
==== Front
Exp Neurobiol
Exp Neurobiol
Experimental Neurobiology
1226-2560
2093-8144
The Korean Society for Brain and Neural Sciences

39266474
10.5607/en24019
en-33-4-180
Original Article
Generation of Astrocyte-specific BEST1 Conditional Knockout Mouse with Reduced Tonic GABA Inhibition in the Brain
Joo Jinhyeong 12
Kim Ki Jung 1
Lim Jiwoon 12
Choi Sun Yeong 13
Koh Wuhyun 1
Lee C. Justin 12*
1 Center for Cognition and Sociality, Institute for Basic Science (IBS), Daejeon 34126, Korea
2 IBS School, Korea University of Science and Technology (UST), Daejeon 34113, Korea
3 Department of Biomedical Engineering, Ulsan National Institute of Science and Technology (UNIST), Ulsan 44919, Korea
* To whom correspondence should be addressed. TEL: 82-42-878-9150, FAX: 82-42-878-9151, e-mail: cjl@ibs.re.kr
31 8 2024
31 8 2024
31 8 2024
33 4 180192
15 8 2024
29 8 2024
31 8 2024
Copyright © Experimental Neurobiology 2024
2024
https://creativecommons.org/licenses/by-nc/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Bestrophin-1 (BEST1) is a Ca2+-activated anion channel known for its role in astrocytes. Best1 is permeable to gliotransmitters, including GABA, to contribute to tonic GABA inhibition and modulate synaptic transmission in neighboring neurons. Despite the crucial functions of astrocytic BEST1, there is an absence of genetically engineered cell-type specific conditional mouse models addressing these roles. In this study, we developed an astrocyte-specific BEST1 conditional knock-out (BEST1 aKO) mouse line. Using the embryonic stem cell (ES cell) targeting method, we developed Best1 floxed mice (C57BL/6JCya-Best1em1flox/Cya), which have exon 3, 4, 5, and 6 of Best1 flanked by two loxP sites. By crossing with hGFAP-CreERT2 mice, we generated Best1 floxed/hGFAP-CreERT2 mice, which allowed for the tamoxifen-inducible deletion of Best1 under the human GFAP promoter. We characterized its features across various brain regions, including the striatum, hippocampal dentate gyrus (HpDG), and Parafascicular thalamic nucleus (Pf). Compared to the Cre-negative control, we observed significantly reduced BEST1 protein expression in immunohistochemistry (IHC) and tonic GABA inhibition in patch clamp recordings. The reduction in tonic GABA inhibition was 66.7% in the striatum, 46.4% in the HpDG, and 49.6% in the Pf. Our findings demonstrate that the BEST1 channel in astrocytes significantly contributes to tonic inhibition in the local brain areas. These mice will be valuable for future studies not only on tonic GABA release but also on tonic release of gliotransmitters mediated by astrocytic BEST1.

Astrocyte
BEST1
Gamma-aminobutyric acid
Striatum
Hippocampus
Thalamus
==== Body
pmcINTRODUCTION

Bestrophin 1 (BEST1) is a Ca2+-activated Cl- channel, first discovered in retinal pigment epithelium, and over 250 mutations of BEST1 are known as causes of bestrophinopathies [1, 2]. BEST1 is now reported to be expressed throughout the brain [3], including the cerebellum [4], striatum [5], hippocampus [6], cerebral cortex [7], thalamus [8], dorsal root ganglia [9, 10] and spinal cord [11]. BEST1 is primarily localized in microdomains of astrocytes [3] and contributes to controlling astrocytic volume transient [12] and modulating synaptic activity by releasing GABA [4], glutamate [6, 13-15], and D-serine [16] from astrocytes. Astrocytic GABA release has an essential physiological role via tonic inhibition for neuronal information processing [17], like controlling sensory acuity in the thalamus [8] and motor coordination in the cerebellum [18]. In pathophysiological conditions such as Alzheimer’s disease [19] and Parkinson’s disease [20], astrocytes become reactive and suppress neighboring neurons with severe tonic inhibition [21]. Moreover, it is reported that redistribution of BEST1 expression can occur in reactive astrocytes of Alzheimer’s disease [21]. Although the importance of the BEST1 channel in astrocytic gliotransmission has been recognized, BEST1 null knockout cannot directly explain astrocytic tonic GABA release since BEST1 is revealed to be expressed in both neurons and astrocytes [22]. Therefore, genetically engineered mouse models are needed to study the astrocytic BEST1 channel solely. We generated a new astrocyte-specific BEST1 conditional knockout (BEST1 aKO) mouse line to address this.

To generate a conditional BEST1 knockout mouse line, we first established a Best1 floxed mouse line using the ES cell targeted method, a gold standard gene editing technique [23]. Exons 3 to 6 of the Best1 gene were targeted for flanking with the loxP site, creating a target vector. The targeting vector provides the necessary homology arms to facilitate recombination at the desired genomic locus, and successful recombination events are identified through selection and screening. The ES cell targeting method has a lower success rate but does not introduce specific DNA damage, unlike techniques such as CRISPR, ZFNs, or TALENs [24-26]. Moreover, it relies on the cell’s mechanisms to make precise genetic changes, avoiding problems like off-target effects.

To study BEST1 in astrocytes specifically, we crossed the Best1 floxed mouse line with a Cre-expressing mouse line driven by an astrocytic promoter. While the ALDH1L1-CreERT2 mouse line offers more pan-astrocyte-specific expression, its broad utility for brain-specific research is severely limited by the ubiquitous expression of Aldh1l1 mRNA throughout the body [27]. We opted to use the tamoxifen-inducible hGFAP-CreERT2 system for targeting astrocyte-specific BEST1. We examined BEST1 and GABA expression and tonic GABA release in astrocytes of the striatum, hippocampal dentate gyrus (HpDG), and Pf using IHC and brain slice patch-clamp techniques. In the striatum, HpDG, and Pf of the BEST1 aKO mouse, we found significantly reduced BEST1 expression and tonic GABA inhibition compared to the Cre-negative control, validating conditional deletion of BEST1 in astrocytes.

MATERIALS AND METHODS

Animals

Both male and female mice were used in this study. Mice were given ad libitum access to food and water, maintained under a 12:12 hour light-dark cycle, and housed in groups of 3~5 per cage. All care and handling of mice were conducted according to protocols approved by the Institutional Animal Care and Use Committee (IACUC) of the Institute for Basic Science (Daejeon, South Korea).

