
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39289437
72352
10.1038/s41598-024-72352-9
Article
Discussion of spinal cord neurons apoptosis and neuroprotection mechanism of NGF gene transfection mediated by recombinant adenovirus in EAE mice
Liu Menglan 12
Li Zuoxiao 12
Lv Zhiyu 12
Xie Yang xy114330@163.com

12
1 https://ror.org/0014a0n68 grid.488387.8 Department of Neurology, The Affiliated Hospital of Southwest Medical University, Luzhou, 646000 China
2 Laboratory of Neurological Diseases and Brain Function, Luzhou, Sichuan China
17 9 2024
17 9 2024
2024
14 2165420 12 2023
5 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
To investigate the spinal cord neuron apoptosis and neuroprotective mechanism of nerve growth factorganismsor (NGF) gene mediated by recombinant adenovirus (Ad-NGF) via peripheral transfection in mice with experimental autoimmune encephalomyelitis (EAE). Forty healthy female C57BL/6 mice were randomly divided into a control group, adenovirus (AdV) group, EAE group, and Ad-NGF transfection group; the control group received no treatment; the AdV group received adenovirus injection via the tail vein; the EAE and Ad-NGF transfection groups were induced with experimental autoimmune encephalomyelitis (EAE) using myelin oligodendrocyte glycoprotein 35–55 (MOG35-55), Ad-NGF transfection group received Ad-NGF injection via the tail vein, and daily neurological impairment scores were obtained. AQThe TUNEL method was employed to observe spinal neuron apoptosis in each group of mice; protein immunoblotting (western blot) and RT-PCR were used to measure NGF levels in the spinal cord tissues of each group, and western blotting was used to assess levels of cleaved caspase-3, Bax, and Bcl-2. ELISA and RT-PCR were employed to detect protein and mRNA levels of neuron-specific enolase (NSE) in spinal cord tissues, respectively. The control group and AdV mice did not develop symptoms. Compared to the EAE group, in the Ad-NGF transfection group, neurological function scores, TUNEL-positive cell counts, the ratio of NeuN + TUNEL to NeuN, levels of Bax and cleaved caspase-3 apoptotic proteins were significantly reduced, while Bcl-2 protein expression was increased. Expression levels of NGF, NGF-mRNA, NSE, and NSE-mRNA in spinal cord tissues were significantly elevated (P < 0.01). Immunofluorescence labeling revealed a significant punctate aggregation of apoptotic cells in spinal neurons of the EAE group, while the aggregation phenomenon was less pronounced in the Ad-NGF transfection group. Ad-NGF transfected by the periphery has a protective effect on spinal cord neurons in EAE mice by up-regulation NGF level, down-regulating apoptotic protein Caspase-3 in spinal cord neurons, inhibiting spinal cord neuron apoptosis and promoting NSE expression.

Keywords

Experimental autoimmune encephalomyelitis
NGF
Adenovirus
Spinal cord neuron
Bax
Bcl-2
Cleaved caspase-3
Neuron-specific enolase
Subject terms

Medical research
Neurology
http://dx.doi.org/10.13039/501100014895 Southwest Medical University No. 2021ZKQN097 issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Multiple sclerosis (MS) is an autoimmune disease characterized by central nervous system (CNS) involvement and myelinoclasis with axonal damage1. The pathogenesis and etiology of the disease are unclear. In the early twenty-first century, degenerative pathological changes of neurons played a key role in MS pathogenesis, which gradually attracted people's attention again. Studies have shown that irreversible damage to axons and neurons has occurred during the early onset of MS and is a major factor in the progressive development of neurological dysfunction in MS patients2. It is well known that enolase is ubiquitous in the metabolism of glycolysis in Type γγ, an enolase isozymes that exists specifically in neuroendocrine cells and neurons; therefore it is called neuron-specific enolase (NSE).It acts as a key enzyme for glycolysis and maintains the physiological function and stability of neurons. When a neuron is damaged, the enolase is released.

from the cytoplasm and enters the blood through the blood–brain barrier, which is often regarded as an indicator of neuronal damage3,4. NGF, a member of the neurotrophic factor family, plays an inhibitory role during normal neuronal cell apoptosis, thus enhancing neuronal cell repair ability to damage, maintaining neuronal stability, and playing a therapeutic role in the progression of multiple autoimmune diseases. However, its clinical application is restricted by complex and expensive factors in the mRNA extraction process of NGF.

Adenoviruses exhibit strong infectivity and high transduction efficiency, primarily targeting the liver upon intravenous tail vein injection. Recombination of adenovirus in humans renders it replication-deficient and reduces its immunogenicity to some extent, while carrying the desired genes, making it a widely used and safe gene vector that is commonly employed in vaccine delivery and tumor-related research5–7. It has been found that exogenous NGF gene mediated by genetic carriers by intramuscular injection can be expressed in vivo and transferred to the injured part of nerve reverse to axon to exert the function of nerve repair8. Therefore, this study selected EAE mice with similar clinical and pathological features to MS as the animal model for basic research. Mice carrying the adenovirus of target gene NGF (Ad-NGF) via peripheral transfection and the effect of peripheral transfection of Ad-NGF on apoptosis of spinal cord neurons in EAE mice and its possible mechanism were investigated by observing the scores of neurological dysfunction in mice, the number of TUNEL-positive apoptotic cells, NSE levels, and co-localization and expression of apoptosis-related protein Caspase3 in spinal cord neurons. We hope to provide a more experimental and theoretical basis for the clinical treatment of MS.

