
==== Front
Transl Psychiatry
Transl Psychiatry
Translational Psychiatry
2158-3188
Nature Publishing Group UK London

39294141
3078
10.1038/s41398-024-03078-5
Article
Social isolation impairs cognition via Aβ-mediated synaptic dysfunction
Huang Fang 12
Liu Xinghua 13
Guo Qian 1
Mahaman Yacoubou Abdoul Razak 1
Zhang Bin 1
Wang Jian-Zhi 12
Luo Hongbin 4
http://orcid.org/0000-0001-7477-6520
Liu Rong rong.liu@hust.edu.cn

1
http://orcid.org/0000-0001-8207-0042
Wang Xiaochuan wxch@mails.tjmu.edu.cn

12
1 https://ror.org/00p991c53 grid.33199.31 0000 0004 0368 7223 Department of Pathophysiology, School of Basic Medicine, Key Laboratory of Education Ministry/Hubei Province of China for Neurological Disorders, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, 430030 China
2 https://ror.org/02afcvw97 grid.260483.b 0000 0000 9530 8833 Co-innovation Center of Neuroregeneration, Nantong University, Nantong, JS 226001 China
3 grid.33199.31 0000 0004 0368 7223 Trauma Center/Department of Emergency and Trauma Surgery, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
4 https://ror.org/01q349q17 grid.440771.1 0000 0000 8820 2504 Medical College, Hubei University for Nationalities, Enshi, 445000 HB China
18 9 2024
18 9 2024
2024
14 38017 5 2024
22 8 2024
27 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Social isolation (SI) is a common phenomenon in the modern world, especially during the coronavirus disease 2019 pandemic, and causes lasting cognitive impairments and mental disorders. However, it is still unclear how SI alters molecules in the brain and induces behavioural dysfunctions. Here, we report that SI impairs cognitive function and induces depressive-like behaviours in C57BL/6 J mice, in addition to impairing synaptic plasticity and increasing the levels of APP cleavage-related enzymes, thereby promoting Aβ production. Moreover, we show that in APP/PS1 transgenic mice, SI accelerates pathological changes and behavioural deficits. Interestingly, downregulation of the expression of the BACE1 attenuates SI-induced Aβ toxicity and synaptic dysfunction. Furthermore, early intervention with BACE1 shRNA blocks SI-induced cognitive impairments. Together, our data strongly suggest that SI-induced upregulation of BACE1 expression mediates Aβ toxicity and induces behavioural deficits. Down-regulation of BACE1 may be a promising strategy for preventing SI-induced cognitive impairments.

Subject terms

Molecular neuroscience
Learning and memory
https://doi.org/10.13039/501100001809 National Natural Science Foundation of China (National Science Foundation of China) 32000688 Huang Fang https://doi.org/10.13039/501100002858 China Postdoctoral Science Foundation 2020M672362 Huang Fang Postdoctoral innovative research post in Hubei Province (No. 2019235346)issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Social isolation (SI), such as the absence of a spouse, reduced contact with friends and family, and a lack of participation in organizations, clubs, or religious groups [1], is a common phenomenon in the modern world, especially during the coronavirus disease 2019 (COVID-19) pandemic. Accumulating evidence has indicated that SI leads to lasting cognitive dysfunction and mental disorders [2, 3]. Currently, the mechanisms by which SI induces behavioural dysfunction at the molecular and morphological levels are unknown. A longitudinal study revealed that those who live alone have doubled the risk of developing Alzheimer’s disease (AD) compared to those who live in groups [4]. Hence, we speculate that SI- and AD-related cognitive dysfunction share some common pathological mechanisms.

AD, the most common form of dementia, is a progressive disease that first presents as mild memory loss. It is characterized neuropathologically by the accumulation of senile plaques composed of amyloid beta (Aβ) and neurofibrillary tangle formation, which is associated with synaptic dysfunction [5]. An increase in Aβ production is a typical pathological change in the early stage of AD [6]. Aβ is generated from amyloid precursor protein (APP) via the amyloidogenic pathway. The β-secretase BACE1 and γ-secretase PSEN1 cleave APP sequentially to produce mainly Aβ40 and Aβ42 [7]. In the brains of AD patients, the expression and enzymatic activity of BACE1 are increased [8, 9]. Dysregulation of BACE1, the rate-limiting enzyme for the production of Aβ peptides, accelerates Aβ production and causes the development of senile plaques. Indeed, BACE1-deficient mice lack Aβ, and loss of BACE1 rescues memory deficits in APP/PS1 mice, confirming that BACE1 is a therapeutic target for AD [10]. Over-production of toxic Aβ peptides, including monomeric and multimeric Aβ peptides, mainly Aβ40 and Aβ42, leads to synaptic dysfunction and neuronal apoptosis and induces cognitive decline [7]. Synaptic function depends on the structure and number of dendritic spines. Immature spines and aberrant expression of synapse-associated proteins are involved in cognitive impairments [11, 12]. Since SI is one of the risk factors for AD, we speculate that SI might induce the generation of key pathological molecules that mediate AD pathology and therefore trigger the development of AD.

In the current study, we evaluated the effects of SI on behaviour, amyloidogenic APP cleavage, and synaptic function in C57BL/6 J mice and found that SI induced Aβ toxicity, upregulation of BACE1 expression, and cognitive deficits. Moreover, SI accelerated amyloidogenic pathological changes and behavioural deficits in APP/PS1 transgenic mice. BACE1 inhibition attenuated SI-induced Aβ toxicity, synaptic dysfunction, and cognitive deficits. Hence, our findings imply that SI impairs cognition via upregulation of BACE1 expression, promoting Aβ toxicity and mediating synaptic dysfunction. Lowering BACE1 levels might be a mechanism-based therapeutic strategy for preventing SI-related cognitive impairments, including AD.

Materials and Methods

Ethics and participants

Ethical approval was obtained from the Ethics Committee of Huazhong University of Science and Technology (Wuhan, Hubei, China; IACUC number: 3308). The study design and all methods were performed in accordance with the relevant ethical guidelines and regulations. No human material was involved in this study.

Animals and SI paradigm

All protocols were approved by the Huazhong University of Animal Care and Use Committee. Four-week-old male wild-type (WT) C57BL/6 J mice were purchased from the Experimental Animal Centre of Tongji Medical Collegen (Hubei, China). APP/PS1 mice were obtained from Cavins Laboratory Animal Co., Ltd (Changzhou, China). The animals were divided into 8 groups by randomization: the WT C57BL/6 J home-caged (HC) (WT-HC) group, the WT C57BL/6 J SI (WT-SI) group, the APP/PS1 HC (APP/PS1-HC) group, the APP/PS1 SI (APP/PS1-SI) group, the WT C57BL/6 J HC and control EGFP-expressing adeno-associated virus (AAV) injection (Ctrl-HC) group, the WT C57BL/6 J SI and control EGFP-expressing AAV injection (Ctrl-SI) group, the WT C57BL/6 J home-caged and BACE1 shRNA-expressing AAV injection (siBACE1-HC) group, and the WT C57BL/6 J SI and BACE1 shRNA-expressing AAV injection (siBACE1-SI) group. For the house cage procedure, four-week-old male mice were housed in groups of 3–4 mice per cage. For the SI procedure, four-week-old male mice were individually housed in cages. All mice were housed on a 12 h dark-light cycle and given food and water ad libitum. The investigator was blinded to the group allocation during all the following experiments.

Intracerebroventricular (ICV) injection

The mice were anaesthetized with isoflurane (1.0%–2.5%) and fixed in a stereotactic apparatus equipped with a heating pad. The coordinates used to target the ventricle were 0.2 mm posterior, ±0.9 mm lateral and 2.3 mm ventral to bregma and were selected according to the Allen brain atlas (https://portal.brain-map.org/). The mice received bilateral ICV injections of 2 µl AAV at a rate of 0.2 µl/min. AAV9-CAG-EGFP-scramble (CGCTGAGTACTTCGAAATGTC) was used as a control AAV, and AAV9-CAG-EGFP-siBACE1 (CCTCCGAAAGGGTGTGTAT) (Genechem Co., Ltd., Shanghai, China) was used to induce the expression of BACE1 shRNA (this is referred to as siBACE1 throughout the manuscript). The syringe was left in the injection site for 10 min after injection was completed. The mice were allowed to recover for 3 days before undergoing SI or home cage procedures.

Behavioural tests

The order in which the animals were subjected to each behavioural test was randomized between litters. All behavioural testing apparatuses were wiped down with 75% ethanol between animals and trials. All scoring was performed manually by researchers blinded to both the genotypes and treatments. All testing was performed in a dimly lit room.

Morris water maze (MWM) test

The mice were subjected to the MWM test to evaluate spatial cognition. The apparatus consisted of a circular tank with a diameter of 1.2 m, above which a camera was fixed. Visual cues of different shapes were placed around the water tank. The water was maintained at a temperature of 22 ± 1 °C and made opaque using milk powder. A 10 cm circular platform was placed 0.5 cm under the water surface. The acquisition test was conducted for 4 or 6 days, with each trial lasting 60 s, and each animal was subjected to 3 trials per day.