Generation of Best1 floxed mouse line

The generation of a Best1 floxed mouse line was commissioned from Cyagen Biosciences (Guangzhou, China). The floxed allele of Best1 was engineered using a technique based on the ES cell targeting method. This involved the amplification of mouse genomic fragments containing homology arms and a conditional knockout region from a Bacterial Artificial Chromosome (BAC) clone with high-fidelity Taq DNA polymerase. These fragments were subsequently integrated into a target vector that included recombination sites. The vector also incorporated a neomycin resistance gene cassette, bordered by self-deletion anchor sites to facilitate positive selection. This construct was then linearized and introduced into C57BL/6-derived ES cells via electroporation. Following homology-directed recombination, these cells underwent selection using neomycin and were further validated by Southern blot. Selected ES cells were microinjected into blastocysts and transferred into pseudopregnant females, yielding chimeric progeny. These chimeric mice were crossed with wild-type mice to produce heterozygous offspring, which were subsequently bred to achieve homozygosity. Best1 floxed mice harbored the modified allele with loxP sites flanking exons 3 through 6. According to the nomenclature guidelines for genetically engineered mice by the International Committee on Standardized Genetic Nomenclature for Mice, this line was named C57BL/6JCya-Best1em1flox/Cya.

Generation of BEST1 aKO mouse line

Homozygous Best1 floxed mice was crossed with transgenic hGFAP-CreERT2 (B6-Tg(GFAP-cre/ERT2)13Kdmc, Cre/+) mice to generated Best1 floxed/hGFAP-CreERT2 mice. To generate astrocyte-specific Best1 knockout (BEST1 aKO), adult (aged 8~11 weeks) Best1 floxed/hGFAP-CreERT2 (Cre/+ or +/+ as control) mice were injected with tamoxifen (100 mg/kg) once per day for five days by intraperitoneal route. Tamoxifen was dissolved in sunflower oil containing 10% ethanol at a concentration of 20 mg/ml. Mice were used for IHC or electrophysiological experiments at least two or three weeks later for the robust CreERT2 system activation.

Genotyping

The mouse tail was submerged into a mixture of 1 mg/ml proteinase K (21560025-2, bioWORLD, USA) and tail lysis buffer (102, Fiat international, South Korea) and digested overnight at 65°C. The next day, proteinase K was inactivated at 85°C for 1 hour. Extracted genomic DNA was genotyped by taking a supernatant from the tail lysate. The PCR mixture for Best1 floxed mouse DNA contained 2×PCR premix reagent (QM13531, Bioquest, South Korea), 3 µl of genomic DNA template, 1 µl of primer sets (10 pmol/µl), and 5 µl of distilled water (D.W.). The PCR mixture for GFAP CreERT2 mouse DNA contained 2X PCR premix reagent, 3 µl of genomic DNA template, 0.5 µl of primer sets (10 pmol/µl), and 6 µl of D.W. For Best1 floxed mice, genotyping was performed by PCR using the following two pairs of primers to target each upstream and downstream loxP site.

Pair 1

Forward #1 (F1), 5’-CCACACACCTTTACTTCTACCCC-3’

Reverse #1 (R1), 5’-TACTATACCATCGTTGTGTGGCTGG-3’

Pair 2

Forward #2 (F2), 5’-AGACACACACGGTCCAGAACTG-3’

Reverse #2 (R2), 5’-ATCGGTCTATTGTTGCCACTGCC-3’

PCR using F1, R1 primer performed by the following cycling protocol: 94°C for 3 min, 33 cycles of 94°C for 30 sec, 62°C for 35 sec, 72°C for 35 sec, with the final extension step, 72°C for 5 min. PCR using F2, R2 primer performed by the following cycling protocol: 94°C for 3 min, 35 cycles of 94°C for 30 sec, 62°C for 35 sec, 72°C for 35 sec, with the final extension step, 72°C for 5min. For the GFAP-CreERT2 mouse, genotyping was performed by PCR using the following primers based on the previous report [28]:

Pair 1

hGFAP_F: 5' - AGACCCATGGTCTGGCTCCAGGTAC - 3'

BAC_R: 5' - ACTGACATTTCTCTTGTCTCCTC - 3'

Pair 2

BAC_F: 5' - ATCGCTCACAGGATCACTCAC - 3'

CreERT2_R: 5' - TCCCTGAACATGTCCATCAGGTTC - 3'

WT primer

Intron3_WT_R: 5' - CTAGCTGGTAAGTTGTGTGTGTC - 3'

PCR using hGFAP_F, BAC_R, BAC_F, CreERT2_R, and Intron3_WT_R primer performed by the following cycling protocol: 95°C for 5 min, 33 cycles of 95°C for 30 sec, 58°C for 30 sec, 72°C for 30 sec, with the final extension step, 72°C for 4 min. PCR products were run on 1.5% and 2% agarose gels (HB0100500, E&S, South Korea) in TAE buffer (40 mM Tris, pH 7.6 with 20 mM acetic acid and 1 mM EDTA) at 100 V for 25 min and visualized using a non-harmful nucleic acid staining solution, RedSafe (21141, iNtRON Biotechnology, South Korea).

Sanger sequencing for detection of loxP sites

The upstream loxP site near exon 3 was amplified by PCR using F1 and R1 primer with the same genotyping protocol. Homozygous Best1 floxed mouse DNA was used, confirmed by gel electrophoresis that the amplified DNA has a 283 bp band. The downstream loxP site near exon 6 was amplified by PCR using F2 and R2 primer with the same protocol. Homozygous Best1 floxed mouse DNA was used, confirmed by gel electrophoresis that the amplified DNA has a 259 bp band. Cosmogenetech (Daejeon, South Korea) conducted a DNA clean-up of PCR product and Sanger sequencing.

