
==== Front
STAR Protoc
STAR Protoc
STAR Protocols
2666-1667
Elsevier

S2666-1667(24)00459-3
10.1016/j.xpro.2024.103294
103294
Protocol
Protocol for evaluating the E3 ligase activity of BRCA1-BARD1 and its variants by nucleosomal histone ubiquitylation
Fitzgerald O’Taveon 1
Wu Bo 1
Wang Meiling 1
Maqbool Rouf 1
Li Wenjing liw1@uthscsa.edu
1∗
Zhao Weixing zhaow2@uthscsa.edu
1234∗∗
1 Department of Biochemistry and Structural Biology, University of Texas Health Science Center at San Antonio, San Antonio, TX 78229, USA
2 Greehey Children’s Cancer Research Institute, University of Texas Health Science Center at San Antonio, San Antonio, TX 78229, USA
∗ Corresponding author liw1@uthscsa.edu
∗∗ Corresponding author zhaow2@uthscsa.edu
3 Technical contact

4 Lead contact

06 9 2024
20 9 2024
06 9 2024
5 3 103294© 2024 The Author(s)
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Summary

The tumor suppressor breast cancer 1 (BRCA1) complexed with BRCA1-associated RING domain 1 (BARD1), a RING-type E3 ligase, facilitates the attachment of ubiquitin onto the substrate protein. Here, we present a protocol for evaluating the E3 ligase activity of BRCA1-BARD1 and its variants by nucleosomal histone ubiquitylation. We describe steps for isolating 147 bp Widom 601 DNA and assembling nucleosome core particles (NCPs). We then detail procedures for the in vitro ubiquitylation of nucleosome histone H2A by BRCA1-BARD1 and its variants.

For complete details on the use and execution of this protocol, please refer to Wang et al.1

Graphical abstract

Highlights

• Expression and purification of human histone octamer, ubiquitin, UBA1 (E1), and E2s

• Isolation of the 147 bp Widom 601 DNA and assembly of the nucleosome core particle (NCP)

• Expression and purification of full-length BRCA1-BARD1 (E3) from insect cells

• In vitro ubiquitylation of nucleosome histone H2A by BRCA1-BARD1 and its variants

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

The tumor suppressor breast cancer 1 (BRCA1) complexed with BRCA1-associated RING domain 1 (BARD1), a RING-type E3 ligase, facilitates the attachment of ubiquitin onto the substrate protein. Here, we present a protocol for evaluating the E3 ligase activity of BRCA1-BARD1 and its variants by nucleosomal histone ubiquitylation. We describe steps for isolating 147 bp Widom 601 DNA and assembling nucleosome core particles (NCPs). We then detail procedures for the in vitro ubiquitylation of nucleosome histone H2A by BRCA1-BARD1 and its variants.

Subject areas

Cell culture
Cancer
Protein expression and purification
==== Body
pmcBefore you begin

The only enzymatic activity known for BRCA1-BARD1 is as a ubiquitin E3 ligase, and a great deal of efforts has focused on identifying its substrates and defining the biological significance.2,3,4 Notably, BRCA1-BARD1 interacts and co-operates with a multiplicity of E2 ubiquitin conjugating enzymes (UBE2D3, UBE2W, UBE2E3, UBE2E2, UBE2E1, UBE2N, UBE2V2, etc.) to catalyze either monoubiquitylation or polyubiquitination through Lys6, Lys29, Lys48 or Lys63 of ubiquitin.5 As such, BRCA1-BARD1 likely mediates distinct ubiquitin conjugation events to meet different physiological demands. Consistent with this, our recent work has shown that a compound BRCA1 I26A + L63A + K65A (E3-ligase dead, in short as E3d) point mutation, is proficient in complex formation with BARD1 but can completely ablate E3 ligase activity of full length BRCA1-BARD1 in all our established in vitro ubiquitylation reactions.1 In concordance, cells expressing BRCA1E3d are defective in homology-directed DNA repair (HDR) and hypersensitive to various DNA damage agents.1 Accordingly, it would be compelling for the research community to employ this authentic E3-dead mutant alongside the wild-type BRCA1-BARD1 in setting up in vitro ubiquitylation reactions. Such experiments could elucidate the ubiquitylation potential of various substrates and evaluate the E3 ligase activity of BRCA1/BARD1 variants, particularly those pathogenic mutations.

We established reliable methods for the expression and purification of the human histone octamer and the BRCA1-BARD1 complex from Escherichia coli and insect cells, respectively. Also, we produced and purified E1 (UBA1), E2s (e.g., UBE2D3), and ubiquitin (Ub) from Escherichia coli using a combination of Nickel affinity, ion exchange, and size exclusion chromatography (SEC).1 With these proteins, we successfully reconstituted the Nucleosome Core Particle (NCP) in vitro and evaluated the E3 ligase activity of multiple BRCA1-BARD1 variants using NCP as a substrate. Our experiments showed histones H2A and H3, but not H2B and H4, are ubiquitylated by BRCA1-BARD1 efficiently.1 More importantly and contrary to a previous assumption over decades that the BRCA1I26A mutant is E3 ligase dead, our findings reveal that it retains robust E3 ligase activity in our in vitro ubiquitylation assays.1 This retention of function provides crucial insight into why cells harboring this mutation maintain a significant capability for HDR and why the I26A form of BRCA1 suppresses tumor formation in mice.

Primer design

Timing: 2 h

1. Primers to construct human histone octamer expressing plasmid (pET29a-human histone 4-in-One).a. H3.2 Forward: 5′-GCTTATCTGGTCGGTCTCTTTGAGGACACCAACCTGTGC-3′.

b. H3.2 Reverse: 5′-GTCCTCAAAGAGACCGACCAGATAAGCCTCGCTGGC-3′.

c. XhoI Forward: 5′-GGTAGCAGCGGCCTCGAGCTGGTGCCGCGCGGCAGC C-3′.

d. XhoI Reverse: 5′-GCGCGGCACCAGCTCGAGGCCGCTGCTACCACCGAAA-3′.

e. TEV-TwinStrep Forward: 5′-GGTAGCAGCGGCctcgagGAGAATCTCTACTTCCAAAGTGCA TGGA.

GCCACCCACAGTTC-3′

f. TEV-TwinStrep Reverse: 5′-GTGGTGGTGGTGGTGCTCGAGCCCGGGCTTCTCAAATTGTG-3′

2. Primers to construct GST-Ub expressing plasmid (pGEX6p-1-Ub).a. 3C-Ub Forward: 5′-CTGGAAGTTCTGTTCCAGGGGATGGCTAGCATGACTGGTGGACAG-3′.

b. 3C-Ub Reverse: 5′-ACCCGGGAATTCCGGGGATCCTCAACCACCTCTTAGTCTTAAGAC-3′.

c. pGEX6p-1 Forward: 5′-GGATCCCCGGAATTCCCG-3′.

d. pGEX6p-1 Reverse: 5′-CCCCTGGAACAGAACTTCCAG-3′.

3. Sequencing primers to verify the DNA sequences of histone and Ub.a. H3 sequence: 5′-GATGTTGTCACGCAGAAC-3′.

b. H4 sequence: 5′-AGGCCAGCGAGGCTTATC-3′.

c. GST sequence: 5′-CCTTTGCAGGGCTGGCAAG-3′.

Construction of expression plasmid

Timing: 1–2 weeks

4. Construction of human histone 4 in-one expression vector (pET29a-human histone 4-in-One): replace Xenopus laevis histones H2A and H2B in pET29a-YS14 with human histone H2A and H2B, mutate A103 to G in histone H3, and add a TEV-TwinStrep tag on C-terminal histone.a. The coding sequence for human histones H2A and H2B with a N-terminal 6×His-TEV-VSV-G on H2A is synthesized into the pET29a-YS146 (Addgene plasmid#66890; for polycistronic co-expression of Xenopus laevis histones (Stag-His6-H2A, H2B, H3 and H4-Thrombin site-His6)), which is first linearized with restriction enzymes (NcoI and SalI) according to manufacturer instructions to remove the DNA region for Xenopus laevis histones H2A and H2B.Note: Step 4a was completed by Gene Universal Inc. (Newark, DE). The coding sequence for human histones H2A with the original Stag and a new 6×His-TEV-VSV-G tag: ATGAAAGAAACCGCTGCTGCTAAAT

TCGAACGCCAGCACATGGACAGCCCAGATCTGCACCACCACCACCACCACGGTACCCTGGTGCCACGCGGTTCCATGGgtGATTACGATATCCCAACGACCGAAAACCTGTATTTTCAGGGCGCCATGGGATACACAGACATTGAGATGAACCGTCTTGGAAAGTCTGGTCGTGGTAAACAGGGTGGTAAAGCGCGTGCGAAAGCGAAATCTCGTTCTTCTCGTGCGGGTCTGCAGTTCCCGGTTGGTCGTGTTCACCGTCTGCTGCGTAAAGGTAACTACGCGGAACGTGTTGGTGCGGGTGCGCCGGTTTACATGGCGGCGGTTCTGGAATACCTGACCGCGGAAATCCTGGAACTGGCGGGTAACGCGGCGCGTGACAACAAAAAAACCCGTATCATCCCGCGTCACCTGCAGCTGGCGATCCGTAACGACGAAGAACTGAACAAACTGCTGGGTAAAGTTACCATCGCGCAGGGTGGTGTTCTGCCGAACATCCAGGCGGTTCTGCTGCCGAAAAAAACCGAATCTCACCACAAAGCGAAAGGTAAATAA. The coding sequence for human H2B: ATGCCGGAACCAGCGAAGTCCGCTCCCGCGCCCAAGAAGGGCTCGAAGAAAGCCGTGACTAAGGCGCAGAAGAAGGACGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTACTCCGTATACGTGTACAAGGTGCTGAAGCAGGTCCACCCCGACACCGGCATCTCCTCTAAGGCCATGGGAATCATGAACTCCTTCGTCAACGACATCTTCGAACGCATCGCGGGTGAGGCTTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACCTCCAGGGAGATCCAGACGGCCGTGCGCCTGCTGCTGCCCGGGGAGTTGGCCAAGCACGCCGTGTCCGAGGGCACCAAGGCCGTCACCAAGTACACCAGCGCTAAGTAA.

b. Perform QuikChange Site-Directed Mutagenesis PCR with H3.2 Forward and Reverse primers (#1a, b) to mutate residue A103 to G, which converts H3 protein sequence from Xenopus H3 to Human H3.2.

c. Transform the PCR product into DH5α competent cells, then plate cells onto LB plate containing kanamycin (50 μg/mL). After approximately 16 h, pick a single bacterial colony and culture it in 2.5 mL of LB medium containing kanamycin (50 μg/mL).

d. After 16–18 h’s growth, collect cells and extract the plasmid DNA using a GeneJET Plasmid Miniprep Kit according to manufacturer instructions. Sequence the plasmids using the H3 sequence primer (#3a) to get the clones with correct H3.2 (pET29a-Stag-6xHis6-TEV-VSV-G-H2A, H2B, H3, H4-thrombin site-His6).

e. Perform QuikChange Site-Directed Mutagenesis PCR with XhoI Forward and Reverse primers (#1c, d) to introduce an XhoI restriction site right after the DNA for H4 and before the thrombin recognition sequence.

f. Transform the PCR product into DH5α competent cells and culture single bacterial colonies as Step 4c.

g. After 16–18 h’s growth, collect cells and extract plasmid using a GeneJET Plasmid Miniprep Kit. Sequence the plasmids using H4 sequence primer (#3b).

h. Digest correct plasmid with XhoI restriction enzyme to remove the thrombin recognition sequence.

i. Perform PCR with TEV-TwinStrep Forward and Reverse primers (#1e, f) to obtain the DNA fragment of TEV-TwinStrep from pFastBac-Twin-StrepTagII-BARD1 plasmid (Addgene#137166).

j. Ligate the PCR fragment from Step (i) and the XhoI-digested 4 in-one vectors from Step 4h together to generate pET29a-Stag-His6-VSV-G-H2A, H2B, H3, H4-TEV-His6-TwinStrepTag using ClonExpress II One Step Cloning Kit according to manufacturer instructions.

k. Transform the ClonExpress II reaction products into DH5α competent cells and culture single bacterial colonies as Step 4c.

l. After 16–18 h’s growth, collect cells and extract plasmid using a GeneJET Plasmid Miniprep Kit. Sequence the plasmids using H4 sequence primer (#3b) to get the final human histone 4 in-one expression vector pET29a-Stag-His6-TEV-VSV-G-H2A, H2B, H3, H4-TEV-His6-TwinStrepTag (in short, we refer it as pET29a-human histone 4 in one and it is deposited as Addgene#223237).Note: The whole plasmid can be sequenced by nanopore sequencing services like Plasmidsaurus.