Materials and methods

Laboratory animals and reagents

Forty healthy female C57BL/6 mice were purchased from Dashuo Experimental Animal Co., Ltd. (Chengdu, China) with the following identification number:SPFC58 17-189. The mice were 6–8 weeks old and weighed approximately 20 g. All mice were randomly grouped and housed under identical conditions, and all experimental procedures complied with the Laboratory Animal Care and Use Regulations and were approved by the Animal Experimental Ethics Review Committee of Southwest Medical University (approval number 20211123-023). MOG35-55 was purchased from Beijing Zhongke Yaguang Biotechnology Co., Ltd. Complete Freund's Adjuvant (CFA) was obtained from Difco. Pertussis toxin (PTX) and Mycobacterium tuberculosis H37Ra were purchased from Sigma in the United States. The NGF gene adenovirus was acquired from Shanghai Jikai Gene Chemical Technology Co., Ltd. The DAB chromogenic reagent kit was purchased from Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd. The TUNEL assay kit was obtained from Roche. Adenovirus, ECL chemiluminescence detection kit, rabbit anti-NGF antibody, rabbit anti-Bcl-2 antibody, rabbit anti-Bax antibody, rabbit anti-cleaved caspase-3 antibody, mouse anti-NeuN antibody, CY3-labeled goat anti-mouse antibody, and rabbit anti-GAPDH antibody were all purchased from Wuhan Hengyisai Biotechnology Co., Ltd. (contract number 20032033). The anti-fluorescence quenching sealing agent was purchased from Roche, and M-MLV reverse transcriptase and TPI pure total RNA extraction solution were both purchased from ELK Biotechnology (catalog number EP013).

Experimental group and sample collection

Forty mice were randomly divided into control group, AdV group, EAE group and Ad-NGF transfection group with 10 mice in each group. The latter two groups of mice were injected with MOG35-55 complete Freund's adjuvant and PTX for modeling. PBS buffer was diluted with antigen MOG35-55 and complete Freund's adjuvant was mixed and repeatedly pumped and emulsified in a glass injection vessel of 10 ml. The emulsion was then subcutaneously injected at any 2 points on both sides of the mouse spine. The control group received the same dose of complete Freund's adjuvant without MOG35-55 and PTX. Starting from the third day post-immunization, mice in the Ad-NGF transfection group were intravenously injected with Ad-NGF via the tail vein, with a viral titer of 8 × 108 TU/ml and a volume of 10 μl per mouse. The AdV group received intravenous tail vein injection of the same volume of non-transfected adenovirus at the same dose. Meanwhile, mice in the control group and EAE group received intravenous tail vein injection of the same volume of saline solution.

After 4 weeks of continuous feeding, the mice were taken out and killed on an ice tray after anesthesia. The entire spinal cord tissue was taken out rapidly, the waist was independently separated lumbar pulp was shredded, rinsed several times and then added to the tissue protein extraction reagent, ground repeatedly on an ice tray, centrifuged, centrifugation, the protein in the middle layer was absorbed carefully and kept dry at room temperature. After precipitation, the precipitate was decomposed and centrifuged again, the supernatant was stored in a refrigerator at − 80 ℃ for future use.

Neurological dysfunction score

From the modeling day to the 28th day (killing mice), the clinical manifestations of mice in each group were observed at the same time each day, and the neurological dysfunction score was recorded. Standards for evaluation are as follows: 0: no clinical manifestations; 1 point: decreased tension on the tail and slightly weak hind legs; 2 points: tail Paralysis and moderately weak hind legs; 3 points severally weak hind legs; 4 points: complete paralysis of limbs; 5 points: dying or dead.

Observation of spinal cord neuronal pathological changes in each group of mice

Hydrated chloral hydrate anesthesia was administered, a perfusion needle was inserted deep into the left ventricle, and the right atrium was then carefully cut. Physiological saline was rapidly perfused until the liver turned pale, followed by perfusion with 4% paraformaldehyde for approximately 30 min. The spinal cord tissue was removed, embedded in paraffin, and sectioned. Continuous sections were made at the lumbar enlargement of the spinal cord, with a thickness of 5 μm, and stained with Nissl stain to observe the pathological morphology of the spinal cord neurons under a light microscope.