Immunohistochemistry

The mouse was anesthetized with 1~2% isoflurane, then transcardiac perfused with saline and 4% paraformaldehyde (PFA). The brain was detached and immediately submerged into 4% PFA for post-fixation at 4°C overnight. Subsequently, the brain was transferred into a 30% sucrose solution for cryoprotection and stored at 4°C. Brain tissue was frozen at -70°C and sectioned with 30 µm thickness in the coronal plane in a cryostat (CM1950, Leica Biosystems, Germany). For the brain tissue immunostaining, brain sections were incubated in a blocking solution containing 0.3% Triton X-100 (X100, Sigma-Aldrich, USA), 4% donkey serum (GTX27475, Genetex, USA), and 0.1M PBS. Then, sections were immunostained with optimized concentrations of primary antibodies (Custom-made Rabbit anti-BEST1, GWVitek, South Korea, antigen: C-AESYPYRDEAGTKPVLYE (19mer), 1:250; Guineapig anti-GABA, ab175, Millipore, Germany, 1:250; Mouse anti-S100β, S2532, Sigma-Aldrich, USA, 1:250) in blocking solution at 4°C overnight. After washing with 0.1 M PBS three times, secondary antibodies with corresponding fluorescent in blocking solution were applied for two hours to brain sections, then washed thoroughly with 0.1 M PBS three times. DAPI (62248, Thermo Fisher Scientific, USA; 1:1000) was added during the second wash to stain the nucleus. Secondary antibodies were purchased from Jackson Immuno Research Laboratories (USA). Brain sections were mounted at silane-coated slide glass (5116-20F, Muto Pure Chemicals, Japan) with Fluorescence mounting medium (S3023, Dako, Denmark). The fluorescent image was acquired by Zeiss LSM900 confocal microscope, with Z-stacked in 1 μm intervals.

Image quantification

Fluorescent images obtained from confocal microscopy were analyzed using ImageJ Fiji (NIH, USA). To quantify GABA and BEST1 immunoreactive intensity, all images were z-stacked with max intensity by pixel, set at the same brightness and contrast. The region of interest (ROI) was set by calculating the area of S100β with the same threshold setting throughout the whole image. S100β-positive GABA and BEST1 intensity in each ROI was analyzed in 8-bit images. To quantify the neuronal BEST1 expression level in the Pf, the S100β-negative, BEST1-positive region around DAPI was selected for ROI. BEST1 intensity in neuron-shaped ROI was calculated.

Brain slice preparation

Animals were anesthetized with 1.5~2% isoflurane and decapitated to isolate the brain. The mouse skull was directly submerged into ice-cold high sucrose artificial cerebrospinal fluid (aCSF) (in mM): 26 NaHCO3, 1.25 NaH2PO4, 3 KCl, 5 MgCl2, 0.1 CaCl2, 10 D(+)-glucose, and 212.5 sucrose, pH 7.4. After slicing, brain slices were cut at 300 μm thick in horizontal plane using a vibratome (DSK Linear Slicer, Kyoto, Japan) and stored into aCSF (in mM): 130 NaCl, 24 NaHCO3, 1.24 NaH2PO4, 3.5 KCl, 1.5 CaCl2, 1.5 MgCl2, and 10 D(+)-glucose, pH 7.4 at room temperature for at least one hour for recovery before recording. All solution was oxygenated for at least one hour by aerating mixed gas containing 95% O2 and 5% CO2.

Slice recording for tonic GABA current

Slices were placed in a recording chamber, and target cells were identified using an upright Zeiss microscope equipped with a 60× water immersion objective and infrared differential interference contrast (DIC) optics. Whole-cell recordings were conducted at room temperature using pCLAMP11 software, a Digidata 1550B, and a MultiClamp 700B amplifier (Axon Instrument, Molecular Devices). We performed these recordings on medium spiny neurons from the striatum, granule cells from the HpDG, and thalamic neurons. The holding potential was set at -70 mV, and pipette resistance typically ranged from 5~8 MΩ. The pipettes were filled with an internal solution composed of (in mM) 135 CsCl, 4 NaCl, 0.5 CaCl2, 10 HEPES, 5 EGTA, 30 QX-314; the pH was adjusted to 7.2 with CsOH (278~285 mOsmol/kg). This solution measured inhibitory postsynaptic currents (IPSCs) and tonic currents. IPSCs and tonic currents were measured in the presence of ionotropic glutamate receptor antagonists: 50 µM D-2-amino-5-phosphonovalerate (APV, Tocris) and 20 µM cyanquixaline (CNQX, Tocris). The amplitude of GABAA receptor (GABAAR)-mediated current was measured by observing baseline shifts following the bath application of 50 µM (-)-bicuculline methobromide (BIC, Tocris) in the striatum, HpDG; 50 µM gabazine (GBZ, Tocris) in the Pf. The amplitude of activated extrasynaptic GABAAR currents was assessed by comparing baseline shifts before and after the application of 5 µM GABA or 2 µM 4,5,6,7-Tetrahydroisoxazolo[5,4-c] pyridin-3-ol hydrochloride (THIP, Tocris), and 50 µM BIC or 50 µM GBZ. The current shifts were measured using 5 µM GABA and 50 µM BIC in the striatum, 2 µM THIP and 50 µM BIC in the HpDG, and 5 µM GABA with 50 µM GBZ in the Pf. Data were filtered at 2 kHz and analyzed for amplitude and frequency of spontaneous IPSC (sIPSC) using Minianalysis software (Bluecell).

Statistical analysis

The Shapiro-Wilcoxon normality test was used for data normality in all experiments. If data follows a normal distribution, an unpaired two-tailed t-test was used to determine the differences between the groups. Otherwise, a Mann-Whitney test (two-tailed) was used. The significance level is represented as asterisks (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001: non-significancy shown as p-value). GraphPad Prism 10.2.3 for Windows (GraphPad Software, USA) was used for data analysis and plotting. The median value was mentioned in the Mann-Whitney test, and the mean value was mentioned in the unpaired t-test.