5. pGEX-6P1-Ub cloning: insert the Ub gene into pGEX-6P-1 empty vector to express GST tagged Ubiquitin and GST tag can be cleaved by PreScission Protease.a. Perform PCR with 3C-Ub forward and reverse primers (#2a, b) using the pET15-Ub plasmid (Addgene#12647) to obtain Ub insertion fragment. Perform PCR with pGEX6p-1 Forward and Reverse primers (#2c, d) using the pGEX-6P-1 plasmid (empty vector from Cytiva or Addgene (e.g., #119755) to obtain pGEX-6P-1 vector fragment. Ligate the two fragments to generate pGEX-6P1-Ub using ClonExpress II One Step Cloning Kit.

b. Transform the ClonExpress II reaction products into DH5α competent cells then plate cells onto LB plate containing ampicillin (100 μg/mL). After approximately 16 h, pick a single bacterial colony and culture in 2.5 mL of LB medium containing ampicillin (100 μg/mL).

c. After 16–18 h’s growth, collect cells and extract plasmid using a GeneJET Plasmid Miniprep Kit. Sequence the plasmids using GST sequence primer (#3c) for the cloning region or using nanopore sequencing service for the whole plasmid. The pGEX-6P1-Ub is deposited in Addgene (#223236).

6. Preparation of other expression vectors utilized.a. The plasmid containing 16x Widom 601 nucleosome sequence (pST55-16xNCP601a; gift from Song Tan) is used to isolate 147 bp DNA of Widom 601 nucleosome sequence.7

b. The plasmids of pFastbac-Flag-BRCA1 (modified based on the plasmid from Jeffrey Parvin; deposited in Addgene (#223228)) and pFastBac-TwinStrepTag-BARD1 (Addgene#137166) are used for Flag-BRCA1 and Twin-StrepTag-BARD1 expression in insect cells.8,9

c. The expression plasmids for human E1 (pET3a-hUBA1 (Addgene#63571)), E2s (pET28a-UBE2D3 (Addgene#12643), pET15-UBE2W, pET24a-UBE2E3, pET24a-UBE2E2, pET24a-UBE2E1, pET24a-UBE2N, pET24a-UBE2V2), and Ubiquitin (pET15-Ub (Addgene#12647)) were described before.5,10,11,12 Plasmids of pDEST17-UBE2B (Addgene#15781) was from Addgene.13

Note: pET15-UbE2W (Addgene#15809); pDEST17-UbE2E3 (Addgene#15789); pDEST17-UbE2E2 (Addgene#15788); pDEST17-UbE2E1 (Addgene#15787); pET21(+)-His6-Ubc13/UBE2N (Addgene#212715); MBP-His6-TEV-MMS2/UBE2V2 (Addgene#25465) are available from Addgene.13

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER	
Antibodies	
	
Rabbit anti-VSV-G	Sigma-Aldrich	Cat#V4888	
Goat anti-rabbit IgG HRP	Sigma-Aldrich	Cat#A6154	
	
Bacterial strains	
	
BL21 (DE3) competent cells	Thermo Fisher Scientific	Cat#C600003	
BL21 (DE3) pLysS competent cells	Thermo Fisher Scientific	Cat#C606010	
DH10EMBacY competent cells	Geneva Biotech	N/A	
	
Chemicals, peptides, and recombinant proteins	
	
2-Mercaptoethanol	Fisher Scientific	Cat#BP176-100	
Acrylamide (electrophoresis grade)	Acros Organics	Cat#76-06-1	
Agar (granulated)	Fisher Scientific	Cat#BP9744-5	
Ampicillin sodium salt	Fisher Scientific	Cat#BP1760	
Aprotinin	GoldBio	Cat#9087-70-1	
ATP	GoldBio	Cat#519633-61-2	
Benzamidine HCl	Fisher Scientific	Cat#50-488-530	
Bis-acrylamide	Fisher Scientific	Cat#BP171	
Bovine serum albumin (fraction V)	Fisher Scientific	Cat#BP1605-100	
Bromophenol blue	Fisher Scientific	Cat#BP115	
Calcium chloride anhydrous	Acros Organics	Cat#10043-52-4	
Chloramphenicol	RPI	Cat#C61000	
Chymostatin	GoldBio	Cat#C-315-50	
Coomassie brilliant blue R250	Sigma-Aldrich	Cat#1125530025	
Creatine phosphate	Sigma-Aldrich	Cat#10621722001	
Creatine phosphokinase	Roche	Cat#10127566001	
Disodium phosphate	J.T. Baker	Cat#3828-01	
Dry milk powder	RPI	Cat#M17200	
DTT	GoldBio	Cat#27565-41-9	
EDTA (ethylenediaminetetraacetic acid disodium salt dihydrate)	Sigma-Aldrich	Cat#E5134-500G	
Glacial acetic acid	Supelco	Cat#AX0073	
Glycerol	Fisher Scientific	Cat#BP229-4	
Glycine	Fisher Scientific	Cat#BP381-5	
HyClone SFX insect medium	Cytiva	Cat#SH30278.02	
HyClone SFM4 insect medium	Cytiva	Cat#SH30913.02	
Igepal-CA630	Thermo Fisher Scientific	Cat#J61055-AP	
Imidazole	Acros Organics	Cat#288-32-4	
IPTG	GoldBio	Cat#367-93-1	
L-glutathione reduced	GoldBio	Cat#70-18-8	
Leupeptin hemisulfate	GoldBio	Cat#103476-89-7	
Magnesium chloride anhydrous	Alfa Aesar	Cat#7786-30-3	
Methanol	Fisher Scientific	Cat#A412-4	
Monopotassium phosphate	RPI	Cat#7778-77-0	
Recombinant S. marcescens NucA nuclease protein, CF	R&D Systems	Cat#10038-NA-020	
Orange G, electrophoresis grade	Alfa Aesar	Cat#J6274314	
Pepstatin A	GoldBio	Cat#26305-03-3	
Phenylmethylsulfonyl fluoride (PMSF)	GoldBio	Cat#329-98-6	
Potassium acetate	RPI	Cat#127-08-2	
Potassium chloride	RPI	Cat#7447-40-7	
Sodium azide	TCI America	Cat#26628-22-8	
Sodium chloride	Fisher Scientific	Cat#S271	
Sodium dodecyl sulfate	Fisher Scientific	Cat#BP166-500	
Sodium hydroxide	Fisher Scientific	Cat#BP359-500	
Tris base	Fisher Scientific	Cat#BP152-10	
Tryptone	RPI	Cat#91079-40-2	
Tween 20	Fisher Scientific	Cat#BP337	
Yeast extract	RPI	Cat#8013-01-2	
	
Critical commercial assays	
	
Anti-FLAG M2 affinity gel	Sigma-Aldrich	Cat#A2220-1ML	
Clarity Max Western ECL substrate	Bio-Rad	Cat#1705062	
EcoRV-HF	NEB	Cat#R3195S	
GeneJET Plasmid Miniprep Kit	Thermo Fisher Scientific	Cat#K0502	
ClonExpress II One Step Cloning Kit	Cellagen Technology	Cat# C11201	
HiTrap SP HP	Cytiva	Cat#17115101	
Mono Q 5/50 GL	GE Healthcare	Cat#17-5166-01	
NcoI-HF	NEB	Cat#R3193S	
Ni Sepharose 6 Fast Flow resin	Cytiva	Cat#17-5318-03	
PreScission protease	Cytiva/homemade	Cat#27084301	
SalI-HF	NEB	Cat#R3138S	
Superdex 200 Increase 10/300 GL	Cytiva	Cat#28990944	
StrepTrap XT	Cytiva	Cat#29401320	
TEV protease	NEB/homemade	Cat#P8112S	
RNase A	Invitrogen	Cat#12091021	
XhoI	NEB	Cat#R0146S	
	
Experimental models: Cell lines	
	
High Five Cells in Express Five medium	Thermo Fisher Scientific	Cat#B85502	
Sf9 cells in Sf-900 II SFM	Thermo Fisher Scientific	Cat#11496015	
	
Other	
	
Accumet XL200 benchtop pH/conductivity meter	Fisher Scientific	Cat#13-636-XL200	
Amicon Ultra-4 3K centrifugal filter	Millipore	Cat#UFC800324	
Amicon Ultra-4 30k centrifugal filter	Millipore	Cat#UFC803024	
AKTA PURE 25L	Cytiva	Cat#29018224	
Centrifuge 5804R	Eppendorf	Cat#022623508	
Centrifuge tube (50 mL)	Corning	Cat#430828	
Econo-column chromatography column	Bio-Rad	Cat#7371022	
Fraction Collector F9-C	Cytiva	Cat#29027743	
Heratherm refrigerated incubator	Thermo Fisher Scientific	Cat#51031563	
Isotemp water bath GPD 05	Fisher Scientific	Cat#FSGPD05	
Digital dry bath	Corning	Cat#6885DB	
Microcentrifuge 5425 R	Eppendorf	Cat#5405000646	
Mini Trans-Blot electrophoretic transfer cell	Bio-Rad	Cat# 1703930	
NanoDrop OneC	Thermo Fisher Scientific	Cat#ND-ONE-W	
New Brunswick Excella incubator shaker E25	VWR	Cat#89171-828	
PES Rapid-Flow sterile filter unit	Thermo Fisher Scientific	Cat#569-0020	
PowerPac Basic power supply	Bio-Rad	Cat#1645050	
Precision BalanceME4002E	Mettler Toledo	Cat#30046461	
Q700 WATT sonicator	Qsonica	Cat#Q700-110	
Innova S44I REF 2 ORBIT	Eppendorf	Cat#S44I230005	
Ultrospec 2100 Pro UV-VIS spectrophotometer	Amersham Pharm.	Cat#23064	
Amersham Protran western blotting membranes, nitrocellulose	Cytiva	Cat#10600002	
ChemiDoc MP imaging system	Bio-Rad	Cat#12003154	

Materials and equipment

LB medium liquid or plate

Reagent	Final concentration	Amount	
Tryptone	1%	10 g	
Yeast extract	0.5%	5 g	
NaCl	1%	10 g	
Agar powder (for plate)	1.5%	15 g	
ddH2O	N/A	Add to 1 L	
Autoclaved medium can be stored at room temperature (20°C–25°C) for up to 1 month. Plates can be stored at 4°C for up to 3 months.

2XTY Medium

Reagent	Final concentration	Amount	
Tryptone	1.6%	16 g	
Yeast extract	1.0%	10 g	
NaCl	0.5%	5 g	
ddH2O	N/A	Add to 1 L	
Adjust pH of medium to 7.0 with 5N NaOH. Autoclaved medium can be stored at room temperature (20°C–25°C) for up to 1 month.

2× T buffer

Reagent	Final concentration	Amount	
Tris-base	50 mM	6.057 g	
Glycerol	20%	200 mL	
EDTA (0.5 M)	1 mM	2 mL	
HCl	Adjust to pH 7.5	N/A	
ddH2O	N/A	Add to 1 L	
Store at 4°C for up to 6 months.

T0 buffer

Reagent	Final concentration	Amount	
2× T buffer	1×	500 mL	
DTT (1 M)	1 mM	1 mL	
Igepal-CA630 (10%)	0.01%	1 mL	
ddH2O	N/A	Add to 1 L	
Store at 4°C for up to 1 month.

T1000 buffer

Reagent	Final concentration	Amount	
2× T buffer	1×	500 mL	
KCl (3 M)	1 M	333.3 mL	
DTT (1 M)	1 mM	1 mL	
Igepal-CA630 (10%)	0.01%	1 mL	
ddH2O	N/A	Add to 1 L	
Prepare buffers with different concentrations of KCl by mixing T0 and T1000. Store at 4°C for up to 1 month.

Coomassie blue staining buffer

Reagent	Final concentration	Amount	
Coomassie brilliant blue	0.2%	2 g	
Methanol	25%	250 mL	
Acetic acid	12.5%	125 mL	
ddH2O	N/A	Add to 1 L	
Store at room temperature (20°C–25°C) for up to 1 year.

50X TAE

Reagent	Final concentration	Amount	
Tris-base	2 M	242 g	
Glacial acetic acid	5.7%	57.1 mL	
Disodium EDTA dihydrate	50 mM	18.61 g	
ddH2O	N/A	Add to 1 L	
Store at room temperature (20°C–25°C) for up to 6 months.

