transfection until cell collection. 4.9 μg DNA was transfected per dish containing a 1:1 molar ratio of pmCherry-N1 (Clontech) and of the pUC18-GFP or linear GFP substrate. 24h after transfection, cells were trypsinised, collected in cold medium and then centrifuged at 4°C at 1000 RPM for 5 min. Cells were resuspended in cold PBS containing 1 % bovine serum albumin (PBS-1 % BSA), centrifuged at 1000 RPM at 4°C for 5 min and fixed by incubation for 15 min at room temperature in 2 % paraformaldehyde in PBS. After addition of PBS 1 % BSA, the cells were centrifuged at 1000 RPM at 4°C for 5 min, washed in PBS 1 % BSA and resuspended in PBS 1 % BSA before analysis on LSRII Fortessa X20 (Becton Dickinson). A minimum of 300,000 cells were acquired per condition. Data were analyzed and formatted using FlowJo v10.8.1.

Pull-Down of the GFP reporter substrate

The biotinylated substrate was produced using 5’ biotinylated and phosphorothioate-modified Biot-SV40-F and Biot-BGH-R primers (see Table S1) and the same PCR conditions than for the non-biotinylated substrate (see the chapter “Transcription assay”). For transfections, LIG4-KO and LIG4/PKcs-KO cells were seeded in 60 mm dishes the day before and transfected using a maximum of 4 μg of the indicated substrate together with 8 μL of Lipofectamine 2000 (Thermo Fisher Scientific) in 1 mL of OptiMEM (Thermo Fisher Scientific). Total cell count of each cell line was determined to normalize the quantity of substrate transfected. This mix was then added to the cells in 2 mL of DMEM 5 % FBS. 4 h after, cells were washed with PBS and scrapped in PBS lysis buffer (PBS 1X, 0.1 % Triton X-100, 5 mM EDTA) supplemented with a cocktail of proteases/phosphatases inhibitors (HALT, 2X, Thermo Fisher Scientific). Extracts were then centrifuged 5 min at 15,000 RPM and the pull-down was performed by incubating for 90 min at 4°C on a rotating wheel 25 μL of M280 streptavidin-coupled magnetic beads (Thermo Fisher Scientific, washed twice with PBS Lysis buffer) with 1 mg (as measured with Bradford protein assay, Bio-Rad) of the extract supernatants diluted in PBS lysis buffer. The beads were then washed 3 times with PBS supplemented with 150 mM NaCl (300 mM Na/KCl final) and containing 5 mM EDTA, 0.1 % Triton X-100 and 1X HALT and once in PBS lysis buffer. The beads were finally resuspended into 10 μL of PBS lysis buffer to which was added 20 μL of SDS lysis buffer (120 mM Tris-HCl pH 6.8, 4 % SDS, 20 % glycerol) and 10 μL of a DTT/loading solution (10 mM Tris-HCl pH 6.8, 400 mM DTT, 0.02 % Bromophenol Blue). Input, corresponding to 50 μg of proteins, were prepared in 10 μL of PBS lysis buffer supplemented in a manner similar to the beads. After heating 5 min at 95°C, bead supernatant and inputs were analyzed by immunoblotting. Image Lab Software (Bio-Rad) was used to quantify Ku70 intensity in each condition.

Flow cytometry

1.106 cells were seeded in 60 mm dishes and treated 24 h later as specified. Cells were washed with PBS, trypsinised, collected with cold DMEM, and centrifuged 5 min with 400 g at 4°C. Cells were again washed with cold PBS, centrifuged 4 min with 400g at 4°C and pre-extracted on ice for 10 min with PBS containing 0.2 % Triton TX-100. After PBS 1 % BSA addition, cells were fixed 15 min at RT in 500 μL PBS containing 2 % paraformaldehyde. PBS 1 % BSA was added to stop the reaction, cells were washed with PBS 1% BSA and resuspended in 100 μL of PBS-T 5 % BSA containing primary antibody (RPA32, 1:100; PCNA, 1:500) for 1h at RT. After PBS-1% BSA addition, cells were incubated 30 min in 200 μL of PBS-T 5% BSA containing secondary antibody (AlexaFluor488-coupled goat anti-mouse and AlexaFluor594-coupled goat anti-rabbit, 1:200 for both) at RT and obscurity. PBS 1 % BSA was added in each condition and cells were finally incubated at least 30 min in PBS containing 0.25 mg/mL RNAse A and 2 μg/ml DAPI. A minimum of 40,000 cells were processed by a BD LSRII flow cytometer (Becton Dickinson). FlowJo v10.8.1 was used to analyze and format data.

Egg extract preparation and immunodepletion

High-speed supernatant (HSS) of egg cytosol was prepared as described previously.57 For DNA-PKcs immunodepletion, antibodies, described below, were bound to protein A sepharose beads at a ratio of 20 μg antibody per 1 μL beads. For Ku80, antibodies were bound to the beads at a ratio of 4 μg antibody per 1 μL beads. For XLF and XRCC4 depletions, antibodies were bound to the beads at a ratio of 3 μg antibody per 1 μL beads. Beads were extensively washed with egg lysis buffer with sucrose (ELBS; 10 mM HEPES, pH 7.7, 50 mM KCl, 2.5 mM MgCl2, 250 mM sucrose). Extract was supplemented with nocodazole to a final concentration of 7.5 ng/ml and one volume of extract was incubated for 3 rounds with 1/3 volume (for DNA-PKcs) or 1/5 volume (for Ku80) of antibody-bound beads for 60 min per round on a rotator at 4°C. Beads were pelleted by centrifugation at 2000 g after each round, and extract was collected with a standard P200 pipette tip followed by an ultrafine gel-loading tip. The immunodepleted extract was then centrifuged for 5 min 16000 r.f.c. at 4°C and supernatant was transferred to a new tube.

Antibody preparation

For egg extract experiments, rabbit polyclonal antibodies raised against the following X. laevis proteins were previously described for Ku80, XLF, XRCC4, DNA-PKcs (Graham et al., 2016), and Histone H3 (Cell Signaling Technology). DNA-PKcs antibody was affinity purified from rabbit serum by coupling recombinant DNA-PKcs PIKK-FATC antigen40 to AminoLink Coupling Resin (Thermo Fisher Scientific) and following manufacturer’s instructions for IgG purification. For immunoblotting, antibodies were used at the following concentrations: α-Ku80 1:10000, 1:5000 dilution of concentrated hybridoma supernatant containing α-DNA-PKcs 42–27 mouse monoclonal antibody (a kind gift of Prof. Katheryn Meek, Michigan State University), α-H3 1:500.

Halo-Ku80/Ku70 preparation

Plasmid generation

N-terminally Halo-tagged Ku80 was cloned into pFastBac1 by PCR amplifying Halo tag coding sequence from pTG344 using primers oAM082 and oAM083 (see Table S1) and PCR amplifying pFastBac1 plasmid pTG246 containing X. laevis Ku8040 using primers oAM084 and oAM085, followed by Gibson assembly with HiFi DNA Assembly Master Mix (Invitrogen). To generate N-terminally His-Halo tagged Ku80 in pACEBac1, Halo-tagged Ku80 was PCR amplified from pAM047 using primers oAM107 and oAM108 and inserted into pACEBac1 cut with NotI by Gibson assembly. The cDNA encoding X. laevis Ku70 was cloned into pIDK by PCR amplifying Ku70 from pTG284 using primers oAM111 and oAM112 (see Table S1) and inserted into pIDK cut with XhoI and KpnI by Gibson assembly. The His-Halo-Ku80 DNA and Ku70 were cloned into a single expression plasmid (pAM086) using the MultiBac system.58 The bacmid encoding Halo-Ku80/Ku70 complex was obtained by electroporating pAM086 into DH10EMBacY electro-competent cells and purified using ZR BAC DNA miniprep kit (Zymo Research).