Observation of apoptosis of spinal cord neurons, positive cell rate and the ratio of NeuN + TUNEL to NeuN by TUNEL staining

Paraffin sections were dewaxed in water and washed with distilled water, and circles were drawn around the tissue with a histochemical pen to prevent the incubation solution from flowing away in subsequent processes. The sections were then washed with PBS. Proteinase K from the kit was diluted in PBS at a ratio of 1:9 to prepare the working solution, incubated in a 37 °C water bath for 20 min, and washed three times with PBS for 5 min each. The membrane permeabilization solution was prepared and incubated at room temperature for 10 min, followed by washing thrice with PBS for 5 min each. The primary antibody (mouse anti-NeuN antibody, 1:300) was diluted in 5% BSA and applied to the sections, which were then incubated overnight at 4 °C. After rewarming, the sections were washed three times with PBS for 5 min each and then incubated with the secondary antibody (CY3-labeled goat anti-mouse antibody, 1:100) in a 37 °C water bath for 40 min, avoiding light. The sections were washed three times with PBS for 5 min each. TdT enzyme, CF488-dUTP green fluorescence reaction solution, and EB balance buffer from the kit were mixed at a ratio of 1:5:50 to prepare the appropriate incubation solution, which was then incubated in the dark at 37 °C for 1 to 1.5 h or overnight at 4 °C. After washing three times with PBS for 5 min each, the sections were incubated with DAPI nuclear stain at room temperature for 20–30 min in the dark, followed by washing with PBS. Finally, an anti-fluorescence quenching agent was used to seal the slides, and observations and photography were performed under a microscope. The nuclei that are stained green are the positive cells, the cells marked as positive by TUNEL in the view field were counted, and the positive cell rate and the ratio of NeuN + TUNEL to NeuN.

Western blot analysis the protein level of NGF, cleaved caspase-3, Bax, and Bcl-2 in spinal cord tissue

A proper amount of total lumbar medulla protein was removed, and the corresponding protein concentration was determined using a BCA protein concentration assay kit. The sample size for total protein per pore was 40ug. SDS-PAGE electrophoresis (modulation of constant pressure by concentrated glue at 80 V and separation glue at 120 V) was performed until the bromophenol blue reached the lower edge of the rubber plate. First, the prepared PVDF membrane was activated with methanol and the structure of the transfer membrane was placed according to the direction of the positive and negative poles. The membrane that was successfully transferred was sealed by adding sealing fluid at room temperature for approximately 1 h. After removing the blocking solution, 1:1000 diluted NGF, 1:500 diluted cleaved caspase-3, 1:2000 diluted Bax, 1:1000 diluted Bcl-2, and 1:10000 diluted GAPDH primary antibodies were added and incubated overnight at 4 ℃. The primary antibody that was recovered and diluted was washed thrice with TBST every 5 min. The diluted secondary antibody (1:10000 diluted goat anti-rabbit HRP antibody) was then added and incubated at room temperature in the dark for 30 min, and washed four times with TBST every 5 min. The ECL mixture was added to the protein side of the film, exposed to the dark, and finally developed and fixed. After film scanning and archiving processing, Alpha Ease FC software was used to analyze the band optical density of the corresponding protein, which was the protein expression level.

Determination of mRNA level expression in NGF and NSE using RT-PCR

Approximately 80 mg of spinal cord tissue was prepared in 1.4, and total miRNA was extracted using TRI pure reagent. The extracted miRNA was put in 30 μl of DEPC water and then bathed in 56 °C water for 15 min to accelerate RNA dissolution of RNA. The purified miRN completed the first chain cDNA synthesis using the M-MLV reverse transcription kit (TIANGEN, China) and miRNA quantitative fluorescence detection using an miRNA fluorescence detection kit (QIAGEN, Germany) in accordance with the principles of the SYBR Green chimeric fluorescence method. These procedures were performed according to the manufacture’s instructions. The reaction system was 20 μl and the primer design was completed using Primer 5.0. The primer sequences used are listed in Table 1. Table 1 RT-PCR primer sequence.

Gene	Primer sequences (5'–3')	The annealing temperature (℃)	The length of the product (bp)	
NGF	Upstream: GATAAGACCACAGCCACGGAC	59.3	182	
	Downstream: TGAGTCGTGGTGCAGTATGAGTT	59.8		
NSE	Upstream: GAGTGTCGCTTAGAGGTGCAAC	59.2	168	
	Downstream: CTGTAGACCTTGCTTCTCCTGC	58.6		
GAPDH	Upstream: CGCTAACATCAAATGGGGTG	58.8	201	
	Downstream: TTGCTGACAATCTTGAGGGAG	57.7		

The reaction conditions of the quantitative PCR were treated at 95 °C for 5 min, transformed at 95 °C for 10 s, then annealing and extension at 60 °C for 36 s. A total of 40 cycles were performed. All data were processed using the ABI 7300 SDSvl.2 × System software. The corresponding Ct value was obtained using the automatic analysis function of the software. The relative content of the target gene was calculated using 2−△△CT. After a single sample was measured three times, the corresponding average Ct value was obtained using software analysis.

Determination of NSE protein level in the spinal cord tissue of mice using ELISA method

Spare spinal cord tissue 1.4 was isolated, and the lumbar spinal cord portion was frozen in liquid nitrogen for reserve. NSE protein levels in the spinal cord tissues of mice in each group were detected according to the manufacture’s instructions.

Statistical analysis

SPSS27.0 software was used to analyze the related data. The mean comparison of two independent samples was tested using a t-test, while the measurement data were expressed as the mean ± standard deviation (x¯ ± s). The mean of multiple independent samples was analyzed using one-way ANOVA, while intergroup comparison was performed using the LSD method. Bilateral α = 0.05 selected was as the test level. Statistical significance was set at P < 0.05.