1X TAE

Reagent	Final concentration	Amount	
50X TAE	2%	40 mL	
ddH2O	N/A	Add to 2 L	
Store at room temperature (20°C–25°C) for up to 1 week.

6X Orange DNA loading buffer

Reagent	Final concentration	Amount	
1 M Tris-HCl, pH 7.5	20 mM	2.0 mL	
Glycerol	60%	60 mL	
Orange G dye	0.15% (w/v)	0.15 g	
ddH2O	N/A	Add to 100 mL	
Store at 4°C for up to 1 year.

Destaining buffer

Reagent	Final concentration	Amount	
Methanol	25%	250 mL	
Acetic acid	12.5%	125 mL	
ddH2O	N/A	Add to 1 L	
Store at room temperature (20°C–25°C) for up to 1 year.

10X SDS running buffer

Reagent	Final concentration	Amount	
Tris-base	250 mM	60.0 g	
Glycine	1.92 M	288.2 g	
Sodium Dodecyl Sulfate	1% (w/v)	20.0 g	
ddH2O	N/A	Add to 2 L	
Store at room temperature (20°C–25°C) for up to 6 months.

1X SDS running buffer

Reagent	Final concentration	Amount	
10X SDS running buffer	10% (v/v)	100 mL	
ddH2O	N/A	Add to 1 L	
Store at room temperature (20°C–25°C) for up to 1 week.

4X SDS-PAGE loading buffer

Reagent	Final concentration	Amount	
1 M Tris-HCl pH 6.5	0.2 M	1.5 mL	
1 M DTT	0.4 M	3 mL	
SDS	8.0% (w/v)	0.6 g	
Bromophenol Blue	6 mM	30 mg	
Glycerol	4.3 M	2.4 mL	
ddH2O	N/A	Add to 7.5 mL	
Store at −20°C for up to 1 year.

10X Transfer buffer

Reagent	Final concentration	Amount	
Tris-base	250 mM	30.0 g	
Glycine	1.92 M	144.1 g	
ddH2O	N/A	Add to 1 L	
Store at room temperature (20°C–25°C) for up to 6 months.

1X Transfer buffer

Reagent	Final concentration	Amount	
10X Transfer buffer	10% (v/v)	100 mL	
Methanol	20% (v/v)	200 mL	
ddH2O	N/A	Add to 1 L	
Store at room temperature (20°C–25°C) for up to 2 weeks.

10X PBS

Reagent	Final concentration	Amount	
Sodium Chloride	1.4 M	81.8 g	
Potassium Chloride	270 mM	20.1 g	
Disodium phosphate	100 mM	14.2 g	
Monopotassium phosphate	18 mM	2.45 g	
ddH2O	N/A	Add to 1 L	
Store at room temperature (20°C–25°C) for up to 6 months.

1X PBST buffer

Reagent	Final concentration	Amount	
10X PBS	1X PBS	100 mL	
Tween 20	0.1%	1.0 mL	
ddH2O	N/A	Add to 1 L	
Store at room temperature (20°C–25°C) for up to 1 month.

Blocking buffer

Reagent	Final concentration	Amount	
Dry milk powder	5% (w/v)	5.0 g	
1X PBST buffer	N/A	Add to 100 mL	
Store at 4°C for up to 5 days.

Step-by-step method details

Amplification, extraction, and isolation of the 147 bp widom 601 DNA

Timing: 5 days

Assembly of the nucleosome core particle (NCP) requires a high concentration prep of purified 147 bp Widom 601 DNA. The modified procedure7 produces and purifies the 147 bp 601 DNA through precipitation mediated by polyethylene glycol (PEG) and sodium chloride, followed by Mono-Q ion-exchange chromatography. This ensures that the histone octamer can stably assemble on the Widom 601 DNA following the dilution assembly protocol.1. Preparing stocks.a. Buffers.i. Solution I: 50 mM Tris-HCl, pH 8.0, 10 mM EDTA, pH 8.0, 50 mM Glucose, 200 μg/mL RNase A.

ii. Solution II: 0.2 M NaOH (freshly diluted from 5–10 M stock) + 1% SDS.

iii. Solution III: 3M Potassium Acetate (5 M KOAc (60 mL) + Glacial acetic acid (11.5 mL) + H2O (28.5 mL)). Store at 4°C.

iv. 1X TAE buffer (diluted from 50X TAE buffer): 40 mM Tris-HCl 8.5, 0.114% Glacial acetic acid, 1 mM EDTA.

2. Transform the Widom 601 plasmid into competent cells.a. Add 100 ng of the pST55–16xNCP601a plasmid containing the 16x Widom 601 nucleosome sequence into 20 μL DH5a competent cells and incubate on ice for 30 min.

b. Heat-shock the competent cells at 42°C for 1 min in a water-bath and immediately transfer onto ice for 3 min.

c. Culture cells in 500 μL of LB medium without antibiotics at 37°C for 1 h with shaking (200 rpm).

d. Spread 100 μL of the cells on an LB plate containing ampicillin (100 μg/mL) and incubate for 16–18 h at 37°C in an incubator.

3. Culture an isolated colony in LB medium.a. Pick a single bacterial colony from the plate using a 200 μL pipette tip.

b. Inoculate 10 mL of LB medium containing ampicillin.

c. Incubate culture at 37°C shaking for 16–18 h.

d. Transfer 10 mL of culture to 1.0 L of fresh LB medium containing ampicillin and grow until OD600 is approximately 1.5–2.0.

e. Harvest the bacteria cells via centrifugation at 4,500 x g for 10 min at 4°C in 1 L centrifuge bottles. After discarding the supernatant, transfer the cell pellet into a 50 mL conical tube, and store at −80°C.

Pause point: Can freeze cell pellet at −80°C for up to 3 months.

4. Isolate the Widom 601 plasmid. Troubleshooting 1.a. Resuspend cell pellet in 45 mL ice-cold Solution I buffer by vortexing or pipetting up and down.

b. Split the above suspension into 3 50 mL conical tubes (15 mL/each) and complete the proceeding steps in each, respectively.

c. Add 15 mL room temperature (20°C–25°C) Solution II and gently mix by inverting 5–10 times. Do not allow reaction to proceed longer than ∼5 min.

d. Add 15 mL cold Solution III and invert several times and incubate on ice for 30 min.

e. Centrifuge at 8,000 xg for 45 min at 4°C in a 50 mL conical tube (5804R Centrifuge).

f. Transfer supernatants to fresh 50 mL conical tubes.

g. Add 0.7 V room-temperature isopropanol to solution and invert several times.

h. Centrifuge at 8,000 xg for 45 min (5804R Centrifuge).

i. Carefully decant supernatant and wash pellet with 10 mL of ice-cold 70% ethanol. Repeat wash with 10 mL of ice-cold 70% ethanol.

j. Airdry pellet for approximately 10 min and dissolve in 1 mL of sterile ddH2O.

Note: Prolonged airdrying can lead to increased difficulty in dissolving DNA.

5. Digest the Widom 601 plasmid and purify the 147 bp fragment.a. Measure concentration of the Widom 601 plasmid using NanoDrop OneC and add EcoRV-HF restriction enzyme at a ratio of 1 unit per ug of DNA in rCutsmart buffer for a 12–16 h’s digestion at 37°C.

b. Perform agarose gel electrophoresis using 1% agarose gel to verify complete digestion of the plasmid (Figure 1A).Figure 1 Isolation of 147 bp Widom 601 DNA

(A) Complete digestion of the Widom 601 plasmid by EcoRV-HF was confirmed by agarose gel electrophoresis (1 μg).

(B) The precipitation of 147 bp fragment (200 ng) was analyzed by agarose gel electrophoresis.

(C) The elution fractions containing 147 bp fragment from Mono-Q Anion affinity chromatography were analyzed with agarose gel electrophoresis.

c. Add 0.3375 volumes of 40% PEG-6000 and 0.15 volumes of 5 M NaCl directly to digested DNA sample and mix them well. Troubleshooting 2.

d. Incubate sample at 4°C for approximately 1 h to precipitate the 3 kb vector backbone, which is larger than 147 bp Widom 601 DNA fragment.

e. Centrifuge at 5,500 xg for 40 min at 4°C to get the supernatant, which contains isolated 147 bp DNA.

f. Add 2.5 volumes of 100% ethanol to supernatant and incubate at −20°C for 12–16 h.

g. Centrifuge at 16,000 × g for 30 min at 4°C to pellet the DNA.

h. Carefully remove the supernatant without disturbing the cDNA pellet.

i. Add 150 μL of 70% ethanol. Centrifuge the sample at 4°C for 2 min at 16,000 x g. Carefully remove the supernatant. Repeat this step once more to remove as much of the remaining ethanol as possible.

j. Airdry pellet for approximately 5–10 min at room temperature (20°C–25°C) and dissolve in 1 mL of 10 mM Tris-HCl, pH 8.0.

k. Perform agarose gel electrophoresis using 1% agarose gel to verify isolation of only 147 bp Widom 601 DNA fragment (Figure 1B).Note: If the precipitation is efficient (Step 5c & d), the vector backbone in isolated prep of the 147 bp Widom 601 DNA fragment should be no more than ∼10% before proceeding to the next step of Mono-Q anion exchange chromatography.

l. Perform Mono Q anion exchange chromatography.i. Pre-wash Mono-Q column (5 mL) with 50 mL of 10 mM Tris, pH 8.0.

ii. Load the 1 mL solution containing the 147 bp Widom 601 DNA onto Mono-Q column.

iii. Elute the 147 bp DNA from Mono-Q column using a 15 mL gradient of 0–1000 mM KCl in 10 mM Tris, pH 8.0 buffer with 0.5 mL for each fraction.Note: For increased separation of the 147 bp fragments from the vector backbone, increase the elution buffer volume used in gradient fractionation.

iv. Take 5 μL of each sample for agarose gel electrophoresis in 1% agarose gel and collect fractions containing only the 147 bp fragment (Figure 1C).Note: Verify that the A260/A280 ratio is 1.7–2.0 to assure the purity of DNA before proceeding to the next step.

m. Concentrate the 147 bp Widom 601 DNA fragment with 3K MWCO concentrator.i. Pre-wash 3K MWCO concentrator (Amicon) with 10 mM Tris, pH 8.0 buffer twice.

ii. Pool the fractions containing only 147 bp fragment from the above Mono-Q anion exchange purification and add them to 3K MWCO concentrator.

iii. Centrifuge at 3,000 xg for 10 min at 4°C. Repeat this step until the eluate is approximately 1 mg/mL based on NanoDrop OneC measurement.

n. Aliquot 20 μL each into 0.2 mL tubes and store at −20°C.

Expression and purification of human histone octamer and assembly of nucleosome core particle (NCP)

Timing: 1–2 weeks

To properly assemble the NCP in vitro, we established a modified procedure to express and purify human histone octamer (H2A, H2B, H3, and H4) using a single polycistronic co-expression vector, pET29a-human histone 4 in-one, in E. coli cells. This allows us to produce soluble histone octamer in a simple purification process without the traditional renature process of each histone protein.14,156. Preparing stocks.a. Protease inhibitors.i. Aprotinin: 0.5 mg/mL = 77 μM (500X).

ii. Chymostatin: 1 mg/mL = 1.65 mM (1000X).

iii. Leupeptin: 0.5 mg/mL = 1.05 mM (500X).

iv. Pepstatin A: 1 mg/mL = 1.46 mM (1000X).

v. PMSF: 200 mM (200X).

b. Buffers.i. Cell lysis buffer: 20 mM Tris-HCl, pH 8.0, 2 M KCl, 10% Glycerol, 0.5 mM DTT.

ii. Ni-NTA buffer: 50 mM Tris-HCl pH 8.0, 2 M KCl, 10% Glycerol, 1 mM DTT.

iii. Wash buffer.

1: 50 mM Tris-HCl pH 8.0, 2 M KCl, 10% Glycerol, 1 mM DTT, 20 mM Imidazole.

2: 50 mM Tris-HCl pH 8.0, 2 M KCl, 10% Glycerol, 1 mM DTT.

iv. Elution buffer: 50 mM Tris-HCl pH 8.0, 2 M KCl ,10% Glycerol, 1 mM DTT, 30–500 mM Imidazole.

v. Size exclusion chromatography (SEC) buffer: 50 mM Tris-HCl pH 8.0, 2 M KCl, 10% glycerol, 1 mM DTT.

vi. 1X SDS running buffer (diluted from 10X SDS running buffer): 25 mM Tris-base, 192 mM Glycine and 0.1% (w/v) Sodium Dodecyl Sulfate.

vii. 1X TAE buffer (diluted from 50X TAE buffer): 40 mM Tris-HCl 8.5, 0.14% Glacial acetic acid, 1 mM EDTA.

