
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39294172
68528
10.1038/s41598-024-68528-y
Article
Baicalin target protein, Annexin A2, is a target of new antitumor drugs
Kusakabe Yoshio 1
Matsumoto Kazuya 1
Tsuyuki Takahiro 1
Hayashi Yasuhiro 2
Watanabe Hideaki hwatanabe@med.showa-u.ac.jp

3
1 https://ror.org/01gaw2478 grid.264706.1 0000 0000 9239 9995 Faculty of Pharma-Sciences, Teikyo University, Tokyo, Japan
2 https://ror.org/0447kww10 grid.410849.0 0000 0001 0657 3887 Faculty of Agriculture, University of Miyazaki, Miyazaki, Japan
3 https://ror.org/00p9rpe63 grid.482675.a 0000 0004 1768 957X Department of Dermatology, Showa University Northern Yokohama Hospital, Chigasakichuo, Tsuduki-ku, Yokohama City, Kanagawa Japan
18 9 2024
18 9 2024
2024
14 218143 7 2023
24 7 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Baicalin is a flavonoid extracted from Scutellaria baicalensis Georgi. As it has significant antitumor and apoptosis-inducing effects, baicalin may be useful as a lead compound in new antitumor drug development. However, as the pharmacological actions of baicalin have yet to be elucidated, we isolated its target protein, which was successfully identified as Annexin A2. Annexin A2 forms a heterotetramer with S100A10 protein, which plays an important role in the plasminogen activator system. The heterotetramer bound to tissue plasminogen activator (tPA) activates the conversion of plasminogen to plasmin and promotes the expression of STAT-3 and NF-κB, which are target genes involved in the development of cancer. Moreover, NF-κB and STAT-3 induce the expression of cell inhibitors of apoptotic proteins and inhibit apoptosis. To examine whether these antitumor and apoptosis-inducing effects of baicalin are mediated by Annexin A2, we prepared Annexin A2 knockdown HepG2 cells. We compared mRNA expression by RT-qPCR and apoptosis by caspase-3 activity assays in Annexin A2 knockdown HepG2 cells. The results showed that the antitumor and apoptosis-inducing effects of baicalin are mediated by Annexin A2. The results of this study suggest that agents capable of inhibiting Annexin A2 may be useful candidates for the development of novel antitumor agents.

Subject terms

Cancer
Biochemistry
Cell biology
Computational biology and bioinformatics
http://dx.doi.org/10.13039/501100001691 Japan Society for the Promotion of Science 21K08358 22K08392 Kusakabe Yoshio Watanabe Hideaki issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Baicalin (5,6-dihydroxy-4-oxo-2-phenyl-chromen-7-yl oxy-3,4,5-trihydroxy-tetrahydropyran-2-carboxylic acid) (Fig. 1a), the predominant flavonoid extracted from the roots of Scutellaria baicalensis Georgi, has attracted a great deal of attention due to its low toxicity and efficient antitumor, antioxidation, and antiinflammatory activities1–3. Baicalin has been reported to show antitumor activity against a variety of tumor types, including liver cancer4, colorectal carcinoma5, bladder cancer6,7, glioblastoma8, and breast cancer9. Previous studies have also shown that baicalin inhibits the growth of cancer cells through the induction of apoptosis10–12. As resistance to apoptosis is a characteristic of cancer cells and contributes to the endurance of cancer, baicalin has been suggested to be useful as a lead compound for the development of new antitumor agents. However, the pharmacological actions of baicalin have yet to be elucidated4. Therefore, we first isolated and identified a baicalin target protein that interacts with baicalin. Compounds that inhibit baicalin target proteins are potential candidates for the development of more effective, novel antitumor agents. We isolated and identified Annexin A2 as a baicalin target protein in this study.Figure 1 (a) The chemical structure of baicalin. (b) The results of affinity chromatography. SDS-PAGE of affinity chromatography using a baicalin-Affi-Gel 102 column. The band surrounded by a cyan line was analyzed by in-gel digestion and tandem mass spectrometry nano LC–MS/MS according to the standard protocol.

Proteins belonging to the Annexin family promote invasion and metastasis of several types of cancer, including breast cancer13, esophageal carcinoma14, liver cancer15, and intrahepatic cholangiocarcinoma. The C-terminal core domain is relatively conserved among members of the human Annexin family, each of which is composed of four homologous Annexin repeats (eight in Annexin A6) containing multiple α-helical segments. Compared to the C-terminal core domain, the N-terminal domain of human Annexin is relatively variable in sequence. In the Annexin family, the N-terminal domain is released from the C-terminal core domain and interacts with various protein ligands to exhibit biological activity.

Annexin A2 (ANXA2) exists as both a monomer and a heterotetramer known as AIIt6,9. The ANXA2 monomer is an intracellular protein with a molecular weight of 38 kDa, while the AIIt heterotetramer complex consisting of two subunits of ANXA2 monomers and two subunits of S100A10 (also known as p11) is localized on the plasma membrane6,10,16. S100A10 is a member of the 11 kDa calmodulin-related proteins within the S100 protein family, and was discovered as a binding partner of ANXA211. There is emerging evidence of an important role of the AIIt heterotetramer in the plasminogen activator system6,12. The AIIt heterotetramer binds to tissue plasminogen activator (tPA) to mediate the activation of plasminogen to plasmin, which facilitates degradation of the extracellular matrix and proteolytic activation of inactive proteases, such as matrix metalloproteases, leading to increased angiogenesis, migration, invasion, and metastasis of tumor cells17–19. Moreover, cleavage of a part of ANXA2 by plasmin generates an amino-terminal peptide that acts as a ligand for transmembrane receptors and activates intracellular signaling cascades. In short, Plasmin activates macrophages via the AIIt heterotetramer with subsequent stimulation of Janus kinase JAK1/TYK2 signaling. JAK1/TYK2 leads to a signal transducer and activator of transcription 3 (STAT-3) activation, Akt-dependent nuclear factor κ binding (NF-κB) activation, and phosphorylation of extracellular signal-regulated kinase 1/2 and mitogen-activated kinase p3820. Crosstalk between STAT-3 and NF-κB signaling pathways affects cancer cell invasiveness (Fig. 2)21.Figure 2 Expression mechanism of cancer-promoting genes and inhibitors of apoptotic proteins by the complex of ANXA2 and S100A10. ANXA2 and S100A10 proteins form the AIIt heterotetramer complex within the cytoplasm prior to translocate to the cell surface. Once at the cell surface, AIIt acts as a receptor for tissue plasminogen activator (tPA) to mediate the activation of plasminogen to plasmin. Plasmin cleavage of a part of ANAX2 generates a peptide that activates Type I cytokine receptors. Activation of the receptors promotes the expression of cancer-promoting factors such as STAT-3 and NF-κB.