If a mouse could climb onto the platform within 1 min, it would be allowed to stay on the platform for 20 s; otherwise, it would be guided to the platform and allowed to stay for 20 s. Twenty-four hours (day 5 for the WT-HC and WT-SI group and day 7 for the rest groups) or 72 h (day 9) after the last acquisition test, the probe test, in which the hidden platform was removed and each mouse was allowed to swim for 60 s, was carried out. The latency to reach the previous platform location and the number of platform crossings were recorded. Due to poor performance, APP/PS1 mice were subjected to acquisition tests for 4 days after the probe test. The subsequent probe test was performed in the same manner 24 h or 72 h after the last acquisition test.

Fear conditioning tests

The mice were habituated to a training chamber for 3 min. A 55 dB tone, which served as the conditioned stimulus (CS), was played for 30 s. During the last 2 s of the tone, a foot shock (0.3 mA) was delivered as the unconditioned stimulus (US). Each mouse received three CS-US pairings with a 2 min interstimulus interval. Twenty-four hours after conditioning the mice were re-exposed to the original training chamber for 3 min for the context-dependent test, during which no tones or shocks were presented. After twenty-four hours, the cue-dependent test was carried out. For this test, a novel cardboard was placed on the top of the grid floor to provide a different tactile stimulus. Each mouse was placed in the original context for 3 min and a 30 s tone was presented without a shock. The freezing percentage was calculated as freezing duration (sec)/180 (sec) ×100.

Sucrose preference test (SPT)

The SPT was used to assess anhedonia. Each mouse was placed individually in a cage containing two bottles of water for a 24 h acclimation period. After 24 h of water deprivation, two identical bottles, one containing pure water and another containing 1% sucrose solution, were placed in each cage. The consumption of water and sucrose solution over four hours was recorded, and sucrose preference was calculated according to the following equation: sucrose preference (%) = sucrose solution consumption/total fluid intake×100.

Open field test (OFT)

The OFT was applied to assess the anxiety and spontaneous movements of the mice. The apparatus consisted of an open field arena (50×50×50 cm), and a digital camera was positioned directly above the centre of the field. The square field was divided into 5 × 5 zones. Each mouse was gently placed in the open field arena and allowed to explore freely. The distance travelled and the number of zone crossings over 5 min were recorded.

Tail suspension test (TST)

The TST was conducted to assess the depressive-like behaviour of the mice. In brief, the tip of the tail was taped to a crossbar, which was 15 cm above a laboratory bench. Initially, the mice struggled to overcome the abnormal posture and became immobile after a period. The latency to immobility and the total immobility time during the five-minute test were recorded to assess behavioural despair.

Primary neuron culture

Between gestational days 15 and 17, pregnant SD rats or C57 mice were deeply anaesthetized with isoflurane followed by a single intraperitoneal (i.p.) injection of a cocktail containing ketamine (100 mg/kg) and glycopyrrolate (0.2 mg/kg). This anaesthesia protocol was used for the rest of the experiment. The brains of foetal rats were isolated at 4 °C, cut into small pieces with scissors, and digested with 4 ml of 0.125% trypsin for 10–15 min. The digestion was stopped by adding equal amount of neuronal plating medium (10% foetal bovine serum in DMEM/F12). After centrifugation, resuspension, and trituration with a plating medium, the neurons were filtered with a 200-mesh sieve and plated in a 60 mm plastic culture dish or 6-well cell culture plate coated with poly D-lysine. The neurons were incubated in a humidified incubator at 37 °C for 4 h with 5% CO2, and then the medium was replaced with a neurobasal medium supplemented with B27, GlutaMAX, and penicillin/streptomycin, all from Gibco (maintenance medium). Half of the medium was changed every 3 days.

Cell viability assays

Cell viability was measured with a CCK8 kit (Beyotime, Shanghai, China) following the instructions in the manual. The neurons were cultivated in a 96-well plate and treated with mouse Aβ40 at concentrations of 1, 2, 4, 8, 16, and 32 μM for 24 h. Each well was added 10 ul CCK-8 solution, incubated for 3 hours, and then read using a microplate reader at a wavelength of 450 nm.

Electrophysiology

The mice were deeply anaesthetized and sacrificed, and their brains were collected. The brains were frozen in ice-cold oxygenated (95% O2, 5% CO2) artificial cerebrospinal fluid (aCSF, containing in mM: 124 NaCl, 2.5 KCl, 2 CaCl2, 2 MgSO4, 1 NaH2PO4, 25 NaHCO3, and 10 glucose; pH 7.4) and horizontally sliced at a thickness of 300 μm with a vibratome (Leica, Germany). The slices were allowed to recover in 29 °C aCSF for 90 min. A single slice was transferred to an MED probe (MED-P515A, 8 × 8 array, interpolar distance 150 μm, Panasonic, Japan) and perfused with 29 °C aCSF at a flow rate of 2 ml/min. To assess the effect of Aβ40 on long-term potentiation (LTP) in WT-HC mice, brain slices were perfused with 5 nM human dimeric Aβ40 or 5 μM mouse oligomeric Aβ40 in aCSF. The human Aβ40 dimer was purchased from AnaSpec, Inc. (USA, 63130) and prepared with anhydrous DMSO as the stocking solution at the concentration of 50 μM, according to the instruction manual. The mouse oligomeric Aβ40 are prepared, as previously described [13], by incubating monomeric mouse Aβ40 at 37 °C or 4 °C for 6 h and confirmed by electrophoresis on an SDS-PAGE gel. The molecular weights of mouse oligomeric Aβ40 are identified with Coomassie Brilliant Blue staining. The oligomeric Aβ40 using in our LTP experiment is that incubating at 37 °C for 6 h. The electrodes were placed in the dentate gyrus (DG, stimulated region) and CA3 region (recording region). Field excitatory postsynaptic potentials (fEPSPs) were recorded at DG-CA3 synapses. Electrical stimulation was delivered to one channel within the DG and evoked fEPSPs were recorded from the other 63 channels. The stimulation intensity was approximately 40% of the intensity required to induce maximal fEPSPs. To record LTP, baseline responses were evoked for at least 30 min until stabilized, and then a high-frequency stimulation (HFS) protocol (consisting of 10 bursts, each containing 4 pulses at 100 Hz with an inter-burst interval of 200 ms) was applied at a stimulation intensity that was adjusted to elicit 40% of the maximal response. After the application of the HFS protocol, the test stimulus was repeatedly delivered once every minute for 1 hour to record LTP.

Immunofluorescence

The mice were deeply anaesthetized and then intracardially perfused with saline and 4% paraformaldehyde. The brains were collected, postfixed for one day, and dehydrated in 30% sucrose solution for three days before being sectioned with a cryotome (slice thickness: 20 μm). Primary neuronal cells were fixed in 4% PFA for 20 min at room temperature and washed with PBS 3 times. Free-floating brain slices or primary neuronal cells were permeabilized with 0.5% Triton X-100 and then blocked with 5% bovine serum albumin in PBS. The slices were incubated with a primary antibody at 4 °C for approximately 16 h. After washing with PBS three times, fluorescent secondary antibodies were applied at room temperature for one hour. The antibodies used in this study were as follows: rabbit anti-MAP2 (1:200; Abcam, UK), rabbit anti-BACE1 (1:200; Cell Signaling Technology, USA), mouse anti-Synapsin I (1:200; Millipore, Massachusetts, USA), donkey anti-mouse IgG and donkey anti-rabbit IgG (1:200; Jackson ImmunoResearch Labs, USA). For amyloid plaque staining, the Amylo-Glo RTD amyloid plaque stain reagent was applied according to the manufacturer’s instructions (TR-300-AG, Biosenis, USA) [14]. After washing with PBS three times, the samples were incubated in Hoechst (1:10000, Millipore, Massachusetts, USA) for 5 min and washed with PBS three times. The slices were mounted on glass slides and sealed with 50% glycerine in PBS. Images were acquired by laser scanning confocal microscopy.

Western blot analysis

The mice were deeply anaesthetized and intracardially perfused with saline. The brains were harvested and homogenized in RIPA lysis buffer containing proteinase inhibitor cocktail and phenylmethanesulfonyl fluoride (PMSF) in a glass-Teflon homogenizer. Then, they were ultrasonicated to completely lyse the tissues. After centrifugation (12,000 rpm, 15 min, 4 °C), the supernatants were collected, and the protein concentration was measured (BCA kit, Beyotime Biotechnology, Shanghai, China). Aliquots of the protein samples were mixed with 5× loading buffer containing bromophenol blue at a v/v ratio of 4:1. The samples were then boiled in a water bath for ten min before loading. After electrophoresis on an SDS-PAGE gel, the proteins were transferred for 70 min at 100 V to a nitrocellulose (NC) membrane with a pore size of 0.45 μm in transfer buffer with 20% methanol (Sigma, Massachusetts, USA; 322415). NC membranes were blocked for 45 min with 5% skim milk in Tris-buffered saline (TBS; Thermo Fisher, USA; BP24711) and 0.1% Tween-20 (Sigma, Massachusetts, USA; P2287). Primary antibodies were added at the proper dilution to the blocking buffer, and membranes were left overnight in primary antibodies and blocking buffer at 4 °C. Membranes were washed three times in TBS with 0.1% Tween-20 for 10 min each wash, and near-infrared species-appropriate secondary antibodies were added. Membranes were stained for 1 hour at room temperature, washed twice in TBS with 0.1% Tween-20, and the blots were visualized with the Licor Odyssey Fc. We used Fiji software (NIH) to quantify the density of the bands. All the full length uncropped original western blots are provided in the Supplemental Material.