Results

Onset of disease and neurological deficit score of mice in each group (Figs. 1, 2, Table 2)

Fig. 1 Schematic diagram of neurological dysfunction score (Note: compared with EAE group, transfection group has lower scores and progressive stage days).

Fig. 2 The scores of neurological function, the time of the progressive stage and incubation period in each group. (Note: Control group and AdV group had no disease; the neurological dysfunction score of Ad-NGF transfection group was lower than the EAE group; compared with EAE group, transfection group showed a shortened progressive stage and prolonged incubation period, P < 0.05).

Table 2 Comparison of the progressive stage, incubation period and neurological dysfunction scores in different groups x¯±s.

Group	Number	Progressive stage (d)	Incubation period (d)	Benson 5 score	
Control group	10	0	0	0	
AdV group	10	0	0	0	
EAE group	10	7.30 ± 0.67	11.50 ± 0.50	2.10 ± 0.99	
Transfection group	10	4.40 ± 1.17*	13.20 ± 0.42*	1.30 ± 0.82*	
Note: Compared with EAE group, *P < 0.05.

The mice in the control and AdV groups had no disease. The EAE and Ad-NGF transfection groups had different degrees of disease (see Table2, Benson 5 score). The early stage of the disease mainly showed a slow response, diet loss, and weight loss; symptoms of neurological dysfunction developed as the course progressed. Most of the symptoms included decreased tail tension in mice, accompanied by ataxia, incontinence, various degrees of quadriplegia, and even death. During the course of the disease, the neurological dysfunction score of the Ad-NGF transfection group was lower than that of the EAE group (see Fig. 1). In the peak period (see Fig. 2), the Ad-NGF transfection group showed a prolonged incubation period, shortened progressive stage, and lower neurological dysfunction score compared to the EAE group (P < 0.05).

Nissl staining of spinal cord neurons in each group of mice (Fig. 3, Table 3)

Fig. 3 Nissl staining of spinal cord neurons in each group (Note: (A) Control group; (B) AdV group; (C) EAE group; (D) Ad-NGF transfection group). Under light microscopy, no abnormalities were observed in the morphology and distribution of the spinal cord neurons in the control and AdV groups. The boundaries between the neuronal cell bodies and axons were clear, and Nissl bodies exhibited distinct staining patterns, with clear boundaries between the deeply stained area and the lightly stained area, presenting a tiger-stripe-like distribution. In the EAE group, Nissl bodies appeared smaller in size, decreased in number, and lighter in color. They were loosely arranged and the contours of the cell bodies and axons were blurred. Compared to the EAE group, in the transfection group, spinal cord neurons were more orderly arranged, with increased numbers and sizes of Nissl bodies, and fewer instances of blurred contours between the cell bodies and axons.

Table 3 Comparing with the marked spinal cord neurons with Nissl staining.

Group	n	The number (per field of view) of spinal cord neurons marked by Nissl	
Control group	10	58.60 ± 3.13	
AdV group	10	59.6 ± 2.27	
EAE group	10	39.20 ± 3.01a	
Transfection group	10	45.63 ± 3.47ab	
F-measure		110.789	
P value		< 0.01	
Note: Compared with the control group, aP < 0.01; compared with the EAE group, bP < 0.05.

Under light microscopy (Fig. 3), no abnormalities were observed in the morphology and distribution of spinal cord neurons in the control and AdV groups. The boundaries between the neuronal cell bodies and axons were clear, and Nissl bodies exhibited distinct staining patterns, with clear boundaries between the deeply stained area and the lightly stained area, presenting a tiger-stripe-like distribution. In the EAE group, Nissl bodies appeared smaller in size, decreased in number, and lighter in color. The y were loosely arranged and the contours of the cell bodies and axons were blurred. Compared to the EAE group, in the transfection group, spinal cord neurons were more orderly arranged, with increased numbers and sizes of Nissl bodies and fewer instances of blurred contours between the cell bodies and axons (see Table 3).

TUNEL staining results, apoptotic rate and the ratio of NeuN + TUNEL to NeuN of spinal cord neurons in each group of mice (Fig. 4, Tables 4, 5)

Fig. 4 TUNEL staining of spinal cord neurons in each group (Note: (A) Control group; (B) AdV group; (C) EAE group; (D) Ad-NGF transfection group). Apoptosis was not evident in the control and AdV groups after TUNEL staining. Compared to the control group, the positive apoptotic cell rate of spinal cord neurons was significantly increased in the EAE and Ad-NGF transfection groups (P < 0.01). However, compared to the EAE group, the apoptotic cell rate of spinal cord neurons was slightly decreased in the Ad-NGF transfection group (P < 0.01).

Table 4 apoptosis rates of TUNEL positive cells of spinal cord neurons in each group %,x¯±s.

Group	n	Apoptosis rate of TUNEL positive cells in spinal cord neurons	
Control group	10	0.44 ± 0.17	
AdV group	10	0.66 ± 0.03	
EAE group	10	40.30 ± 6.64*	
Transfection group	10	15.27 ± 1.39▼	
F-measure		91.721	
P value		< 0.01	
Note: Compared with the control and AdV group, *P < 0.01; compared with EAE group, ▼P < 0.01.