Notably, both transcription factors are regulators of genes that control other processes, such as antiapoptotic processes, cytokine production, and inflammation. STAT-3 and NF-κB also have antiapoptotic effects by promoting transcription of cell inhibitor of apoptotic proteins (cIAPs) that inhibit apoptosis by caspase-degrading activity22. The above findings indicate that STAT-3 and NF-κB are cancer-promoting factors, which significantly enhance cancer cell viability and chemotherapy resistance19,23–25. Furthermore, the overexpression of ANXA2 was detected in tumors of various organs, including the brain, liver26, pancreas27,28, lung29, and colon30. High levels of expression of ANXA2 and STAT-3 promote progression of hepatocellular carcinoma and predict poor prognosis31.

Disruption of heterotetramer formation by inhibiting the action of ANXA2 suppresses the transcription of cancer-promoting factors, such as STAT-3 and NF-κB. Suppression of STAT-3 and NF-κB expression can subsequently suppress cIAP transcription and induce apoptosis32.

Therefore, ANXA2 is an attractive target for the development of new anticancer drugs. Here, we confirmed the transcriptional repression of cancer-promoting factors, STAT-3 and apoptosis inhibitors, cIAP-1 and cIAP-2, and the apoptosis-inducing effect of baicalin in HepG2 liver cancer cells. Then, to investigate whether the antitumor and apoptosis-inducing effects of baicalin are mediated by ANXA2, we generated an ANXA2 knockdown HepG2 cell line. Changes in the levels of STAT-3, cIAP-1, and cIAP-2 expression with increasing baicalin concentration were compared between the knockdown cells and negative controls33,34. In addition, the ability to induce apoptosis with increasing baicalin concentration was also compared between knockdown and negative control cells.

Finally, in silico docking simulations were performed to gain insights for the development of new inhibitors targeting ANXA2. The docking simulation was performed using not only the experimentally elucidated 3D structures of delta N-terminal domain (1–31) ANXA2 (ΔN_ANXA2) but also the 3D structure of full-length ANXA2 predicted by AlphaFold 2. The binding site and binding mode were predicted by docking simulations of the structure of ANXA2 and baicalin and further molecular dynamics (MD) calculations.

Materials and methods

Cell culture

HepG2 cells were purchased from RIKEN cell bank (Wako, Saitima, Japan). HepG2 cells were maintained in low-glucose Dulbecco’s Modified Eagle’s Medium (DMEM) (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) supplemented with 10% USDA-tested fetal bovine serum (FBS; Cytiva, Marlborough, MA, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin (FUJIFILM Wako Pure Chemical Corporation) in a humidified atmosphere of 5% CO2 at 37 °C34. For subculture, the cells were trypsinized with 0.05% EDTA-trypsin (FUJIFILM Wako Pure Chemical Corporation).

Isolation and identification of baicalin target protein

The baicalin target protein was extracted by the method reported previously by our group35.

Baicalin-treated HepG2 cells

HepG2 cells were inoculated into 35-mm dishes (1 × 106 cells/2 mL) for 48 h, and treated with baicalin at a concentration of 0, 10, 25, 50, or 75 µM in 2 mL of DMEM containing 2% FBS at 37 °C for a further 48 h34. Comparisons of mRNA expression levels were performed by real-time quantitative PCR (RT-qPCR), and apoptosis activity was examined by caspase-3 activity assay.

Real-time quantitative PCR

RNA was extracted using ISOSPIN Cell and Tissue RNA (314-08211; Nippon Gene Co., Ltd., Tokyo, Japan) according to the manufacturer’s instructions. Reverse transcription of total RNA (500 ng) into cDNA was performed with TKR TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (RR820A; TaKaRa, Kyoto, Japan) on a PTC-200 DNA Engine Cycler (Bio-Rad, Hercules, CA, USA). Real-time PCR was performed using LightCycler 480 SYBR Green I Master Mix (TaKaRa) on an ABI 7500 Real Time PCR System (Applied Biosystems, Foster City, CA, USA). The primers used for analysis of ANXA2, cIAP-1, cIAP-2, STAT-3, and β-actin36–39 gene expression are listed in Table 1. The mRNA expression levels were measured and quantified using ABI Prism 7000 sequence Detection System (Applied Biosystems). RT-qPCR was performed in quadruplicate, and the mean values relative to β-actin were calculated. The 2−ΔΔCT method was used to calculate the relative mRNA expression.Table 1 Primer sequences for each gene.

Genes	Sequences of primers (5′–3′)	
ANXA2	Forward	GTGAAGAGGAAAGGAACCGA	
Reverse	CTTGATGCTCTCCAGCATGT	
STAT-3	Forward	GCCAGAGAGCCAGGAGCA	
Reverse	ACACAGATAAACTTGGTCTTCAGGTATG	
cIAP-1	Forward	TCAGAATTGGCAAGAGCTGGT	
Reverse	AAATGCCTCCGGTGTTCTGA	
cIAP-2	Forward	GCTTGCAAGTGCGGGTTTTT	
Reverse	ACCTTGGAAACCACTTGGCA	
β-actin	Forward	ACAGAGCCTCGCCTTTGC	
Reverse	GCGGCG ATATCATCATCC	

Caspase-3 activity assay

Apoptosis was analyzed by caspase-3 activity assay with an APOPCYTO Caspase-3 Colorimetric Assay Kit (Medical and Biological Laboratories, Tokyo, Japan) according to the manufacturer’s protocol40. A Pierce Coomassie (Bradford) Protein Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA) was used to measure the total protein concentration. Protein samples were prepared at a concentration of 100 µg/50 µL and the absorbance was measured at 405 nm using a microplate reader (SpectarMax® i3; Molecular Devices, Sunnyvale, CA, USA). All assays were performed in triplicate.

siRNA transfection

HepG2 cells were transfected with 10 μM Annexin II small interfering RNA (siRNA) (h2) (sc-270151; Santa Cruz Biotechnology, Santa Cruz, CA, USA) by electroporation. HepG2 cells were inoculated onto 35-mm dishes (1 × 106 cells/2 mL), cultured for 24 h, washed, and the medium was replaced with Opti-MEM (Gibco, by Life Technologies, Carlsbad, CA, USA). The HepG2 cells in 100 μL of Opti-MEM and 2 μL of siRNA (2.6 μg) were mixed and transferred to a 2-mm gap electroporation cuvette (EC-002; Nepa Gene, Chiba, Japan). The HepG2 cells were transfected in an electroporator (NEPA21; Nepa Gene), cultured in DMEM supplemented with 10% FBS, seeded into 35-mm culture dishes, and cultured for 48 h. The siRNA transfection efficiency was confirmed by RT-qPCR and Western blotting. Cells transfected with control siRNA were used as a negative control (Stealth RNAi siRNA Negative Control, sc-37007; Santa Cruz Biotechnology).