The information of the primary antibodies used here are as follow: rabbit anti-ADAM10 (1:1000; Proteintech, Hubei, China), rabbit anti-BACE1 (1:1000; Cell Signaling Technology, USA), rabbit anti-PS1 (1:1000; Cell Signaling Technology, USA), rabbit anti-APP (1:1000; Cell Signaling Technology, USA), rabbit anti-NMDAR1 (1:1000; Millipore, USA), rabbit anti-NMDAR2B (1:1000; Abcam, UK), rabbit anti-Synaptophysin (1:1000; Abcam, UK), rabbit anti-Synapsin I (1:1000; Millipore, USA), rabbit anti-PSD95 (1:1000; Millipore, USA), rabbit anti-DM1A (1:1000; Sigma-Aldrich, Massachusetts, USA) and rabbit anti-β actin (1:1000; Abclonal, Hubei, China). See the key resources table for details (Supplementary table).

RT-qPCR analysis of BACE1 and PSEN1

Total RNA was extracted from the cortex, hippocampus, and amygdala using TRIzol reagent (Life Technologies, NY, USA). Complementary DNA was generated from the RNA according to the Prime-Script RT Reagent kit’s instructions (Takara Bio, Dalian, China). cDNA, primers, and the SYBR Premix Ex Taq (Takara Bio, Dalian, China) were combined according to the kit’s instructions. RT-qPCR and melting-curve analysis were performed on a StepOnePlus Real-Time PCR Detection System (Life Technologies, NY, USA). The expressions of all target messenger RNA levels were determined using the 2–ΔΔCT cycle threshold method normalized to Actb mRNA.

The primers used here are as follow:

Actb Forward—5’-GAGACCTTCAACACCCCAGC-3’,

Actb Reverse—5’-GGAGAGCATAGCCCTCGTAGAT-3’;

BACE1 Forward—5’-CCTTTGGTCACATGAGTTGG-3’,

BACE1 Reverse—5’-AAGGATATTCCTGCCACCAG-3’;

PSEN1 forward—5’-GCTGCTCCAATGACAGAGAT-3’,

PSEN1 Reverse—5’-ATATTGGCTCAGGGTTGTCA-3’.

ELISA

The mouse brain was isolated and homogenized in buffer (2% SDS in H2O containing protease inhibitor and phosphatase inhibitors 1:100). After centrifugation (12 000 rpm, 15 min, 4 °C), the supernatants were collected for analysis of soluble Aβ40 and Aβ42 levels, and the pellet was re-homogenized in 70% formic acid (FA) and centrifuged as above. The supernatants were stored as the insoluble fraction. Aβ levels were quantified using the mouse Amyloid β High Specific Assay Kits (27720 and 27721, IBL, Japan) and the human Aβ ELISA kits (E-EL-H0542, E-EL-H0543c, Elabscience, Hubei, China) in accordance with the manufacturer’s instructions.

Golgi staining

The mice were deeply anaesthetized. Their brains were collected and placed directly in Golgi solution (1 g potassium bichromate, 1 g mercuric chloride, 0.8 g potassium chromate, and 100 ml double-distilled water), where they remained in the dark for 2 weeks, and changed the solution every 2 days. Thereafter, the tissues were sequentially incubated in 10%, 20%, and 30% sucrose in light-protected jars to aid in maintaining histological structure. The brains were sectioned at 100 μm thickness with a vibratome and placed on gelatine-coated glass slides. After rinsing with double-distilled water, the slides were incubated in ammonium hydroxide for 30 min. After being washed with water, the slides were incubated for 30 min in black and white film developer diluted 1:9 with water and then rinsed with double-distilled water. The slides were mounted with resin and coverslipped. Images were visualized under the microscope (Nikon, Tokyo, Japan). All subsequent quantitative analyses were performed using ImageJ software and conducted by researchers blinded to the groups.

Statistical analysis

All data are presented as the mean ± SD and were analysed using GraphPad Prism (GraphPad Software Inc., San Diego, CA, USA). The sample size of all the experiment were chosen based on experience or calculate using statistical formulas. The difference between the two groups was assessed using an unpaired Student’s t-test or Mann-Whitney test. The difference among multiple groups was assessed by one- or two-way analysis of variance or repeated measured analysis of variance followed by a post hoc test. Two-way ANOVA followed by Tukey’s multiple comparisons test was used to analyse the data from the MWM acquisition phase. Statistical significance was set at p ≤ 0.05.

Results

SI induces cognitive deficits in C57BL/6 J mice

To determine the effects of SI on cognitive function in WT mice, 4-week-old C57BL/6 J mice in the SI group were caged individually for 6 weeks, and C57BL/6 J mice in the HC group were housed 34 per cage for 6 weeks (Fig. 1A). We performed the MWM test to assess the effects of SI on hippocampus-dependent spatial learning and memory. The latency to find the hidden platform on the last two days of the 4-days learning training period was significantly increased in the SI group compared to the HC group (Fig. 1B). Moreover, in the probe test, the latency to find the platform location is longer in the SI mice when compared with HC mice (Fig. 1C). The number of mean platform crossings reduced but no significant difference, and the percentage of time spent in the target quadrant was markedly reduced in the SI group compared to the HC group (Fig. 1D, E). The total swimming distance didn’t change in the SI group compared to the HC group (Supplemental Fig. 1A). Thus, our data suggest that SI induces cognitive deficits in wild-type mice without effecting motor function. To further evaluate cognitive deficits in the mice, we employed fear conditioning test and found that the percentage of freezing in the SI group was less than that in the HC group in the cue-dependent fear memory test but not different from that in the HC group in the context-dependent fear memory test (Fig. 1F, G), strongly suggesting that the mice in the SI group exhibited impairments of amygdala-dependent cognition.Fig. 1 SI induces behavioural deficits in WT mice.

A Experimental behavioural paradigm for WT mice. OFT Open field test, SPT Sucrose preference test, TST: Tail suspension test, MWM: Morris water maze, FC: Fear conditioning. B–E Performance of WT mice in the MWM test. B The mean latency to find the hidden platform in the 4-days acquisition phase (Two-way ANOVA followed by Tukey’s multiple comparisons test, p = 0.0404 for day3, p = 0.0075 for day4). C The latency to first reach the previous platform location on the 72 h after the acquisition task (Mann-Whitney test, p = 0.0099). D The number of platform location crossings (Mann-Whitney test, p = 0.0787). E The percentage time in the target quadrant during the probe test (unpaired Student’s t-test, p = 0.0012). F, G Performance of WT mice in the fear conditioning test. The freezing duration in the cue-dependent (unpaired Student’s t-test, p = 0.0109) and context-dependent (unpaired Student’s t-test, p = 0.1244) fear conditioning tests. H, I The immobility time (Mann-Whitney test, p = 0.0012) and latency to immobility (Mann-Whitney test, p = 0.0017) in the TST. J In the SPT, the sucrose consumption percentage was calculated for the WT-HC and WT-SI groups (unpaired Student’s t-test, p = 0.0003). K, L Performance of WT mice in the OFT. The distance travelled (unpaired Student’s t-test, p = 0.2187) and the number of zone crossings (unpaired Student’s t-test, p = 0.0095) were analysed. For the MWM test, TST, SPT, and OFT, n = 6 in the WT-HC group and n = 7 in the WT-SI group. For the fear conditioning test, n = 6 in each group. The data are presented as the mean ± SD. *p < 0.05, **p < 0.01 and ***p < 0.001, the WT-HC group vs. the WT-SI group.

Since SI is associated with mental disorders [15], we next analysed anxiety and depression in the mice using the TST, SPT, and OFT. In the TST, the immobility time was longer and the latency to immobility was shorter in the SI group than in the HC group (Fig. 1H, I). The mice in the SI group also exhibited anhedonia in the SPT (Fig. 1J). In the OFT, the number of zone crossings was increased but there was no difference in the distance travelled in the SI group compared to the HC group (Fig. 1K, L). These findings suggest that SI induces anxiety and depression but no motor dysfunction.

SI induces Aβ toxicity and leads to loss of dendritic synaptic plasticity

For the reason that AD is associated with SI [16], we evaluated Aβ toxicity in the SI and HC groups. The levels of α-, β- and γ-secretases (ADAM10, BACE1, and PSEN1, respectively), which are proteolytic enzymes that participate in APP cleavage and determine Aβ production, were measured. Compared to that in the WT-HC group, the hippocampal BACE1 mRNA level in the SI group was increased significantly, while there was no significant change in BACE1 mRNA expression in the cortex or amygdala (Fig. 2A). We also observed an increase in PSEN1 mRNA levels in the hippocampus and cortex in the WT-SI group compared to the WT-HC group (Fig. 2B). The western blot results demonstrated that the expression of APP, BACE1, and PSEN1 was upregulated in the cortex, hippocampus and amygdala in the WT-SI group compared with the WT-HC group, whereas the levels of the anti-amyloidogenic α-secretase in the cerebrum were lower in the WT-SI group than in the WT-HC group (Fig. 2C, D). Furthermore, compared to cerebral homogenates from mice in the WT-HC group, cerebral homogenates from mice in the WT-SI group showed a higher level of Aβ40 but not Aβ42 (Fig. 2E). Notably, the level of APP-C99 in the WT-SI group was lower than in the WT-HC group, suggesting more APP-C99 was digested to Aβ by the elevated γ-secretase in the SI condition (Supplemental Fig. 1B, C). These results indicate that SI activates the amyloidogenic APP cleavage pathway and promotes Aβ production.Fig. 2 SI induces Aβ toxicity and leads to dendritic synaptic dysfunction.