7. Transform plasmid into competent cells.a. The procedures are performed as described in Step 2 except: the plasmid pET29a-human histone 4-in-one, kanamycin (50 μg/mL) and chloramphenicol (25 μg/mL) antibiotic LB plates, and BL21(DE3) pLysS bacterial cells are used.

8. Culture an isolated colony in LB medium.a. Pick a single bacterial colony from the plate using a 200 μL pipette tip.

b. Inoculate 60 mL of LB medium containing kanamycin and chloramphenicol, then shake at 37°C for 3–4 h until media becomes slightly turbid (OD600 reaches 0.2–0.4).

9. Mix 20 mL of starter bacterial culture from Step 8b with 2 L of fresh 2xTY medium containing kanamycin and chloramphenicol, for a total of 6 L bacterial culture (2 L per 4 L flask). Culture at 37°C with shaking until the OD600 reaches 0.4.

CRITICAL: Ensure that the culture expansion is done in fresh 2xTY media for optimal expression of each histone.

10. Induction of human histone expression.a. To induce histone expression, add IPTG to a final concentration of 0.4 mM.

b. Incubate the bacterial culture at 37°C with shaking for approximately 20 h.

c. Harvest the bacteria cells via centrifugation at 4,500 xg for 10 min at 4°C in 1 L centrifuge bottles. After discarding the supernatant, transfer the cell pellet into a 50 mL conical tube, and store at −80°C.

d. Collect 6 μL of bacterial culture suspension and use SDS-PAGE with 1X SDS-PAGE running buffer and Coomassie blue staining to check expression of the individual H2A-VSVG, H2B, H3, and H4 histone proteins (Figure 2A).Figure 2 Purification of histone octamer and NCP assembly

(A) Whole cell lysate of induced co-expression of H2A, H2B, H3, and H4 histone proteins in bacterial cells (6 μL) was analyzed by SDS-PAGE and Coomassie staining.

(B) The elution fractions of the Ni-NTA affinity resin (3 μL) were analyzed by SDS-PAGE and Coomassie staining to detect histone octamer.

(C) The size exclusion chromatography (SEC) samples (3 μL) were analyzed by SDS-PAGE and Coomassie staining.

(D) NCP assembled with different ratio of DNA: histone octamer (5 μL) was analyzed by agarose gel electrophoresis.

Note: H4 histone usually has lower expression than H2A, H2B, and H3. If there is no obvious H4 expression observed in the cell lysate, perform small scale lysis and one step Ni-NTA resin affinity purification to approximate amount of H4 protein. Troubleshooting 3.

Pause point: The cell pellet can be stored at −80°C for up to 3 months.

11. Purification of human histone complexes.a. Prepare cell lysate (∼12 g of pellet).i. Prepare 80 mL cell lysis buffer and keep on ice.

ii. Add 40 mL of cell lysis buffer to 50 mL conical tube and resuspend cells. Transfer bacterial cells to a 150 mL beaker and add the remaining 40 mL of cell lysis buffer. Add protease inhibitors, then add 5 μL of NucA nuclease (15 ng/μL) to digest DNA and RNA for reducing the viscosity of cell lysate.CRITICAL: Ensure that the NaCl concentration remains above 2 M to prevent the disassembly of the histone complex.

iii. Lyse bacterial cells by sonication (Q700 Sonicator; 1/2IN Microtip; 5 min (2s on 5s off); 35% power).

iv. Centrifuge the cell lysate at 40,000 xg for 60 min and transfer the supernatant into a pre-cooled 50 mL conical tube.

b. Nickel affinity purification with Ni-NTA agarose resin (Ni-Sepharose 6 Fast Flow).i. Prewash 2 mL of Ni-NTA agarose resin with 5 mL of Ni-NTA buffer, then centrifuge at 2,000 xg for 1 min at 4°C. Carefully discard the supernatant without disturbing the bead pellet. Repeat this step twice.

ii. Add the cell lysate to the washed Ni-NTA resin and add imidazole to a final concentration of 20 mM. Incubate at 4°C for 1 h rotating end-over-end.

iii. Transfer the mixture of cell lysate and resin to an Econo-Column gravity flow chromatography column and collect flowthrough.

iv. Wash resin with 40 mL wash buffer 1 containing 20 mM Imidazole, followed by washing with 40 mL of wash buffer 2.

v. Elute protein with 2 mL fractions of elution buffer containing 30-, 100-, 200-, 300-, or 500-mM Imidazole. Take 3 μL of each sample to run SDS-PAGE electrophoresis using 1X SDS-PAGE running buffer and Coomassie Blue staining to identify fractions containing human histone proteins and approximate the yield (Figure 2B).Note: Often high expression level of histone proteins is induced by IPTG, thus it is necessary to elute twice with each elution buffer containing different concentration of imidazole.

vi. Pool fractions containing the human histone octamer and remove 6x-His affinity tag using 1:50 (w/w) TEV protease for 18–20 h.Note: Complete digestion may require empirical determination of the optimal ratio of protease: histone octamer.

vii. Verify complete digestion using SDS-PAGE electrophoresis with 1X SDS-PAGE running buffer and Coomassie Blue staining.

c. Concentrate histone complexes for further gel filtration purification.i. Pre-wash the 30K MWCO concentrator (Amicon) with SEC buffer twice.

ii. Add digested histone protein sample to 30K MWCO concentrator.

iii. Centrifuge at 3,000 xg for 10 min at 4°C. Repeat this until the sample is approximately 500 μL.

iv. Transfer concentrated protein into a 1.5 mL tube. Keep 3 μL of sample for SDS-PAGE with 1X SDS-PAGE running buffer and Coomassie blue staining.

d. Purify histone octamer with SEC (Superdex 200 increase 10/300 GL).i. Load the concentrated human histone octamer sample onto the SEC column pre-equilibrated with SEC buffer.

ii. Fractionate human histone octamer protein from SEC column with 24 mL of SEC buffer with 0.5 mL for each fraction.

iii. Take 3 μL of each elution fraction for SDS-PAGE analysis with 1X SDS-PAGE running buffer and Coomassie blue staining (Figure 2C).

iv. Measure protein concentration with BSA standards (e.g., 100, 200, 400 ng BSA) for estimating the yield.

e. Concentrate pure histone octamer with 30K MWCO concentrator.i. Pre-wash the 30K MWCO concentrator (Amicon) with SEC buffer twice.

ii. Pool eluates containing human histone octamer from the above SEC purification into the centrifugal filter tube.

iii. Centrifuge at 3,000 xg for 10 min at 4°C. Repeat this step until the eluate is approximately 3 mg/mL based on previously estimated protein concentration.

iv. Check the protein concentration using BSA standards as described in Step 11d.

v. Aliquot the purified human histone octamer (5 μL each) into 0.2 mL tubes, freeze in liquid nitrogen, and store at −80°C. Human histone octamer remains stable at −80°C for several years.

12. Assembly of NCP (50 pmol).a. This assembly is designed to yield 50 pmol nucleosome in 160 μL (to final concentration of 1.25 μM NCP).i. For the first round of NCP assembly, use several ratios (0.5:1 to 2:1) of 147 bp Widom 601 DNA: histone octamer to get the right ratio for >95% NCP assembly.Note: The suggested fine ratios for optimization are 0.9:1, 1:1, and 1.1:1 for DNA: histone octamer in the 2nd- round NCP assembly.

ii. Prepare the 20 μL of reaction on ice in the following order: nuclease-free water, 5M NaCl (up to final concentration of 2M NaCl), 147 bp DNA (10 μM), and purified histone octamer protein (10 μM for 1:1).CRITICAL: Purified histone octamer must be added last to prevent disassembly.

iii. Incubate at room temperature (20°C–25°C) for 30 min.

iv. Add 7 μL of 10 mM Tris-HCl, pH 8.0 (to final concentration of 1.48 M NaCl) and incubate at room temperature (20°C–25°C) for 30 min.

v. Add 13 μL of 10 mM Tris-HCl, pH 8.0 (to final concentration of 1.0 M NaCl) and incubate at room temperature (20°C–25°C) for 30 min.

vi. Add 27 μL of 10 mM Tris-HCl, pH 8.0 (to final concentration of 0.6 M NaCl) and incubate at room temperature (20°C–25°C) for 30 min.

vii. Add 93 μL of 10 mM Tris-HCl, pH 8.0 (to final concentration of 0.25 M NaCl) and incubate at room temperature (20°C–25°C) for 30 min.Note: For optimal assembly, it is recommended to allow for additional time at 4°C (1–14 h).

viii. Store samples at 4°C.

ix. Run 5 μL of sample with 1 μL of 6X Orange loading buffer on 1% agarose gel to verify successful assembly (Figure 2D).

Expression and purification of E3 (BRCA1-BARD1)

Timing: 6–8 weeks

The Flag tagged heterodimer of BRCA1-BARD1 has been purified by us9 and demonstrated to have ubiquitin E3 ligase activity.14 In this section, we describe a robust but cost-effective way to express and purify the full-length BRCA1-BARD1 with N-terminal Twin-Strep tag on BARD1 instead from insect cells.1,15 This enables us to efficiently produce and examine a list of BRCA1-BARD1 variants for their abilities to ubiquitylate substrates, such as H2A in NCP.13. Preparing stocks.a. Protease inhibitors.i. Aprotinin: 0.5 mg/mL = 77 μM (500X).

ii. Chymostatin: 1 mg/mL = 1.65 mM (1000X).

iii. Leupeptin: 0.5 mg/mL = 1.05 mM (500X).

iv. Pepstatin A: 1 mg/mL = 1.46 mM (1000X).

v. PMSF: 200 mM (100X).

vi. Benzamidine HCl: 35 mg/mL (100X).

b. Buffers: (components in parentheses are freshly added at time of purification).i. Alkaline lysis solution I: 50 mM Tris-HCl pH 8.0, 10 mM EDTA, 50 mM Glucose, RNase A (20 μg/mL).

ii. Alkaline lysis solution II: 0.2 M NaOH (freshly diluted from 5–10 M stock) + 1% SDS.

iii. Alkaline lysis solution III: 3M Potassium Acetate. Store at 4°C.

iv. Cell lysis buffer: 50 mM Tris-HCl pH 7.5, 500 mM NaCl, 1 mM EDTA, 0.01% Igepal-CA630, 1 mM 2-beta mercaptoethanol, 10% Glycerol, (5 mM MgCl2, 2 mM ATP).

v. StrepTactin XT wash buffer: 50 mM Tris-HCl pH 7.5, 500 mM NaCl, 1 mM EDTA, 0.01% Igepal-CA630, 1 mM 2-beta mercaptoethanol, 10% Glycerol, (5 mM MgCl2, 2 mM ATP).

vi. StrepTactin XT elution buffer: 50 mM Tris-HCl pH 7.5, 300 mM NaCl, 1 mM EDTA, 0.01% Igepal-CA630, 1 mM 2-beta mercaptoethanol, 10% Glycerol, (5 mM MgCl2, 2 mM ATP, 50 mM Biotin).

vii. T0 Buffer: 25 mM Tris-Cl pH pH 7.5, 1 mM DTT, 10% Glycerol, 0.5 mM EDTA, 0.01% Igepal CA-630.

viii. T75 Buffer: 25 mM Tris-Cl pH pH7.5, 75 mM KCl, 1 mM DTT, 10% Glycerol, 0.5 mM EDTA, 0.01% Igepal CA-630.

ix. T500 buffer: 25 mM Tris-Cl pH pH 7.5, 500 mM KCl, 1 mM DTT, 10% Glycerol, 0.5 mM EDTA, 0.01% Igepal CA-630.

x. 1X SDS running buffer (diluted from 10X SDS running buffer): 25 mM Tris-base, 192 mM Glycine and 0.1% (w/v) Sodium Dodecyl Sulfate.

xi. TE Buffer: 10 mM Tris-HCl pH 8.0, 1 mM EDTA.