Western blotting

Total cellular protein was extracted with radioimmunoprecipitation assay (RIPA) lysis buffer (Cell Signaling Technology, Danvers, MA, USA). Total protein concentration was measured using a Pierce Coomassie (Bradford) Protein Assay Kit (Thermo Fisher Scientific). Proteins (total 10 μg) were separated by SDS-PAGE and then transferred onto polyvinylidene difluoride (PVDF) membranes (Zhuzhou Hongda Polymer Materials Co., Ltd., Zhuzhou, China).

The membranes were subjected to Western blotting analysis using specific rabbit and mouse antibodies against ANXA2 (dilution 1:1000, Q25; Cell Signaling Technology) and β-actin (dilution 1:10000, A5316; Sigma, St. Louis. MO, USA). We detected immunoreactive ANXA2 and β-actin using an enhanced chemiluminescence (ECL) Prime Western Blotting System (RPN2232; Cytiva) after the isolated cellular proteins were complexed with horseradish peroxidase-conjugated anti-rabbit and mouse immunoglobulin G (IgG).

Amersham Imager 680 (Cytiva) was used for development and visualization, and the gray values of the target bands were analyzed with Image J38.

Baicalin-treated ANXA2 knockdown HepG2 cells

The transfected ANXA2 knockdown cells were inoculated into 35-mm dishes (1 × 106 cells/2 mL), cultured for 48 h, and then treated with baicalin at a concentration of 0, 10, or 75 µM in 2 mL of DMEM supplemented with 2% FBS at 37 °C for a further 48 h34. Comparisons of mRNA expression levels were carried out by RT-qPCR, and the apoptosis activity was examined by caspase-3 activity assay.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 9.0 (GraphPad Software, San Diego, CA, USA). All data are presented as the mean ± standard deviation (SD). For panels, n.s., not significant, *P < 0.05 (one-way analysis of variance (ANOVA)).

Molecular docking simulations

To examine the binding mode of ANXA2–baicalin complex, we conducted docking experiments using AutoDock Vina (Scripps Research, La Jolla, CA, USA). As 3D structures are necessary for molecular docking experiments, the 3D structures of the delta N-terminal domain of human ANXA2 (ΔN_ANXA2) were obtained from PDB (5LQ0, 2HYW, 4HRE, 1XJL). To confirm the binding mode of full-length ANXA2 including the N-terminal domain to baicalin, the 3D structure of full-length human ANXA2 was constructed by AlphaFold 2. Hydrogen atoms and AM1-BCC atomic charge were added to baicalin using the Hgene program in the myPresto portal41. Then, energy optimization to generate 3D conformations of baicalin was conducted using the cofgene program in the myPresto portal. For all docking simulations, box centers were set to the default settings. To include all ANXA2 structures, a grid box size of 60 × 60 × 60 Å against the monomeric structure of ANXA2 and the exhaustiveness of 100 were used as docking parameters42,43. The spacing between grid points was adjusted to 1 Å and the maximum number of docking modes was set to 20. The docking poses were visualized using UCSF Chimera and pymol. The ligand (baicalin) was then sorted based on the AutoDock score (kcal/mol).

Molecular dynamics simulations

The protein–ligand complexes with the highest binding affinities (kcal/mol) based on the docking simulations performed in AutoDock Vina (Scripps) were used as the starting structures for MD simulations. First, each ANXA2–baicalin complex was immersed in a transferable intermolecular potential 3P (TIP3P) water box, with water molecules extending 15.0 Å from any solute atom in each direction using Bondi radii. Then, Na+ or Cl− ions were added to neutralize each complex. The complexes were minimized in two steps: first, all of the heavy backbone atoms of ANXA2 were restrained with a weight of 2 kcal/mol Å2. Next, the system was minimized without any restraints. These systems were optimized by 5000 cycles of steepest descent and 5000 cycles of conjugate gradient minimization. All minimizations were performed using the sander Amber package.

Following minimization, the AmberTools 23 simulation package was used to carry out MD simulations43,44. The total simulation time for baicalin and ANXA2 protein complexes was 100 ns, in which the complexes were heated from 0 to 300 K at 25 ps, in constant volume mode with a restraint weight of 2.0 kcal/mol Å2, then density balance was carried out with a restraint weight of 2.0 kcal/mol Å2 (constant pressure of 10 ps), equilibrium (constant pressure of 100 ps), and MD production. During 100 ns MD calculations, the docking poses with the lowest energy were defined as the binding models.

Results and discussion

Baicalin acts as a target of ANXA2

The baicalin target protein was extracted by the method reported previously by our group35. In the previous report, we showed that the method was able to isolate a target protein capable of binding specifically to baicalin. A baicalin-Affi-Gel 102 Agarose gel was prepared, and affinity chromatography was performed using the prepared column. The baicalin target proteins were extracted using the baicalin-Affi-Gel 102 affinity column from HepG2 cells. Then, the proteins were identified by nano liquid chromatography coupled to tandem mass spectrometry (nano LC–MS/MS), and ANXA2 was identified as one of the target proteins of baicalin (Fig. 1b). The results of nano LC–MS/MS showed that the amount of ion coverage was 9.4% (32 amino acids per 339 total amino acids).