RESULTS

Generation of Best1 floxed mouse line and BEST1 aKO mouse line

The Best1 gene is located on the positive strand of chromosome 19 (19q) of Mus musculus (NC_000085.7), spanning 9,962,538 to 9,978,997, and comprises 12 exons. During the generation of the Best1 floxed mouse, the Best1 floxed allele was produced using the traditional ES cell targeting method commonly employed in mouse model gene engineering. Mouse genomic fragments, including homology arms, loxP sequences, and target exons, were amplified and recombined using a BAC clone. The recombined target vector was introduced into ES cells via electroporation and resulted in the generation of the Best1 floxed allele through homology-directed recombination. ES cells containing the selected Best1 floxed allele were injected into blastocysts via microinjection. After screening with a selective marker, these selected ES cells were transferred to pseudopregnant females. The delivered chimeric mice were bred with wild-type (WT) mice, obtaining mice heterozygous for the Best1 floxed allele (Fig. 1A, B). Subsequently, the obtained Best1 floxed mice (C57BL/6JCya-Best1em1flox/Cya) were genotyped using two primer pairs to confirm the presence of loxP sequences upstream of exon 3 and downstream of exon 6. Pair 1, using Forward #1 (F1) and Reverse #1 (R1) primers for the loxP sequence downstream of exon 6, identified three genotypes: a single 283 bp band for homozygous (fl/fl), two bands at 283 and 187 bp for heterozygous (fl/+), and a single 187 bp band for wildtype (+/+). Pair 2, using Forward #2 (F2) and Reverse #2 (R2) primers for the loxP sequence upstream of exon 3, similarly identified three genotypes: a single 259 bp band for homozygous (fl/fl), two bands at 259 and 226 bp for heterozygous (fl/+), and a single 226 bp band for wildtype (+/+). The genotyping protocol was adapted and modified to distinguish between three genotypes: two bands at 439 and 179 bp for homozygous (Cre/Cre), three bands at 439, 256, and 179 bp for heterozygous (Cre/+), and a single 256 bp band for wildtype (+/+) [28]. In this study, however, we applied this method but focused exclusively on using heterozygous and wildtype mice (Fig. 1C). Sanger sequencing using F1 and R2 primers confirmed that the loxP sequences downstream and upstream of the Best1 floxed allele were fully intact, spanning the original 34 bp (Fig.1D, E). Subsequently, to generate BEST1 aKO mice, Best1 floxed mice were bred with hGFAP-CreERT2 mice to produce Best1 floxed/ hGFAP-CreERT2 mice. To maintain homozygosity in the Best1 floxed alleles and generate experimental groups based on Cre expression, homozygous Best1 floxed mice without Cre expression (fl/fl, +/+) were bred with homozygous Best1 floxed mice with Cre expression (fl/fl, Cre/+) (Fig. 1F). Both mouse genotype group (fl/fl, +/+; fl/fl, Cre/+) were injected with tamoxifen (100 mg/kg) once daily for five days by intraperitoneal route. CreERT2 translocation to the nucleus causes recombination of loxP-flanked exons 3 and 6 under the control of human GFAP promoter, generating BEST1 aKO mice (Fig. 1G).

BEST1 aKO mice show a significant reduction in GABA content, BEST1 expression in astrocytes, and tonic GABA current in the striatum

Previously, we have reported that BEST1 mediates the tonic release of GABA, which is synthesized mainly by MAOB in the striatum astrocytes [5]. In this study, we investigate the levels of BEST1 and GABA in astrocytes within the striatum of BEST1 control (fl/fl, +/+) and BEST1 aKO (fl/fl, Cre/+) mice. To measure the difference between the two groups, both Best1 floxed/hGFAP-CreERT2 mice genotype group were injected with 100 mg /kg /day tamoxifen five days a row to induce astrocytic ablation of BEST1, as previously validated [28]. After 2~3 weeks later, IHC and electrophysiology experiment were conducted (Fig. 2A, B). In IHC, we performed immunostaining against S100β, GABA, and BEST1. Immunostaining small molecules like GABA has been confirmed by directly correlating the amount of GABA and the degree of tonic inhibition [29] and a positive correlation between GABA content and immunostaining intensity [30].

We observed colocalization of GABA and BEST1 within S100β-positive cell area, highlighted with a white arrow (Fig. 2C). There is significant GABA and BEST1 reduction in the S100β-positive cell area of BEST1 aKO mouse compared to BEST1 control (Fig. 2D). To check the contribution of astrocytic BEST1 channel to the tonic GABA level of the striatum, we measure tonic GABA current in the medial spiny neurons (MSNs) (Fig. 2B). Under treatment of AMPA receptor (AMPAR) and NMDA receptor (NMDAR) blockers, CNQX, and APV, GABAAR-mediated tonic GABA current (ITonic) was measured as a shift of current between baseline and application of GABAAR antagonist, BIC (50 μM). The GABA-induced current (IGABA) was calculated as the current difference between the peak following GABA (5 μM) application and the observed after treatment with BIC (Fig. 2E). Tonic GABA current was significantly decreased by 66.7% in BEST1 aKO compared to BEST1 control. At the same time, there is no significant change in GABA-induced current, membrane capacitance (Cm), sIPSC amplitude, and frequency (Fig. 2F~H). This result suggests that astrocyte-specific BEST1 majorly contributes to tonic GABA release in the striatum.

BEST1 aKO mice show a significant reduction in BEST1 expression and tonic GABA current, along with increased GABA content in astrocytes in the HpDG

Tonic GABA-mediated inhibition has also been reported in the HpDG [21], as seen in the striatum [21]. To assess the differences in BEST1 and GABA levels between the two groups, the expression of BEST1 and GABA was compared in HpDG of BEST1 control and BEST1 aKO mice through IHC. The experiment timeline in HpDG was the same as in the striatum (Fig. 3A). In IHC data, colocalization of GABA and BEST1 with S100β-positive cell area, highlighted with a white arrow, was observed (Fig. 3C). In the S100β-positive cell areas of BEST1 aKO mice compared to BEST1 control mice, there was a significant reduction in BEST1 expression; however, BEST1 aKO showed significantly increased GABA content in astrocytes (Fig. 3D). To check the contribution of astrocytic BEST1 channel for tonic inhibition in HpDG, we measure the tonic GABA current of the granule cell (Fig. 3B). In the presence of CNQX and APV, GABAAR-mediated tonic GABA current was measured by application of BIC (50 μM). It has been reported that the HpDG exhibits a dense expression of the GABAAR δ-subunit [30], which is known to localize at extrasynaptic and perisynaptic sites [31], showing high sensitivity to THIP [30, 32]. We observed that several papers have treated THIP or GABA in a dose-dependent manner to compare extrasynaptic GABAAR activation, focusing primarily on changes in δ-subunit activation due to different pharmacological treatments [33-35]. However, due to the scarcity of studies that focus exclusively on the activation of extrasynaptic GABAAR by THIP in the HpDG of genetically engineered mouse lines, there is a need to investigate these currents, specifically in the Best1 aKO mouse. Therefore, the GABAAR δ-subunit agonist, THIP (2 μM), was used to selectively activate extrasynaptic GABAAR in the HpDG of BEST1 aKO mouse (Fig. 3E). Tonic GABA current was significantly decreased by 46.4% in BEST1 aKO compared to BEST1 control. At the same time, there is no significant change in THIP-induced current, Cm, sIPSC amplitude, and frequency (Fig. 3F~H). This result implicates that astrocyte-specific BEST1 is majorly contributing to tonic GABA release in HpDG.