A, B mRNA levels of BACE1 and PSEN1 in the cortex, hippocampus, and amygdala in the WT-HC group and WT-SI group were measured (unpaired Student’s t-test). Hippo, hippocampus; Amy, amygdala. n = 6 in each group. C The expression of BACE1, PS1, ADAM10, APP, Synapsin I, and NMDAR1 in the cortex, hippocampus, and amygdala in the WT-HC group and WT-SI group. D Statistical analysis of the western blot data (unpaired Student’s t-test). n = 3 per group. E Cortical Aβ40 and Aβ42 levels in the WT-HC group and WT-SI group were measured by ELISA (unpaired Student’s t-test). n = 3 per group. F, G Representative images of Golgi staining and analysis (unpaired Student’s t-test) of dendritic spine density in the WT-HC group and WT-SI group. Scale bar = 5 μm. n = 6 in the WT-HC group and n = 5 in the WT-SI group, 6 sections per mouse. H LTP at DG-CA3 synapses was measured in the WT-HC group and WT-SI group (Two-way ANOVA followed by Tukey’s multiple comparisons test). n = 3 per group, 4 brain slices per mouse. I LTP at DG-CA3 synapses was completely suppressed in brain slices from mice in the WT-HC group when treated with 5 μM mouse oligomeric Aβ40 (Two-way ANOVA followed by Tukey’s multiple comparisons test). n = 3 per group, 4 brain slices per mouse. J Mouse oligomeric Aβ40 were identified by Coomassie Brilliant Blue staining. K–L The expression of Synaptophysin, Synapsin I, NMDAR1, and PSD95 in cultured primary neurons was analysed by western blot after 5 μM mouse oligomeric Aβ40 treatment (One-way analysis of variance followed by a post hoc test). n = 4 wells. Data are presented as the mean ± SD. *p < 0.05 and **p < 0.01, the WT-HC group vs. the WT-SI group.

Loss of dendritic synaptic plasticity [17] occurs in the brains of AD patients, and it constitutes a key neurobiological basis of dementia [18]. Therefore, we investigated whether SI impairs synaptic function. The levels of some synaptic proteins in the cortex, hippocampus, and amygdala were measured by western blotting (Fig. 2C). We found that the level of the presynaptic protein Synapsin I was significantly decreased in the hippocampus in the WT-SI group compared to the WT-HC group; the expression of the postsynaptic protein NMDAR1 was markedly downregulated in all three brain regions after SI (Fig. 2D), indicating that SI leads to synaptic dysfunction. We also employed Golgi staining to analyse dendritic synaptic morphology in the cortex and found that the spine density was significantly reduced in the WT-SI group compared to the WT-HC group (Fig. 2F, G). Next, electrophysiological analysis of hippocampal slices showed that LTP at DG-CA3 synapses was significantly suppressed in the WT-SI group compared with the WT-HC group (Fig. 2H), strongly suggesting that SI impairs synaptic plasticity.

Previous studies have shown that Aβ toxicity induces synaptic dysfunction [19]. To further determine whether the effect of Aβ on synaptic function in the WT-HC group was similar to that in the WT-SI group, we incubated brain slices of WT-HC group with mouse oligomeric Aβ40 or human dimeric Aβ40. Electrophysiological analysis showed that LTP at DG-CA3 synapses was completely suppressed in the WT-HC group after the mouse or human Aβ40 treatment, similar to that of SI (Fig. 2I and Supplemental Fig. 2A). In primary cultured neurons, mouse Aβ40 treatment reduced the cell viability and inhibited the expression of Synapsin I and NMDAR1 (Fig. 2K, L, Supplemental Fig. 2B–D). Human Aβ40 treatment inhibited the expression of synapse-associated proteins, including Synaptophysin, Synapsin I, NMDAR1, NMDAR2B, and PSD95 (Supplemental Fig. 2E, F), similar to the effect of SI (Fig. 2C). These results suggest that Aβ might be a key factor in the synaptic damages in the WT-SI group.

The above data led us to speculate that SI impairs cognition via Aβ-mediated synaptic dysfunction.

SI exacerbates behavioural deficits in APP/PS1 mice

Since SI triggers the amyloidogenic APP cleavage pathway and Aβ is a key factor in synaptic damage, we wondered whether SI accelerates and is responsible for behavioural deficits in APP/PS1 mice. APP/PS1 mice start to exhibit cognitive dysfunction at the age of 12–14 weeks and show amyloid plaques at the age of 6 months [20–22]. We exposed 4-week-old APP/PS1 mice to SI for 6 weeks and housed age-matched mice in the APP/PS1-HC group 3–4 per cage for 6 weeks. Behavioural tests were performed on APP/PS1 mice at the age of 2.5 months (Fig. 3A). In the MWM, slight impairment of memory acquisition but no memory retrieval deficits were observed in the APP/PS1-SI group compared with the APP/PS1-HC group in the first 9 days (Supplemental Fig. 3A–C). We then performed memory acquisition training for 4 more days (Fig. 3B). The mice in the APP/PS1-SI group showed a delayed learning ability and poor performance in the probe test, as the APP/PS1-SI group exhibited a longer latency to find the location of the hidden platform and fewer platform location crossings than the APP/PS1-HC group (Fig. 3C, D). The total swimming distance didn’t change in the APP/PS1-SI group compared to the APP/PS1-HC group (Supplemental Fig. 3D). Compared to the home cage procedure, SI impaired cue-dependent and context-dependent fear conditioning in APP/PS1 mice (Fig. 3E, F). The MWM test and fear conditioning test revealed that SI accelerated cognitive deficits in APP/PS1 mice. In the TST, the immobility time was longer and the latency to immobility was shorter in the APP/PS1-SI group compared to the APP/PS1-HC group, suggesting that SI exacerbated depressive-like behaviour in APP/PS1 mice (Fig. 3G, H). Compared to mice in the APP/PS1-HC group, mice in the APP/PS1-SI group consumed less sucrose in the SPT, suggesting that SI exacerbated anhedonia in APP/PS1 mice (Fig. 3I). The OFT results showed that relative to mice in the APP/PS1-HC group, mice in the APP/PS1-SI group exhibited more zone crossings but no difference in distance travelled (Fig. 3J, K), indicating that SI induced anxiety in APP/PS1 mice. Altogether, these findings strongly demonstrate that SI accelerates behavioural deficits in APP/PS1 mice.Fig. 3 SI exacerbates behavioural deficits in APP/PS1 mice.

A Experimental behavioural paradigm for the APP/PS1 mice. B–D The results of the MWM test. B Due to poor performance after the 5-day acquisition phase (Supplemental Fig. 3), the mice were trained to find the hidden platform for 4 more days (Two-way ANOVA followed by Tukey’s multiple comparisons test). C, D Mice in the APP/PS1-SI group took longer to find the platform location and made fewer platform location crossings than mice in the APP/PS1-HC group (unpaired Student’s t-test). E, F The freezing duration of the APP/PS1-HC group and APP/PS1-SI group in the cue-dependent fear conditioning test and context-dependent fear conditioning test (unpaired Student’s t-test). G, H The latency to immobility and immobility time of the APP/PS1-HC group and APP/PS1-SI group in the TST. I The sucrose consumption percentages of the APP/PS1-HC group and APP/PS1-SI group in the SPT were calculated (unpaired Student’s t-test). J, K The distance travelled and number of zone crossings by the APP/PS1-HC group and APP/PS1-SI group in the OFT (unpaired Student’s t-test). For the MWM test, SPT and OFT, n = 15 in the APP/PS1-HC group and n = 12 in the APP/PS1-SI group. For the fear conditioning test, n = 13 in the APP/PS1-HC group and n = 12 in the APP/PS1-SI group. For the TST, n = 13 in the APP/PS-HC group and n = 11 in the APP/PS1-SI group. The data are presented as the mean ± SD. *p < 0.05 and **p < 0.01, the APP/PS1-HC group vs. the APP/PS1-SI group.