Baicalin reduced STAT-3, cIAP-1, and cIAP-2 mRNA expression in HepG2 cells

To analyze the relations between baicalin and STAT-3, cIAP-1, and cIAP-2, HepG2 cells were treated with different concentrations of baicalin, and RT-qPCR was performed to determine the levels of STAT-3, cIAP-1, and cIAP-2 expression. HepG2 cells were treated with 0, 10, 25, 50, or 75 μM baicalin. After culturing for 48 h, the levels of STAT-3, cIAP-1, and cIAP-2 mRNA expression were measured. As shown in Fig. 3a–c, baicalin reduced STAT-3 (Fig. 3a), cIAP-1 (Fig. 3b), and cIAP-2 (Fig. 3c) mRNA levels in a dose-dependent manner. These observations indicated that baicalin inhibited the expression of STAT-3, cIAP-1, and cIAP-2 in HepG2 cells.Figure 3 The mRNA levels of STAT-3 (a), cIAP-1 (b), and cIAP-2 (c) in HepG2 cells treated with baicalin for 48 h were determined by RT-qPCR. The experiments were performed in quintuplicate. (d) The caspase-3 activity in HepG2 cells treated with baicalin for 48 h was measured with a Caspase-3 Activity Assay Kit. The experiments were performed in quadruplicate. The data are shown as the mean ± SD.

Baicalin increases apoptosis in HepG2 cells

To analyze the relations between baicalin and apoptosis, HepG2 cells were treated with different concentrations of baicalin, and apoptosis was examined by caspase-3 activity assay. Baicalin was considered to induce apoptosis as the apoptotic activity was strongly correlated with the concentration of baicalin (Fig. 3d).

Transfection of ANXA2 siRNA into HepG2 cells significantly reduced the level of ANXA2 expression

To confirm whether the apoptosis-promoting effects and antitumor effects of baicalin are due to the inhibition of ANXA2, HepG2 cells were transfected with siRNA to specifically knockdown ANXA2 expression. To find conditions suitable for low mortality and highly efficient target gene knockdown, a variety of conditions with regard to time and pulse power were tested. These tests showed that a single pulse of 125 V for 5.0 ms was optimal. The knockdown efficiency of ANXA2 knockdown HepG2 cells prepared under optimized conditions was about 89.7% (Supplementary Fig. 1(a)). In addition to RT-qPCR, ANXA2 protein expression was examined by Western blotting analysis. The results showed that ANXA2 expression was significantly reduced in ANXA2 knockdown HepG2 cells in comparison with controls (Supplementary Fig. 1 (b)).

ANXA2 knockdown did not significantly decrease the relative gene expression levels of cIPA-1, cIAP-2, and STAT-3 by baicalin treatment in HepG2 cells

To examine whether the apoptosis-inducing effect of baicalin is mediated by ANXA2, the prepared ANXA2 knockdown HepG2 cells were treated with 0, 10, or 75 μM baicalin, and the levels of STAT-3, cIAP-1, and cIAP-2 mRNA expression were measured by RT-qPCR. The levels of STAT-3, cIAP-1, and cIAP-2 expression in the 0 μM baicalin treatment group were used as standards for knockdown and control cells, and the expression levels in the 10 and 75 μM baicalin treatment groups were compared (Fig. 4). In the control cells transfected with negative control siRNA, the levels of STAT-3, cIAP-1, and cIAP-2 mRNA expression in the 75 μM baicalin treatment groups were significantly decreased in comparison with the 0 μM baicalin treatment group. On the other hand, in ANXA2 knockdown cells, there were no significant decreases in levels of STAT-3, cIAP-1, and cIAP-2 mRNA expression in the 10 μM and 75 μM baicalin treatment groups, compared to the 0 μM baicalin treatment group. These results suggested that baicalin reduces STAT-3, cIAP-1, and cIAP-2 expression by acting on ANXA2.Figure 4 The effects of treatment with 0, 10, and 75 μM baicalin on STAT-3, cIAP-1, and cIAP-2 mRNA expression in ANXA2 knockdown HepG2 cells. Relative mRNA expression of STAT-3 (a), cIAP-1 (b), and cIAP-2 (c) in control cells and STAT-3 (d), cIAP-1 (e), and cIAP-2 (f) in ANXA2 knockdown HepG2 cells. RT-qPCR was performed in quintuplicate. The data are shown as the mean ± SD.

ANXA2 knockdown did not significantly increase apoptosis by baicalin treatment in HepG2 cells

To examine whether the apoptotic activity induced by baicalin is due to its effect on ANXA2, caspase-3 activity was measured using knockdown cells transfected with ANXA2 siRNA. As shown in Fig. 5a, c, in the control cells transfected with negative control siRNA, the 50 μM and 75 μM baicalin treatment group showed a significant increase in caspase-3 activity, compared to the 0 μM baicalin treatment group. On the other hand, in ANXA2 knockdown cells, the cells in the baicalin treatment group showed no significant difference in caspase-3 activity, compared to the 0 μM baicalin treatment group (Fig. 5 (b, c). The results suggested that the apoptosis-inducing effect of baicalin is mediated by ANXA2.Figure 5 Effect of 0, 10, 25, 50, and 75 μM baicalin treatment on caspase-3 activity in control cells with control siRNA (a) and ANXA2 knockdown HepG2 cells with ANXA2 knockdown siRNA (b). (c) Shows these results on the same coordinate. Three independent experiments were performed, and the data are shown as the mean ± SD. Statistical analyses were performed by one-way ANOVA.

In silico docking simulation and molecular dynamics calculation

To predict the binding mode of ANXA2 and baicalin, docking simulation was performed using AutoDock Vina. Docking simulations were performed using the four ΔN_ANXA2 3D structures determined by X-ray crystallography and the full-length ANXA2 3D structure predicted by AlphaFold 2 as models (Fig. 6a, b). In a docking simulation of four ΔN_ANXA2 3D structures, the model with the lowest AutoDock value (kcal/mol) was used for MD calculations (Table 2).Figure 6 (a, b) The structure of ANXA2 is colored in rainbow and baicalin is shown in grey. (a) Is a front view and (b) is a side view. (c, d) In the full-length ANXA2-baicalin binding model, the N-terminal domain of ANXA2 is shown in red, the C-terminal core domain is shown in blue, and baicalin is shown in yellow. ANXA2 is shown in cyan and baicalin in beige in the ΔN_ANXA2-baicalin binding model. Chloride ions are shown in green spheres. (e) Details of the baicalin-binding site of ANXA2 are shown with N-terminal domain residues in red and C-terminal core domain residues in blue. Hydrogen bonds are indicated by yellow dashed lines.