BEST1 aKO mice show a significant reduction in BEST1 expression, tonic GABA current, and increased GABA content in astrocytes in the Pf

We have presented that tonic release of astrocytic GABA via the BEST1 channel controls sensory acuity in thalamic ventrobasal region (VB) [8]. To assess the differences in BEST1 and GABA levels between BEST1 control and BEST1 aKO mice, we compared the expression of BEST1 and GABA in the Pf of the two groups using IHC. The experimental timeline in the Pf was the same as in the striatum, and HpDG (Fig. 4A). Brain slices were immunostained for S100β, GABA, and BEST1. Under confocal microscopy, colocalization of GABA and BEST1 within the S100β-positive cell area was observed, highlighted with a white arrow (Fig. 4C). In the S100β-positive cell areas of BEST1 aKO mice compared to BEST1 control mice, there was a significant reduction in BEST1 expression; however, significantly increased GABA content in astrocytes was identified, similar with HpDG (Fig. 4D). In addition, as we have reported neuronal BEST1 expression in thalamic reticular neurons [36], we have also examined neuronal BEST1 and found that there was no significant change in BEST1 level in BEST1-positive thalamocortical neurons (highlighted with yellow arrow) between BEST1 control and BEST1 aKO (Fig. 4C). This result indicates astrocyte-specific removal of BEST1 in BEST1 aKO mice. To determine if astrocytic BEST1 is required for tonic inhibition in the Pf, we measured the tonic GABA current in thalamocortical neurons (Fig. 4B). In the presence of CNQX and APV, GABAAR-mediated tonic GABA current was assessed using another allosteric GABAAR antagonist, GBZ (50 μM) [37]. The tonic GABA current was significantly decreased by 49.6% in BEST1 aKO mice compared to BEST1 control mice. At the same time, there was no significant change in GABA-induced current, Cm, or sIPSC amplitude and frequency (Fig. 4F~H). These results suggest that astrocyte-specific BEST1 significantly contributes to Pf's tonic GABA release.

DISCUSSION

To date, the reported BEST1 null KO mouse line has been on a Balb/c background [38], and this mouse line has not been sufficient for studying astrocytic BEST1. Recognizing the importance of astrocytic BEST1 in various gliotransmission research through previous reports[4, 15, 16], we successfully generated Best1 floxed (C57BL/6JCya-Best1em1flox/Cya) using the ES cell targeting method. We crossed these with hGFAP-CreERT2 mice to generate BEST1 aKO mice. Using the CreERT2 system allows us to control the time window of Cre recombinase activation by injecting tamoxifen. This system enables us to ablate a developmentally important gene without fatal underdevelopment. Consistent with previous studies [5, 8, 21], ablation of astrocytic BEST1 showed a critical reduction in tonic inhibition by 66.7% in the striatum, 46.4% in the HpDG, and 49.6% in the Pf, compared to Cre-negative controls, without affecting phasic inhibition (Fig. 5).

Due to its low expression level of GFAP (https://www.proteinatlas.org/ENSG00000131095-GFAP/brain), It is well established that GFAP promoter does not work well in the striatum and thalamus. To overcome the limitation due to the low expression level of GFAP, GLAST-CreERT2 [39] and ALDH1L1-CreERT2 [40] mouse lines have been developed. However, the Glast-CreERT2 mouse line exhibits significant neuronal expression, and the Aldh1l1-CreERT2 line is not ideal for brain-specific targeting due to its expression in other body parts [27]. In a previous study validating the hGFAP-CreERT2 mouse [28], we assessed astrocyte specificity (tdTomato+ & S100β+/tdTomato+) and coverage (tdTomato+ & S100β+/S100β+) in brain sections from the hGFAP-CreERT2×Ai14 double transgenic mouse line using S100β immunostaining. The striatum showed high astrocyte specificity (89%) but moderate coverage (50%), whereas the thalamic VB area demonstrated moderate astrocyte specificity (64%) and high coverage (89%). Our measurements indicated reductions in tonic GABA current of 66.7% in the striatum and 49.6% in the thalamus. The decrease in tonic GABA current appears to be correlated with astrocyte specificity. These results confirm that the GFAP promoter functions effectively in both the striatal and thalamic regions. Our measurements demonstrated a reduction in tonic GABA currents of 66.7% in the striatum and 49.6% in the Pf. This decrease in tonic GABA current is seemingly correlated with astrocytic specificity. Consequently, aligning our tonic GABA current reduction data with the previously reported high astrocytic specificity in the hGFAP-CreERT2×Ai14 double transgenic mouse line substantiates the reliability of the Cre-expression system of hGFAP-CreERT2 in the striatum and thalamus.

In the Best1 aKO mouse immunostaining data, we observed that the BEST1 level significantly decreased. We expected unreleased GABA can be accumulated in the astrocyte since GABA can be released through the BEST1 channel. GABA level was significantly increased in the HpDG and Pf. However, GABA expression was paradoxically decreased in the striatum. The high level of GABA degradation enzyme, ABAT, expression in the striatum can explain this paradoxical decrease of GABA. However, there is a lack of evidence on whether striatal astrocytes express high levels of ABAT. Therefore, future investigation is needed to determine the astrocytic ABAT level in the striatum.

Additionally, the BEST1 channel mediates slow glutamate release in astrocytes upon GPCR activation [13] and, along with the co-release of D-serine [16], contributes to tonic NMDAR currents in the hippocampus [16, 41]. The BEST1 aKO mouse will help study both glutamate release and the contribution of BEST1 to the tonic NMDAR current in the brain. This mouse line will be valuable for future studies on GABA and other gliotransmitters, such as glutamate and D-serine, mediated by astrocytic BEST1.

ACKNOWLEDGEMENTS

The Institute for Basic Science Center for Cognition and Sociality (IBS-R001-D2-2024-a00) supported this research for C.J.L.

Fig. 1 Generation of Best1 floxed mouse line and BEST1 aKO mouse line. (A) Schematic illustration of generating heterozygous Best1 floxed mouse using ES cell targeting method. (B) Schematic diagram of Best1 gene location in chromosome 19 (top) and generation of Best1 floxed allele using homology-directed recombination. (C) (left) Construct of Best1 floxed allele in Best1 floxed mouse (C57BL/6JCya-Best1em1flox/Cya, fl/fl) with two sets of primer for genotyping (F1-R1, F2-R2). (right) Genotyping result using F1-R1, F2-R2, and primers for hGFAP-CreERT2 mouse. (bottom) Band size information for determining genotypes. (D) Sequencing results of loxP sites (blue highlighted) upstream of exon 3 using F1 primer. (E) Sequencing results of loxP site (blue highlighted) downstream of exon 6 using R2 primer. (F) Schematic diagram of BEST1 aKO generation strategy specific to mating. (G) Schematic diagram of knocking out Best1 gene by Cre recombination.