Table 5 Comparing with the ratio of NeuN + TUNEL to NeuN.

Group	n	The ratio of NeuN + TUNEL to NeuN	
Control group	10	3.97 ± 2.90	
AdV group	10	3.83 ± 1.66*	
EAE group	10	48.15 ± 7.83**	
Transfection group	10	33.72 ± 7.00**▼	
F-measure		48.574	
P value		< 0.01	
Note: Compared with the control group, *P > 0.05,**P < 0.01; compared with the AdV group, **P < 0.01; compared with EAE group, ▼P < 0.01.

As shown in Fig. 4 and Table 4, apoptosis was not evident in the control and AdV groups. Compared to the control group, the positive apoptotic cell rate of spinal cord neurons was significantly increased in the EAE and Ad-NGF transfection groups (P < 0.01). However, compared to the EAE group, the apoptotic cell rate of spinal cord neurons was slightly decreased in the Ad-NGF transfection group (P < 0.01). As shown in Table 5, compared with the control group, the ratio of NeuN + TUNEL to NeuN in the spinal cord tissue was not significantly different between the control and the AdV groups. Compared with the control group, the ratio of NeuN + TUNEL to NeuN in the EAE and Ad-NGF transfection groups increased significantly (P < 0.01). Compared to the AdV group, the ratio of NeuN + TUNEL to NeuN in the EAE and Ad-NGF transfection groups increased significantly (P < 0.01). The ratio of NeuN + TUNEL to NeuN in the Ad-NGF transfection group was lower than that in EAE group (P < 0.01).

Expression of NGF protein and its mRNA in spinal cord tissue homogenate of mice in each group (Fig. 5, Table 6)

Fig. 5 The western blot of NGF proteins in different groups mice (Note: (A) control group, (B) AdV group; (C) EAE group, (D) Transfection group). Compared with the control group, the level of NGF mRNA in the spinal cord tissue was not significantly different between the control group and the AdV group; however, the level of NGF protein and its mRNA in the spinal cord tissue of the EAE and Ad-NGF transfection groups was significantly (P < 0.01). Compared with the AdV group, the level of NGF protein and mRNA in the spinal cord tissue of the EAE and Ad-NGF transfection groups decreased significantly (P < 0.01). NGF protein and mRNA levels in the spinal cord tissue of Ad-NGF transfection group were higher than those in the EAE group (P < 0.01).

Table 6 Levels of NGF protein and its mRNA in each group mice.

Group	NGF-mRNA	NGF proteins Relative gray value	
Control group	1.321 ± 0.064	0.825 ± 0.047	
AdV group	1.229 ± 0.078*	0.586 ± 0.066	
EAE group	0.348 ± 0.057**	0.226 ± 0.036**	
Transfection group	0.816 ± 0.070**▼	0.463 ± 0.031**▼	
F-measure	216.824	135.913	
P value	< 0.01	< 0.01	
Note: Compared with the control group, *P > 0.05, **P < 0.01; compared with the AdV group, **P < 0.01; compared with EAE group, ▼P < 0.01.

As shown in Fig. 5 and Table 6, compared with the control group, the level of NGF mRNA in the spinal cord tissue was not significantly different between the control group and the AdV group; however, the level of NGF protein and its mRNA in the spinal cord tissue of the EAE and Ad-NGF transfection groups decreased significantly (P < 0.01). Compared with the AdV group, the level of NGF protein and mRNA in the spinal cord tissue of the EAE and Ad-NGF transfection groups decreased significantly (P < 0.01). NGF protein and mRNA levels in the spinal cord tissue of the Ad-NGF transfection group were higher than those in the EAE group (P < 0.01).

Western blot analysis the protein level of cleaved caspase-3, Bax, and Bcl-2 in spinal cord tissue (Fig. 6)

Fig. 6 The protein level of cleaved caspase-3, Bax, and Bcl-2 in different groups (Note: (A) Control group; (B) AdV group; (C) EAE group; (D) Ad-NGF transfection group). Based on the results shown in Fig. 6, compared to the control group, the expression of the apoptosis-related protein Bcl-2 decreased, while the expression of Bax and cleaved caspase-3 increased in the EAE group (P < 0.01). Conversely, compared to the EAE group, the expression of Bcl-2 increased, whereas the expression of Bax and cleaved caspase-3 decreased in the transfection group (P < 0.01).

Based on the results shown in Fig. 6, compared to the control group, the expression of the apoptosis-related protein Bcl-2 decreased, while the expression of Bax and cleaved caspase-3 increased in the EAE group (P < 0.01). Conversely, compared to the EAE group, the expression of Bcl-2 increased, whereas the expression of Bax and cleaved caspase-3 decreased in the transfection group (P < 0.01).

Determination of NSE protein level using Elisa method, and determination of mRNA level using RT-PCR (Table 7)

Table 7 Levels of NSE protein and its mRNA in each group mice.