Table 2 The results of in silico docking simulation.

Model	Auto dock score (kcal/mol)	Etot	
Annexin A2 5LQ0	− 7.6		
Annexin A2 2HYW	− 8.8	− 200,130 kcal/mol

(62.36 ns)

	
Annexin A2 4HRE	− 8.2		
Annexin A2 1XJL	− 8.7		
Annexin A2 full length by AlphaFold 2	− 8.7	− 232,673 kcal/mol

(50.9 ns)

	

During 100 ns MD calculation, the lowest energy (Etot) state structures were defined as the binding model for the ANXA2–baicalin complex (Supplementary Fig. 2).

As a result of the comparison of the full-length ANXA2-baicalin docking model with the ΔN ANXA2-baicalin docking model, the structure of ANXA2 and the binding site for baicalin were nearly identical (Fig. 6c, d). Thus, there was no change in the binding site of baicalin with or without the N-terminal domain. Baicalin was bound to the pocket in ANXA2 on the opposite side of the membrane-bound region to which Ca2+ binds44. At the binding site of baicalin, Asn 137 formed three hydrogens bonded to C-2 OH in the sugar moiety, 6-OH in the flavone backbone, and the oxygen of the carboxy group. Arg179 also formed hydrogen bonds with the oxygen of C5 in the sugar moiety and carbonyl oxygen in the carboxy group. Furthermore, Cys 133 and Arg135 participated in the hydrogen bond with oxygen of C-2 OH and C-3 OH in the sugar moiety, respectively. The flavone moiety of baicalin was bound in a hydrophobic pocket containing the N-terminal domain and C-terminal core domain (Fig. 6e).

The crystal structure of the S100A10 dimer in complex with the peptide corresponding to the N-terminus of ANXA2 shows the first 10 amino acids of ANXA2 form an α-helix, which is important for its interaction with S100A1045. AlphaFold 2 predicted the structure of the full-length ANXA2, showing that the flexible N-terminal domain bound to S100A10 protein deviates significantly from the C-terminal core domain (Fig. 7a–c). In this state, the N-terminal domain interacts with S100A10 to form a heterotetramer. That is, ANXA2 forms the heterotetramer with the released N-terminal domain and S100A10 protein after the N-terminal domain is released from the C-terminal core domain (Fig. 7c)16. The subsequent docking simulation and MD calculation predicted that baicalin anchors the flexible N-terminal domain to the C-terminal core domain (Fig. 7a, b, and d). In other words, it can be considered that baicalin prevents the heterotetramer formation because baicalin fixes the N-terminal domain, which is important for binding to S100A10, within the C-terminal core domain. The formed heterotetramer migrates to the extracellular space and functions as a plasminogen receptor to induce expression of cancer-inducing proteins, such as STAT-3 and NF-κB. Therefore, baicalin, which prevents the heterotetramer formation, may exert anticancer effects by abrogating the expression of cancer-inducing proteins such as STAT-3 and NF-κB. These proteins also function as promoters of cIAPs that inhibit apoptosis by caspase-degrading activity. Baicalin was shown to induce apoptosis by suppressing the expression of these proteins.Figure 7 (a, b) In the full-length ANXA2-baicalin binding model, the N-terminal domain of ANXA2 is shown in red, the C-terminal core domain is shown in blue. On the other hand, in the structure of ANXA2 without baicalin, the N-terminal domain of ANXA2 is shown in magenta, the C-terminal core domain is shown in green. (c) Schematic diagram of the formation of the heterotetramer, AIIt. (d) Schematic diagram showing inhibition of the heterotetramer formation by baicalin. Compared to the model without baicalin, the N-terminal region is significantly bent in the model with baicalin.

Conclusion

The results of knockdown experiments, apoptosis induction experiments with measurement of caspase-3 activity, RT-qPCR experiments, and docking simulation experiments showed that baicalin binds to ANXA2 and inhibits the release of the N-terminal domain from the C-terminal core domain. Therefore, baicalin was suggested to interfere with the formation of the heterotetramers between ANXA2 and S100A10 protein. The interference with the formation of the heterotetramers with the S100A10 protein abolished the function as a plasminogen receptor, and it was expected that the expression of carcinogenic proteins, such as STAT-3 and NF-κB, would be suppressed. Furthermore, suppression of the expression of these proteins suppressed cIAP expression and induced apoptosis. In summary, agents capable of inhibiting release of the N-terminal domain by anchoring the C-terminal core domain of ANXA2 are likely candidates for novel inhibitors of carcinogenic protein expression and induction of apoptosis. The results of this study suggested that agents that inhibit Annexin A2 may be useful as novel antitumor agents.

Supplementary Information

Supplementary Figures.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-68528-y.

Acknowledgements

This work was supported by JSPS KAKENHI Grant Number 21K08358. Caspase-3 activity assay was performed using a SpectarMax® i3 and the RT-qPCR experiment was performed using an ABI 7500 Real Time PCR System at the Central Laboratory of Teikyo University.

Author contributions

Y.K. and Y.H. designed research. Y.K. performed all experiments, analyzed data, and wrote the main manuscript text. K.M. performed the experiments and prepared Figs. 3, 4 and Supplementary Fig. 1. T.T. performed the experiments and prepared Figs. 1. H.W. funding and editing the pape. All authors reviewed the manuscript.