SI exacerbates Aβ toxicity and synaptic dysfunction in APP/PS1 mice

To evaluate the effects of SI on the amyloidogenic APP cleavage pathway in APP/PS1 mice, we further analysed β-secretase generation and Aβ production at the age of 2.5 months. The BACE1 mRNA level in the brain was higher in the APP/PS1-SI group than in the APP/PS1-HC group but was not significantly different between the APP/PS1-HC group and the WT-HC group, suggesting that SI triggered early BACE1 translation (Fig. 4A left panel). This result further demonstrates that BACE1, the rate-limiting enzyme to produce Aβ peptides, also plays a key role in the SI-induced acceleration of Aβ toxicity. Increases in PSEN1 mRNA levels were observed in the brains of both the WT-SI group and APP/PS1-SI group compared with the WT-HC group and APP/PS1-HC group, respectively (Fig. 4A right panel). The western blot results revealed that BACE1 levels increased markedly in the cortex, hippocampus, and amygdala in the APP/PS1-SI group compared to APP/PS1-HC group (Fig. 4B, C). For mouse Aβ, SI increased the levels of insoluble Aβ42, insoluble Aβ40, and soluble Aβ40 in WT mice and APP/PS1 mice but did not change the level of soluble Aβ42 in WT mice (Fig. 4D). Notably, more toxic soluble Aβ42 was produced in the APP/PS1-SI group than in the WT-SI group, suggesting that SI and Aβ toxicity form a vicious cycle in mice, leading to synaptic damage and behavioural deficits. For human Aβ in the APP/PS mice, SI accelerated the process of all kinds of human Aβ, including soluble and insoluble (Supplemental Fig. 4). In addition, amyloid deposition was markedly increased in mice exposed to SI, especially mice in the APP/PS1-SI group, as indicated by stronger Amylo-Glo staining (Fig. 4E; Supplemental Fig. 5A).Fig. 4 SI exacerbates Aβ toxicity and synaptic dysfunction in APP/PS1 mice.

A mRNA levels of BACE1 and PSEN1 in the brain of the WT-HC group, WT-SI group, APP/PS1-HC group, and APP/PS1-SI group were measured (One-way analysis of variance followed by a post hoc test). n = 8 per group. B The expression of BACE1, NMDAR1, PS1, NMDAR2B, Synaptophysin, Synapsin I, and PSD95 in the cortex, hippocampus, and amygdala of the APP/PS1-HC group and APP/PS1-SI group. n = 4 per group. C Western blot analysis of the proteins in panel B (Unpaired Student’s t-test). D Soluble and insoluble mouse Aβ (40 and 42) levels in the brain of the WT-HC group, WT-SI group, APP/PS1-HC group, and APP/PS1-SI group were measured by ELISA (One-way analysis of variance followed by a post hoc test). n = 4 per group. E Amyloid plaques in the hippocampus of the WT-HC group, WT-SI group, APP/PS1-HC group, and APP/PS1-SI group were stained with Amylo-Glo. The plaque load was analysed by measuring the density of the fluorescent and normalizing it to the WT-HC group (One-way analysis of variance followed by a post hoc test). Scale bar=200 μm. F Representative images of Golgi staining in the APP/PS1-HC group and APP/PS1-SI group. Scale bar = 5 μm. G The dendritic spine density in the cortex was analysed by Golgi staining (Unpaired Student’s t-test). n = 6 per group, 6 sections per mouse. H LTP at DG-CA3 synapses was measured in the APP/PS1-HC group and APP/PS1-SI group (Two-way ANOVA followed by Tukey’s multiple comparisons test). n = 4 per group, 5 brain slices per mouse. The data are presented as the mean ± SD. **p < 0.01 vs. the WT-HC group. ##p < 0.01, the APP/PS1-HC group vs. the APP/PS1-SI group. && p < 0.01, the APP/PS1-SI group vs. the WT-SI group.

We further evaluated synaptic function in APP/PS1 mice. Western blot analysis showed that the expressions of the synapse-associated proteins NMDAR1, NMDAR2B, Synaptophysin, Synapsin I, and PSD95 were significantly decreased in the cortex, hippocampus, and amygdala in mice in the APP/PS1-SI group compared to those in the APP/PS1-HC group (Fig. 4B, C). The results of Golgi staining showed that the density of dendritic spines in the cortex was lower in the APP/PS1-SI group than in the APP/PS1-HC group (Fig. 4F, G). Electrophysiological analysis of in vitro brain slices also indicated that SI evidently reduced synaptic plasticity in APP/PS1 mice (Fig. 4H). These data indicate that SI impairs synaptic function in APP/PS1 mice.

Knockdown of BACE1 ameliorates Aβ toxicity in WT mice exposed to SI

To verify whether BACE1/Aβ toxicity is indeed responsible for SI-induced cognitive deficits and synaptic dysfunction, we injected AAV9-CAG-EGFP-siCtrl or AAV9-CAG-EGFP-siBACE1 virus into the lateral ventricles of 4-week-old C57Bl/6 J mice and studied whether knockdown of BACE1 reverses the detrimental effects of SI. Immunofluorescence showed that after 6 weeks in an SI or HC environment (Fig. 5A), EGFP was expressed widely throughout the brain, especially in the hippocampus, and the BACE1 density was markedly decreased in shRNA-treated mice (Fig. 5B). Compared to those in the Ctrl-HC group, the mRNA levels of BACE1 and PSEN1 and the protein levels of BACE1 and Aβ (soluble Aβ40 and Aβ42 and insoluble Aβ40 and Aβ42) in the Ctrl-SI group were significantly increased (Fig. 5C–F, Supplemental Fig. 6). ICV injection of the BACE1 shRNA-expressing virus reduced BACE1 mRNA levels in the brain by 49% (siBACE1-HC vs. Ctrl-HC) and 70% (siBACE1-SI vs. Ctrl-SI) (Fig. 5C left panel). Western blot analysis showed that knockdown of BACE1 effectively blocked the SI-induced increase in BACE1 levels in the hippocampus (Fig. 5D, E), cortex, and amygdala (Supplemental Fig. 6A, B). In agreement with the western blot results, the ELISA results showed that the expression of soluble and insoluble Aβ40 and Aβ42 did not increase in the brains of mice in the siBACE1-SI group and were similar to the level in the Ctrl-HC group (Fig. 5F). We also measured amyloid deposition in the cortex, hippocampus, and amygdala and found that knockdown of BACE1 markedly prevented SI-induced Aβ accumulation (Fig. 5G; Supplemental Fig. 5B). These results imply that downregulation of BACE1 expression ameliorates Aβ toxicity in mice exposed to SI.Fig. 5 Knockdown of BACE1 ameliorates Aβ toxicity in WT mice subjected to SI.

A Experimental behavioural paradigm for the Ctrl-HC group, Ctrl-SI group, siBACE1-HC group, and siBACE1-SI group. B Representative images of the EGFP expression in different brain areas, 6 weeks after the injection of AAV9-CAG-EGFP-siBACE1 into 4-week-old WT mice. Scale bar = 400 μm for upper panel. Scale bar = 200 μm for lower panels. C mRNA levels of BACE1 and PSEN1 in the brain of the Ctrl-HC group, Ctrl-SI group, siBACE1-HC group, and siBACE1-SI group were analysed (One-way analysis of variance followed by a post hoc test). n = 8 per group. D The expression of BACE1, NMDAR1, NMDAR2B, Synaptophysin, Synapsin I, and PSD95 in the hippocampus of the Ctrl-HC group, Ctrl-SI group, siBACE1-HC group, and siBACE1-SI group. n = 6 per group. E Western blot analysis of the protein levels in panel D (One-way analysis of variance followed by a post hoc test). F Soluble and insoluble Aβ40 and Aβ42 levels in the brain of the Ctrl-HC group, Ctrl-SI group, siBACE1-HC group, and siBACE1-SI group were measured by ELISA (One-way analysis of variance followed by a post hoc test). n = 4 per group. G Amyloid plaques in the hippocampus of the Ctrl-HC group, Ctrl-SI group, siBACE1-HC group, and siBACE1-SI group were analysed by Amylo-Glo staining. The plaque load was analysing by measuring the density of the fluorescent and normalizing it to the Ctrl-HC group (One-way analysis of variance followed by a post hoc test). n = 4 per group. Scale bar=200 μm. The data are presented as the mean ± SD. **p < 0.01, the Ctrl-HC group vs. the Ctrl-SI group. ##p < 0.01, the Ctrl-SI group vs. the siBACE1-SI group.

Knockdown of BACE1 protects WT mice from SI-induced behavioural deficits and synaptic impairments

Given that knockdown of BACE1 profoundly ameliorates SI-induced Aβ toxicity and that Aβ is a key driver of cognitive impairments, it may be possible to alleviate the behavioural deficits caused by SI. Thus, we carried out a series of behavioural tests on C57Bl/6 J mice after 6-week exposure to SI or the HC procedure with or without siBACE1. In the MWM test, mice in the siBACE1-SI group exhibited a learning curve similar to that of mice in the siBACE1-HC group and better than that of mice in the Ctrl-SI group in the acquisition trials (Fig. 6A). In addition, knockdown of BACE1 showed protective effects on spatial memory retrieval without effecting motor function in mice subjected to SI: the latency to reach the platform location, number of platform location crossings and total swimming distance were not significantly different between mice in the siBACE1-HC group and those in the siBACE1-SI group (Fig. 6B, C, Supplemental Fig. 6C). In the context-dependent and cue-dependent fear conditioning tests, the freezing percentage was comparable between the siBACE1-HC group and siBACE1-SI group (Fig. 6D, E). These data suggest that reducing BACE1 levels improved cognitive function in mice exposed to SI. In the TST, the siBACE1-SI group and siBACE1-HC group showed comparable immobility times and latencies to immobility, suggesting that reducing BACE1 levels ameliorated SI-induced depressive-like behaviour in C57BL/6 J mice (Fig. 6F, G). The siBACE1-SI group consumed a comparable amount of sucrose as the siBACE1-HC group in the SPT, suggesting that knockdown of BACE1 reduced anhedonia in mice exposed to SI (Fig. 6H). The OFT results showed that the number of zone crossings was similar between the siBACE1-SI group and the siBACE1-HC group, indicating that BACE1 knockdown protected mice from SI-induced anxiety (Fig. 6J). In the SPT, the preference index of siBACE1-SI showed a statistically significant improvement when compared with Ctrl-SI (Fig. 6H). In the OFT, the number of zone crossings in siBACE1-SI mice was lower than that in Ctrl-SI (Fig. 6J). These data strongly suggest that downregulation of BACE1 expression protects wild-type mice from SI-induced behavioural deficits.Fig. 6 Knockdown of BACE1 protects WT mice from SI-induced behavioural deficits and synaptic impairments.