Group	NSE-mRNA	The level of NSE proteins	
Control group	0.975 ± 0.053	43.287 ± 2.356	
AdV group	0.955 ± 0.046*	41.255 ± 1.987*	
EAE group	0.263 ± 0.041**	14.265 ± 1.879**	
Transfection group	0.584 ± 0.060**▼	26.075 ± 1.806**▼	
F-measure	225.909	229.328	
P value	< 0.01	< 0.01	
Note: Compared with the control group, *P > 0.05,**P < 0.01; compared with the AdV group, **P < 0.01; compared with EAE group, ▼P < 0.01.

Table 7 shows that compared with the control group, the level of NSE protein and its mRNA in the spinal cord tissue showed no statistically significant difference between the control group and the AdV group. Compared with the control group, the levels of NSE protein and its mRNA in the spinal cord tissue of the EAE and Ad-NGF transfection groups decreased significantly (P < 0.01). Compared with the AdV group, the levels of NSE protein and its mRNA in the spinal cord tissue of the EAE and Ad-NGF transfection groups decreased significantly (P < 0.01). The protein and mRNA levels of NSE in the spinal cord tissue of the Ad-NGF transfection group were higher than those in the EAE group (P < 0.01).

Discussion

MS, a neurodegenerative disease, is associated with structural abnormalities that cause permanent impairment of the physiological function. The main histopathological changes include inflammatory demyelination of the central nervous system, axonal damage, apoptosis of nerve cells9. In cortical lesion studies of patients with MS, Peterson et al.10 found that the number of cortical apoptotic neuronal cells with demyelination changes was significantly higher than that in the myelinated cortex. Furthermore, in vitro experiments have shown that peripheral serum and cerebrospinal fluid in patients with primary progressive MS can induce a significant increase in the apoptosis of cerebellar granulosa neurons. This specific change is related to the disease11,12. The cysteine asparaginase (caspase) family plays an important role in the regulation of apoptosis, as the converging point of many apoptotic pathways13. Caspase3 exists in the form of an inactive single-stranded zymogen in normal cells. When cells are stimulated by various apoptotic signals, caspase3 dissociates from the associated apoptosis inhibitor, cleaves adjacent aspartic acid to form p12 and p20 fragments, and activates them. Immunohistochemistry revealed that FAS in oligodendrocytes of MS was significantly increased. It promotes the release of cytochrome C and initiates apoptosis through the activation of Caspase3 by binding to Fasl14. In the mitochondrial-mediated intrinsic apoptotic pathway, Bcl-2 exerts anti-apoptotic effects, whereas Bax promotes apoptosis. Bcl-2 binds to the mitochondrial outer membrane along with Bax. Upon stimulation by death signals, Bax undergoes a conformational change, activating cleaved caspase-3 and ultimately leading to cell apoptosis15,16. Numerous studies have confirmed that the caspase cascade mediates neuronal apoptosis in neurodegenerative diseases. Inhibition of this enzyme can rescue neurons from undergoing cell death induced by various apoptotic stimuli17.

As a member of the neural growth factor family, NGF regulates the intake of amino acids and small molecules, enhances the synthesis of functional and structural proteins, and plays a key role in nervous system development and neuronal cell regeneration. It is also a protein factor with dual biological functions that plays a key role in downregulating the incidence of myelin and reducing the number of deformed and necrotic nerve fibers18. The exogenous supply of NGF has a remarkable effect on nerve injury. Studies have shown that the increase in the CNS after NGF damage can maintain the concentration of calcium in nerve cells by antagonizing excitatory amino acid toxicity, activating the activity of protein kinase, effectively blocking the occurrence of nerve cell apoptosis caused by CNS damage, and playing a protective role in nerve cells19. As a specific neuroendocrine factor, NSE exists mainly in neurons and neuroendocrine cells in a stable state. As a key enzyme in the glycolysis pathway, it plays an important role in the stability and maintenance of neurons20. NSE concentrations in the peripheral blood are typically low in normal cases. After serious damage to neurons, NSE can quickly enter the cell space from the cell and enter the peripheral blood through the damaged blood–brain barrier to significantly reduce the intracellular NSE and result in neuronal cell damage. Therefore, NSE is therefore an objective indicator of neuronal damage in the central nervous system21. Studies have shown that NSE is involved in several neurodegenerative diseases.

Therefore, in this experiment, we used mice from the AdV group to exclude the influence of adenovirus on the nervous system. In the EAE group mice, Nissl staining revealed smaller Nissl body volumes and looser arrangements of the spinal cord neurons. TUNEL staining showed significant aggregation of apoptotic proteins with markedly increased immunofluorescence intensity, indicating a significant increase in protein expression. This suggests the presence of spinal cord neuron apoptosis in EAE. In addition, the decreased expression of the anti-apoptotic protein Bcl-2 and the increased expression of Bax and cleaved caspase-3 (P < 0.01) in the EAE group further confirmed the occurrence of apoptosis. The absence of NGF and its mRNA expression resulted in significant neuronal damage, as evidenced by the downregulation of neuron-specific enolase (NSE) and its mRNA levels in spinal cord tissue, indicating severe spinal cord damage in the EAE group. In contrast, in the Ad-NGF transfection group, there was an increase in Nissl body volume, and apoptotic proteins were more dispersed within the spinal cord neurons. The immunofluorescence intensity was not significantly pronounced. The expression of the anti-apoptotic protein Bcl-2 increased, whereas the expression of Bax and cleaved caspase-3 decreased (P < 0.01). This indicates that Ad-NGF transfection can inhibit apoptosis of spinal cord neurons. The expression of NGF and its mRNA was also significantly increased in the transfection group, which resulted in the upregulation of the synthesis of NSE and its mRNA in spinal cord tissue and improved damage to spinal cord neurons. This mechanism may be upregulated in EAE mice following Ad-NGF transfection. After reducing the expression of the apoptotic gene protein Caspase3 in spinal cord neuronal cells, the apoptosis of spinal cord neurons can be inhibited and the specific index NSE of neuronal damage can be increased, thus eliminating the damage to spinal cord neurons.