14. Transform pFastBac plasmid (using pFastbac-Flag-BRCA1 as an example).a. Add 5 ng of pFastbac-Flag-BRCA1 plasmid into 20 μL of DH10Bac competent cells.Note: It is highly recommended to utilize DH10EmBacY competent cells to produce the bacmid with an integrated enhanced yellow fluorescence protein-coding gene (YFP) to monitor virus production with high sensitivity using either fluorescence microscopy or spectrophotometry.

b. Incubate cells on ice for 30 min, lightly tapping every 10 min.

c. Heat-shock the cells for 45 s in a 42°C water bath and transfer the tubes to ice immediately for a 2 min incubation.

d. Add 180 μL of pre-warmed SOC medium to the cells and incubate with shaking (225 rpm) for 5 h at 37°C.

e. Dilute 10, 50, and 100 μL of the culture and add SOC medium to make 100 μL/tube and spread the 100 μL onto LB plates containing 50 μg/mL kanamycin, 7 μg/mL gentamicin, 10 μg/mL tetracycline, 100 μg/mL Bluo-gal, and 40 μg/mL IPTG.Note: Make fresh plates (less than 1 week old) before spreading bacterial culture. For optimal contrast of blue and white colonies, add Bluo-gal and IPTG the day of transformation, at least 2 h prior to spreading.

f. Incubate plates for 48 h at 37°C until distinct blue and white colonies can be seen clearly.Note: Transformation should begin to produce bacterial colonies after approximately 16 h. Ensure that colonies are not inoculated early to prevent inadvertent culturing of blue colonies.

g. Inoculate several single white colonies into separate 3 mL of LB media supplemented with 50 μg/mL kanamycin, 7 μg/mL gentamicin, 10 μg/mL tetracycline in a shaker at 37°C for 14–16 h.

h. Centrifuge the bacterial culture at 3,000 xg for 5 min and discard supernatant.

15. Isolate the recombinant bacmid DNA.Note: All steps should be carried out at 4°C

a. Resuspend the cell pellet with 300 μL Alkaline lysis solution I. Transfer samples to fresh 1.5 mL microcentrifuge tubes.

b. Add 300 μL of room temperature (20°C–25°C) Alkaline lysis solution II and gently mix by inverting 5–10 times. Do not allow the reaction to proceed longer than 5 min.

c. Add cold Alkaline lysis solution III and invert several times.

d. Centrifuge mixture at 15,000 xg at 4°C for 10 min and transfer 900 μL of the supernatant to fresh 2 mL microcentrifuge tube.

e. Add 800 μL of pre-chilled isopropanol and incubate on ice for 30 min or at −20°C for 12–16 h, if needed.

f. Centrifuge the solution at 15,000 xg at 4°C for 15 min.

g. Discard the supernatant and add 1 mL ice-cold 70% ethanol to wash the DNA pellet, and centrifuge again for 5 min.

h. Discard supernatant and air-dry the pellet for 10 min with cap open at room temperature (20°C–25°C).

i. Dissolve the DNA pellet in 40 μL TE buffer and mix gently by tapping the tube and store at 4°C for 16–18 h. Measure the DNA concentration after 12–16 h’s incubation.

16. Transfect Sf9 with the bacmid DNA.Note: Each step occurs in a sterile tissue culture hood.

a. Culture Sf9 cells to a density of 1.5–2.5 × 106 cells/mL with >95% viability in SFM4 medium without antibiotics.

b. Dilute cell suspension to 0.4 × 106 cells/mL and plate 2 mL of cells into a well of a 6-well plate for each baculovirus DNA sample.

c. Allow cells to attach for 15–30 min at room temperature (20°C–25°C) in the hood.

d. For each transfection for a single well of 6-well plate, prepare the Cellfectin II-DNA complex.i. Gently mix Cellfectin II reagent before use and dilute 6 μL in 100 μL of SF900 II medium.

ii. Dilute 1 μg baculovirus DNA in 100 μL of SF900 II medium.

e. Combine the Cellfectin II and DNA dilutions. Mix gently and incubate for 20 min at room temperature (20°C–25°C).

f. Add ∼210 μL of Cellfectin II-DNA mixture dropwise into the respective wells and incubate at 27°C for 5 h.

g. Remove the transfection mixture and replace with 2 mL of SF900 II medium.

h. Incubate Sf9 cells at 27°C until signs of viral infection are apparent-approximately 5–7 days (P1).Note: Ensure to include an uninfected well of Sf9 cells to serve as a negative control for monitoring viral infection and YFP expression.

i. Transfer supernatant to sterile 1.5 mL tubes and spin at 600 xg for 10 min at room temperature (20°C–25°C).

j. Transfer cleared supernatant to new sterile tube and store P1 stock baculovirus at 4°C protected from the light.Note: If the bacmid DNA is produced from DH10EmBacY cells, >90% of Sf9 cells should express YFP at the time for P1 baculovirus harvest.

17. Amplify P1 baculovirus.a. Dilute healthy Sf9 cells (density between 1.5–2.5 × 106 cells/mL with >95% viability) to 1.0 × 106 cells/mL in 50 mL SFM4 medium per flask.

b. Add 50–100 μL of P1 baculovirus and incubate at 27°C shaking for 3–4 days.Note: The amount of P1 baculovirus used for amplification may need to be determined empirically for optimal baculovirus production.

c. Transfer cell suspension to 50 mL conical tube and centrifuge at 600 xg for 10 min.

d. Transfer cleared supernatant to a new 50 mL conical tube and store virus at 4°C protected from light. This is the P2 baculovirus.

18. Prepare baculovirus working stock (P3).a. Dilute healthy Sf9 cells (density between 1.5–2.5 × 106 cells/mL with >95% viability) to 1.0 × 106 cells/mL in 50 mL SFM4 medium per flask.

b. Add 50–100 μL of P2 baculovirus and incubate at 27°C shaking for 3–4 days.

c. Transfer cell suspension to 50 mL conical tube and centrifuge at 600 xg for 10 min.

d. Transfer cleared supernatant to a new 50 mL conical tube and store virus at 4°C protected from light. This is the P3 baculovirus for protein expression shown below.

19. Express BRCA1 and BARD1 in High Five cells. Troubleshooting 4.a. Dilute healthy, log-phase High Five cells (cell density 1.5–2.0 × 106 cells/mL, >95% viability) to 1.0 × 106 cells/mL in 300 mL in SFX medium.

b. Simultaneously add 7.5 mL of BRCA1 (1/40) and 3.75 mL of BARD1 (1/80) P3 baculovirus to the cell suspension. Return cell suspension to 27°C incubator and continue shaking.

20. Harvest cells after 44–48 h.a. Collect cells in centrifuge bottles and spin at 600 xg for 10 min at room temperature (20°C–25°C) and remove supernatant.

b. Collect cells in 50 mL conical tubes. Gently resuspend pellet in 40 mL of cold PBS buffer, spin at 600 xg for 10 min at room temperature (20°C–25°C), and remove all residual liquid.

Pause point: Can freeze cell pellets in liquid nitrogen and store at −80°C for 3 months.

21. Purify the BRCA1-BARD1 complex. Troubleshooting 5.Note: All steps performed at 4°C

a. Add 5 mL of cold cell lysis buffer supplemented with protease inhibitors to cell pellet. Leave the pellet at room temperature (20°C–25°C) for 5 min.Note: Each proceeding buffer utilized in the study is supplemented with protease inhibitors until the final SP column loading.

b. Once the pellet has thawed, fully resuspend the pellet in the 5 mL lysis buffer.

c. Add 10 μL of NucA nuclease (15 ng/uL) and add 45 mL of lysis buffer.

d. Lyse cells with sonication (Q700 Sonicator; 1/4IN Microtip; 3 min (2s on 5s off); 10% power for 50 mL lysate) and add an additional 50 μL of PMSF before centrifugation.

e. Centrifuge cell lysate at 45,000 xg for 30 min at 4°C.Note: During centrifugation, equilibrate 1 mL StrepTactin XT column with 5 mL cell lysis buffer.

f. Filter the supernatant from centrifugation through a 0.45 μm PES filter.

g. Perform StrepTactin XT affinity chromatography.i. Load the filtered supernatant onto pre-equilibrated StrepTactin XT column at 0.75 mL/min. Save flowthrough and repeat loading the sample onto the column again.

ii. Wash the StrepTactin XT column with 100 mL wash buffer at 0.75 mL/min.

iii. Elute BRCA1-BARD1 protein with 10 mL of elution buffer at 0.5 mL/min.Note: After collecting 5 mL of eluate, stop elution, wait 10 min, then resume elution of remaining 5 mL to maximize yield of BRCA1-BARD1 protein from column.

h. Perform Cation affinity chromatography.i. Pool all eluates into a single container and add 30 mL T0 buffer to reach a final salt concentration of 75 mM.

ii. Load the 40 mL dilution onto 1 mL HiTrap SP HP cation exchange chromatography column pre-equilibrated in T75 buffer at 1 mL/min.

iii. Wash column with 10 mL T75 buffer to remove unbound protein.

iv. Elute BRCA1-BARD1 from HiTrap SP HP column over a 12 mL gradient of T75-T500 buffer with 0.5 mL for each fraction (Figure 3).CRITICAL: Centrifugal concentration of BRCA1-BARD1 is likely to result in precipitation and fragmentation of full-length protein.

Figure 3 Purification of BRCA1-BARD1 (E3)

Whole cell lysate (WCL) (6 μL), flowthrough (FT) (6 μL), StrepTrap XT elution (3 μL), and SP cation affinity elution fractions (3 μL) during BRCA1-BARD1 expression and purification were analyzed by SDS-PAGE and Coomassie staining.

v. Measure protein concentration of each peak using SDS-PAGE analysis with 1X SDS-PAGE running buffer and Coomassie blue staining with BSA as the standards. The prep of BRCA1-BARD1 typically ranges from 0.5–2.5 μM.Note: Keep the fractions containing a 1:1 ratio of BRCA1 to BARD1, which is very active as the E3 ligase in the following ubiquitylation assays. It is optional to perform the gel filtration step for further purification with the peak fractions of above SP elution.

vi. Aliquot the purified BRCA1-BARD1 prep into 10 μL per tube, freeze in liquid nitrogen, and store at −80°C. BRCA1-BARD1 remains active at −80°C for 1 year.

Expression and purification of ubiquitin

Timing: 1–2 weeks

The purification of recombinant Ubiquitin protein is a critical step for the reconstitution of the ubiquitylation reaction. In this process, Glutathione S-transferase (GST)-tagged Ubiquitin is immobilized on Glutathione Sepharose resin, which is then used to capture the UBA1 (ubiquitin activating enzyme E1) protein (described in the next section). Next, the GST moiety is proteolytically removed to release the Ubiquitin protein. The final step involves purification of the Ubiquitin through size-exclusion chromatography (SEC).22. Preparing stocks.a. Protease inhibitors: (Please refer to “Protease inhibitors” section of Step 6).

b. Buffers.i. Cell lysis buffer: 50 mM Tris-HCl, pH. 7.5, 150 mM KCl, 10% Glycerol, 1 mM DTT.

ii. Equilibration buffer: 50 mM Tris-HCl pH. 8.0, 10% Glycerol.

iii. Wash buffer: 50 mM Tris-HCl pH. 8.0, 500 mM KCl, 10% Glycerol.

iv. 1X SDS running buffer (diluted from 10X SDS running buffer): 25 mM Tris-base, 192 mM Glycine and 0.1% (w/v) Sodium Dodecyl Sulfate.

23. Transform plasmid into competent cells.a. The procedures are performed as described in Step 2 except the plasmid pGEX-6P1-Ub, the BL21 (DE3) bacterial cells, and ampicillin (100 μg/mL) antibiotic LB plates are used.

24. Culture an isolated colony in LB medium.a. Pick a single bacterial colony from the LB plate using a 200 μL pipette tip.

b. Inoculate it in 30 mL of LB medium containing ampicillin.

c. Incubate 30 mL of culture at 37°C without shaking for about 12–16 h until optical density at 600 nm (OD600) reaches 0.6.

Note: The regular incubation time is approximately 14 h, however optimal OD600 is between 0.4–0.6.

25. Mix 10 mL of bacterial culture with 1 L of fresh LB medium containing ampicillin, for a total of 3 L bacterial culture (1 L per 4 L flask) and culture at 37°C with shaking until the OD600 reaches 0.6.

26. Induce expression of Ubiquitin.a. To induce Ubiquitin expression, add IPTG to a final concentration of 0.6 mM.

b. Incubate the bacterial culture at 37°C for 3 h with shaking at 220 rpm.

c. Harvest the bacteria via centrifugation at 4,500 xg for 10 min at 4°C in 1 L centrifuge bottles. After discarding the supernatant, transfer the cell pellet into a 50 mL conical tube, and store at −80°C.

d. Collect 6 μL of bacterial culture suspension and run SDS-PAGE with 1X SDS-PAGE running buffer and Coomassie blue staining to estimate the amount of Glutathione Sepharose resin needed.

Pause point: The cell pellet can be stored at −80°C for up to 3 months.