Purification of His-Halo-Ku80:Ku70

Baculovirus encoding Halo-Ku80/Ku70 was amplified in three stages (P1, P2, and P3) in Sf9 cells (Expression Systems). To express X. laevis Halo-Ku80/Ku70, Sf9 cells at a density of 2 × 106/mL in 500 mL of Sf900 III serum-free medium (Invitrogen) were infected with 5–10 mL P3 baculovirus (MOI > 1). Cells harvested 60 h post-infection were pelleted at 500 × g for 15 min, washed with phosphate-buffered saline (PBS; 135 mM NaCl, 2.7 mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4; Teknova), and centrifuged again for 5 min at 500 g at 4°C. Pellets were flash-frozen in liquid nitrogen and stored at −80°C. Thawed cell pellets were resuspended in ~5 volumes lysis buffer (20 mM Tris-HCl pH 8, 1 M NaCl, 20 mM imidazole, 10 % glycerol, 0.2 % Triton X-100, 5 mM β-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride, and cOmplete protease inhibitor cocktail tablet (Sigma-Aldrich)). Cells were lysed by sonication on ice and the insoluble fraction was pelleted via centrifugation for 1 h at 40,000 g at 4°C. The clarified lysate was incubated with 0.5 mL NiNTA resin (QIAGEN) for 1 h at 4°C on a rotary. The resin was washed 3 times with 10 mL of lysis buffer in a disposable column. The protein was eluted in 10 rounds with 500 μL/each of Lysis buffer + 250 mM Imidazole; the elutions were pooled and concentrated using 50kDa MWCO centrifugal concentrator (Millipore). Recombinant Halo-Ku80/Ku70 was further purified on a HiTrap Q HP 1 mL column (Cytiva) connected to an AKTA Pure FPLC with a 100–1000 mM NaCl gradient in 25 mM Hepes pH 7.8, 10 % glycerol, 1 mM DTT, 0.05 mM EDTA buffer. The eluted protein was buffer exchanged into storage buffer (25 mM Hepes pH 7.8, 300 mM NaOAc, 1 mM DTT, 0.5 mM EDTA, 10 % glycerol) using 50 kDa MWCO centrifugal concentrator (Millipore), concentrated to ~10 μM, frozen in liquid nitrogen, and stored at −80°C.

Fluorescence labeling of Halo-Ku80/Ku70

A fivefold molar excess of sulfo-Cy5-Halo ligand in DMSO was added to Halo-Ku80/Ku70 protein in its storage buffer. Preparation of sulfo-Cy5-Halo substrate was previously described.59 The mixture was incubated for 20 min at 4°C on a rotator and then centrifuged at 16,000 r.c.f. at 4°C. Labeled protein was separated from free dye on a Superdex 200 Increase 10/300 column equilibrated with storage buffer. Peak fractions were pooled and concentrated with a 50 kDa MWCO centrifugal concentrator. To determine protein concentrations absorbance at 280 nm was corrected for Cy5 absorbance at 280 nm and calculated assuming an extinction coefficient of 129,150 M−1 cm−1 at 280 nm. Dye concentrations were calculated according to absorbance at 650 nm for Cy5 (assuming an extinction coefficient of 250,000 M−1 cm−1). The degree of Halo-Ku80/Ku70 labeling was obtained by division of the dye molar concentration by the protein molar concentration.

Endogenous DNA-PKcs purification from egg extract

A biotinylated 19 bp duplex was prepared by combining 6 nmol each of oAM094 and oAM571 (see Table S1), in 200 μL anneal buffer (20 mM Tris-HCl, 300 mM NaCl, 1 mM EDTA), and placed in a 2 L beaker containing water heated to 85°C that was allowed to cool overnight. Streptavidin-sepharose beads (300 μL, Cytiva) were washed twice with 2x Bead Wash Buffer (10 mM Tris, pH 7.4, 2 M NaCl, and 20 mM EDTA), and resuspended in 0.5x Bead Wash Buffer containing 1.32 nmol of biotinylated DNA and rotated for 1 h at 4°C. The DNA-bound magnetic beads were then extensively washed with Bead Wash Buffer, followed by washing with Blocking Buffer (10 mM Hepes, pH 7.7, 50 mM KCl, 2.5 mM MgCl2, 250 mM sucrose, and 0.02 % Tween-20). Beads were then resuspended in 500 μL Blocking Buffer. Prepared HSS stored at −80°C was thawed, 4 aliquots of 1 mL, supplemented with nocodazole to a final concentration of 7.5 ng/mL, and centrifuged for 10 min at 16800 r.c.f. in a 4°C chilled centrifuge. The supernatant was transferred to a new tube and centrifuged for an additional 10 min at 16800 r.c.f.. The supernatant from the extract was diluted with 3.5 mL of Blocking Buffer, mixed with 0.5 mL of DNA-beads, and placed on ice, inverting the tube every 30 seconds to keep DNA-beads in suspension during a 4 min incubation. The DNA beads were then pelleted by centrifugation at 400 g for 30 s in a chilled centrifuge. The beads were resuspended in 1 mL cold Blocking Buffer and transferred to a polypropylene column. The DNA beads were washed with 10 mL of cold Blocking Buffer at 4°C followed by washing with 8 mL of cold Blocking Buffer containing 100 mM NaOAc at 4°C. DNA-PKcs was eluted from the DNA beads using a gradient of 150 to 600 mM NaOAc in Blocking Buffer. Q-sepharose fast flow resin, 500 μL (GE Healthcare), was washed twice with 2x Bead Wash Buffer (10 mM Tris, pH 7.4, 2 M NaCl, and 20 mM EDTA), followed by extensive washing with Q-dilution Buffer (20 mM Tris, pH 8.0, 10 % sucrose, 0.02 % Tween-20, and 10 mM EDTA). Fractions containing DNA-PKcs were pooled and concentrated to a final volume of 50 μL using 100 kDa MWCO spin concentrator (Millipore) centrifuging 5000 r.c.f. at 4°C. The concentrated eluate from DNA-sepharose resin, was diluted with 5 mL of Q-dilution Buffer, mixed with 500 μL of Q-sepharose resin, and incubated on ice for 4 min. The resin was then transferred to a polypropylene column (Qiagen) and washed with 8 mL Q-binding Buffer (20 mM Tris, pH 8.0, 40 mM NaOAc, 10 % sucrose, 0.02 % Tween-20, and 10 mM EDTA). DNA-PKcs was eluted from the Q resin using a gradient of 100 to 600 mM NaOAc in Q-binding Buffer. Fractions containing DNA-PKcs were pooled and concentrated to a final volume of 50 μL using 100 kDa MWCO spin concentrator (Millipore) centrifuging 5000 r.c.f. at 4°C. Purified DNA-PKcs was stored on ice at 4°C and used within the next 24 h.

Bulk end-joining assay

Substrate preparation

Plasmid pAM089 was linearized by cleavage with EcoRI-HF (New England Biolabs), separated on a 1x TBE agarose gel and extracted by electroelution. DNA was labeled by fill-in of EcoRI overhangs with the DNA polymerase I Klenow fragment (New England Biolabs) in the presence of [α−32P] dATP (Perkin Elmer), dTTP, dCTP, and dGTP incubating for 15 min at 25°C. Labeled DNA was purified using a spin column PCR purification kit (Qiagen) and eluted with 10 mM Tris-HCl, pH 8.0.

End-joining assay

The bulk end-joining assay was performed as described previously.40 Briefly, extracts were supplemented with the following (final concentrations in parentheses): closed-circular DNA pAM089 (30 ng/μL) and ATP regeneration mixture ATP (3 mM); phosphocreatine (15 mM); creatine phosphokinase (0.01 mg/mL; Sigma-Aldrich). For rescue experiments, extract was supplemented with HaloKu80/Ku70 (300 nM). For experiments to examine effect of Cullin inhibitor on end-joining extracts were supplemented with either Cullin neddylation inhibitor MLN4924 (200 μM) or DMSO vehicle control and incubated on ice for 5 min. The mixture was incubated for 5 min at room temperature and then placed back on ice. To initiate the reaction 1 μL of 20 ng/μL radiolabeled linear substrate DNA was added to the extract, and 2 μL sample (0 min)was withdrawn while the reactions were on ice and mixed with 5 μL stop solution (80 mM Tris [pH 8], 8 mM EDTA, 0.13 % phosphoric acid, 10 % Ficoll, 5 % SDS, 0.2 % bromophenol blue) and 1 μg proteinase K. Reactions were transferred to room temperature, and additional 2 μL samples were withdrawn at the indicated times and mixed with 5 μL stop solution and 1 μg proteinase K. Samples were digested at 37°C for a minimum of 1 h, and products were separated by electrophoresis on a 13 Trisborate-EDTA, 0.8% agarose gel. Gels were sandwiched between filter paper and a HyBond-XL nylon membrane (GE Healthcare), dried on a gel dryer, and exposed to a phosphorscreen, which was imaged with Typhoon FLA 7000 imager (GE Healthcare Life Sciences).