A–C Performance in the MWM test. A The latency of the Ctrl-HC group, Ctrl-SI group, siBACE1-HC group, and siBACE1-SI group to find the hidden platform was analysed in the acquisition trials (Two-way ANOVA followed by Tukey’s multiple comparisons test). B-C. Twenty-four hours or 72 hours after the acquisition task, the latency to first reach the previous platform location and the number of platform location crossings were analysed (One-way analysis of variance followed by a post hoc test). D, E The freezing duration in the cue-dependent fear conditioning test and context-dependent fear conditioning test (One-way analysis of variance followed by a post hoc test). F, G The latency to immobility and immobility time in the TST (One-way analysis of variance followed by a post hoc test). H The sucrose consumption percentage in the SPT was calculated (One-way analysis of variance followed by a post hoc test). I, J The distance travelled and number of zone crossings in the OFT were measured (One-way analysis of variance followed by a post hoc test). For the behavioural tests, n = 8, 8, 11, 13, in the Ctrl-HC group, Ctrl-SI group, siBACE1-HC group, and siBACE1-SI group, respectively. K Representative images of Golgi staining in the Ctrl-HC group, Ctrl-SI group, siBACE1-HC group, and siBACE1-SI group. L Dendritic spine density in the Golgi staining image was analysed using ImageJ (One-way analysis of variance followed by a post hoc test). n = 6 mice in each group. Six sections per mouse. Scale bar=5 μm. M LTP at DG-CA3 synapses was measured in the siBACE1-HC and siBACE1-SI groups (Two-way ANOVA followed by Tukey’s multiple comparisons test). n = 4 per group, 4 brain slices per mouse. The data are presented as the mean ± SD. *p < 0.05 and **p < 0.01, the Ctrl-HC group vs. the Ctrl-SI group. #p < 0.05 and ##p < 0.01, the Ctrl-SI group vs. the siBACE1-SI group.

To further verify that SI-induced cognitive impairments are caused by Aβ-mediated synaptic damage, we assessed the effects of BACE1 knockdown on synaptic function by analysing the levels of synapse-associated proteins and synaptic plasticity. NMDAR1, NMDAR2B, Synaptophysin, Synapsin I and PSD95 levels in the hippocampus (Fig. 5D, E), cortex, and amygdala (supplemental Fig. 6A, B) were not significantly different between the siBACE1-HC group and siBACE1-SI group. The Golgi staining results showed that the density of dendritic spines in the cortex was similar between the siBACE1-HC and siBACE1-SI groups (Fig. 6K, L). Further, the spine density of siBACE1-SI was higher when compared to Ctrl-SI (Fig. 6K, L). Moreover, no difference was found in the excitatory postsynaptic potential (EPSP) slope between the siBACE1-HC group and siBACE1-SI group, indicating that SI-induced impairment of LTP at DG-CA3 synapses in C57BL/6 J mice was ameliorated following BACE1 knockdown (Fig. 6M). These data provide further evidence that BACE1-induced Aβ toxicity triggers synaptic dysfunction and consequently leads to cognitive impairments in mice exposed to SI.

Discussion

The COVID-19 pandemic has posed major public health problems, particularly those related to SI. Accumulating data have shown that SI is an important risk factor for AD, and greater social activity prevents cognitive decline and delays the onset of AD [23–25]. However, the exact mechanism by which SI induces cognitive impairments is not well understood [26]. In the current study, we provide extensive evidence that SI after weaning leads to cognitive dysfunction and mental disorders, as well as the promotion of the amyloidogenic APP cleavage pathway (especially upregulation of BACE1 expression) and synaptic impairment. SI accelerates amyloidogenic pathological changes, synaptic dysfunction, and behavioural deficits in APP/PS1 mice, suggesting that SI-induced cognitive deficits are related to Aβ toxicity and synaptic damage. Moreover, we provide additional evidence that knockdown of BACE1, the rate-limiting enzyme for Aβ production, markedly protects synaptic function and attenuates SI-induced cognitive impairments in C57BL/6 J mice. Together, our data strongly indicate that SI impairs cognition via BACE1/Aβ toxicity-mediated synaptic dysfunction.

In daily life, the more social activities a person engages in, the better their cognitive function is [25]. However, the mechanisms underlying the correlation between social activity and cognition are largely unknown. There are still conflicting reports on whether SI-induced cognitive impairments are associated with AD-like pathological changes. For instance, Wilson RS et al unexpectedly found that loneliness score is not correlated with Aβ plaque burden, arguing against a direct contribution of SI to the risk of AD [27]. In contrast, Donovan NJ and colleagues reported a correlation between loneliness and cortical Aβ burden in preclinical AD cases [28]. Consistent with this result, our findings indicate that SI-induced cognitive deficits are related to Aβ toxicity, an early pathological alteration in AD.

Three types of APP cleavage enzymes determine the species and amount of Aβ that is produced. Toxic Aβ40 and Aβ42 are derived from cleavage of APP by the β-secretase (BACE1) and followed by the γ-secretase (PSEN1). Under physiological conditions, α-secretase has an advantage over BACE1 in cleaving APP [29]. Here, we showed that SI induces an increase in the mRNA and protein levels of both BACE1 and PSEN1 and a decrease in the level of α-secretase protein in the C57Bl/6 J mouse brain. Consequently, the level of Aβ in brain homogenates was shown to be markedly higher in the mice subjected to SI than in the mice subjected to the HC procedure, suggesting that SI causes dysfunction of the APP cleavage pathway and promotes the production of Aβ, subsequently leading to synaptic damage. Similar findings were observed in APP/PS1 mice from age 4 weeks to 10 weeks, as 6-week exposure to SI was found to exacerbate Aβ toxicity and synaptic damage, accelerating cognitive impairments. In a study using 5×FAD+ mice, isolation stress significantly increased the number of plaques and the expression of BACE1 in the hippocampus [30]. Some studies reveal that other mechanisms participate in the isolation stress associated with Aβ plaque formation and cognitive dysfunctions. Isolation stress increases corticosterone levels and glucocorticoid receptors and corticotropin-releasing factor receptor-1 expressions in the APP/PS1 [31]. Furthermore, in an APP/PS1 mouse social isolation model, treatment of N-acetylcysteine decreases γ-secretase activity, Aβ production, calpain activity and restores GluR1 and GluR2 surface expression [32]. Notably, in our experiments, the plaque formation and cognitive dysfunctions are not only seen in the transgenic mice, but also, and more importantly, in SI wild-type mice. Our study simulates a lifestyle that could be a risk factor in developing sporadic AD, which constitutes more than 90% of AD patients and is free from the mutation and does not necessarily have an overproduction of APP.

The previous study has shown that the increase in Aβ and amyloid plaque is seen from 4 to 6 months of age in the APP/PS1 mice [33]. Our study for the APP/PS1 mice, in which Aβ measurements and the behavioral tests were carried out at around 2.5 months of age, shows that SI accelerates the APP amyloidogenic cleavage.

Consistent with previous studies [34, 35], our study revealed that SI induces spatial cognitive impairments and loss of conditional fear memory. More importantly, SI also induces anxiety, depression, and anhedonia. This suggests that SI-induced behavioural deficits are related to not only cognition-associated brain regions but also emotion-associated areas, such as the amygdala. Indeed, aberrant expression of synapse-associated proteins and decreased spine density in the amygdala are undoubtedly responsible for SI-induced emotional disorders, of which the exact mechanism should be further explored in the future.

BACE1 inhibitors have been shown to be promising candidates for preventing or attenuating AD in clinical trials [9]. In the current study, we found that, the level of APP is upregulated in the WT-SI mice while the expression of APP-C99 is lower than in the WT-HC mice, suggesting APP-C99 is digested to Aβ by the elevated γ-secretase. As the rate-limiting enzyme to produce Aβ peptides, downregulation of BACE1 prevents SI-induced Aβ toxicity, and synaptic impairments, strongly supporting the important role of BACE1 in the SI-induced neurological injuries. More importantly, early intervention with BACE1 shRNA in SI mice delays cognitive dysfunction and prevents emotional disorders, suggesting that the BACE1/Aβ toxicity is crucial for the early-stage SI-associated behavioural dysfunction. The elevated expression of APP is seen in familial AD [7]. Interestingly, social isolation induces an increase in the level of APP in wild-type mice accompanied by synaptic and cognitive impairments, which could be blocked by BACE1 inhibition, suggesting that lowering BACE1 level might attenuate neurological alterations due to either the elevated APP or Aβ deposit.