Fig. 2 BEST1 aKO mice show a significant reduction in GABA content, BEST1 expression in astrocytes, and tonic GABA current in the striatum. (A) Experimental scheme and timeline of generating and using BEST1 aKO mouse. (B) Schematic diagram of the striatum in the coronal plane of Best1 floxed/hGFAP-CreERT2 mouse (left) and DIC image of a whole cell-patch clamped region in the dorsal striatum and medial spiny neuron (right). (C) Representative confocal images of DAPI (blue), S100β (green), GABA (red), and BEST1 (Magenta) in the coronal plane of dorsal striatum from BEST1 control and BEST1 aKO mouse. The white box is a magnified image. (D) (top) Violin plot showing GABA intensity in S100β-positive cells in the striatum (control: 87.99; aKO: 77.48; Mann-Whitney test, p=0.0021). (bottom) Violin plot for BEST1 intensity in S100β-positive cells (control: 53.64; aKO: 42.43; unpaired t-test, p=0.0002). (E) Representative traces from tamoxifen-injected BEST1 control (without Cre expression) and BEST1 aKO (with Cre expression). Measured currents include GABA-induced current (IGABA, green arrow) and ambient tonic GABA current (ITonic, black arrow) after serial bath application of 5 μM GABA (green line) and 50 μM BIC (black line). (F) Summarized scatter bar graphs of ambient tonic GABA current, GABA-induced current, and Cm (left, control, 25.36, aKO, 11.21, unpaired t-test, p=0.0232) (middle, control, 30.56, aKO, 27.26, unpaired t-test, p= 0.7697) (right, control, 19.03, aKO, 25.08, Mann-Whitney test, p=0.2381). (G) Representative trace of sIPSC from BEST1 control and BEST1 aKO mouse. (H) Summarized scatter bar graphs of sIPSC amplitude and sIPSC frequency. (left, control, 23.56, aKO, 23.20, unpaired t-test, p=0.9098) (right, control, 0.7420, aKO, 0.5580, Mann-Whitney test, p=0.4747).

Fig. 3 BEST1 aKO mice show a significant reduction in BEST1 expression and tonic GABA current, along with increased GABA content in astrocytes in the HpDG. (A) Experimental scheme and timeline of generating and using BEST1 aKO mouse. (B) Schematic diagram of HpDG in the horizontal plane of Best1 floxed/hGFAP-CreERT2 mouse (left) and DIC image of a whole cell-patch clamped region in the ventral dentate gyrus and granule cells (right). (C) Representative confocal images of DAPI (blue), S100β (green), GABA (red), and BEST1 (Magenta) in the coronal plane of HpDG from BEST1 control and BEST1 aKO mouse. The white box is a magnified image. (D) (left) Violin plot showing GABA intensity in S100β-positive cells in the HpDG (control, 100.2, aKO, 116.9, Mann-Whitney test, p<0.0001). (middle) Violin plot for BEST1 intensity in S100β-positive cells (control, 82.77, aKO, 72.78, Mann-Whitney test, p<0.0001). (E) Representative traces from tamoxifen-injected BEST1 control (without Cre expression) and BEST1 aKO (with Cre expression). Measured currents include THIP-induced current (ITHIP, blue arrow) and ambient tonic GABA current (ITonic, black arrow) after serial bath application of 2 μM THIP (blue line) and 50 μM BIC (black line). (F) Summarized scatter bar graphs of ambient tonic GABA current, THIP-induced current, and Cm value (left, control, 26.88, aKO, 14.42, unpaired t-test, p=0.0313) (middle, control, 30.77, aKO, 25.28, unpaired t-test, p=0.1739) (right, control, 32.44, aKO, 30.59, Mann-Whitney test, p=0.5273). (G) Representative trace of sIPSC from BEST1 control and BEST1 aKO mouse. (H) Summarized scatter bar graphs of sIPSC amplitude and sIPSC frequency (left, control, 26.14, aKO, 28.88, Mann-Whitney test, p=0.8315) (right, control, 2.041, aKO, 1.374, Mann-Whitney test, p=0.1010).

Fig. 4 BEST1 aKO mice show a significant reduction in BEST1 expression, tonic GABA current, and increased GABA content in astrocytes in the Pf. (A) Experimental scheme and timeline of generating and using BEST1 aKO mouse. (B) Schematic diagram of the Pf in the horizontal plane of Best1 floxed/hGFAP-CreERT2 mouse (left) and DIC image of a whole cell-patch clamped region in the Pf and Pf neuron (right). (C) Representative confocal images of DAPI (Blue), S100β (Green), GABA (Red), and BEST1 (Magenta) in the coronal plane of the Pf from BEST1 control and BEST1 aKO mouse. The white box is a magnified image. (D) (left) Violin plot showing GABA intensity in S100β-positive cells in the Pf (control, 125.8, aKO, 134.3, Mann-Whitney test, p<0.0001). (middle) Violin plot for BEST1 intensity in S100β-positive cells (control, 95.00, aKO, 87.30, Mann-Whitney test, p<0.0001). (right) Violin plot for BEST1 intensity in Pf neuronal cells (control, 114.1, aKO, 110.8, Mann-Whitney test, p=0.3577). (E) Representative traces from tamoxifen-injected BEST1 control (without Cre expression) and Best1 aKO (with Cre expression). Measured currents include GABA-induced current (IGABA, green arrow) and ambient tonic GABA current (ITonic, black arrow) after serial bath application of 5 μM GABA (green line) and 50 μM GBZ (black line). (F) Summarized scatter bar graphs of ambient tonic GABA current, GABA-induced current, and Cm (left, control, 20.81, aKO, 6.912, Mann-Whitney test, p=0.0220) (middle, control, 53.92, aKO, 22.73, Mann-Whitney test, p=0.0541) (right, control, 51.88, aKO, 27.21, Mann-Whitney test, p=0.1128). (G) Representative trace of sIPSC from BEST1 control and BEST1 aKO mouse. (H) Summarized scatter bar graphs of sIPSC amplitude and sIPSC frequency (left, control, 20.43, aKO, 16.05, unpaired t-test, p=0.0587) (right, control, 1.159, aKO, 1.242, Mann-Whitney test, p=0.6276).