27. Purify Ubiquitin protein.Note: All purification steps are carried out at 4°C

a. Preparation of cell lysate (∼6 g of pellet).i. Prepare 50 mL cell lysis buffer and keep on ice.

ii. Add 30 mL of cell lysis buffer to 50 mL conical tube and resuspend cells. Transfer bacterial cells to 150 mL beaker and add the remaining 20 mL of cell lysis buffer. Add protease inhibitors then add 5 μL of NucA nuclease (15 ng/μL) to digest DNA and RNA for reducing the viscosity of cell lysate.

iii. Lyse bacterial cells by sonication (Q700 Sonicator; 1/4IN Microtip; 5 min (2s on 5s off); 35% power).

iv. Centrifuge the cell lysate at 40,000 xg for 50 min and transfer the supernatant into a pre-cooled 50 mL conical tube.

b. GST-tag affinity purification with Glutathione Sepharose resin.i. Prewash 2 mL of Glutathione Sepharose resin with 5 mL of cell lysis buffer, then centrifuge at 2,000 xg for 1 min at 4°C. Carefully discard the supernatant without disturbing the bead pellet. Repeat this step twice.

ii. Add the cell lysate to the pre-washed Glutathione Sepharose resin and incubate at 4°C for 1 h rotating end-over-end.

iii. Transfer the mixture of cell lysate and resin to gravity flow chromatography column and collect flowthrough.

iv. Wash resin with 50 mL wash buffer to remove nonspecific protein and leave approximately 2 mL remaining with the resin.Note: The Glutathione Sepharose resin with bounded GST-Ub will be used to capture UBA1 (E1) from cell lysate in the next section of E1 purification.

c. Elution of Ubiquitin protein.i. Wash resin with 50 mL T150 buffer with 1 mM DTT. Leave approximately 5 mL remaining with resin.Note: Never allow the column to run completely dry.

ii. Remove Glutathione Sepharose resin from Econo gravity flow column and place in 50 mL conical tube.

iii. Add PreScission Protease (1:50 for the ratio of target protein to PreScission Protease) to resin slurry and cleave GST tag off Ubiquitin protein for 16–18 h with mild agitation.Note: On-column digest is recommended for removal of PreScission Protease, which has GST tag and will remain on Glutathione Sepharose resin.

iv. Load resin into gravity flow chromatography column and collect Ubiquitin protein in the flowthrough. Take 3 mL of flowthrough and resin for SDS-PAGE analysis with 1X SDS-PAGE running buffer and Coomassie blue staining to confirm complete digestion.Note: Complete digestion may require empirical determination of the optimal ratio of target protein: protease and the incubation time.

d. Concentrate Ubiquitin with the 3K MWCO concentrator.i. Pre-wash the 3K MWCO concentrator (Amicon) with T150 twice.

ii. Pool all flowthrough samples from the above Glutathione Sepharose purification and add to centrifugal filter.

iii. Centrifuge at 3,500 xg for 10 min at 4°C. Repeat this step until the sample is concentrated to approximately 500 μL.

e. Purify Ubiquitin with SEC (Superdex 200 increase 10/300 GL; 24 mL).i. Load the concentrated Ubiquitin solution onto SEC column pre-equilibrated with T150 buffer.

ii. Fractionate Ubiquitin protein from SEC column with 24 mL T150 buffer with 0.5 mL for each fraction.

iii. Take 3 μL of each elution fraction for SDS-PAGE analysis and Coomassie blue staining (Figure 4A).Figure 4 Purification of Ubiquitin and UBA1 (E1)

(A) The samples of GST-Ubiquitin affixed to GST resin, of flowthrough (FT) after PreScission protease digestion and of elution fractions from size exclusion chromatography (SEC) (3 μL) were analyzed by SDS-PAGE and Coomassie staining.

(B) Bound UBA1 protein (3 μL) and elution fractions (3 μL) from GST-Ub affinity resin were analyzed by SDS-PAGE and Coomassie staining.

(C) The UBA1 (E1) elution fractions from size exclusion chromatography (SEC) (3 μL) were analyzed by SDS-PAGE and Coomassie staining.

iv. Measure protein concentration with BSA standards (e.g., 100, 200, 400 ng BSA) for estimating the yield.

f. Concentrate Ubiquitin with 3K MWCO concentrator.i. Pre-wash 3K MWCO concentrator (Amicon) with T150 buffer twice.

ii. Pool elution fractions from the above SEC purification and add to centrifugal filter.

iii. Centrifuge at 3,500 x g for 10 min at 4°C. Repeat this step until the sample is concentrated to approximately 0.6 mg/mL.

iv. Aliquot protein into 5 μL per tube, freeze in liquid nitrogen, and store at −80°C.

Expression and purification of ubiquitin activating enzyme E1 (UBA1)

Timing: 1–2 weeks

This section outlines the process for expressing UBA1 (E1) with a 6x His tag in a bacterial expression system, followed by its purification through affinity chromatography using GST-tagged Ubiquitin and subsequent size-exclusion chromatography (SEC).28. Preparing stocks.a. Protease inhibitors (Please refer to “Protease inhibitors” section of Step 6).

b. Buffers: (components in parentheses are freshly added at time of purification).i. Cell lysis buffer: 50 mM Tris-HCl pH 7.5, 150 mM KCl, 10% Glycerol, 1 mM DTT.

ii. Equilibration buffer: 50 mM Tris-HCl pH 8.0, 10% Glycerol (2 mM ATP, 6 mM Creatine phosphate and 2 U/mL Creatine phosphokinase).

iii. Wash buffer: 50 mM Tris-HCl pH 8.0, 500 mM KCl, 10% Glycerol.

iv. Elution buffer.

I: 50 mM Tris-HCl, pH 7.5, 10% Glycerol, 5 mM DTT.

II: 50 mM Tris-HCl, pH 7.5, 10% Glycerol, 10 mM DTT.

v. Regeneration buffer: 50 mM Tris-HCl, pH 9.0, 1000 mM KCl.

vi. Storage Buffer: 50 mM Tris-HCl, pH 7.5, 0.2% Sodium azide.

vii. 1X SDS running buffer (diluted from 10X SDS running buffer): 25 mM Tris-base, 192 mM Glycine and 0.1% (w/v) Sodium Dodecyl Sulfate.

29. Transform plasmid into competent cells: The procedures are performed as described in Step 2 except the plasmid UBA-6XHis is used.

30. Culture an isolated colony in LB medium: The procedures are performed as described in Step 24.

31. Mix 10 mL of starter bacterial culture with 1 L of fresh LB medium containing ampicillin, for a total of 3 L bacterial culture (1 L per 4 L flask) and culture at 37°C with shaking until the OD600 reaches 0.7.

Note: The incubation time is approximately 5 h, and optimal OD600 for induction is between 0.6–0.8.

32. Induction of UBA1 expression.a. To induce UBA1 expression, add IPTG to a final concentration of 0.2 mM.

b. Incubate the bacterial culture at 16°C with shaking for 16–18 h.

c. Harvest the bacteria cells via centrifugation at 4,500 xg for 10 min at 4°C in 1 L centrifuge bottles. After discarding the supernatant, transfer the cell pellet into a 50 mL conical tube, and store at −80°C.

Pause point: The cell pellet can be stored at −80°C for up to 3 months.

33. Purify UBA1. Troubleshooting 6.Note: All purification steps are carried out at 4°C.

a. Prepare cell lysate (∼6g of pellet).i. Prepare 50 mL cell lysis buffer and keep on ice.

ii. Add 30 mL of cell lysis buffer to 50 mL conical tube and resuspend cells. Transfer bacterial cells to 150 mL beaker and add 20 mL of cell lysis buffer. Add protease inhibitors then add 5 μL of NucA nuclease (15 ng/μL) to digest DNA and RNA for reducing the viscosity of cell lysate.

iii. Lyse bacterial cells by sonication (Q700 Sonicator; 1/4IN Microtip; 5 min (2s on 5s off); 35% power).

iv. Centrifuge the cell lysate at 40,000 xg for 30 min and transfer the supernatant into a pre-cooled 50 mL conical tube.

b. GST-Ub affinity with Glutathione Sepharose resin.i. Wash GST-Ub/Glutathione Sepharose resin with equilibration buffer.

ii. Add MgCl2 to 10 mM and fresh ATP (0.1 M Stock) to 2 mM; Phosphocreatine to 6 mM (0.1 M Stock); Add a small amount of solid Phosphocreatine Kinase (PCK) into Cell lysate of UBA1.

iii. Add supernatant to GST-Ub-Glutathione Sepharose affinity resin made in Step 27 and incubate for 1 h at 4°C.

iv. Allow supernatant to flowthrough by gravity.

v. Wash beads with 50 column volumes of wash buffer.

vi. Collect the flow through and measure its A260/A280 with wash buffer as blank.Note: Ensure that A260 reading is close to 0 before addition of elution buffer. Adding wash buffer in small amounts and letting it flow through before addition of new wash buffer is most effective.

vii. Elute UBA1 protein with fresh elution buffer. Seal the bottom of the column and add approximately 5 mL of elution buffer I. Let sit for 10 min prior to elution of UBA1 protein. Repeat this process with elution buffer II 3–4 times.

viii. Following elution of UBA1 protein, take 3 μL of each elution for SDS-PAGE with 1X SDS-PAGE running buffer and Coomassie blue staining (Figure 4B).

ix. Regenerate GST-Ub/Glutathione Sepharose affinity resin by washing with 50 column volume of regeneration buffer to reconstitute column for additional ubiquitin-mediated purifications. Store column in storage buffer at 4°C.

c. Concentrate UBA1 protein with 30K MWCO concentrator for gel filtration.i. Pre-wash 30K MWCO concentrator (Amicon) with T150 buffer twice.

ii. Pool the UBA1 elution and add to the pre-washed 30K MWCO concentrator.

iii. Centrifuge at 3,000 xg for 10 min at 4°C. Repeat this until the concentrated protein solution is approximately 500 μL.

iv. Transfer the concentrated protein solution into a 1.5 mL tube.

d. Purify UBA1 with SEC (Superdex 200 increase 10/300 GL).i. Load the concentrated UBA1 solution onto SEC column pre-equilibrated with T150 buffer.

ii. Fractionate UBA1 protein from SEC column with 24 mL T150 buffer with 0.5 mL for each fraction.

iii. Take 3 μL of each elution fraction for SDS-PAGE with 1X SDS-PAGE running buffer analysis and Coomassie blue staining (Figure 4C).

iv. Measure protein concentration with BSA standards (e.g., 100, 200, 400 ng BSA) for estimating the yield.

e. Concentrate UBA1 with 30K MWCO concentrator.i. Pre-wash 30K MWCO concentrator (Amicon) with T150 buffer twice.

ii. Pool eluates (∼3 mL) from the above SEC purification and add to the prewashed 30K MWCO concentrator.

iii. Centrifuge at 3,000 x g for 10 min at 4°C. Repeat this step until the eluate is approximately 1 mg/mL.

iv. Measure the protein concentration using BSA standards.

v. Aliquot protein into 5 μL per tube, freeze in liquid nitrogen, and store at −80°C.

Expression and purification of ubiquitin conjugating enzyme E2s (e.g., UBE2D3)

Timing: 1–2 weeks

To thoroughly assess the E3 ligase activity of the BRCA1-BARD1 complex, we have purified a range of E2 conjugating enzymes that has been reported to interact with E3 BRCA1-BARD1. This approach is undertaken to reveal any potential efficiency and specificity disparities in the E3 ligase activity of BRCA1-BARD1 utilizing different E2 enzymes. The expression and purification protocol are standardized across all E2 proteins. For illustrative purposes, we detail the expression and purification methodology using UBE2D3 as a representative example.34. Preparing stocks.a. Protease inhibitors (Please refer to “Protease inhibitors” section of Step 6).

b. Buffers.i. Cell lysis buffer: 20 mM Tris-HCl, pH 7.5, 150 mM KCl, 10% Glycerol, 1 mM DTT.

ii. Ni-NTA buffer: 50 mM Tris-HCl pH 7.5, 150 mM KCl, 10% Glycerol, 1 mM DTT.

iii. Wash buffer.

iv. 1: 50 mM Tris-HCl pH 7.5, 300 mM KCl, 10% Glycerol, 1 mM DTT, 20 mM imidazole.

v. 2: 50 mM Tris-HCl pH 7.5, 150 mM KCl, 10% Glycerol, 1 mM DTT.

vi. Elution buffer: 50 mM Tris-HCl pH 7.5, 150 mM KCl, 10% Glycerol, 1 mM DTT, 300 mM imidazole.

vii. T0 buffer: 20 mM Tris-HCl pH 7.5, 10% Glycerol, 1 mM DTT.

viii. T50 buffer: 20 mM Tris-HCl pH 7.5, 75 mM KCl, 10% Glycerol, 1 mM DTT.

ix. T500 buffer: 20 mM Tris-HCl pH 7.5, 500 mM KCl, 10% Glycerol, 1 mM DTT.

x. SEC buffer: 50 mM Tris-HCl pH 7.5, 150 mM KCl, 10% Glycerol, 1 mM DTT.

xi. 1X SDS running buffer (diluted of 10X SDS running buffer): 25 mM Tris-base, 192 mM Glycine and 0.1% (w/v) Sodium Dodecyl Sulfate.