In conclusion, we demonstrated that SI activates the amyloidogenic APP cleavage pathway and impairs synaptic function in mice, leading to cognitive dysfunction and emotional disorders, further verifying the involvement of BACE1 in SI-induced behavioural deficits. Therefore, in addition to increasing social activity, the administration of drugs that inhibit BACE1 is promising for preventing dementia in socially isolated individuals.

Supplementary information

Supplemental Figure

Supplementary table

Supplementary information

The online version contains supplementary material available at 10.1038/s41398-024-03078-5.

Acknowledgements

All the authors wish to express their gratitude and appreciation to Mr. Dan Ke and Ms. Qun Wang for their expertise and technical assistance. Thanks to all the members of our research team for the constructive discussion and suggestions that shaped this work. This work was supported by grants from National Natural Science Foundation of China (82330041, 32000688 and 82360263), grant from Postdoctoral Science Foundation of China (No. 2020M672362), grant from Postdoctoral innovative research post in Hubei Province (No. 2019235346), grant from the Science and Technology Innovation Team project to Xiaochuan Wang from Department of Science and Technology of Hubei Province (2022-72-18) and grant from the Central Government Guides Local Science and Technology Development Special Projects of Hubei Province (No. 2022BGE243).

Author contributions

XCW designed all experiments and organized all results, including the writing of the manuscript. FH and XL planned and performed all experiments and participated in the writing of the manuscript. QG and Mahaman YAR performed in vitro cell culture and biochemical analysis. BZ, JZW, and RL analysed and interpreted the data. All authors read and approved the final manuscript.

Data availability

All the data during the current study have been shown in manuscript and supplemental materials, and unprocessed data are available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing interests.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Fang Huang, Xinghua Liu.
==== Refs
References