Fig. 5 Schematic illustration of generation (top) and characterization (bottom) of astrocyte-specific Best conditional KO (BEST1 aKO) mice. BEST1 aKO mice show reduced tonic GABA inhibition with reduced levels of BEST1 expression in astrocytes, compared to Cre-negative control.
==== Refs
References

1 Marmorstein AD Marmorstein LY Rayborn M Wang X Hollyfield JG Petrukhin K 2000 Bestrophin, the product of the Best vitelliform macular dystrophy gene (VMD2), localizes to the basolateral plasma membrane of the retinal pigment epithelium Proc Natl Acad Sci U S A 97 12758 12763 10.1073/pnas.220402097 11050159
2 Johnson AA Guziewicz KE Lee CJ Kalathur RC Pulido JS Marmorstein LY Marmorstein AD 2017 Bestrophin 1 and retinal disease Prog Retin Eye Res 58 45 69 10.1016/j.preteyeres.2017.01.006 28153808
3 Oh SJ Lee CJ 2017 Distribution and function of the bestrophin-1 (Best1) channel in the brain Exp Neurobiol 26 113 121 10.5607/en.2017.26.3.113 28680296
4 Lee S Yoon BE Berglund K Oh SJ Park H Shin HS Augustine GJ Lee CJ 2010 Channel-mediated tonic GABA release from glia Science 330 790 796 10.1126/science.1184334 20929730
5 Yoon BE Woo J Chun YE Chun H Jo S Bae JY An H Min JO Oh SJ Han KS Kim HY Kim T Kim YS Bae YC Lee CJ 2014 Glial GABA, synthesized by monoamine oxidase B, mediates tonic inhibition J Physiol 592 4951 4968 10.1113/jphysiol.2014.278754 25239459
6 Park H Han KS Oh SJ Jo S Woo J Yoon BE Lee CJ 2013 High glutamate permeability and distal localization of Best1 channel in CA1 hippocampal astrocyte Mol Brain 6 54 10.1186/1756-6606-6-54 24321245
7 Oh SJ Han KS Park H Woo DH Kim HY Traynelis SF Lee CJ 2012 Protease activated receptor 1-induced glutamate release in cultured astrocytes is mediated by bestrophin-1 channel but not by vesicular exocytosis Mol Brain 5 38 10.1186/1756-6606-5-38 23062602
8 Kwak H Koh W Kim S Song K Shin JI Lee JM Lee EH Bae JY Ha GE Oh JE Park YM Kim S Feng J Lee SE Choi JW Kim KH Kim YS Woo J Lee D Son T Kwon SW Park KD Yoon BE Lee J Li Y Lee H Bae YC Lee CJ Cheong E 2020 Astrocytes control sensory acuity via tonic inhibition in the thalamus Neuron 108 691 706.e10 10.1016/j.neuron.2020.08.013 32905785
9 Al-Jumaily M Kozlenkov A Mechaly I Fichard A Matha V Scamps F Valmier J Carroll P 2007 Expression of three distinct families of calcium-activated chloride channel genes in the mouse dorsal root ganglion Neurosci Bull 23 293 299 10.1007/s12264-007-0044-8 17952139
10 André S Boukhaddaoui H Campo B Al-Jumaily M Mayeux V Greuet D Valmier J Scamps F 2003 Axotomy-induced expression of calcium-activated chloride current in subpopulations of mouse dorsal root ganglion neurons J Neurophysiol 90 3764 3773 10.1152/jn.00449.2003 12944538
11 Pineda-Farias JB Barragán-Iglesias P Loeza-Alcocer E Torres-López JE Rocha-González HI Pérez-Severiano F Delgado-Lezama R Granados-Soto V 2015 Role of anoctamin-1 and bestrophin-1 in spinal nerve ligation-induced neuropathic pain in rats Mol Pain 11 41 10.1186/s12990-015-0042-1 26130088
12 Woo J Jang MW Lee J Koh W Mikoshiba K Lee CJ 2020 The molecular mechanism of synaptic activity-induced astrocytic volume transient J Physiol 598 4555 4572 10.1113/JP279741 32706443
13 Woo DH Han KS Shim JW Yoon BE Kim E Bae JY Oh SJ Hwang EM Marmorstein AD Bae YC Park JY Lee CJ 2012 TREK-1 and Best1 channels mediate fast and slow glutamate release in astrocytes upon GPCR activation Cell 151 25 40 10.1016/j.cell.2012.09.005 23021213
14 Lee JM Gadhe CG Kang H Pae AN Lee CJ 2022 Glutamate permeability of chicken Best1 Exp Neurobiol 31 277 288 10.5607/en22038 36351838
15 Han KS Woo J Park H Yoon BJ Choi S Lee CJ 2013 Channel-mediated astrocytic glutamate release via bestrophin-1 targets synaptic NMDARs Mol Brain 6 4 10.1186/1756-6606-6-4 23324492
16 Koh W Park M Chun YE Lee J Shim HS Park MG Kim S Sa M Joo J Kang H Oh SJ Woo J Chun H Lee SE Hong J Feng J Li Y Ryu H Cho J Lee CJ 2022 Astrocytes render memory flexible by releasing D-serine and regulating NMDA receptor tone in the hippocampus Biol Psychiatry 91 740 752 10.1016/j.biopsych.2021.10.012 34952697
17 Koh W Kwak H Cheong E Lee CJ 2023 GABA tone regulation and its cognitive functions in the brain Nat Rev Neurosci 24 523 539 10.1038/s41583-023-00724-7 37495761
18 Woo J Min JO Kang DS Kim YS Jung GH Park HJ Kim S An H Kwon J Kim J Shim I Kim HG Lee CJ Yoon BE 2018 Control of motor coordination by astrocytic tonic GABA release through modulation of excitation/inhibition balance in cerebellum Proc Natl Acad Sci U S A 115 5004 5009 10.1073/pnas.1721187115 29691318
19 Chun H Im H Kang YJ Kim Y Shin JH Won W Lim J Ju Y Park YM Kim S Lee SE Lee J Woo J Hwang Y Cho H Jo S Park JH Kim D Kim DY Seo JS Gwag BJ Kim YS Park KD Kaang BK Cho H Ryu H Lee CJ 2020 Severe reactive astrocytes precipitate pathological hallmarks of Alzheimer's disease via H2O2- production Nat Neurosci 23 1555 1566 10.1038/s41593-020-00735-y 33199896
20 Heo JY Nam MH Yoon HH Kim J Hwang YJ Won W Woo DH Lee JA Park HJ Jo S Lee MJ Kim S Shim JE Jang DP Kim KI Huh SH Jeong JY Kowall NW Lee J Im H Park JH Jang BK Park KD Lee HJ Shin H Cho IJ Hwang EM Kim Y Kim HY Oh SJ Lee SE Paek SH Yoon JH Jin BK Kweon GR Shim I Hwang O Ryu H Jeon SR Lee CJ 2020 Aberrant tonic inhibition of dopaminergic neuronal activity causes motor symptoms in animal models of Parkinson's disease Curr Biol 30 276 291.e9 10.1016/j.cub.2019.11.079 31928877
