
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)13356-7
10.1016/j.heliyon.2024.e37325
e37325
Research Article
Evaluation of cadmium effects on the glucose metabolism on insulin resistance HepG2 cells
Li Changhao a
Lin Ke b
Xiao Liang a
Dilixiati Yilimilai a
Huo Yuan a
Zhang Zengli zhangzengli@suda.edu.cn
a⁎
a School of Public Health, Soochow University, Suzhou, 215123, China
b Center for Disease Control and Prevention of Xishan District, Wuxi, 214000, Jiangsu, China
⁎ Corresponding author. School of Public Health, Soochow University, 199 Renai Road, Suzhou, Jiangsu, 215123, China. zhangzengli@suda.edu.cn
02 9 2024
15 9 2024
02 9 2024
10 17 e373253 6 2024
11 8 2024
1 9 2024
© 2024 Published by Elsevier Ltd.
2024

https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Cadmium (Cd) is an environmental endocrine disruptor. Despite increasing research about the metabolic effects of Cd on HepG2 cells, information about the metabolic effects of Cd on insulin resistance HepG2 (IR-HepG2) cells is limited. Currently, most individuals with diabetes are exposed to Cd due to pollution. Previously, we reported that Cd exposure resulted in decreased blood glucose levels in diabetic mice, the underlying mechanism deserves further study. Therefore, we used palmitic acid (0.25 mM) to treat HepG2 cells to establish IR-HepG2 model. IR-HepG2 cells were exposed to CdCl2 (1 μM and 2 μM). Commercial kits were used to measure glucose production, glucose consumption, ROS and mitochondrial membrane potential. Western blot and qRT-PCR were used to measure the proteins and genes of glucose metabolism. In the current study setting, we found no significant changes in glucose metabolism in Cd-exposed HepG2 cells, but Cd enhanced glucose uptake, inhibited gluconeogenesis and activated the insulin signaling pathway in IR-HepG2 cells. Meanwhile, we observed that Cd caused oxidative stress and increased the intracellular calcium concentration and inhibited mitochondrial membrane potential in IR-HepG2 cells. Cd compensatingly increased glycolysis in IR-HepG2 cells. Collectively, we found Cd ameliorated glucose metabolism disorders in IR-HepG2 cells. Furthermore, Cd exacerbated mitochondrial damage and compensatory increased glycolysis in IR-HepG2 cells. These findings will provide novel insights for Cd exposure in insulin resistant individuals.

Graphical abstract

Image 1

Highlights

• Cd at low dosing activated the insulin signaling pathway and improved glucose metabolic disorders in IR-HepG2 cells.

• Cd induced mitochondrial damage and increased ROS in IR-HepG2 cells.

• Cd promoted glycolysis and increased lactic acid levels in IR-HepG2 cells.

Keywords

Heavy metal
Low dosing exposure
Hormesis
HepG2
Glucose metabolism
==== Body
pmc1 Introduction

Cadmium (Cd) is an environmental contaminant with endocrine-disrupting effects. Due to rapid urbanization and industrialization in the last century, amount of farmland and water is polluted with Cd [1]. Non-occupational individuals are exposed to Cd through the consumption of contaminated food and water, leading to a gradual increase in the prevalence of Cd burden in human beings [1,2]. Cd is frequently detected in non-occupational individual biological samples, such as urine and serum, and has adverse health effects [[3], [4], [5]]. Besides the well-known osteotoxicity and nephrotoxicity, studies have shown that urinary Cd levels are associated with increased risk of diabetes [[6], [7], [8]]. Additionally, studies have reported that elevated blood Cd levels are closely associated with insulin resistance and hyperglycemia [9]. The animal study also demonstrated that Cd exposure increases blood glucose levels and induces diabetes in rats [[10], [11], [12]]. However, other studies found no significant association between Cd exposure and glucose metabolism [[13], [14], [15]]. All of the previous studies have focused on metabolic effects of Cd in healthy individuals or animals. However, with the increasing prevalence of diabetes and widespread Cd pollution, it is necessary to recognize the metabolic effects of Cd in diabetic individuals. Our previous study found that Cd played hypoglycemic effect in diabetic mice at low dosing exposure [16]. In addition, another study also reported that low dosing Cd exposure improved glucose tolerance in NAFLD mice [17].

Liver plays a critical role in glucose metabolism. Disrupted hepatic IRS-1/PI3K/AKT insulin signaling cascade, which is characterized by inhibited expression of PI3K and phosphorylation of AKT and promoted phosphorylation of IRS-1 (Ser307), induced hepatic insulin resistance. Hepatic insulin resistance led to decrease hepatic glucose uptake and glycogen synthesis and increased hepatic gluconeogenesis, ultimately contributing to hyperglycemia and type 2 diabetes [[18], [19], [20], [21]]. Meantime, liver, as the largest detoxification organ of the organism, is one of the targets of Cd. Study reported that Cd disrupted hepatic IRS-1/PI3K/AKT insulin signaling cascade, leading to hepatic insulin resistance and hyperglycaemia in mice [22]. Additionally, study also reported that Cd increases hepatic gluconeogenesis and increases blood glucose levels in rats [23,24]. Besides Cd, other heavy metals, such as lead and mercury, have also been reported to induce hepatic gluconeogenesis and insulin resistance [[25], [26], [27]]. Intriguingly, different from these studies, our previous study found that Cd exposure resulted in decreased blood glucose levels in diabetic mice via inhibiting hepatic gluconeogenesis and promoting hepatic glycolysis [16].