1. House JS Landis KR Umberson D Social relationships and health Science (N.Y, NY) 1988 241 540 5 10.1126/science.3399889
House JS, Landis KR, Umberson D. Social relationships and health. Science (N.Y, NY). 1988;241:540–5.
2. Alavi Naini SM Soussi-Yanicostas N Tau Hyperphosphorylation and Oxidative Stress, a Critical Vicious Circle in Neurodegenerative Tauopathies? Oxid Med Cell Longev 2015 2015 151979 10.1155/2015/151979 26576216
Alavi Naini SM, Soussi-Yanicostas N. Tau Hyperphosphorylation and Oxidative Stress, a Critical Vicious Circle in Neurodegenerative Tauopathies? Oxid Med Cell Longev. 2015;2015:151979.26576216
3. Holt-Lunstad J Why Social Relationships Are Important for Physical Health: A Systems Approach to Understanding and Modifying Risk and Protection Annu Rev Psychol 2018 69 437 58 10.1146/annurev-psych-122216-011902 29035688
Holt-Lunstad J. Why Social Relationships Are Important for Physical Health: A Systems Approach to Understanding and Modifying Risk and Protection. Annu Rev Psychol. 2018;69:437–58.29035688
4. Leser N Wagner S The effects of acute social isolation on long-term social recognition memory Neurobiol Learn Mem 2015 124 97 103 10.1016/j.nlm.2015.07.002 26169536
Leser N, Wagner S. The effects of acute social isolation on long-term social recognition memory. Neurobiol Learn Mem. 2015;124:97–103.26169536
5. Chiti F Dobson CM Protein Misfolding, Amyloid Formation, and Human Disease: A Summary of Progress Over the Last Decade Annu Rev Biochem 2017 86 27 68 10.1146/annurev-biochem-061516-045115 28498720
Chiti F, Dobson CM. Protein Misfolding, Amyloid Formation, and Human Disease: A Summary of Progress Over the Last Decade. Annu Rev Biochem. 2017;86:27–68.28498720
6. Salimi A Li H Lee JY Molecular insight into the early stage of amyloid-β(1-42) Homodimers aggregation influenced by histidine tautomerism Int J Biol Macromol 2021 184 887 97 10.1016/j.ijbiomac.2021.06.078 34153362
Salimi A, Li H, Lee JY. Molecular insight into the early stage of amyloid-β(1-42) Homodimers aggregation influenced by histidine tautomerism. Int J Biol Macromol. 2021;184:887–97.34153362
7. Rosenberg RN Lambracht-Washington D Yu G Xia W Genomics of Alzheimer Disease: A Review JAMA Neurol 2016 73 867 74 10.1001/jamaneurol.2016.0301 27135718
Rosenberg RN, Lambracht-Washington D, Yu G, Xia W. Genomics of Alzheimer Disease: A Review. JAMA Neurol. 2016;73:867–74.27135718
8. Fukumoto H Cheung BS Hyman BT Irizarry MC Beta-secretase protein and activity are increased in the neocortex in Alzheimer disease Arch Neurol 2002 59 1381 9 10.1001/archneur.59.9.1381 12223024
Fukumoto H, Cheung BS, Hyman BT, Irizarry MC. Beta-secretase protein and activity are increased in the neocortex in Alzheimer disease. Arch Neurol. 2002;59:1381–9.12223024
9. Hampel H Vassar R De Strooper B Hardy J Willem M Singh N The β-Secretase BACE1 in Alzheimer’s Disease Biol psychiatry 2021 89 745 56 10.1016/j.biopsych.2020.02.001 32223911
Hampel H, Vassar R, De Strooper B, Hardy J, Willem M, Singh N, et al. The β-Secretase BACE1 in Alzheimer’s Disease. Biol psychiatry. 2021;89:745–56.32223911
10. Ohno M Sametsky EA Younkin LH Oakley H Younkin SG Citron M BACE1 deficiency rescues memory deficits and cholinergic dysfunction in a mouse model of Alzheimer’s disease Neuron 2004 41 27 33 10.1016/S0896-6273(03)00810-9 14715132
Ohno M, Sametsky EA, Younkin LH, Oakley H, Younkin SG, Citron M, et al. BACE1 deficiency rescues memory deficits and cholinergic dysfunction in a mouse model of Alzheimer’s disease. Neuron. 2004;41:27–33.14715132
11. Bourne JN Harris KM Balancing structure and function at hippocampal dendritic spines Annu Rev Neurosci 2008 31 47 67 10.1146/annurev.neuro.31.060407.125646 18284372
Bourne JN, Harris KM. Balancing structure and function at hippocampal dendritic spines. Annu Rev Neurosci. 2008;31:47–67.18284372
12. Redondo RL Morris RG Making memories last: the synaptic tagging and capture hypothesis Nat Rev Neurosci 2011 12 17 30 10.1038/nrn2963 21170072
Redondo RL, Morris RG. Making memories last: the synaptic tagging and capture hypothesis. Nat Rev Neurosci. 2011;12:17–30.21170072
13. Klein WL Abeta toxicity in Alzheimer’s disease: globular oligomers (ADDLs) as new vaccine and drug targets Neurochem Int 2002 41 345 52 10.1016/S0197-0186(02)00050-5 12176077
Klein WL. Abeta toxicity in Alzheimer’s disease: globular oligomers (ADDLs) as new vaccine and drug targets. Neurochem Int. 2002;41:345–52.12176077
14. Schmued L Raymick J Tolleson W Sarkar S Zhang YH Bell-Cohn A Introducing Amylo-Glo, a novel fluorescent amyloid specific histochemical tracer especially suited for multiple labeling and large scale quantification studies J Neurosci methods 2012 209 120 6 10.1016/j.jneumeth.2012.05.019 22705750
Schmued L, Raymick J, Tolleson W, Sarkar S, Zhang YH, Bell-Cohn A. Introducing Amylo-Glo, a novel fluorescent amyloid specific histochemical tracer especially suited for multiple labeling and large scale quantification studies. J Neurosci methods. 2012;209:120–6.22705750
15. Arzate-Mejía RG Lottenbach Z Schindler V Jawaid A Mansuy IM Long-Term Impact of Social Isolation and Molecular Underpinnings Front Genet 2020 11 589621 10.3389/fgene.2020.589621 33193727
Arzate-Mejía RG, Lottenbach Z, Schindler V, Jawaid A, Mansuy IM. Long-Term Impact of Social Isolation and Molecular Underpinnings. Front Genet. 2020;11:589621.33193727
16. Panza F Solfrizzi V Logroscino G Age-related hearing impairment-a risk factor and frailty marker for dementia and AD Nat Rev Neurol 2015 11 166 75 10.1038/nrneurol.2015.12 25686757
Panza F, Solfrizzi V, Logroscino G. Age-related hearing impairment-a risk factor and frailty marker for dementia and AD. Nat Rev Neurol. 2015;11:166–75.25686757
17. Yu W Lu B Synapses and dendritic spines as pathogenic targets in Alzheimer’s disease Neural plasticity 2012 2012 247150 10.1155/2012/247150 22474602
Yu W, Lu B. Synapses and dendritic spines as pathogenic targets in Alzheimer’s disease. Neural plasticity. 2012;2012:247150.22474602
18. Skaper SD Facci L Zusso M Giusti P Synaptic Plasticity, Dementia and Alzheimer Disease CNS Neurol. Disord drug targets 2017 16 220 33 10.2174/1871527316666170113120853 28088900
Skaper SD, Facci L, Zusso M, Giusti P. Synaptic Plasticity, Dementia and Alzheimer Disease. CNS Neurol. Disord drug targets. 2017;16:220–33.28088900
19. Tu S Okamoto S Lipton SA Xu H Oligomeric Aβ-induced synaptic dysfunction in Alzheimer’s disease Mol Neurodegeneration 2014 9 48 10.1186/1750-1326-9-48
Tu S, Okamoto S, Lipton SA, Xu H. Oligomeric Aβ-induced synaptic dysfunction in Alzheimer’s disease. Mol Neurodegeneration. 2014;9:48.
20. Holcomb L Gordon MN McGowan E Yu X Benkovic S Jantzen P Accelerated Alzheimer-type phenotype in transgenic mice carrying both mutant amyloid precursor protein and presenilin 1 transgenes Nat Med 1998 4 97 100 10.1038/nm0198-097 9427614
Holcomb L, Gordon MN, McGowan E, Yu X, Benkovic S, Jantzen P, et al. Accelerated Alzheimer-type phenotype in transgenic mice carrying both mutant amyloid precursor protein and presenilin 1 transgenes. Nat Med. 1998;4:97–100.9427614
21. Manocha GD Floden AM Miller NM Smith AJ Nagamoto-Combs K Saito T Temporal progression of Alzheimer’s disease in brains and intestines of transgenic mice Neurobiol aging 2019 81 166 76 10.1016/j.neurobiolaging.2019.05.025 31284126
Manocha GD, Floden AM, Miller NM, Smith AJ, Nagamoto-Combs K, Saito T, et al. Temporal progression of Alzheimer’s disease in brains and intestines of transgenic mice. Neurobiol aging. 2019;81:166–76.31284126
22. Holcomb LA Gordon MN Jantzen P Hsiao K Duff K Morgan D Behavioral changes in transgenic mice expressing both amyloid precursor protein and presenilin-1 mutations: lack of association with amyloid deposits Behav Genet 1999 29 177 85 10.1023/A:1021691918517 10547924
Holcomb LA, Gordon MN, Jantzen P, Hsiao K, Duff K, Morgan D. Behavioral changes in transgenic mice expressing both amyloid precursor protein and presenilin-1 mutations: lack of association with amyloid deposits. Behav Genet. 1999;29:177–85.10547924
23. Fabrigoule C Letenneur L Dartigues JF Zarrouk M Commenges D Barberger-Gateau P Social and leisure activities and risk of dementia: a prospective longitudinal study J Am Geriatrics Soc 1995 43 485 90 10.1111/j.1532-5415.1995.tb06093.x
Fabrigoule C, Letenneur L, Dartigues JF, Zarrouk M, Commenges D, Barberger-Gateau P. Social and leisure activities and risk of dementia: a prospective longitudinal study. J Am Geriatrics Soc. 1995;43:485–90.
24. Helmer C Damon D Letenneur L Fabrigoule C Barberger-Gateau P Lafont S Marital status and risk of Alzheimer’s disease: a French population-based cohort study Neurology 1999 53 1953 8 10.1212/WNL.53.9.1953 10599764
Helmer C, Damon D, Letenneur L, Fabrigoule C, Barberger-Gateau P, Lafont S, et al. Marital status and risk of Alzheimer’s disease: a French population-based cohort study. Neurology. 1999;53:1953–8.10599764
25. Fratiglioni L Wang HX Ericsson K Maytan M Winblad B Influence of social network on occurrence of dementia: a community-based longitudinal study Lancet (Lond, Engl) 2000 355 1315 9 10.1016/S0140-6736(00)02113-9
Fratiglioni L, Wang HX, Ericsson K, Maytan M, Winblad B. Influence of social network on occurrence of dementia: a community-based longitudinal study. Lancet (Lond, Engl). 2000;355:1315–9.
26. Hsiao YH Chang CH Gean PW Impact of social relationships on Alzheimer’s memory impairment: mechanistic studies J Biomed Sci 2018 25 3 10.1186/s12929-018-0404-x 29325565
Hsiao YH, Chang CH, Gean PW. Impact of social relationships on Alzheimer’s memory impairment: mechanistic studies. J Biomed Sci. 2018;25:3.29325565
27. Wilson RS Krueger KR Arnold SE Schneider JA Kelly JF Barnes LL Loneliness and risk of Alzheimer disease Arch Gen psychiatry 2007 64 234 40 10.1001/archpsyc.64.2.234 17283291
Wilson RS, Krueger KR, Arnold SE, Schneider JA, Kelly JF, Barnes LL, et al. Loneliness and risk of Alzheimer disease. Arch Gen psychiatry. 2007;64:234–40.17283291
28. Donovan NJ Okereke OI Vannini P Amariglio RE Rentz DM Marshall GA Association of Higher Cortical Amyloid Burden With Loneliness in Cognitively Normal Older Adults JAMA psychiatry 2016 73 1230 7 10.1001/jamapsychiatry.2016.2657 27806159
Donovan NJ, Okereke OI, Vannini P, Amariglio RE, Rentz DM, Marshall GA, et al. Association of Higher Cortical Amyloid Burden With Loneliness in Cognitively Normal Older Adults. JAMA psychiatry. 2016;73:1230–7.27806159
29. Simons M de Strooper B Multhaup G Tienari PJ Dotti CG Beyreuther K Amyloidogenic processing of the human amyloid precursor protein in primary cultures of rat hippocampal neurons J Neurosci: J Soc Neurosci 1996 16 899 908 10.1523/JNEUROSCI.16-03-00899.1996
Simons M, de Strooper B, Multhaup G, Tienari PJ, Dotti CG, Beyreuther K. Amyloidogenic processing of the human amyloid precursor protein in primary cultures of rat hippocampal neurons. J Neurosci: J Soc Neurosci. 1996;16:899–908.
30. Peterman JL White JD Calcagno A Hagen C Quiring M Paulhus K Prolonged isolation stress accelerates the onset of Alzheimer’s disease-related pathology in 5xFAD mice despite running wheels and environmental enrichment Behav. brain Res 2020 379 112366 10.1016/j.bbr.2019.112366 31743728
Peterman JL, White JD, Calcagno A, Hagen C, Quiring M, Paulhus K, et al. Prolonged isolation stress accelerates the onset of Alzheimer’s disease-related pathology in 5xFAD mice despite running wheels and environmental enrichment. Behav. brain Res. 2020;379:112366.31743728
31. Dong H Yuede CM Yoo HS Martin MV Deal C Mace AG Corticosterone and related receptor expression are associated with increased beta-amyloid plaques in isolated Tg2576 mice Neuroscience 2008 155 154 63 10.1016/j.neuroscience.2008.05.017 18571864
Dong H, Yuede CM, Yoo HS, Martin MV, Deal C, Mace AG, et al. Corticosterone and related receptor expression are associated with increased beta-amyloid plaques in isolated Tg2576 mice. Neuroscience. 2008;155:154–63.18571864
32. Hsiao YH Kuo JR Chen SH Gean PW Amelioration of social isolation-triggered onset of early Alzheimer’s disease-related cognitive deficit by N-acetylcysteine in a transgenic mouse model Neurobiol Dis 2012 45 1111 20 10.1016/j.nbd.2011.12.031 22227002
Hsiao YH, Kuo JR, Chen SH, Gean PW. Amelioration of social isolation-triggered onset of early Alzheimer’s disease-related cognitive deficit by N-acetylcysteine in a transgenic mouse model. Neurobiol Dis. 2012;45:1111–20.22227002
33. Garcia-Alloza M Robbins EM Zhang-Nunes SX Purcell SM Betensky RA Raju S Characterization of amyloid deposition in the APPswe/PS1dE9 mouse model of Alzheimer disease Neurobiol Dis 2006 24 516 24 10.1016/j.nbd.2006.08.017 17029828
Garcia-Alloza M, Robbins EM, Zhang-Nunes SX, Purcell SM, Betensky RA, Raju S, et al. Characterization of amyloid deposition in the APPswe/PS1dE9 mouse model of Alzheimer disease. Neurobiol Dis. 2006;24:516–24.17029828
34. Wang B Wu Q Lei L Sun H Michael N Zhang X Long-term social isolation inhibits autophagy activation, induces postsynaptic dysfunctions and impairs spatial memory Exp Neurol 2019 311 213 24 10.1016/j.expneurol.2018.09.009 30219732
Wang B, Wu Q, Lei L, Sun H, Michael N, Zhang X, et al. Long-term social isolation inhibits autophagy activation, induces postsynaptic dysfunctions and impairs spatial memory. Exp Neurol. 2019;311:213–24.30219732
35. Matsumoto K Fujiwara H Araki R Yabe T Post-weaning social isolation of mice: A putative animal model of developmental disorders J Pharmacol Sci 2019 141 111 8 10.1016/j.jphs.2019.10.002 31708401
Matsumoto K, Fujiwara H, Araki R, Yabe T. Post-weaning social isolation of mice: A putative animal model of developmental disorders. J Pharmacol Sci. 2019;141:111–8.31708401