DNA pulldown assay

The DNA pulldown assay was largely performed as previously described.60 The protocol with modifications is briefly described below. A Cy3-labeled 100bp duplex with biotin molecules attached to the5’ termini, generated for single-molecule experiments, was the DNA substrate used in pulldown experiments. Streptavidin-coated magnetic beads (M-280, Thermo Fisher Scientific) (96 μL per biological replicate) were washed twice in 2x Bead Wash Buffer (10 mM Tris, pH 7.4, 2 M NaCl, and 20 mM EDTA), and resuspended in 1x Bead Wash Buffer containing 1.1 pmol of biotinylated DNA and rotated for 20 min at 4°C. The DNA-bound magnetic beads were then washed 3x with 2x Bead Wash Buffer and twice with Blocking Buffer (10 mM HEPES, pH 7.7, 50 mM KCl, 2.5 mM MgCl2, 250 mM sucrose, and 0.02 % Tween20). Beads were then resuspended in 120 μL of Blocking Buffer and aliquoted, 10 μL per a sample. Extract was supplemented with the ATP regeneration mixture, ATP (3 mM); phosphocreatine (15 mM); creatine phosphokinase (0.01 mg/mL; Sigma-Aldrich), and 30 ng/mL of circular pBlueScript II plasmid to act as carrier DNA.57 To maximize ubiquitination signal, extracts were supplemented with p97 inhibitor NMS-873 (200 μM). Effects of Cullin inhibition on Ku80 ubiquitination were examined by supplementing extracts with either Cullin neddylation inhibitor MLN4924 (200 μM) or DMSO vehicle control. The extracts were then incubated on ice for 5 min. To initiate assembly of the NHEJ machinery, the DNA-beads sample was mixed with an equal volume of extract and incubated at room temperature. At a given timepoint the reaction was then layered over 200 μL of Sucrose cushion (10 mM HEPES, pH 7.7, 50 mM KCl, 2.5 mM MgCl2, 500 mM sucrose) in Beckman microfuge tube (5 × 44 mm) and centrifuged for 1 minute at 16800 r.c.f. in a swinging bucket centrifuge (Eppendorf, 5430R). The sucrose-cushion was aspirated off and the pelleted DNA-beads were then washed in 200 mL of Egg Lysis Blocking Buffer and resuspended in 20 mL of 1x reducing Laemmli sample buffer. Extract was diluted 1:40 in 1x reducing Laemmli sample buffer to be used as input sample for western blotting. Samples were separated on a 4–15 % precast SDS-PAGE gel (BioRad) for 30 min at 200V and western blots were performed as outlined above.

Single-molecule imaging and analysis

Substrate preparation

The Cy3-labeled biotinylated 100 bp duplex was prepared by combining 1 nmol each of oTG048F, oTG415, oTG532, and oTG533 (see Table S1) in 50 μL anneal buffer (20 mM Tris-HCl, 300 mM NaCl, 1 mM EDTA) and placed in a 2-liter beaker containing water heated to 90°C that was allowed to cool overnight. Nicks were sealed by adding 10 μL 10x T4 DNA ligase buffer and 2 μL T4 DNA ligase (New England Biolabs) and incubating overnight at 16°C. The ligated product was separated on a 0.5x TBE, 8 % polyacrylamide (19:1 bis-acrylamide:acrylamide) gel running at 200 V, 4°C. The band corresponding to the full-length 100 bp DNA was observed by UV shadow and excised from the gel. The gel slice was cut into small fragments suspended in 500 μL 1x TE, and DNA was electroeluted using Elutrap System (Whatman). The DNA eluate was lyophilized and suspended in TE.

Preparation of calibration substrate

The calibration substrate used for channel alignment consists of Cy5 and Cy3 labeled 60 bp duplex and was made as previously described.61

Flow cell preparation

Coverslips were prepared as previously described.61 Briefly, glass coverslips were cleaned by sonication in methanol, washed with DI H2O, and incubated for 1 hour with piranha solution (3:1 mixture of sulfuric acid and 30 % hydrogen peroxide). The piranha solution was removed, and coverslips were again washed with DI H2O. The coverslips were then functionalized with a mixture of methoxypolyethylene glycol succinimidyl valerate, MW 5,000 (mPEG-SVA-5000; Laysan Bio, Inc.) and biotin-methoxypolyethylene glycolsuccinimidyl valerate, MW 5,000 (biotin-PEG-SVA-5000; Laysan Bio, Inc.) as previously described.59

Microfluidic chambers were assembled as follows: 4.5 mm wide piece of double-sided SecureSeal Adhesive Sheet (Grace BioLabs) was placed parallel on each side of holes drilled 10 mm apart in a glass microscope slide. A functionalized coverslip was then secured to the other side of the adhesive sheet and the edges of the coverslip were sealed with epoxy (Devcon). The microfluidic chamber was assembled by inserting PE20 tubing into one hole, PE60 tubing into the other (Intramedic), and fixing in place with epoxy. The microfluidic cells were stored under vacuum until time of use.

Single-molecule imaging

A through-objective TIRF microscope configured around an inverted Olympus IX-71 microscope was used to image fluorescent molecules. Laser beams 532 nm (Coherent Sapphire 532) and 641 nm (Cube 641) were expanded and then combined using dichroic mirrors. The colinear beams were expanded and focused onto the rear focal plane of an oil-immersion objective (Olympus UPlanSApo, 100 3; NA, 1.40). For TIRF illumination a focusing lens was translated in the vertical plane. A multipass dichroic mirror separated emission from excitation light, followed by a StopLine 488/532/635 notch filter (Semrock) to further reduce excitation light. A home-built beamsplitter59 separates emission from Cy3 and Cy5 to image on separate halves of an EMCCD camera (Hamamatsu, ImageEM 9100–13) operating at maximum EM gain. The focus was adjusted manually, and the sample was positioned on the microscope using an automated microstage (Mad City Labs).

Calibration data collection

The flow cell chamber was passivated with 30 μL PBS-BSA buffer (1.0 mg/mL BSA (NEB) in PBS) for 5 min, followed by 5 min incubation with 25 μL 0.2 mg/mL streptavidin in PBS. The flow cell was then washed with PBS-BSA. The calibration substrate, 5-prime biotinylated 60 bp dsDNA labeled with Cy5 and Cy3, was diluted to ~80 pM in PBS, containing oxygen scavenging system and triplet-state quencher system: protocatechuic acid (PCA; 5 mM; Sigma-Aldrich), protocatechuate 3,4-dioxygenase (PCD; 0.1 mM; Sigma-Aldrich), and Trolox (6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; 1 mM; Sigma-Aldrich). The biotinylated, fluorescent DNA substrate was immobilized on a glass coverslip in a microfluidic chamber. Images were acquired of different fields of view (~120) with 0.5 sec simultaneous exposure to 532 and 641 nm lasers using a surface power density of 4 mW/cm2 for the 532 nm laser and 2.4 mW/cm2 for the 641 nm laser.

Single-molecule stoichiometry

The flow cell chamber was passivated with PBS-BSA buffer (1.0 mg/mL BSA; NEB) in PBS for 5 min, followed by 5 min incubation with streptavidin (0.2 mg/ml; Sigma-Aldrich) in PBS. The flow cell was then washed with PBS-BSA and the 5-prime biotinylated 100 bp dsDNA labeled with Cy3 (~80 pM) in PBS and immobilized on the glass coverslip. The chamber was then washed with egg lysis buffer (ELB wash; 10 mM HEPES, pH 7.7, 50 mM KCl, 2.5 mM MgCl2). For extract Halo-Ku80/Ku70 stoichiometry experiments, extracts were supplemented with the following (final concentrations in parentheses): either Cullin neddylation inhibitor MLN4924 (200 μM) or DMSO vehicle control and incubated on ice for 5 min. To Ku-immunodepleted extract, Cy5 labeled HaloKu80/Ku70 (20 nM), closed-circular DNA pAM089 (30 ng/μL), ATP (3 mM), phosphocreatine (150 mM), and creatine phosphokinase (0.01 mg/ml; Sigma-Aldrich) was added and incubated for 5 min at room temperature. The reaction mixture was then placed on ice and supplemented with oxygen scavenging system and triplet-state quencher PCA (4 mM), PCD (0.08 μM), and Trolox (1 mM). The flow cell was then washed with ELB wash containing PCA (5 mM), PCD (0.1 μM), and Trolox (1 mM). Extract was introduced to the chamber and incubated for 60 min. The flow cell was then washed with ELB wash containing PCA (2.5 mM), PCD (0.05 μM), and Trolox (1 mM). Images were then taken continuously at a rate of 20 frame/s for ~90 s, alternating between four frames of 641 nm excitation and one frame of 532 nm excitation with surface power densities of 4 mW/cm2 for 532 nm and a 641 nm laser power that was adjusted for photobleaching >95 % of Halo-Ku80/Ku70 by the end of the movie. Experimental conditions for in vitro minimal reconstitutions involving Halo-Ku80/Ku70 were the same as above except extract were replaced with ELB wash buffer and Cy5 labeled HaloKu80/Ku70 (20 nM) was incubated with 60 nM of NHEJ factors in ELB wash containing 10 % volume storage buffer (20 mM Tris, pH 8.0, 300 mM NaOAc, 10 % sucrose, 0.02 % Tween-20, and 10 mM EDTA) on ice for 5 min before addition to flow cell. For DNA-PKcs kinase inhibition Halo-Ku80/Ku70 stoichiometry experiments, samples were supplemented with DNA-PKcs inhibitor NU7441 (125 μM) and incubated on ice for 5 min. Endogenous DNA-PKcs was purified as described above, recombinant XLF and LIG4-XRCC4 were purified as previously described.8,60 For each experiment, Halo-Ku80/Ku70 photobleaching was recorded for a minimum of 5 different fields of view.