Acknowledgements

Tis study was funded by Research Project of Southwest Medical University (No. 2021ZKQN097)

Author contributions

Y.-X. contributed to the conception and design of the article. Y.-X., M.-L.L. conducted experiments and acquired data. Z.-Y.L., Z.-X.L. contributed to data interpretation, and data analysis. M.-L.L. contributed to drafing of the manuscript. All authors contributed to revising the article for important intellectual content and gave final approval of the version to be published.

Funding

This study was funded by Research Project of Southwest Medical University (No. 2021ZKQN097).

Data availability

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Ethical statement

The study is reported in accordance with ARRIVE guidelines.

Ethics approval

All procedures involving animals were in compliance with the Ethics Committee of Southwest Medical University, and ethical approval was granted by ethics review approval No.20211123-023.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Sospedra M Martin R Immunology of multiple sclerosis Semin. Neurol. 2016 36 02 115 127 27116718
Sospedra, M. & Martin, R. Immunology of multiple sclerosis. Semin. Neurol. 36(02), 115–127 (2016).27116718
2. Zhou X Li X Feng M Analysis of the direct injury effector of oligodendroglia cells or myelin sheath in an experimental allergic encephalomyelitis model induced by the MOG35-55 peptide Mol. Med. Rep. 2015 27 8 124 131
Zhou, X. et al. Analysis of the direct injury effector of oligodendroglia cells or myelin sheath in an experimental allergic encephalomyelitis model induced by the MOG35-55 peptide. Mol. Med. Rep. 27(8), 124–131 (2015).
3. Xi C Hongsong Z Tian K Effect of edaravone combined with nimodipine sequential therapy on neurological function and expression of serum NSE, OPN and BDNF in patients with cerebral hemorrhage China Mod. Doctor 2019 13 2 132 142
Xi, C., Hongsong, Z. & Tian, K. Effect of edaravone combined with nimodipine sequential therapy on neurological function and expression of serum NSE, OPN and BDNF in patients with cerebral hemorrhage. China Mod. Doctor 13(2), 132–142 (2019).
4. Du W Li H Sun J The prognostic value of serum neuron specific enolase (NSE) and S100B level in patients of acute spinal cord injury Med. Sci. Monitor Int. Med. J. Exp. Clin. Res. 2018 24 4510 4515
Du, W. et al. The prognostic value of serum neuron specific enolase (NSE) and S100B level in patients of acute spinal cord injury. Med. Sci. Monitor Int. Med. J. Exp. Clin. Res. 24, 4510–4515 (2018).
5. Greber UF Flatt JW Adenovirus entry: from infection to immunity Ann. Rev. Virol. 2019 6 1 177 197 31283442
Greber, U. F. & Flatt, J. W. Adenovirus entry: from infection to immunity. Ann. Rev. Virol. 6(1), 177–197 (2019).31283442
6. Watanabe M Adenovirus biology, recombinant adenovirus, and adenovirus usage in gene therapy Viruses 2021 13 12 227 231 33540576
Watanabe, M. et al. Adenovirus biology, recombinant adenovirus, and adenovirus usage in gene therapy. Viruses 13(12), 227–231 (2021).33540576
7. Atasheva S Yao J Shayakhmetov DM Innate immunity to adenovirus: Lessons from mice FEBS Lett. 2019 593 24 3461 3483 31769012
Atasheva, S., Yao, J. & Shayakhmetov, D. M. Innate immunity to adenovirus: Lessons from mice. FEBS Lett. 593(24), 3461–3483 (2019).31769012
8. Ghasemi N The evaluation of astaxanthin effects on differentiation of human adipose derived stem cells into oligodendrocyte precursor cells Avicenna J. Med. Biotechnol. 2018 10 2 69 74 29849982
Ghasemi, N. The evaluation of astaxanthin effects on differentiation of human adipose derived stem cells into oligodendrocyte precursor cells. Avicenna J. Med. Biotechnol. 10(2), 69–74 (2018).29849982
9. Poser CM Paty DW Scheinberg L New diagnostic criteria for multiple sclerosis: Guidelines for research protocols Ann. Neurol. 2010 13 3 227 231
Poser, C. M. et al. New diagnostic criteria for multiple sclerosis: Guidelines for research protocols. Ann. Neurol. 13(3), 227–231 (2010).
10. Peterson JW Bö Lars Mörk SJ Transected neurites, apoptotic neurons, and reduced inflammation in cortical multiple sclerosis lesions Ann. Neurol. 2001 50 3 389 400 11558796