Data availability

The datasets used and/or analysed during the current study available from the corresponding author upon formal request.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Gao Z Huang K Xu H Protective effects of flavonoids in the roots of Scutellaria baicalensis Georgi against hydrogen peroxide-induced oxidative stress in HS-SY5Y cells Pharmacol. Res. 2001 43 2 173 178 10.1006/phrs.2000.0761 11243719
Gao, Z., Huang, K. & Xu, H. Protective effects of flavonoids in the roots of Scutellaria baicalensis Georgi against hydrogen peroxide-induced oxidative stress in HS-SY5Y cells. Pharmacol. Res. 43(2), 173–178 (2001).11243719
2. Shen YC Mechanisms in mediating the anti-inflammatory effects of baicalin and baicalein in human leukocytes Eur. J. Pharmacol. 2003 465 1–2 171 181 10.1016/S0014-2999(03)01378-5 12650847
Shen, Y. C. et al. Mechanisms in mediating the anti-inflammatory effects of baicalin and baicalein in human leukocytes. Eur. J. Pharmacol. 465(1–2), 171–181 (2003).12650847
3. Dong LH Baicalin inhibits PDGF-BB-stimulated vascular smooth muscle cell proliferation through suppressing PDGFRβ-ERK signaling and increase in p27 accumulation and prevents injury-induced neointimal hyperplasia Cell Res. 2010 20 11 1252 1262 10.1038/cr.2010.111 20661261
Dong, L. H. et al. Baicalin inhibits PDGF-BB-stimulated vascular smooth muscle cell proliferation through suppressing PDGFRβ-ERK signaling and increase in p27 accumulation and prevents injury-induced neointimal hyperplasia. Cell Res. 20(11), 1252–1262 (2010).20661261
4. Yu Y Pei M Li L Baicalin induces apoptosis in hepatic cancer cells in vitro and suppresses tumor growth in vivo Int. J. Clin. Exp. Med. 2015 8 6 8958 8967 26309548
Yu, Y., Pei, M. & Li, L. Baicalin induces apoptosis in hepatic cancer cells in vitro and suppresses tumor growth in vivo. Int. J. Clin. Exp. Med. 8(6), 8958–8967 (2015).26309548
5. Chen WC Baicalin induces apoptosis in SW620 human colorectal carcinoma cells in vitro and suppresses tumor growth in vivo Molecules 2012 17 4 3844 3857 10.3390/molecules17043844 22456615
Chen, W. C. et al. Baicalin induces apoptosis in SW620 human colorectal carcinoma cells in vitro and suppresses tumor growth in vivo. Molecules 17(4), 3844–3857 (2012).22456615
6. Lin C AKT serine/threonine protein kinase modulates baicalin-triggered autophagy in human bladder cancer T24 cells Int. J. Oncol. 2013 42 3 993 1000 10.3892/ijo.2013.1791 23354080
Lin, C. et al. AKT serine/threonine protein kinase modulates baicalin-triggered autophagy in human bladder cancer T24 cells. Int. J. Oncol. 42(3), 993–1000 (2013).23354080
7. Kong N Baicalin induces ferroptosis in bladder cancer cells by downregulating FTH1 Acta Pharm. Sin. B 2021 11 12 4045 4054 10.1016/j.apsb.2021.03.036 35024325
Kong, N. et al. Baicalin induces ferroptosis in bladder cancer cells by downregulating FTH1. Acta Pharm. Sin. B 11(12), 4045–4054 (2021).35024325
8. Zhu Y Baicalin suppresses proliferation, migration, and invasion in human glioblastoma cells via Ca(2+)-dependent pathway Drug Des. Dev. Ther. 2018 12 3247 3261 10.2147/DDDT.S176403
Zhu, Y. et al. Baicalin suppresses proliferation, migration, and invasion in human glioblastoma cells via Ca(2+)-dependent pathway. Drug Des. Dev. Ther. 12, 3247–3261 (2018).
9. Shehatta NH Baicalin; a promising chemopreventive agent, enhances the antitumor effect of 5-FU against breast cancer and inhibits tumor growth and angiogenesis in Ehrlich solid tumor Biomed. Pharmacother. 2022 146 112599 10.1016/j.biopha.2021.112599 34968922
Shehatta, N. H. et al. Baicalin; a promising chemopreventive agent, enhances the antitumor effect of 5-FU against breast cancer and inhibits tumor growth and angiogenesis in Ehrlich solid tumor. Biomed. Pharmacother. 146, 112599 (2022).34968922
10. Zhou QM The combination of baicalin and baicalein enhances apoptosis via the ERK/p38 MAPK pathway in human breast cancer cells Acta Pharmacol. Sin. 2009 30 12 1648 1658 10.1038/aps.2009.166 19960010
Zhou, Q. M. et al. The combination of baicalin and baicalein enhances apoptosis via the ERK/p38 MAPK pathway in human breast cancer cells. Acta Pharmacol. Sin. 30(12), 1648–1658 (2009).19960010
11. Gerke V Weber K Identity of p36K phosphorylated upon Rous sarcoma virus transformation with a protein purified from brush borders; calcium-dependent binding to non-erythroid spectrin and F-actin Embo J. 1984 3 1 227 233 10.1002/j.1460-2075.1984.tb01789.x 6323166
Gerke, V. & Weber, K. Identity of p36K phosphorylated upon Rous sarcoma virus transformation with a protein purified from brush borders; calcium-dependent binding to non-erythroid spectrin and F-actin. Embo J. 3(1), 227–233 (1984).6323166
12. Huang Y Down-regulation of the PI3K/Akt signaling pathway and induction of apoptosis in CA46 Burkitt lymphoma cells by baicalin J. Exp. Clin. Cancer Res. 2012 31 1 48 10.1186/1756-9966-31-48 22607709
Huang, Y. et al. Down-regulation of the PI3K/Akt signaling pathway and induction of apoptosis in CA46 Burkitt lymphoma cells by baicalin. J. Exp. Clin. Cancer Res. 31(1), 48 (2012).22607709
13. Al-Qahtani SM The association between Annexin A2 and epithelial cell adhesion molecule in breast cancer cells Cancer Rep. 2021 5 e1498 10.1002/cnr2.1498
Al-Qahtani, S. M. et al. The association between Annexin A2 and epithelial cell adhesion molecule in breast cancer cells. Cancer Rep. 5, e1498 (2022).
14. Gao S The calcimedin Annexin A3 displays tumor-promoting effect in esophageal squamous cell carcinoma by activating NF-κB signaling Mamm. Genome 2021 32 5 381 388 10.1007/s00335-021-09883-3 34109455