35. Transform plasmid into competent cells: The procedures are performed as described in Step 2 except the pET28a-UBE2D3 plasmid is used.

36. Culture an isolated colony in LB medium: The procedures are performed as described in Step 24.

37. Mix 10 mL of starter bacterial culture with 1 L of fresh LB medium containing ampicillin, for a total of 3 L bacterial culture (1 L per 4 L flask). Culture at 37°C with shaking until the OD600 reaches 0.6.

38. Induction of UBE2D3 expression.a. To induce protein expression, add IPTG to a final concentration of 0.5 mM.

b. Incubate the bacterial culture at 37°C for 3 h with shaking at 220 rpm.

c. Harvest the bacteria via centrifugation at 4,500 xg for 10 min at 4°C in 1 L centrifuge bottles. After discarding the supernatant, transfer the cell pellet into a 50 mL conical tube, and store at −80°C.

39. Purify UBE2D3.Note: All purification steps are carried out at 4°C

a. Prepare cell lysate (∼6g of pellet).i. Prepare 70 mL cell lysis buffer and keep on ice.

ii. Add 30 mL of cell lysis buffer to 50 mL conical tube and resuspend cells. Transfer bacterial cells to 150 mL beaker and add 20 mL of cell lysis buffer. Add protease inhibitors, then add 5 μL of NucA nuclease (15 ng/μL) to digest DNA and RNA for reducing the viscosity of cell lysate.

iii. Lyse bacterial cells by sonication (Q700 Sonicator; 1/4IN Microtip; 5 min (2s on 5s off); 35% power).

iv. Centrifuge the cell lysate at 40,000 × g for 50 min and transfer the supernatant into a pre-cooled 50 mL conical tube.

b. Nickel affinity with Ni-NTA agarose resin (Ni-Sepharose 6 Fast Flow).i. Prewash 2 mL of Ni-NTA agarose resin with 5 mL of cell lysis buffer, then centrifuge at 2,000 xg for 1 min at 4°C. Carefully discard the supernatant without disturbing the bead pellet. Repeat this step twice.

ii. Add the cell lysate to the pre-washed Ni-NTA resin and add imidazole to a final concentration of 20 mM. Incubate at 4°C for 1 h rotating end-over-end.

iii. Transfer the mixture of cell lysate and resin to gravity flow chromatography column and collect flowthrough.

iv. Wash beads with 40 mL wash buffer 1 containing 20 mM Imidazole, followed by washing with 40 mL of wash buffer 2.

v. Elute protein with 2 mL fractions of elution buffer containing 300 mM Imidazole 5 times.

vi. Use SDS-PAGE electrophoresis with 1X SDS-PAGE running buffer and Coomassie Blue staining to identify fractions containing UBE2D3 protein and estimate the yield (Figure 5A).Figure 5 Purification of UBE2D3 and other E2s

(A) Whole cell lysate (WCL) (6 μL), cell pellet (P) (6 μL), cell lysate supernatant (S) (3 μL), Ni-NTA resin flowthrough (FT) (3 μL), and Ni-NTA elution fractions (lanes 6–11) (3 μL) of UBE2D3 were analyzed by SDS-PAGE and Coomassie staining.

(B) The UBE2D3 elution fractions from SP cation affinity chromatography (3 μL) were analyzed by SDS-PAGE and Coomassie staining.

(C) The UBE2D3 elution fractions from size exclusion chromatography (SEC) (3 μL) were analyzed by SDS-PAGE and Coomassie staining.

(D) SDS-PAGE of purified E2s (UBE2D3, UBE2W, UBE2N, UBE2E3, UBE2V2, UBE2E2, UBE2E1, UBE2B), Lane 1 shows MW markers.

c. Cation exchange chromatography.i. Pool 10 mL of UBE2D3 elution and dilute them with 20 mL of T0 buffer.

ii. Load the dilution onto 1 mL HiTrap SP-HP column pre-equilibrated with T50 buffer.

iii. Fractionate UBE2D3 protein from HiTrap SP-HP column using a 12 mL gradient of 50–500 mM KCl in T0 buffer with 0.5 mL for each fraction.

iv. Take 3 μL of each elution fraction for SDS-PAGE analysis with 1X SDS-PAGE running buffer and Coomassie blue staining (Figure 5B).

v. Measure protein concentration with BSA standards (e.g., 100, 200, 400 ng BSA) for estimating the yield.

d. Concentrate UBE2D3 protein with 3K MWCO concentrator for gel filtration.i. Pre-wash 3K MWCO concentrator (Amicon) with T150 buffer twice.

ii. Pool the SP column elution fractions containing UBE2D3 protein and add to the pre-washed 3K MWCO concentrator.

iii. Centrifuge at 3,000 xg for 10 min at 4°C. Repeat this until the eluate is approximately 500 μL.

iv. Transfer concentrated protein into a 1.5 mL tube. Take 3 μL protein for SDS-PAGE with 1X SDS-PAGE running buffer and Coomassie blue staining.

e. Purify UBE2D3 with SEC (Superdex 200 increase 10/300 GL; 24 mL).i. Load UBE2D3 sample onto SEC column pre-equilibrated with T150 buffer.

ii. Fractionate UBE2D3 with SEC column using 24 mL T150 buffer with 0.5 mL for each fraction.

iii. Take 3 μL of each elution fraction for SDS-PAGE analysis with 1X SDS-PAGE running buffer and Coomassie blue staining (Figure 5C).

iv. Measure protein concentration with BSA standards (e.g., 100, 200, 400 ng BSA) for estimating the yield.

f. Concentrate UBE2D3 with 3K MWCO concentrator.i. Pre-wash 3K MWCO concentrator (Amicon) with T150 buffer twice.

ii. Pool eluates (∼3 mL) from the above SEC purification and add to 3K MWCO concentrator.

iii. Centrifuge at 3,000 xg for 10 min at 4°C. Repeat this step until the eluate is approximately 0.5 mg/mL.

iv. Measure the protein concentration using BSA standards.

v. Aliquot 5 μL of protein per tube, freeze in liquid nitrogen, and store at −80°C.

40. Purification of other E2s (Figure 5D): The procedure is similar to purification of UB2D3 (Steps 34–39).

In vitro ubiquitylation assays of BRCA1-BARD1 and its mutants with nucleosome histone H2A

Timing: 1 day

To fully assess the relative ability of BRCA1-BARD1 mutants to ubiquitylate H2A in the NCP substrate compared to wild type, we conducted in vitro ubiquitylation assays as described below (Figure 6A).41. Preparing stocks.a. Protein stocks.i. BSA working stock: 10 mg/mL.

ii. E1 working stock: Dilute purified UBA1 (10 μM) to 1.5 μM in 25 mM Tris-HCl pH 7.5, 150 mM KCl, 0.01% IgePal-CA 630, and 1 mM DTT.

iii. E2 working stock: Dilute purified E2 (e.g., UBE2D3; 30 μM) to 10 μM in 25 mM Tris-HCl pH 7.5, 150 mM KCl, 0.5 mM EDTA, 0.01% IgePal-CA 630, and 1 mM DTT.

iv. E3 working stock: Dilute purified E3 (BRCA1-BARD1 or its variants; 2.1 μM) to desired concentration (0.3, 0.6, 0.9, 1.2 or 2.1 μM) in 25 mM Tris-HCl pH 7.5, 300 mM KCl, 0.5 mM EDTA, 0.01% IgePal-CA 630, and 1 mM DTT.

v. Ub working stock: purified Ub (100 μM) in 25 mM Tris-HCl pH 7.5, 150 mM KCl, 0.5 mM EDTA, 0.01% IgePal-CA 630, and 1 mM DTT.

vi. NCP working stock: 1.25 μM in 25 mM Tris-HCl pH 7.5, 250 mM NaCl, 0.1 mM EDTA, 1 mM DTT.

b. Buffer stocks.i. 5X reaction buffer: 125 mM Tris-HCl pH 7.5, 0.05% IgePal-CA 630, and 2.5 mM DTT.

ii. T80: 25 mM Tris-HCl pH 7.5, 80 mM KCl, 0.01% IgePal-CA 630, and 1 mM DTT.

iii. 1X SDS running buffer (diluted of 10X SDS running buffer): 25 mM Tris-base, 192 mM Glycine and 0.1% (w/v) Sodium Dodecyl Sulfate.

iv. 1X transfer buffer: 25 mM Tris-base, 192 mM Glycine, 10% Methanol.

v. 1X PBST buffer: 1X PBS, 0.1% Tween 20.

vi. Blocking buffer: 1X PBS, 5% (w/v) dry milk powder and 0.1% Tween 20.

42. Set up the standard BRCA1-BARD1 mediated ubiquitylation reaction with NCP as the substrate (Table 1).a. To prepare the reaction, follow these steps carefully.i. Thaw all reagents and keep them on ice.

ii. In a pre-chilled reaction tube, make the master mix of the following components: 5X reaction buffer, BSA, E1, E2, substrate, Ubiquitin and ddH2O.

iii. Aliquot 8.5 μL of the master mix into separate, appropriately labeled, and pre-chilled tubes.

iv. Add 1 μL various concentrations of E3 (BRCA1-BARD1) into the reaction mixture. Gently mix after the addition to ensure even distribution.Note: Keep everything on ice throughout the procedure. Calculate all the protein stocks to ensure the final reaction salt concentration is 100 mM.

b. Initiate the reaction with the addition of ATP/MgCl2. Quickly, but gently, mix the reaction mixture to ensure all components are well combined.

c. Move the reaction tubes from ice to the 37°C incubator for 30 min or the appropriate time as required for the specific reaction.

d. To stop reaction, add 3.5 μL of 4X SDS-PAGE loading buffer.Note: Ensure you have positive and negative controls. Use proper pipetting techniques to avoid introducing bubbles or inaccuracies in volume.

Table 1 Reagents for the in vitro ubiquitination assay

Reagents	Final concentration	Amount/per tube	
5X reaction buffer	25 mM Tris-HCl pH 7.5, 0.01% IgePal-CA 630
0.5 mM DTT	2.0 μL	
BSA (10 mg/mL)	100 μg/mL	0.1 μL	
T80 Buffer	--	0.5 μL	
E1 (i.e., UBA1) (1.0 μM)	50 nM	0.5 μL	
E2 (e.g., UBE2D3) (10 μM)	0.5 μM	0.5 μL	
E3 (i.e., BRCA1-BARD1) (0.3, 0.6, 0.9, 1.2 or 2.1 μM)	30-,60-,90-,120-, or 210 nM	1.0 μL	
Substrate (i.e., NCP) (1.25 μM)	180 nM	1.44 μL	
Ubiquitin (100 μM)	10 μM	1.0 μL	
ddH2O	--	2.46 μL	
MgCl2 + ATP mixture (50 + 50 mM)	2.5 mM	0.5 μL	
Total	--	10 μL	

43. Detect BRCA1-BARD1 E3 ligase activity by examining histone H2A ubiquitylation.a. Heat samples at 95°C for 5 min and use 15% SDS-PAGE with 1X SDS-PAGE running buffer to separate proteins.

b. Transfer proteins to nitrocellulose membrane and block the membrane with blocking buffer.i. Perform a wet transfer (or tank transfer) using the Mini Trans-Blot cell according to manufacturer instructions.

ii. Transfer protein to membrane at 90 V for 1 h.

iii. Following transfer, block membrane with blocking buffer for 1 h at room temperature (20°C–25°C).

c. Incubate the membrane with a specific VSV-G epitope antibody (refer to Table 2 for the dilution of primary antibody used) to recognize histone H2A and ubiquitylated H2A in blocking buffer at room temperature (20°C–25°C) for 1 h.Table 2 Dilutions of primary and secondary antibodies for immunoblotting of H2A and H2A-Ub

Dilution of primary antibody	Dilution of secondary antibody	
Rabbit polyclonal antibody specific for VSV-G tag on H2A of NCP	1:3000	Goat polyclonal anti-rabbit IgG conjugated to HRP	1:5000	
Immunogen for anti-VSV-G is synthetic peptide corresponding to amino acids 497–511 (N-Tyr-Thr-Asp-Ile-Glu-Met-Asn-Arg-Leu-Gly-Lys-C) of the Vesicular Stomatitis Virus glycoprotein (VSV-G), which is the tag on H2A of NCP substrate.

d. Wash the membrane for 10 min with 1X PBST buffer three times.

e. Incubate the membrane blot with blocking buffer containing HRP-conjugated secondary antibodies (refer to Table 2 for the dilution of secondary antibody used) at room temperature (20°C–25°C) for 1 h.

f. Wash the membrane for 10 min with PBST buffer three times.

g. After final wash, develop the membrane blot using the ECL max kit (Bio-Rad) according to manufacturer instructions and visualize the chemiluminescent signals using ChemiDoc MP imaging system (Bio-Rad; Figures 6B–6D).