Single-molecule stoichiometry Image analysis

Channel alignment of the 532 nm and 641 nm channels was done as previously described.61 Briefly, a custom MATLAB script was used to identify fluorescent molecules in the 532 and 641 emission channels based on local maximum and particles were fit using a 2D Gaussian. For each image, spots whose coordinates are greater than 6 pixels from surrounding molecules and are within 6 pixels of a molecule in the corresponding channel are added to the calibration list. The calibration list is then refined based on spot diameter and amplitude. A final calibration list is made using a previously described method.62 Briefly, for each reference image spot coordinates x1,y1 in the 532 nm emission channel are mapped onto coordinates x2,y2 in 641 emission channel to identify a matching partner spot using the transformation Equation 1 (for x) and Equation 2 (for y): (Equation 1) x2=Ax1+By1+C

(Equation 2) y2=Dx1+Ey1+F

where A–F are fit parameters. Because the field of view is non-uniform, the fit parameters are determined for each spot coordinate x1,y1 by fitting pairs of corresponding points from the initial calibration list that are within a defined pixel box from x1,y1. A spot that maps greater than 3 pixels from all spots in 641 nm channel is removed from the calibration list. This process is repeated for spots in 641 nm channel, mapping coordinates onto 532 nm channel using the updated calibration list. The 641 nm Channel spots that are within 3 pixels of to its 532 nm channel partner are retained in the calibration list. The calibration list is further refined by iteratively repeating the above process while reducing the pixel threshold from 3 to 0.5 pixels.

Detection and quantification of Halo-Ku80/Ku70 stoichiometry

Analysis of single-molecule Cy5 labeled Halo-Ku80/Ku70 stoichiometry were performed using the following steps. The ROIs for tethered DNAs were identified after averaging the first 5 images with 532 nm excitation in the Cy3 channel using the method described in Alignment of the Cy3 and Cy5 Channels. To examine the non-specific interaction between Halo-Ku80/Ku70 and the coverslip, control ROIs were picked that were > 6 pixels from tethered DNAs. The position of ROIs in the Cy5 channel for tethered DNA and control ROIs were identified using the calibration list and the transformation method described in Alignment of the Cy3 and Cy5 Channels. Stage drift was estimated using the average change in x and y position between successive frames for particles in the 532 nm channel and ROI positions were translated to compensate. In each of the 641 nm excitation frames, Cy5-labeled Halo-Ku80/Ku70 localized spots were detected using the algorithm described above and were fit to a 2D Gaussian. Integrated intensities for Cy5-Halo-Ku80/Ku70 emission signal for tethered DNA ROI was used to identify Halo-Ku80/Ku70 stoichiometry as outlined with the following method. The trajectories for Cy5 emission were first smoothed using a moving average followed by identification of the last bleaching changepoints event and median background intensity using the built-in MATLAB function ischangepts, which identifies abrupt changes in the mean that is above a specified threshold by minimization of a cost function. For each trajectory, the median background intensity was subtracted and was then normalized to the immediate state preceding complete loss of Cy5 signal. The abrupt changepoints in mean intensity were then identified in the normalized trajectory. The identified changepoints are classified as bleaching events if the following conditions are satisfied: (1) a 15 % decrease in intensity at the identified changepoint, (2) the intensity of the preceding state must be four standard deviations above the mean Cy5 background threshold. The number of bleaching events (see Table 1) was then used to define the number of Ku70/Ku80 molecules bound to DNA. To obtain the fractional occupancy of Ku70/80 on DNA ends plots (Figure 2 and Figure S5), for each experiment the distribution of bound Ku70/Ku80 was normalized to the number of immobilized DNA substrates. Normalized histograms (Figures 2B–2F) are constructed from mean fractions per occupancy bin calculated in 3 independent experiments with the standard deviation indicated by the error bars (+/− SD). Histograms of the normalized initial state intensity are constructed from initial state mean Cy5 intensity for each immobilized DNA with bound Ku70/Ku80 molecules; the initial state is defined by first identified bleaching event. Histograms of the normalized final state intensity are constructed from the immobilized DNA with a bound Ku70/Ku80 molecules using the mean final state Cy5 intensity preceding Cy5 signal loss. Histograms of the normalized bleached state intensity are constructed from the immobilized DNA with bound Ku70/Ku80 molecules using the mean intensity following Cy5 signal loss.

QUANTIFICATION AND STATISTICAL ANALYSIS

Displayed uncertainties in all graph correspond to standard deviation (SD). For SIM imaging experiments and streptavidin pull-down assays, statistical analysis was performed on at least 3 independent experiments using a ratio paired t-test. For the transcription assay, a paired t-test was performed on at least 3 independent experiments. On the graphs, the data of each individual experiment are indicated with a symbol which is shared between the different conditions depicted on the graph. P-values were pictured as follow: ns p > 0.05, * p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001.

Supplementary Material

1

ACKNOWLEDGMENTS

We acknowledge the TRI-IPBS Microscopy and Cytometry facilities (Genotoul-TRI), members of the national infrastructure France-BioImaging infrastructure supported by the French National Research Agency (ANR-10-INBS-04), and Hannah Careless for performing the first analyses with the GFP reporters. This work was supported by the Ligue Contre le Cancer as Equipe Labellisée 2018 (S.B., P. Calsou, and P.F.), La Ligue contre le Cancer Comité Midi-Pyrénées (to S.B.), la Fondation pour la Recherche Médicale (to M.B.), and National Institutes of Health grant R01GM115487 (to J.J.L.). We thank Sylvain Cantaloube (CBI, Toulouse) for technical assistance with STORM imaging. P. Calsou and M.-J.P. are scientists from INSERM. We thank Johannes Walter and his laboratory for access to their frog facility, for sharing reagents, and for helpful discussions.

Figure 1. DNA-PKcs presence but not activity limits Ku accumulation at DSBs

(A) Immunoblot of U2OS cells that are wild type (WT) or knocked out for the indicated genes. See Figure S1A for the IR sensitivity analysis of each of these cells.

(B) WT, PKcs-KO, LIG4-KO, or LIG4/PKcs-KO received 5 Gy of IR before being post-incubated 5 or 60 min and processed for Ku foci imaging. Representative pictures are shown on the left. Ku foci intensity was measured and normalized to the average Ku foci intensity measured after 5 Gy of IR in WT U2OS to compute the fold change in Ku foci intensity in each condition, depicted on the graph on the right.

(C) WT or PKcs-KO U2OS cells received 5 Gy of IR and were post-incubated for 60 min before being processed for Ku foci imaging. Cells were pre-treated with nedisertib (PKi) for 1 h before treatment where indicated. Fold change in Ku foci intensity in each condition is displayed.

(D) PKcs-KO or LIG4-KO U2OS cells received 5 Gy of IR and were post-incubated for the indicated time with or without NEDi before being processed for Ku foci imaging. Representative pictures are shown on the left, while the ratio between the changes in Ku foci intensity with NEDi versus without NEDi (DMSO) are shown in the graph on the right. The graph depicting the fold change in Ku foci intensity in each condition corresponds to Figure S1C.

(E) WT, PKcs-KO, LIG4-KO, or LIG4/PKcs-KO U2OS cells received 5 Gy of IR and were post-incubated for 5 or 60 min with or without NEDi before being processed for Ku foci imaging. Representative pictures are shown on the left, while the ratio between the change in Ku foci intensity with NEDi versus without NEDi (DMSO) is plotted in the graph on the right. The graph in Figure S1D depicts the fold change in Ku foci intensity in each condition.

(F) WT, PKcs-KO, or LIG4-KO U2OS cells incubated with 3 μM NU7441 (PKi) were treated with 3 nM Cali for 1 h with or without NEDi before being collected and processed to separate the chromatin fraction from the soluble fraction, which were both analyzed by immunoblotting. SAF-A and nucleolin were used as loading controls for the chromatin and the soluble fraction, respectively.

(G) Control (immunoglobulin G [IgG]) or anti-Ku immunoprecipitation was performed from the soluble fractions of PKcs-KO U2OS to monitor Ku ubiquitination in response to Cali with or without NEDi.

For all panels, error bars represent SD from the means of n ≥ 3 independent experiments. p values are as follow: ns p > 0.05, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001. Scale bars, 5 μm.