Gao, S. et al. The calcimedin Annexin A3 displays tumor-promoting effect in esophageal squamous cell carcinoma by activating NF-κB signaling. Mamm. Genome 32(5), 381–388 (2021).34109455
15. Guo C 33-kDa ANXA3 isoform contributes to hepatocarcinogenesis via modulating ERK, PI3K/Akt-HIF and intrinsic apoptosis pathways J. Adv. Res. 2021 30 85 102 10.1016/j.jare.2020.11.003 34026289
Guo, C. et al. 33-kDa ANXA3 isoform contributes to hepatocarcinogenesis via modulating ERK, PI3K/Akt-HIF and intrinsic apoptosis pathways. J. Adv. Res. 30, 85–102 (2021).34026289
16. Cañas F Annexin A2 autoantibodies in thrombosis and autoimmune diseases Thromb. Res. 2015 135 2 226 230 10.1016/j.thromres.2014.11.034 25533130
Cañas, F. et al. Annexin A2 autoantibodies in thrombosis and autoimmune diseases. Thromb. Res. 135(2), 226–230 (2015).25533130
17. Lokman NA Annexin A2 is regulated by ovarian cancer-peritoneal cell interactions and promotes metastasis Oncotarget 2013 4 8 1199 1211 10.18632/oncotarget.1122 23945256
Lokman, N. A. et al. Annexin A2 is regulated by ovarian cancer-peritoneal cell interactions and promotes metastasis. Oncotarget 4(8), 1199–1211 (2013).23945256
18. Díaz VM Specific interaction of tissue-type plasminogen activator (t-PA) with annexin II on the membrane of pancreatic cancer cells activates plasminogen and promotes invasion in vitro Gut 2004 53 7 993 1000 10.1136/gut.2003.026831 15194650
Díaz, V. M. et al. Specific interaction of tissue-type plasminogen activator (t-PA) with annexin II on the membrane of pancreatic cancer cells activates plasminogen and promotes invasion in vitro. Gut 53(7), 993–1000 (2004).15194650
19. Sharma M Ownbey RT Sharma MC Breast cancer cell surface annexin II induces cell migration and neoangiogenesis via tPA dependent plasmin generation Exp. Mol. Pathol. 2010 88 2 278 286 10.1016/j.yexmp.2010.01.001 20079732
Sharma, M., Ownbey, R. T. & Sharma, M. C. Breast cancer cell surface annexin II induces cell migration and neoangiogenesis via tPA dependent plasmin generation. Exp. Mol. Pathol. 88(2), 278–286 (2010).20079732
20. Li Q Plasmin triggers cytokine induction in human monocyte-derived macrophages Arterioscler. Thromb. Vasc. Biol. 2007 27 6 1383 1389 10.1161/ATVBAHA.107.142901 17413040
Li, Q. et al. Plasmin triggers cytokine induction in human monocyte-derived macrophages. Arterioscler. Thromb. Vasc. Biol. 27(6), 1383–1389 (2007).17413040
21. Godier A Hunt BJ Plasminogen receptors and their role in the pathogenesis of inflammatory, autoimmune and malignant disease J. Thromb. Haemost. 2013 11 1 26 34 10.1111/jth.12064 23140188
Godier, A. & Hunt, B. J. Plasminogen receptors and their role in the pathogenesis of inflammatory, autoimmune and malignant disease. J. Thromb. Haemost. 11(1), 26–34 (2013).23140188
22. Wang L Du H Chen P Chlorogenic acid inhibits the proliferation of human lung cancer A549 cell lines by targeting Annexin A2 in vitro and in vivo Biomed. Pharmacother. 2020 131 110673 10.1016/j.biopha.2020.110673 32882585
Wang, L., Du, H. & Chen, P. Chlorogenic acid inhibits the proliferation of human lung cancer A549 cell lines by targeting Annexin A2 in vitro and in vivo. Biomed. Pharmacother. 131, 110673 (2020).32882585
23. Chen L Annexin A2 regulates glioma cell proliferation through the STAT3-cyclin D1 pathway Oncol. Rep. 2019 42 1 399 413 31115554
Chen, L. et al. Annexin A2 regulates glioma cell proliferation through the STAT3-cyclin D1 pathway. Oncol. Rep. 42(1), 399–413 (2019).31115554
24. Fan Y Mao R Yang J NF-κB and STAT3 signaling pathways collaboratively link inflammation to cancer Protein Cell 2013 4 3 176 185 10.1007/s13238-013-2084-3 23483479
Fan, Y., Mao, R. & Yang, J. NF-κB and STAT3 signaling pathways collaboratively link inflammation to cancer. Protein Cell 4(3), 176–185 (2013).23483479
25. He G Karin M NF-κB and STAT3—Key players in liver inflammation and cancer Cell Res. 2011 21 1 159 168 10.1038/cr.2010.183 21187858
He, G. & Karin, M. NF-κB and STAT3—Key players in liver inflammation and cancer. Cell Res. 21(1), 159–168 (2011).21187858
26. Yin D LINC01133 promotes hepatocellular carcinoma progression by sponging miR-199a-5p and activating annexin A2 Clin. Transl. Med. 2021 11 5 e409 10.1002/ctm2.409 34047479
Yin, D. et al. LINC01133 promotes hepatocellular carcinoma progression by sponging miR-199a-5p and activating annexin A2. Clin. Transl. Med. 11(5), e409 (2021).34047479
27. Zheng L Jaffee EM Annexin A2 is a new antigenic target for pancreatic cancer immunotherapy Oncoimmunology 2012 1 1 112 114 10.4161/onci.1.1.18017 22720228
Zheng, L. & Jaffee, E. M. Annexin A2 is a new antigenic target for pancreatic cancer immunotherapy. Oncoimmunology 1(1), 112–114 (2012).22720228
28. Kumble KD Enhanced levels of annexins in pancreatic carcinoma cells of Syrian hamsters and their intrapancreatic allografts Cancer Res. 1992 52 1 163 167 1530768
Kumble, K. D. et al. Enhanced levels of annexins in pancreatic carcinoma cells of Syrian hamsters and their intrapancreatic allografts. Cancer Res. 52(1), 163–167 (1992).1530768
29. Ağababaoğlu İ Chaperonin (HSP60) and annexin-2 are candidate biomarkers for non-small cell lung carcinoma Medicine 2017 96 6 e5903 10.1097/MD.0000000000005903 28178129
Ağababaoğlu, İ et al. Chaperonin (HSP60) and annexin-2 are candidate biomarkers for non-small cell lung carcinoma. Medicine 96(6), e5903 (2017).28178129
30. Kantara C Methods for detecting circulating cancer stem cells (CCSCs) as a novel approach for diagnosis of colon cancer relapse/metastasis Lab. Invest. 2015 95 1 100 112 10.1038/labinvest.2014.133 25347154