Figure 6 In vitro ubiquitylation of histone H2A by BRCA1-BARD1 and its variants

(A) Schematic of ubiquitination assay mediated by E3 BRCA1-BARD1 with NCP as a substrate.

(B) Representative nucleosome ubiquitylation assays monitoring H2A-Ub efficiency of BRCA1-BARD1 in conjunction with different E2s. UBE2B that does not bind BRCA1-BARD1 was included as a negative control. BC1-BD1, BRCA1-BARD1.

(C) The BRCA1-BARD1 RING structure showing the locations of BRCA1 residues I26, L63, and K65 with the E2 binding surface indicated by dotted lines (PDB:7JZV).

(D) Representative nucleosome ubiquitylation assays monitoring H2A-Ub efficiency for wild-type or mutant BRCA1-BARD1 in conjunction with NCP as a substrate and E2s: UBE2D3 (top) and UBE2D3 + UBE2N-UBE2V2 (bottom).

Expected outcomes

As demonstrated in Figure 1, we have successfully obtained a high concentration prep of pure 147 bp Widom 601 DNA utilizing a method that includes alkaline lysis-mediated DNA extraction, PEG-6000/NaCl precipitation, and Mono-Q ion-exchange chromatography. The human histone proteins H2A, H2B, H3, and H4 are expressed simultaneously from a single vector, and the histone octamer is purified to near homogeneity using Ni-NTA resin followed by size-exclusion chromatography (SEC), as evidenced in Figure 2. The nucleosome core particle (NCP) is successfully reconstituted with human histone octamer and 147 bp Widom 601 DNA by the gradual dilution approach. The full-length BRCA1-BARD1 protein, enzymatically active as a ubiquitin E3 ligase, is overexpressed in High Five insect cells and achieves near-homogeneity purification via StrepTactin XT and ion-exchange chromatography, as shown in Figure 3. GST-tagged Ubiquitin and UBA1 protein, produced in E. coli, are efficiently purified using affinity chromatography with Glutathione Sepharose and subsequent SEC, which is detailed in Figure 4. The purification of the 6x His-tagged UBE2D3 and other E2s through Ni-NTA resin, ion-exchange chromatography, and SEC results in a high level of yield and purity, as depicted in Figure 5.

The in vitro ubiquitylation assay, utilized to assess the E3 ligase activity of the BRCA1-BARD1 complexes, reveals that the wildtype BRCA1-BARD1 demonstrates high proficiency and E2 dependency in ubiquitylating histone H2A, whereas our recently isolated variant BARD1-BRCA1E3d displays a pronounced deficiency, as presented in Figure 6. Notably, the previously reported E3 dead mutant (i.e., BRCA1I26A-BARD1) retains significantly E3 ligase activity toward H2A under the reaction conditions with different E2s.

Limitations

The nucleosome core particle (NCP) utilized in this study is reconstructed using a histone octamer purified from bacterial cells, which largely excludes post-translational modifications (PTM) on histones. Also, it is only an individual nucleosome unit rather than a tightly packed chromatin structure, which consists of a series of NCP subunits. To better emulate in vivo conditions and corroborate these findings, future experiments employing chromatin mimetic substrate with multiple NCP subunits arranged in series, possibly in combination with histone PTM and nucleosome remodeling factors, will be necessary to simulate the dynamic nature of chromatin accurately.

Troubleshooting

Problem 1

Residual protein in alkaline lysis-extracted Widom 601 DNA leads to low A260/A280 readings and potential discoloration.

Potential solution

• Add 1 volume of Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v; Thermo Fisher 15593031) to DNA solution, mix gently and spin for 5 min at max speed, carefully the upper aqueous phase, and transfer the layer to a fresh tube. Be sure not to carry over any phenol during pipetting. Then, proceed to “Ethanol precipitation” as described in Step 4f-i.

• If Phenol:Chloroform:Isoamyl Alcohol is not available in the lab, add a 1.2 volume of 88% isopropanol and 0.2 M potassium acetate mixture to DNA solution, followed by a 10-min room temperature (20°C–25°C) incubation. Centrifuge at 8,000 xg for 15 min at 4°C. Decant and re-spin briefly, removing any leftover solution. Wash the DNA pellet with ice-cold 70% ethanol, spin it down, and air-dry for 10 min. Resuspend in 2 mL of deionized water.

Problem 2

Inefficient separation of the vector backbone from the 147 bp Widom 601 DNA fragment following PEG/NaCl precipitation.

Potential solution

Adjust the PEG/NaCl solution volume to improve precipitation efficiency or modify the precipitation duration for the 147 bp fragment.

Problem 3

Low H4 expression level from the induction of pET29a-human histone 4 in-one in E. coli cells.

Potential solution

Preform StrepTactin XT resin-based affinity purification by using the twin-strep tag on H4 to enrich the histone octamer if the expression of H4 is extreme low.

Problem 4

Low expression or solubility of BRCA1 or BARD1 proteins in High Five insect cells.

Potential solution

Monitor bacmid transfection or baculovirus amplification in Sf9 cells to maintain >90% cell fluorescence, adhering strictly to the culture times. Insufficient or extensive viral amplification can lead to low expression of BRCA1 or BARD1; if observed, consider reinitiating bacmid transfection or baculovirus amplification. Assess solubility issues by optimizing the viral infection ratio of BRCA1 to BARD1 in High Five cells through preliminary small-scale expression trials.

Problem 5

Heavy BRCA1 protein degradation during purification.

Potential solution

Ensure all buffers are freshly prepared with protease inhibitors. Aim to complete the purification process within 8 h to minimize degradation.

Problem 6

Significant amount of truncation forms and low yield of UBA1.

Potential solution

Check that there are sufficient GST-Ub proteins on the resin before loading the UBA1 cell lysate. Ensure freshly made MgCl2 + ATP is used to activate ubiquitin for binding full-length UBA1 and freshly made DTT is included in the elution buffer to efficiently elute UBA1 from the GST-Ub resin. Also, add protease inhibitors to each buffer until the SEC purification step.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Weixing Zhao (zhaow2@uthscsa.edu).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Weixing Zhao (zhaow2@uthscsa.edu).

Materials availability

Plasmids, recombinant proteins, DNA substrates and cell lines are available without restriction upon requests, which should be directed to the lead contact, Weixing Zhao (zhaow2@uthscsa.edu).

Data and code availability

Western blot has been deposited at Mendeley: https://doi.org/10.17632/9s37k6s8jr.1 and is publicly available as of the date of publication. DOI is listed in the key resources table.

All data reported in this publication will be shared by the lead contact upon request.

This paper does not report the original code.

Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Acknowledgments

We are grateful to Jeffery Parvin, Andrew Deans, Song Tan, and Rachel Klevit for the plasmids. This study was supported by a V Scholar Cancer Research Grant, a Young Investigator Award from the Max and Minnie Tomerlin Voelcker Fund, a research award from the Cancer Prevention and Research Institute of Texas (RP210102 ), an NIH research RO1 grant (R01GM141091 ), and an American Cancer Society research scholar grant (RSG-22-721675-01-DMC ) awarded to W.Z.

Author contributions

O.F., B.W., M.W., R.M., and W.L. performed the experiments. O.F., W.L., and W.Z. designed the experiments and wrote the manuscript. O.F., B.W., W.L., and W.Z. proofread and revised the manuscript.

Declaration of interests

The authors declare no competing interests.
==== Refs
References

1 Wang M. Li W. Tomimatsu N. Yu C.H. Ji J.H. Alejo S. Witus S.R. Alimbetov D. Fitzgerald O. Wu B. Crucial roles of the BRCA1-BARD1 E3 ubiquitin ligase activity in homology-directed DNA repair Mol. Cell 83 2023 3679 3691.e8 10.1016/j.molcel.2023.09.015 37797621
2 Witus S.R. Stewart M.D. Klevit R.E. The BRCA1/BARD1 ubiquitin ligase and its substrates Biochem. J. 478 2021 3467 3483 10.1042/BCJ20200864 34591954
3 Wu W. Koike A. Takeshita T. Ohta T. The ubiquitin E3 ligase activity of BRCA1 and its biological functions Cell Div. 3 2008 1 10.1186/1747-1028-3-1 18179693
4 Densham R.M. Morris J.R. The BRCA1 Ubiquitin ligase function sets a new trend for remodelling in DNA repair Nucleus 8 2017 116 125 10.1080/19491034.2016.1267092 28032817
5 Christensen D.E. Brzovic P.S. Klevit R.E. E2-BRCA1 RING interactions dictate synthesis of mono- or specific polyubiquitin chain linkages Nat. Struct. Mol. Biol. 14 2007 941 948 10.1038/nsmb1295 17873885
6 Shim Y. Duan M.R. Chen X. Smerdon M.J. Min J.H. Polycistronic coexpression and nondenaturing purification of histone octamers Anal. Biochem. 427 2012 190 192 10.1016/j.ab.2012.05.006 22617796
7 McGinty R.K. Makde R.D. Tan S. Preparation, Crystallization, and Structure Determination of Chromatin Enzyme/Nucleosome Complexes Methods Enzymol. 573 2016 43 65 10.1016/bs.mie.2016.01.003 27372748
8 Tan W. Murphy V.J. Charron A. van Twest S. Sharp M. Constantinou A. Parker M.W. Crismani W. Bythell-Douglas R. Deans A.J. Preparation and purification of mono-ubiquitinated proteins using Avi-tagged ubiquitin PLoS One 15 2020 e0229000 10.1371/journal.pone.0229000
9 Zhao W. Steinfeld J.B. Liang F. Chen X. Maranon D.G. Jian Ma C. Kwon Y. Rao T. Wang W. Sheng C. BRCA1-BARD1 promotes RAD51-mediated homologous DNA pairing Nature 550 2017 360 365 10.1038/nature24060 28976962
10 Brzovic P.S. Keeffe J.R. Nishikawa H. Miyamoto K. Fox D. 3rd Fukuda M. Ohta T. Klevit R. Binding and recognition in the assembly of an active BRCA1/BARD1 ubiquitin-ligase complex Proc. Natl. Acad. Sci. USA 100 2003 5646 5651 10.1073/pnas.0836054100 12732733
11 Pichler A. Knipscheer P. Oberhofer E. van Dijk W.J. Körner R. Olsen J.V. Jentsch S. Melchior F. Sixma T.K. SUMO modification of the ubiquitin-conjugating enzyme E2-25K Nat. Struct. Mol. Biol. 12 2005 264 269 10.1038/nsmb903 15723079
12 Brzovic P.S. Lissounov A. Christensen D.E. Hoyt D.W. Klevit R.E. A UbcH5/ubiquitin noncovalent complex is required for processive BRCA1-directed ubiquitination Mol. Cell 21 2006 873 880 10.1016/j.molcel.2006.02.008 16543155
13 Jin J. Li X. Gygi S.P. Harper J.W. Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging Nature 447 2007 1135 1138 10.1038/nature05902 17597759
14 Witus S.R. Burrell A.L. Farrell D.P. Kang J. Wang M. Hansen J.M. Pravat A. Tuttle L.M. Stewart M.D. Brzovic P.S. BRCA1/BARD1 site-specific ubiquitylation of nucleosomal H2A is directed by BARD1 Nat. Struct. Mol. Biol. 28 2021 268 277 10.1038/s41594-020-00556-4 33589814
15 Witus S.R. Tuttle L.M. Li W. Zelter A. Wang M. Kermoade K.E. Wilburn D.B. Davis T.N. Brzovic P.S. Zhao W. Klevit R.E. BRCA1/BARD1 intrinsically disordered regions facilitate chromatin recruitment and ubiquitylation EMBO J. 42 2023 e113565 10.15252/embj.2023113565