Figure 2. DNA-PKcs prevents Ku overloading onto a single DNA end

(A) Scheme depicting the single-molecule assay used to quantify Ku loading on DNA in the presence or the absence of DNA-PKcs. A Cy3-labeled 100 bp DNA substrate was attached to a glass surface and incubated for 60 min with Cy5-labeled Xenopus Halo-Ku80:Ku70 alone or in non-cycling Xenopus eggs extracts. After incubation and washout of the oxygen scavenger, the photobleaching of individual Ku molecules was monitored under continuous illumination, and the number of bleaching steps was used as a readout of the number of Ku molecules on DNA.

(B) Representative trajectories highlighting photobleaching events for Halo-Ku80:Ku70 bound to DNA in buffer. Representative trajectories for each condition are shown in Figure S3J.

(C–H) Normalized histograms depicting the fractional occupancy of Ku70/80 on DNA ends, constructed from mean fractions per occupancy bin calculated in 3 independent experiments. The number of events and total number of molecules observed for each experiment are reported in Table 1. (C) The number of Ku molecules was monitored as described in (A) using purified Cy5-labeled Ku incubated in egg lysis buffer (ELB) wash buffer. (D) The number of Ku molecules was monitored as described in (A) using Xenopus egg extracts containing Cy5-labeled Ku. (E) The number of Ku molecules was monitored as described in (A) using Xenopus egg extracts immunodepleted for DNA-PKcs (ΔDNA-PKcs) and containing purified Cy5-labeled Ku. (F) The number of Ku molecules was monitored as described in (A) using Xenopus egg extracts immunodepleted for XLF and XRCC4 (ΔXLF/ΔXRCC4) and containing purified Cy5-labeled Ku. (G) The number of Ku molecules was monitored as described in (A) using purified Cy5-labeled Ku mixed with 60 nM LIG4-XRCC4 and 60 nM XLF and incubated in ELB wash buffer. (H) The number of Ku molecules was monitored as described in (A) using purified Cy5-labeled Ku mixed with 60 nM DNA-PKcs and incubated in ELB wash buffer. For all panels, error bars represent SD from the means of n ≥ 3 independent experiments.

Figure 3. Different mechanisms limit Ku loading during the cell cycle

(A) PKcs-KO U2OS cells were pre-treated with NEDi, ATMi, or both and received 5 Gy of IR before being post-incubated for the indicated time and then processed for immunofluorescence. PCNA staining was used to identify the cells in S phase. Representative pictures are shown on the left, with insets at the bottom to illustrate the PCNA staining. Ku foci intensity was measured and normalized to the average Ku foci intensity in U2OS WT measured 5 min after 5 Gy of IR to compute the fold change in Ku foci intensity in each condition, displayed in the graph on the right.

(B) PKcs-KO U2OS cells were transfected with siRNA control or against FBXL12 before being treated and processed as described in (A). Representative pictures are shown on the left, with insets at the bottom to illustrate the PCNA staining. An immunoblot showing the depletion of FBXL12 is shown in Figure S5A, while the graph on the right shows the fold change in Ku foci intensity computed as in (A).

(C) PKcs-KO U2OS cells were transfected with siRNA control or against CtIP before being treated and processed as described in (A). Representative pictures are shown on the left, with insets at the bottom to illustrate the PCNA staining. An immunoblot showing the depletion of CtIP is shown in Figure S5E, while the graph on the right shows the fold change in Ku foci intensity computed as in (A).

For all panels, error bars represent SD from the means of n ≥ 3 independent experiments. p values are as follow: ns p > 0.05, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p < 0.0001. Scale bars, 5 μm.

Figure 4. DNA-PKcs deficiency impacts transcription at the DNA end vicinity

(A) Scheme depicting the linear substrate used to monitor Ku interference with transcription. The linear PCR product bears a minimal transcription unit coding for GFP with 5′ DNA ends protected against exonuclease by five phosphorothioate linkages. Upon transfection, Ku is expected to bind to the linear substrate DNA ends and by threading in to physically impede GFP transcription.

(B) WT, LIG4-KO, or LIG4/PKcs-KO U2OS cells were co-transfected with an mCherry-coding circular plasmid together with the circular (GFP unit inserted in a plasmid) or linear GFP-coding substrates for 24 h before being analyzed by flow cytometry. The graphs represent the percentage of GFP-positive cells among the cells successfully transfected, identified using the mCherry fluorescence.

(C) WT or LIG4/PKcs-KO U2OS cells, treated with PKi where indicated, were transfected and analyzed by flow cytometry as described in (B).

(D) LIG4-KO or LIG4/PKcs-KO U2OS cells were transfected with biotinylated (Biot.) or non-biotinylated (Non-biot.) linear substrates for 4 h before being lysed. The substrates with the associated proteins were recovered from the extracts using streptavidin pull-down and analyzed by immunoblotting. A 20th of the extracts used for pull-down was used as input control. The graph on the right corresponds to the quantification of the Ku70 signal, normalized to the input, from 3 independent experiments.

(E) WT or PKcs-KO U2OS mAID-Ku70 cells were treated for 8 h with IAA before being lysed and analyzed by immunoblotting.

(F) WT or PKcs-KO U2OS mAID-Ku70 cells were transfected and analyzed by flow cytometry as described in (B). Where indicated, cells were treated with PKi, and Ku degradation was induced with IAA, added 19 h before transfection. The graphs correspond to four independent experiments.

For all panels, error bars represent SD from the means of n ≥ 3 independent experiments. p values are as follow: ns p > 0.05, *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p < 0.0001.

Figure 5. Model summarizing the different barriers to Ku overloading

Upon DSB formation, Ku quickly loads on DNA ends.

(A) The formation of a Ku-DNA-PKcs complex physically restrains Ku entry into chromatin, enforcing the 1:1 Ku:DNA end stoichiometry.

(B) In the absence of DNA-PKcs, multiple Ku proteins can load and slide from the DNA end into chromatin. The progressive accumulation of larger amounts of Ku into chromatin is actively restricted by two mechanisms. In all cell-cycle phases (bottom left), Ku is evicted via its ubiquitination by an FBXL12-containing SCF complex whose activity relies on its neddylation. In S phase (bottom right), an ATM/CtIP-dependent mechanism overcomes Ku accumulation through DNA end resection. Ku ubiquitination also contributes to Ku removal in S phase.

Table 1. Single-molecule photobleaching events

Replicate	Tethered DNA-Ku complex (n)	Mean bound Ku (n)	SD(n)	(n) DNA bound by	
1 Ku	2 Ku	3 Ku	4 Ku	5 Ku	6 Ku	7 Ku	8 Ku	9 Ku	≥10 Ku	
	
Ku bound to 100-mer in buffer	
	
A	1,321	3	1.9	82	573	419	89	60	28	19	16	3	35	
B	1,196	4	2.4	67	379	405	129	59	39	34	20	17	64	
C	1,334	3	2.2	76	466	436	126	75	41	41	15	17	58	
	
Ku bound to 100-mer in buffer with 60 nM Lig4-XRCC4 and 60 nM XLF	
	
A	987	3	1.0	42	216	223	95	21	2	0	0	0	6	
B	775	3	1.2	127	297	155	133	57	6	0	0	0	6	
C	952	2	1.1	192	356	257	110	31	6	0	0	0	6	
	
Ku bound to 100-mer in buffer with 60 nM DNA-PKcs	
	
A	4,468	1	0.6	622	332	44	1	0	0	0	0	0	4	
B	309	1	0.9	241	31	20	14	3	0	0	0	0	5	
C	1,081	1	0.7	286	64	33	4	2	0	0	0	0	5	
	
Ku bound to 100-mer in buffer with 60 nM DNA-PKcs + PKi	
	
A	540	1	0.4	422	115	3	0	0	0	0	0	0	3	
B	540	1	0.4	386	110	2	0	0	0	0	0	0	3	
C	540	1	0.4	343	102	0	0	0	0	0	0	0	2	
	
Ku bound to 100-mer in Xenopus egg extract	
	
A	350	1	0.5	323	23	1	1	1	1	0	0	0	0	
B	309	1	0.7	246	46	14	1	0	1	0	1	0	0	
C	809	1	0.2	766	41	2	0	0	0	0	0	0	0	
	
Ku bound to 100-mer in Xenopus egg extract ΔXLF/ΔXRCC4	
	
A	466	1	0.4	394	68	3	1	0	0	0	0	0	0	
B	436	1	0.5	351	67	17	1	0	0	0	0	0	0	
C	515	1	0.5	429	69	13	4	0	0	0	0	0	0	
	
Ku bound to 100-mer in Xenopus egg extract ΔDNA-PKcs	
	
A	1,082	2	1.5	676	301	64	22	2	6	2	2	2	7	
B	1,046	2	1.5	689	260	53	15	10	7	5	3	3	4	
C	2,087	2	1.5	848	836	381	9	5	2	1	0	1	5	
	