Peterson, J. W. et al. Transected neurites, apoptotic neurons, and reduced inflammation in cortical multiple sclerosis lesions. Ann. Neurol. 50(3), 389–400 (2001).11558796
11. Jing Y Xue L Nathanael M Ezetimibe, a NPC1L1 inhibitor, attenuates neuronal apoptosis through AMPK dependent autophagy activation after MCAO in rats Exp. Neurol. 2018 307 12 23 29852178
Jing, Y. et al. Ezetimibe, a NPC1L1 inhibitor, attenuates neuronal apoptosis through AMPK dependent autophagy activation after MCAO in rats. Exp. Neurol. 307, 12–23 (2018).29852178
12. Dai Y Zhang H Zhang J Isoquercetin attenuates oxidative stress and neuronal apoptosis after ischemia/reperfusion injury via Nrf2-mediated inhibition of the NOX4/ROS/NF-κB pathway Chem. Biol. Interact. 2018 284 32 40 29454613
Dai, Y. et al. Isoquercetin attenuates oxidative stress and neuronal apoptosis after ischemia/reperfusion injury via Nrf2-mediated inhibition of the NOX4/ROS/NF-κB pathway. Chem. Biol. Interact. 284, 32–40 (2018).29454613
13. Nottingham S Knapp P Springer J FK506 treatment inhibits caspase-3 activation and promotes oligodendroglial survival following traumatic spinal cord injury Exp. Neurol. 2002 177 1 1 251 12429205
Nottingham, S., Knapp, P. & Springer, J. FK506 treatment inhibits caspase-3 activation and promotes oligodendroglial survival following traumatic spinal cord injury. Exp. Neurol. 177(1), 1–251 (2002).12429205
14. Rui LI Yi-Yang LI Duo-Hui LI NGF promotes myelin debris clearance after peripheral nerve injury by inhibiting endoplasmic reticulum stress Chin. J. Biochem. Mol. Biol. 2018 5 2 89 96
Rui, L. I. et al. NGF promotes myelin debris clearance after peripheral nerve injury by inhibiting endoplasmic reticulum stress. Chin. J. Biochem. Mol. Biol. 5(2), 89–96 (2018).
15. Lin X Focus on ferroptosis, pyroptosis, apoptosis and autophagy of vascular endothelial cells to the strategic targets for the treatment of atherosclerosis Arch. Biochem. Biophys. 2022 715 109098 34856194
Lin, X. et al. Focus on ferroptosis, pyroptosis, apoptosis and autophagy of vascular endothelial cells to the strategic targets for the treatment of atherosclerosis. Arch. Biochem. Biophys. 715, 109098 (2022).34856194
16. Dejas L Regulated cell death in neutrophils: From apoptosis to NETosis and pyroptosis Semin. Immunol. 2023 70 101849 37939552
Dejas, L. et al. Regulated cell death in neutrophils: From apoptosis to NETosis and pyroptosis. Semin. Immunol. 70, 101849 (2023).37939552
17. Yun N Lee YM Kim C Anamorsin, a novel caspase-3 substrate in neurodegeneration J. Biol. Chem. 2014 289 32 22183 22195 24973211
Yun, N. et al. Anamorsin, a novel caspase-3 substrate in neurodegeneration. J. Biol. Chem. 289(32), 22183–22195 (2014).24973211
18. Mir S Ali F Chauhan D Accumulation of reactivity to MBP sensitizes TRAIL mediated oligodendrocyte apoptosis in adult sub cortical white matter in a model for human multiple sclerosis Metab. Brain Dis. 2016 31 2 299 309 26477945
Mir, S. et al. Accumulation of reactivity to MBP sensitizes TRAIL mediated oligodendrocyte apoptosis in adult sub cortical white matter in a model for human multiple sclerosis. Metab. Brain Dis. 31(2), 299–309 (2016).26477945
19. Jian-Ning Y Xing-Shu C Le S Progesterone alleviates neural behavioral deficits and demyelination with reduced degeneration of oligodendroglial cells in cuprizone-induced mice PLoS ONE 2013 8 1 54590 54621
Jian-Ning, Y. et al. Progesterone alleviates neural behavioral deficits and demyelination with reduced degeneration of oligodendroglial cells in cuprizone-induced mice. PLoS ONE 8(1), 54590–54621 (2013).
20. Guzzi G Costa A Pigatto P Serum NSE and multiple sclerosis J. Neurol. Sci. 2015 358 1–2 463 26293418
Guzzi, G., Costa, A. & Pigatto, P. Serum NSE and multiple sclerosis. J. Neurol. Sci. 358(1–2), 463 (2015).26293418
21. Koch MW George S Wall W Serum NSE level and disability progression in multiple sclerosis J. Neurol. Sci. 2015 350 1–2 46 50 25686504
Koch, M. W. et al. Serum NSE level and disability progression in multiple sclerosis. J. Neurol. Sci. 350(1–2), 46–50 (2015).25686504