21 Jo S Yarishkin O Hwang YJ Chun YE Park M Woo DH Bae JY Kim T Lee J Chun H Park HJ Lee DY Hong J Kim HY Oh SJ Park SJ Lee H Yoon BE Kim Y Jeong Y Shim I Bae YC Cho J Kowall NW Ryu H Hwang E Kim D Lee CJ 2014 GABA from reactive astrocytes impairs memory in mouse models of Alzheimer's disease Nat Med 20 886 896 10.1038/nm.3639 24973918
22 Park H Oh SJ Han KS Woo DH Park H Mannaioni G Traynelis SF Lee CJ 2009 Bestrophin-1 encodes for the Ca2+-activated anion channel in hippocampal astrocytes J Neurosci 29 13063 13073 10.1523/JNEUROSCI.3193-09.2009 19828819
23 Capecchi MR 2001 Generating mice with targeted mutations Nat Med 7 1086 1090 10.1038/nm1001-1086 11590420
24 Yang L Li H Han Y Song Y Wei M Fang M Sun Y 2023 CRISPR/Cas9 gene editing system can alter gene expression and induce DNA damage accumulation Genes (Basel) 14 806 10.3390/genes14040806 37107564
25 Pattanayak V Ramirez CL Joung JK Liu DR 2011 Revealing off-target cleavage specificities of zinc-finger nucleases by in vitro selection Nat Methods 8 765 770 10.1038/nmeth.1670 21822273
26 Mussolino C Morbitzer R Lütge F Dannemann N Lahaye T Cathomen T 2011 A novel TALE nuclease scaffold enables high genome editing activity in combination with low toxicity Nucleic Acids Res 39 9283 9293 10.1093/nar/gkr597 21813459
27 Petryszak R Keays M Tang YA Fonseca NA Barrera E Burdett T Füllgrabe A Fuentes AM Jupp S Koskinen S Mannion O Huerta L Megy K Snow C Williams E Barzine M Hastings E Weisser H Wright J Jaiswal P Huber W Choudhary J Parkinson HE Brazma A 2016 Expression Atlas update--an integrated database of gene and protein expression in humans, animals and plants Nucleic Acids Res 44 D746 D752 10.1093/nar/gkv1045 26481351
28 Park YM Chun H Shin JI Lee CJ 2018 Astrocyte Specificity and Coverage of hGFAP-CreERT2 [Tg(GFAP-Cre/ERT2)13Kdmc] mouse line in various brain regions Exp Neurobiol 27 508 525 10.5607/en.2018.27.6.508 30636902
29 Lee CJ Yoon BE 2014 Protease-activated receptor 1-induced GABA release in cultured cortical astrocytes pretreated with GABA is mediated by the bestrophin-1 channel Anim Cells Syst (Seoul) 18 244 249 10.1080/19768354.2014.944211
30 Hörtnagl H Tasan RO Wieselthaler A Kirchmair E Sieghart W Sperk G 2013 Patterns of mRNA and protein expression for 12 GABAA receptor subunits in the mouse brain Neuroscience 236 345 372 10.1016/j.neuroscience.2013.01.008 23337532
31 Brickley SG Mody I 2012 Extrasynaptic GABA(A) receptors: their function in the CNS and implications for disease Neuron 73 23 34 10.1016/j.neuron.2011.12.012 22243744
32 Chandra D Jia F Liang J Peng Z Suryanarayanan A Werner DF Spigelman I Houser CR Olsen RW Harrison NL Homanics GE 2006 GABAA receptor α4 subunits mediate extrasynaptic inhibition in thalamus and dentate gyrus and the action of gaboxadol Proc Natl Acad Sci U S A 103 15230 15235 10.1073/pnas.0604304103 17005728
33 Trent S Hall J Connelly WM Errington AC 2019 Cyfip1 haploinsufficiency does not alter GABAA receptor δ-subunit expression and tonic inhibition in dentate gyrus PV+ interneurons and granule cells eNeuro 6 ENEURO.0364-18.2019 10.1523/ENEURO.0364-18.2019
34 Carver CM Reddy DS 2013 Neurosteroid interactions with synaptic and extrasynaptic GABA(A) receptors: regulation of subunit plasticity, phasic and tonic inhibition, and neuronal network excitability Psychopharmacology (Berl) 230 151 188 10.1007/s00213-013-3276-5 24071826
35 Ransom CB Ye Z Spain WJ Richerson GB 2017 Modulation of tonic GABA currents by anion channel and connexin hemichannel antagonists Neurochem Res 42 2551 2559 10.1007/s11064-017-2246-4 28401401
36 Jung JY Lee SE Hwang EM Lee CJ 2016 Neuronal expression and cell-type-specific gene-silencing of Best1 in thalamic reticular nucleus neurons using pSico-Red System Exp Neurobiol 25 120 129 10.5607/en.2016.25.3.120 27358580
37 Ueno S Bracamontes J Zorumski C Weiss DS Steinbach JH 1997 Bicuculline and gabazine are allosteric inhibitors of channel opening of the GABAA receptor J Neurosci 17 625 634 10.1523/JNEUROSCI.17-02-00625.1997 8987785
38 Marmorstein LY Wu J McLaughlin P Yocom J Karl MO Neussert R Wimmers S Stanton JB Gregg RG Strauss O Peachey NS Marmorstein AD 2006 The light peak of the electroretinogram is dependent on voltage-gated calcium channels and antagonized by bestrophin (Best-1) J Gen Physiol 127 577 589 10.1085/jgp.200509473 16636205
39 Slezak M Göritz C Niemiec A Frisén J Chambon P Metzger D Pfrieger FW 2007 Transgenic mice for conditional gene manipulation in astroglial cells Glia 55 1565 1576 10.1002/glia.20570 17823970
40 Srinivasan R Lu TY Chai H Xu J Huang BS Golshani P Coppola G Khakh BS 2016 New transgenic mouse lines for selectively targeting astrocytes and studying calcium signals in astrocyte processes in situ and in vivo Neuron 92 1181 1195 10.1016/j.neuron.2016.11.030 27939582
41 Kim H Choi S Lee E Koh W Lee CJ 2024 Tonic NMDA receptor currents in the brain: regulation and cognitive functions Biol Psychiatry 96 164 175 10.1016/j.biopsych.2024.03.009 38490367