Ku bound to 100-mer in Xenopus egg extract + NEDi	
	
A	342	1	0.9	301	34	1	1	2	0	2	0	0	1	
B	841	1	1.4	675	142	16	0	4	1	1	1	0	1	
C	1,121	1	0.8	1055	60	4	1	0	0	0	0	0	1	
	
Ku bound to 100-mer in Xenopus egg extract ΔDNA-PKcs + NEDi	
	
A	1,462	2	1.2	815	504	82	17	13	12	6	6	1	7	
B	1,453	2	1.2	861	376	136	40	13	12	3	0	6	12	
C	1,899	2	1.2	539	919	367	43	11	7	3	2	3	8	

KEY RESOURCES TABLE REAGENT or RESOURCE	SOURCE	IDENTIFIER	
	
Antibodies	
	
anti-CtIP (human) (14–1), mouse monoclonal	Gift from Dr. Richard Baer	N/A	
anti-DNA-PK (human) (18.2), mouse monoclonal	Thermo Fisher Scientific	Cat# MA5-13238; RRID:AB_10988612	
anti-Ph(S2056)-DNA-PKcs (human), rabbit polyclonal	Abcam	Cat# ab18192; RRID:AB_869495	
anti-DNA-PKcs (Xenopus) antibody (42–27), mouse monoclonal	Gift from Katheryn Meek	RRID:AB_10987499	
anti-DNA-PKcs (Xenopus), rabbit polyclonal	Graham et al.40	N/A	
anti-FBXL12 (human), rabbit polyclonal	Atlas Antibodies	Cat# HPA002843; RRID:AB_2666679	
anti-GAPDH (human) (6C5), mouse monoclonal	Thermo Fisher Scientific	Cat# AM4300; RRID:AB_2536381	
anti-γH2AX (human), rabbit polyclonal	Cell Signaling Technology	Cat# 2577; RRID:AB_2118010	
anti-H3 (Xenopus)	Cell Signaling Technology	Cat# 9715; RRID:AB_331563	
anti-KAP-1 (human), rabbit polyclonal	Abcam	Cat# ab10483; RRID:AB_297222	
anti-Ph(S824)-KAP-1 (human), rabbit polyclonal	Bethyl Laboratories	Cat# IHC-00073; RRID:AB_577234	
anti-Ku70 (human) (N3H10), mouse monoclonal	Thermo Fisher Scientific	Cat# MA5-13110; RRID:AB_10976973	
anti-Ku70 (human), rabbit monoclonal	ABclonal	Cat#A11223; RRID:AB_2861526	
anti-Ku70 (Xenopus), mouse monoclonal	Novus Biologicals	Cat# NB100-1915; RRID:AB_10002228	
anti-Ku80 (human) (111), mouse monoclonal	Thermo Fisher Scientific	Cat# MA5-12933; RRID:AB_10983840	
anti-Ku80 (Xenopus), rabbit polyclonal	Graham et al.40	N/A	
anti-Ku70/80 (human) (162), mouse monoclonal	Thermo Fisher Scientific	Cat# MA5-12938; RRID:AB_10980693	
anti-LIG4 (human), rabbit monoclonal	Abclonal	Cat# A11432; RRID:AB_2861565	
anti-Nucleolin (human), rabbit polyclonal	Abcam	Cat# ab50279; RRID:AB_881762	
anti-PCNA (human), rabbit polyclonal	Abcam	Cat# ab18197; RRID:AB_444313; Lot# GR120413-1	
anti-RPA32 (human) (9H8), mouse monoclonal	Abcam	Cat# ab2175, RRID:AB_302873	
anti-SAFA (human) (3G6), mouse monoclonal	Santa Cruz Biotechnology	Cat# sc-32315; RRID:AB_627741)	
anti-αTubulin (human), mouse monoclonal	Sigma-Aldrich	Cat# T5168; RRID:AB_477579	
anti-Ubiquitin (human), rabbit monoclonal	Abclonal	Cat# A19686; RRID:AB_2862735	
anti-Vinculin (human) (7F9), mouse monoclonal	Santa-Cruz Biotechnology	Cat# sc-73614; RRID:AB_1131294	
anti-XLF (Xenopus), rabbit polyclonal	Generated in-house Joseph Loparo lab	N/A	
anti-XRCC4 (Xenopus), rabbit polyclonal	Generated in-house Joseph Loparo lab	N/A	
AlexaFluor488-coupled goat anti-mouse	Thermo Fisher Scientific	Cat# A-11001; RRID:AB_2534069	
AlexaFluor594-coupled goat anti-rabbit	Thermo Fisher Scientific	Cat# A-11012; RRID:AB_2534079	
AlexaFluor647-coupled donkey anti-mouse	Thermo Fisher Scientific	Cat# A-31571; RRID:AB_162542	
HRP-coupled anti-mouse	Jackson ImmunoResearch	Cat# 115-035-003; RRID:AB_10015289	
HRP-coupled anti-rabbit	Jackson ImmunoResearch	Cat# 111-035-003; RRID:AB_2313567	
HRP-coupled TrueBlot anti-mouse Ultra	Rockland	Cat# 18-8817-30; RRID:AB_2610849	
HRP-coupled TrueBlot anti-rabbit	Rockland	Cat# 18-8816-33; RRID:AB_2610848	
	
Chemicals, peptides, and recombinant proteins	
	
Calicheamicin-γ1 (Cali)	Gift from Philip R. Hamann	N/A	
Camptothecin	Sigma-Aldrich	Cat# C9911	
KU-55933	Tocris	Cat# 3544	
M3814	Selleckchem	Cat# S8586	
MLN4924 (studies in human)	Selleckchem	Cat# S7109	
MLN4924 (studies in Xenopus)	Active Biochem.	Cat# A-1139	
NMS-873 (studies in Xenopus)	Sigma-Aldrich	Cat# SML1128	
NU7441 (studies in human)	Tocris	Cat# 3712	
NU7441 (studies in Xenopus)	R&D Systems, Inc.	Cat# 3712/10	
Bovine Serum Albumin (BSA)	Sigma-Aldrich	Cat# A7030	
RNase A	Sigma-Aldrich	Cat# R4642	
VectaShield	Vector laboratories	Cat# H1000	
Streptavidin-coupled magnetic Dynabeads M-280	Thermo Fisher Scientific	Cat# 11205D	
	
Experimental models: Cell lines	
	
U2OS	ATCC	RRID:CVCL_0042	
HeLa	ATCC	RRID:CVCL_0030	
U2OS PKcs-KO	This study	N/A	
U2OS LIG4-KO	This study	N/A	
U2OS LIG4/PKcs-KO	This study	N/A	
HeLa PKcs-KO	This study	N/A	
U2OS mAID-Ku70	This study	N/A	
U2OS mAID-Ku70 PKcs-KO	This study	N/A	
	
Experimental models: Organisms/strains	
	
Xenopus laevis, adult female	Nasco	Cat# LM00535	
	
Oligonucleotides	
	
See Table S1	N/A	N/A	
	
Recombinant DNA	
	
pCAG-eSpCas9-2A-GFP	Addgene, Gift from Jizhong Zou	RRID:Addgene_79145	
pCAG-eSpCas9-2A-GFP plasmid against DNA-PKcs	This study	RRID:Addgene_220493	
pCAG-eSpCas9-2A-GFP plasmid against LIG4	This study	RRID:Addgene_220494	
pUC18-GFP	This study	RRID:Addgene_220495	
pUC18-LucFF	This study	RRID:Addgene_220496	
pAM047 = pFastBac1-HaloTag-Ku80 (Xenopus)	This study	N/A	
pAM081 = pACEBac1-HaloTag-Ku80 (Xenopus)	This study	N/A	
pAM074 = pIDK-Ku70 (Xenopus)	This study	N/A	
pAM086 = MultiBac-HisHalo-Ku80/Ku70 (Xenopus)	This study	N/A	
pAM089 = modified pBluescript II KS(−) plasmid containing 4.6 kbp of λ bacteriophage genomic DNA	Gift from Thomas Graham (pTG313)	N/A	
	
Software and algorithms	
	
FlowJo v10.8.1	FlowJo	https://www.flowjo.com/	
GraphPad Prism 5	GraphPad	https://www.graphpad.com/	
ImageJ	NIH	https://imagej.nih.gov/ij/index.html	
MATLAB code for single-molecule photobleaching experiments	MATLAB	https://github.com/morenoat/Photobleach_analysis.git	

Highlights

DNA-PKcs structurally blocks Ku from sliding into chromatin in human and Xenopus

A neddylation/FBXL12-dependent mechanism limits Ku accumulation on chromatin

In S phase, ATM/CtIP overcomes Ku accumulation

Without DNA-PKcs, transcription at the DNA end vicinity is inhibited in a Ku-dependent manner

DECLARATION OF INTERESTS

The authors declare no competing interests.