Kantara, C. et al. Methods for detecting circulating cancer stem cells (CCSCs) as a novel approach for diagnosis of colon cancer relapse/metastasis. Lab. Invest. 95(1), 100–112 (2015).25347154
31. Tang L High expression of Anxa2 and Stat3 promote progression of hepatocellular carcinoma and predict poor prognosis Pathol. Res. Pract. 2019 215 6 152386 10.1016/j.prp.2019.03.015 30935762
Tang, L. et al. High expression of Anxa2 and Stat3 promote progression of hepatocellular carcinoma and predict poor prognosis. Pathol. Res. Pract. 215(6), 152386 (2019).30935762
32. Ding Y Circular RNA profile of acute myeloid leukaemia indicates circular RNA Annexin A2 as a potential biomarker and therapeutic target for acute myeloid leukaemia Am. J. Transl. Res. 2020 12 5 1683 1699 32509169
Ding, Y. et al. Circular RNA profile of acute myeloid leukaemia indicates circular RNA Annexin A2 as a potential biomarker and therapeutic target for acute myeloid leukaemia. Am. J. Transl. Res. 12(5), 1683–1699 (2020).32509169
33. Li Y Bufalin induces mitochondrial dysfunction and promotes apoptosis of glioma cells by regulating Annexin A2 and DRP1 protein expression Cancer Cell Int. 2021 21 1 424 10.1186/s12935-021-02137-x 34376212
Li, Y. et al. Bufalin induces mitochondrial dysfunction and promotes apoptosis of glioma cells by regulating Annexin A2 and DRP1 protein expression. Cancer Cell Int. 21(1), 424 (2021).34376212
34. Khanal T Protective role of intestinal bacterial metabolism against baicalin-induced toxicity in HepG2 cell cultures J. Toxicol. Sci. 2012 37 2 363 371 10.2131/jts.37.363 22467027
Khanal, T. et al. Protective role of intestinal bacterial metabolism against baicalin-induced toxicity in HepG2 cell cultures. J. Toxicol. Sci. 37(2), 363–371 (2012).22467027
35. Kusakabe Y Isolation and identification of the new baicalin target protein to develop flavonoid structure-based therapeutic agents Bioorg. Med. Chem. 2023 90 117362 10.1016/j.bmc.2023.117362 37320992
Kusakabe, Y. et al. Isolation and identification of the new baicalin target protein to develop flavonoid structure-based therapeutic agents. Bioorg. Med. Chem. 90, 117362 (2023).37320992
36. Adly Sadik N Ahmed Rashed L Ahmed-Abd-El-Mawla M Circulating miR-155 and JAK2/STAT3 axis in acute ischemic stroke patients and its relation to post-ischemic inflammation and associated ischemic stroke risk factors Int. J. Gen. Med. 2021 14 1469 1484 10.2147/IJGM.S295939 33911894
Adly Sadik, N., Ahmed Rashed, L. & Ahmed-Abd-El-Mawla, M. Circulating miR-155 and JAK2/STAT3 axis in acute ischemic stroke patients and its relation to post-ischemic inflammation and associated ischemic stroke risk factors. Int. J. Gen. Med. 14, 1469–1484 (2021).33911894
37. Yang X Profiling of genes associated with the murine model of oxygen-induced retinopathy Mol. Vis. 2013 19 775 788 23592914
Yang, X. et al. Profiling of genes associated with the murine model of oxygen-induced retinopathy. Mol. Vis. 19, 775–788 (2013).23592914
38. Mori K Preoperative heat shock protein 47 levels identify colorectal cancer patients with lymph node metastasis and poor prognosis Oncol. Lett. 2020 20 6 333 10.3892/ol.2020.12196 33123244
Mori, K. et al. Preoperative heat shock protein 47 levels identify colorectal cancer patients with lymph node metastasis and poor prognosis. Oncol. Lett. 20(6), 333 (2020).33123244
39. Verma AK Expression and correlation of cell-free cIAP-1 and cIAP-2 mRNA in breast cancer patients: A study from India J. Oncol. 2020 2020 3634825 10.1155/2020/3634825 32908506
Verma, A. K. et al. Expression and correlation of cell-free cIAP-1 and cIAP-2 mRNA in breast cancer patients: A study from India. J. Oncol. 2020, 3634825 (2020).32908506
40. Hu X Hu X Wang Q Propofol induces apoptosis of hepatocellular carcinoma cells by upregulating miR-134 expression Transl. Cancer Res. 2021 10 6 3004 3012 10.21037/tcr-21-830 35116608
Hu, X., Hu, X. & Wang, Q. Propofol induces apoptosis of hepatocellular carcinoma cells by upregulating miR-134 expression. Transl. Cancer Res. 10(6), 3004–3012 (2021).35116608
41. Kasahara K myPresto/omegagene: a GPU-accelerated molecular dynamics simulator tailored for enhanced conformational sampling methods with a non-Ewald electrostatic scheme Biophys. Physicobiol. 2016 13 209 216 10.2142/biophysico.13.0_209 27924276
Kasahara, K. et al. myPresto/omegagene: a GPU-accelerated molecular dynamics simulator tailored for enhanced conformational sampling methods with a non-Ewald electrostatic scheme. Biophys. Physicobiol. 13, 209–216 (2016).27924276
42. Sandeep G AUDocker LE: A GUI for virtual screening with AUTODOCK Vina BMC Res. Notes 2011 4 445 10.1186/1756-0500-4-445 22026969
Sandeep, G. et al. AUDocker LE: A GUI for virtual screening with AUTODOCK Vina. BMC Res. Notes 4, 445 (2011).22026969
43. Trott O Olson AJ AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading J. Comput. Chem. 2010 31 2 455 461 10.1002/jcc.21334 19499576
Trott, O. & Olson, A. J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 31(2), 455–461 (2010).19499576
44. Hakobyan D Gerke V Heuer A Modeling of annexin A2-membrane interactions by molecular dynamics simulations PLoS One 2017 12 9 e0185440 10.1371/journal.pone.0185440 28937994
Hakobyan, D., Gerke, V. & Heuer, A. Modeling of annexin A2-membrane interactions by molecular dynamics simulations. PLoS One 12(9), e0185440 (2017).28937994
45. Réty S The crystal structure of a complex of p11 with the annexin II N-terminal peptide Nat. Struct. Biol. 1999 6 1 89 95 10.1038/4965 9886297
Réty, S. et al. The crystal structure of a complex of p11 with the annexin II N-terminal peptide. Nat. Struct. Biol. 6(1), 89–95 (1999).9886297