SUPPLEMENTAL INFORMATION

Supplemental information can be found online at https://doi.org/10.1016/j.celrep.2024.114538.
==== Refs
REFERENCES

1. Ciccia A , and Elledge SJ (2010). The DNA damage response: making it safe to play with knives. Mol. Cell 40 , 179–204.20965415
2. Walker JR , Corpina RA , and Goldberg J (2001). Structure of the Ku heterodimer bound to DNA and its implications for double-strand break repair. Nature 412 , 607–614.11493912
3. Liang F , and Jasin M (1996). Ku80-deficient cells exhibit excess degradation of extrachromosomal DNA. J. Biol. Chem. 271 , 14405–14411.8662903
4. Frit P , Ropars V , Modesti M , Charbonnier JB , and Calsou P (2019). Plugged into the Ku-DNA hub: The NHEJ network. Prog. Biophys. Mol. Biol. 147 , 62–76. 10.1016/j.pbiomolbio.2019.03.001.30851288
5. Stinson BM , and Loparo JJ (2021). Repair of DNA Double-Strand Breaks by the Nonhomologous End Joining Pathway. Annu. Rev. Biochem. 90 , 137–164. 10.1146/annurev-biochem-080320-110356.33556282
6. Chang HHY , Watanabe G , Gerodimos CA , Ochi T , Blundell TL , Jackson SP , and Lieber MR (2016). Different DNA End Configurations Dictate Which NHEJ Components Are Most Important for Joining Efficiency. J. Biol. Chem. 291 , 24377–24389. 10.1074/jbc.M116.752329.27703001
7. Cisneros-Aguirre M , Lopezcolorado FW , Tsai LJ , Bhargava R , and Stark JM (2022). The importance of DNAPKcs for blunt DNA end joining is magnified when XLF is weakened. Nat. Commun. 13 , 3662. 10.1038/s41467-022-31365-6.35760797
8. Stinson BM , Moreno AT , Walter JC , and Loparo JJ (2020). A Mechanism to Minimize Errors during Non-homologous End Joining. Mol. Cell 77 , 1080–1091.e8. 10.1016/j.molcel.2019.11.018.31862156
9. Carter T , Vancurova I , Sun I , Lou W , and DeLeon S (1990). A DNA-activated protein kinase from HeLa cell nuclei. Mol. Cell Biol. 10 , 6460–6471.2247066
10. Blier PR , Griffith AJ , Craft J , and Hardin JA (1993). Binding of Ku protein to DNA. Measurement of affinity for ends and demonstration of binding to nicks. J. Biol. Chem. 268 , 7594–7601.8463290
11. de Vries E , van Driel W , Bergsma WG , Arnberg AC , and van der Vliet PC (1989). HeLa nuclear protein recognizing DNA termini and translocating on DNA forming a regular DNA-multimeric protein complex. J. Mol. Biol. 208 , 65–78.2769755
12. Britton S , Coates J , and Jackson SP (2013). A new method for high-resolution imaging of Ku foci to decipher mechanisms of DNA double-strand break repair. J. Cell Biol. 202 , 579–595. 10.1083/jcb.201303073.23897892
13. Ono M , Tucker PW , and Capra JD (1996). Ku is a general inhibitor of DNA-protein complex formation and transcription. Mol. Immunol. 33 , 787–796.8811074
14. Frit P , Calsou P , Chen DJ , and Salles B (1998). Ku70/Ku80 protein complex inhibits the binding of nucleotide excision repair proteins on linear DNA in vitro. J. Mol. Biol. 284 , 963–973. 10.1006/jmbi.1998.2257.9837719
15. Frit P , Li RY , Arzel D , Salles B , and Calsou P (2000). Ku entry into DNA inhibits inward DNA transactions in vitro. J. Biol. Chem. 275 , 35684–35691.10945984
16. Calsou P , Frit P , Humbert O , Muller C , Chen DJ , and Salles B (1999). The DNA-dependent protein kinase catalytic activity regulates DNA end processing by means of Ku entry into DNA. J. Biol. Chem. 274 , 7848–7856.10075677
17. Chanut P , Britton S , Coates J , Jackson SP , and Calsou P (2016). Coordinated nuclease activities counteract Ku at single-ended DNA double-strand breaks. Nat. Commun. 7 , 12889. 10.1038/ncomms12889.27641979
18. Britton S , Chanut P , Delteil C , Barboule N , Frit P , and Calsou P (2020). ATM antagonizes NHEJ proteins assembly and DNA-ends synapsis at single-ended DNA double strand breaks. Nucleic Acids Res. 48 , 9710–9723. 10.1093/nar/gkaa723.32890395
19. Sharma AB , Erasimus H , Pinto L , Caron MC , Gopaul D , Peterlini T , Neumann K , Nazarov PV , Fritah S , Klink B , (2021). XAB2 promotes Ku eviction from single-ended DNA double-strand breaks independently of the ATM kinase. Nucleic Acids Res. 49 , 9906–9925. 10.1093/nar/gkab785.34500463
20. Lee KJ , Saha J , Sun J , Fattah KR , Wang SC , Jakob B , Chi L , Wang SY , Taucher-Scholz G , Davis AJ , and Chen DJ (2016). Phosphorylation of Ku dictates DNA double-strand break (DSB) repair pathway choice in S phase. Nucleic Acids Res. 44 , 1732–1745. 10.1093/nar/gkv1499.26712563
21. Postow L , Ghenoiu C , Woo EM , Krutchinsky AN , Chait BT , and Funabiki H (2008). Ku80 removal from DNA through double strand break-induced ubiquitylation. J. Cell Biol. 182 , 467–479.18678709
22. van den Boom J , Wolf M , Weimann L , Schulze N , Li F , Kaschani F , Riemer A , Zierhut C , Kaiser M , Iliakis G , (2016). VCP/p97 Extracts Sterically Trapped Ku70/80 Rings from DNA in Double-Strand Break Repair. Mol. Cell 64 , 189–198. 10.1016/j.molcel.2016.08.037.27716483
23. Ismail IH , Gagne JP , Genois MM , Strickfaden H , McDonald D , Xu Z , Poirier GG , Masson JY , and Hendzel MJ (2015). The RNF138 E3 ligase displaces Ku to promote DNA end resection and regulate DNA repair pathway choice. Nat. Cell Biol. 17 , 1446–1457.26502055
24. Ishida N , Nakagawa T , Iemura SI , Yasui A , Shima H , Katoh Y , Nagasawa Y , Natsume T , Igarashi K , and Nakayama K (2017). Ubiquitylation of Ku80 by RNF126 Promotes Completion of Nonhomologous End Joining-Mediated DNA Repair. Mol. Cell Biol. 37 , e00347–16. 10.1128/MCB.00347-16.27895153
25. Fowler FC , Chen BR , Zolnerowich N , Wu W , Pavani R , Paiano J , Peart C , Chen Z , Nussenzweig A , Sleckman BP , and Tyler JK (2022). DNA-PK promotes DNA end resection at DNA double strand breaks in G0 cells. Elife 11 , e74700. 10.7554/eLife.74700.35575473
26. Postow L , and Funabiki H (2013). An SCF complex containing Fbxl12 mediates DNA damage-induced Ku80 ubiquitylation. Cell Cycle 12 , 587–595. 10.4161/cc.23408.23324393
27. Feng L , and Chen J (2012). The E3 ligase RNF8 regulates KU80 removal and NHEJ repair. Nat. Struct. Mol. Biol. 19 , 201–206. 10.1038/nsmb.2211.22266820
28. Brown JS , Lukashchuk N , Sczaniecka-Clift M , Britton S , le Sage C , Calsou P , Beli P , Galanty Y , and Jackson SP (2015). Neddylation promotes ubiquitylation and release of Ku from DNA-damage sites. Cell Rep. 11 , 704–714. 10.1016/j.celrep.2015.03.058.25921528
29. Zenke FT , Zimmermann A , Sirrenberg C , Dahmen H , Kirkin V , Pehl U , Grombacher T , Wilm C , Fuchss T , Amendt C , (2020). Pharmacologic Inhibitor of DNA-PK, M3814, Potentiates Radiotherapy and Regresses Human Tumors in Mouse Models. Mol. Cancer Therapeut. 19 , 1091–1101. 10.1158/1535-7163.MCT-19-0734.
30. Zein N , Sinha AM , McGahren WJ , and Ellestad GA (1988). Calicheamicin gamma 1I: an antitumor antibiotic that cleaves double-stranded DNA site specifically. Science 240 , 1198–1201. 10.1126/science.3240341.3240341
31. Soucy TA , Smith PG , Milhollen MA , Berger AJ , Gavin JM , Adhikari S , Brownell JE , Burke KE , Cardin DP , Critchley S , (2009). An inhibitor of NEDD8-activating enzyme as a new approach to treat cancer. Nature 458 , 732–736. 10.1038/nature07884.19360080
32. Leahy JJ , Golding BT , Griffin RJ , Hardcastle IR , Richardson C , Rigoreau L , and Smith GC (2004). Identification of a highly potent and selective DNA-dependent protein kinase (DNA-PK) inhibitor (NU7441) by screening of chromenone libraries. Bioorg. Med. Chem. Lett. 14 , 6083–6087.15546735
33. Jimenez A , Friedl K , and Leterrier C (2020). About samples, giving examples: Optimized Single Molecule Localization Microscopy. Methods 174 , 100–114. 10.1016/j.ymeth.2019.05.008.31078795
34. Seif-El-Dahan M , Kefala-Stavridi A , Frit P , Hardwick SW , Chirgadze DY , Maia De Oliviera T , Andreani J , Britton S , Barboule N , Bossaert M , (2023). PAXX binding to the NHEJ machinery explains functional redundancy with XLF. Sci. Adv. 9 , eadg2834. 10.1126/sciadv.adg2834.37256950
35. Levet F , Hosy E , Kechkar A , Butler C , Beghin A , Choquet D , and Sibarita JB (2015). SR-Tesseler: a method to segment and quantify localization-based super-resolution microscopy data. Nat. Methods 12 , 1065–1071. 10.1038/nmeth.3579.26344046
36. Levet F , and Sibarita JB (2023). PoCA: a software platform for point cloud data visualization and quantification. Nat. Methods 20 , 629–630. 10.1038/s41592-023-01811-4.36869121
37. Drouet J , Delteil C , Lefrancois J , Concannon P , Salles B , and Calsou P (2005). DNA-dependent protein kinase and XRCC4-DNA ligase IV mobilization in the cell in response to DNA double strand breaks. J. Biol. Chem. 280 , 7060–7069.15520013
38. Calsou P , Delteil C , Frit P , Drouet J , and Salles B (2003). Coordinated assembly of Ku and p460 subunits of the DNA-dependent protein kinase on DNA ends is necessary for XRCC4-ligase IV recruitment. J. Mol. Biol. 326 , 93–103.12547193
39. Zhang H , and Guo P (2014). Single molecule photobleaching (SMPB) technology for counting of RNA, DNA, protein and other molecules in nanoparticles and biological complexes by TIRF instrumentation. Methods 67 , 169–176. 10.1016/j.ymeth.2014.01.010.24440482
40. Graham TG , Walter JC , and Loparo JJ (2016). Two-Stage Synapsis of DNA Ends during Non-homologous End Joining. Mol. Cell 61 , 850–858. 10.1016/j.molcel.2016.02.010.26990988
41. Hickson I , Zhao Y , Richardson CJ , Green SJ , Martin NM , Orr AI , Reaper PM , Jackson SP , Curtin NJ , and Smith GC (2004). Identification and characterization of a novel and specific inhibitor of the ataxia-telangiectasia mutated kinase ATM. Cancer Res. 64 , 9152–9159.15604286
42. Beucher A , Birraux J , Tchouandong L , Barton O , Shibata A , Conrad S , Goodarzi AA , Krempler A , Jeggo PA , and Lobrich M (2009). ATM and Artemis promote homologous recombination of radiation-induced DNA double-strand breaks in G2. EMBO J. 28 , 3413–3427. 10.1038/emboj.2009.276.19779458
43. Yoo S , Kimzey A , and Dynan WS (1999). Photocross-linking of an oriented DNA repair complex. Ku bound at a single DNA end. J. Biol. Chem. 274 , 20034–20039. 10.1074/jbc.274.28.20034.10391954
44. Reginato G , Cannavo E , and Cejka P (2017). Physiological protein blocks direct the Mre11-Rad50-Xrs2 and Sae2 nuclease complex to initiate DNA end resection. Genes Dev. 31 , 2325–2330. 10.1101/gad.308254.117.29321179
45. Gnugge R , Reginato G , Cejka P , and Symington LS (2023). Sequence and chromatin features guide DNA double-strand break resection initiation. Mol. Cell 83 , 1237–1250.e1215. 10.1016/j.molcel.2023.02.010.36917982
46. Zhou Y , Caron P , Legube G , and Paull TT (2014). Quantitation of DNA double-strand break resection intermediates in human cells. Nucleic Acids Res. 42 , e19. 10.1093/nar/gkt1309.24362840
47. Deshpande RA , Myler LR , Soniat MM , Makharashvili N , Lee L , Lees-Miller SP , Finkelstein IJ , and Paull TT (2020). DNA-dependent protein kinase promotes DNA end processing by MRN and CtIP. Sci. Adv. 6 , eaay0922. 10.1126/sciadv.aay0922.31934630
48. Balmus G , Pilger D , Coates J , Demir M , Sczaniecka-Clift M , Barros AC , Woods M , Fu B , Yang F , Chen E , (2019). ATM orchestrates the DNA-damage response to counter toxic non-homologous end-joining at broken replication forks. Nat. Commun. 10 , 87. 10.1038/s41467-018-07729-2.30622252
49. Miller KM , Tjeertes JV , Coates J , Legube G , Polo SE , Britton S , and Jackson SP (2010). Human HDAC1 and HDAC2 function in the DNA-damage response to promote DNA nonhomologous end-joining. Nat. Struct. Mol. Biol. 17 , 1144–1151. 10.1038/nsmb.1899.20802485
50. Caron P , Aymard F , Iacovoni JS , Briois S , Canitrot Y , Bugler B , Massip L , Losada A , and Legube G (2012). Cohesin protects genes against γH2AX Induced by DNA double-strand breaks. PLoS Genet. 8 , e1002460. 10.1371/journal.pgen.1002460.22275873
51. Roberts SA , and Ramsden DA (2007). Loading of the nonhomologous end joining factor, Ku, on protein-occluded DNA ends. J. Biol. Chem. 282 , 10605–10613.17289670
52. Balestrini A , Ristic D , Dionne I , Liu XZ , Wyman C , Wellinger RJ , and Petrini JH (2013). The Ku heterodimer and the metabolism of single-ended DNA double-strand breaks. Cell Rep. 3 , 2033–2045.23770241
53. Slaymaker IM , Gao L , Zetsche B , Scott DA , Yan WX , and Zhang F (2016). Rationally engineered Cas9 nucleases with improved specificity. Science 351 , 84–88. 10.1126/science.aad5227.26628643
54. Brunner A , Li Q , Fisicaro S , Kourtesakis A , Viiliainen J , Johansson HJ , Pandey V , Mayank AK , Lehtio J , Wohlschlegel JA , (2023). FBXL12 degrades FANCD2 to regulate replication recovery and promote cancer cell survival under conditions of replication stress. Mol. Cell 83 , 3720–3739.e8. 10.1016/j.molcel.2023.07.026.37591242
55. Ovesny M , Krizek P , Borkovec J , Svindrych Z , and Hagen GM (2014). ThunderSTORM: a comprehensive ImageJ plug-in for PALM and STORM data analysis and super-resolution imaging. Bioinformatics 30 , 2389–2390. 10.1093/bioinformatics/btu202.24771516
56. Schneider CA , Rasband WS , and Eliceiri KW (2012). NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9 , 671–675. 10.1038/nmeth.2089.22930834
57. Lebofsky R , Takahashi T , and Walter JC (2009). DNA replication in nucleus-free Xenopus egg extracts. Methods Mol. Biol. 521 , 229–252. 10.1007/978-1-60327-815-7_13.
58. Trowitzsch S , Bieniossek C , Nie Y , Garzoni F , and Berger I (2010). New baculovirus expression tools for recombinant protein complex production. J. Struct. Biol. 172 , 45–54. 10.1016/j.jsb.2010.02.010.20178849
59. Graham TGW , Walter JC , and Loparo JJ (2017). Ensemble and Single-Molecule Analysis of Non-Homologous End Joining in Frog Egg Extracts. Methods Enzymol. 591 , 233–270. 10.1016/bs.mie.2017.03.020.28645371
60. Carney SM , Moreno AT , Piatt SC , Cisneros-Aguirre M , Lopezcolorado FW , Stark JM , and Loparo JJ (2020). XLF acts as a flexible connector during non-homologous end joining. Elife 9 , e61920. 10.7554/eLife.61920.33289484
61. Fan J , Moreno AT , Baier AS , Loparo JJ , and Peterson CL (2022). H2A.Z deposition by SWR1C involves multiple ATP-dependent steps. Nat. Commun. 13 , 7052. 10.1038/s41467-022-34861-x.36396651
62. Friedman LJ , and Gelles J (2015). Multi-wavelength single-molecule fluorescence analysis of transcription mechanisms. Methods 86 , 27–36. 10.1016/j.ymeth.2015.05.026.26032816