HepG2 cells, a recognized model for the human hepatocyte, are widely applied for metabolic effects research [28]. Despite increasing research about the metabolic effects of Cd on HepG2 cells, information about the metabolic effects of Cd on insulin resistance HepG2 (IR-HepG2) cells is limited. Meanwhile, it is lacking confident evidence in our previous study which found that Cd played hypoglycemic effect in diabetic mice [16]. In the present study, we used palmitic acid (PA, 0.25 mM) treated HepG2 cells to establish classical IR-HepG2 model [29]. IR-HepG2 cells were exposed to Cd, exploring the detailed effects of Cd exposure on IR-HepG2 cells and the underlying mechanism. Currently, most individuals with diabetes are exposed to Cd due to pollution. Our findings will provide novel insights for Cd exposure in insulin resistant individuals.

2 Materials and methods

2.1 Cell culture

HepG2 cells (Procell, China) were cultured in DMEM (Procell, PM150210, China), 1 % penicillin/streptomycin (Beyotime, China) and 10 % FBS (Gibco, USA) at 37 °C in a humidified incubator of 5 % CO2. When the HepG2 cells were grown to 80 %, we harvested the cells during the logarithmic phase of growth for the following experiments.

2.2 FFA-induced insulin resistance in HepG2 cells

HepG2 cells were seeded into a 96-well plate at a density of 1 × 105 cells/well overnight. After cell attachment, the medium was replaced by fresh complete DMEM. According to previous research for establishing IR-HepG2 model, cells (n = 3 for each concentration) were then exposed to PA (Sigma, P0500, USA) of varied concentrations 0.125 mM, 0.25 mM, 0.5 mM, and 1.0 mM for 24 h [29]. The glucose consumption and the proteins of insulin signaling pathways were determined to indicate the occurrence of insulin resistance.

2.3 Cell viability assay

HepG2 cells were seeded into a 96-well plate at a density of 1 × 105 cells/well. After overnight, cells (n = 3 for each concentration) were treated with cadmium chloride (CdCl2, Sigma, 202908, USA) of a series of concentrations (0, 0.5, 1, 2, 5, 10, 20, 40 μM) and 0.25 mM PA and incubated for 24 h. Then the viability of cells was established by CCK-8 (Beyotime, C0037, China) assay following the manufacturer's instruction.

According to CCK8 results, cells were divided into six groups: Control group, 1 μM CdCl2 group, 2 μM CdCl2 group, IR-HepG2 cells group (PA, 0.25 mM), PA (0.25 mM) +1 μM CdCl2 group, and PA (0.25 mM) +2 μM CdCl2 group.

2.4 Glucose consumption assay

After treatment, following the manufacturer's instruction, the medium (n = 3 for each group) was determined for glucose content with glucose assay kit (Nanjing Jiancheng Bio-engineering Institute, F006-1-1, China). Glucose consumption was calculated as the difference of glucose concentration between the blank group and test groups (glucose consumption = glucose concentration of blank wells - glucose concentration of wells with cells).

2.5 Glucose production assay

Cells (n = 3 for each group) were washed three times with PBS to remove glucose, incubated for 5 h in 1 ml of glucose production medium (glucose and phenol red-free DMEM, containing gluconeogenic substrates, 20 mM sodium lactate, and 2 mM sodium pyruvate), and in the presence of 100 nM insulin (Solarbio, 11061-68-0, China) during the last 20 min. The medium was collected for the measurement of glucose concentration using a glucose assay kit.

2.6 Detection of lactic acid

The medium and cell pellets were collected to measure the contents of lactate (n = 3 for each group) using corresponding commercial kits (Nanjing Jiancheng Bio-engineering Institute, A020-2-2, China).

2.7 Detection of mitochondrial membrane potential

Detection of the mitochondrial membrane potential (n = 3 for each group) was performed using an enhanced mitochondrial membrane potential assay kit with JC-1 (Beyotime, C2003S China). 500,000 cells/sample were added with 500 μL JC-1 and analyzed for their fluorescence intensity using flow cytometry instrument (Beckman Coulter, USA).

2.8 Detection of Ca2+ levels

The collected cells (n = 3 for each group) were incubated in 5 μM Fluo-3 AM (Beyotime, S1056, China) at 37 °C for 20 min according to the instructions of manufacturer. Then, the cells were washed with PBS and incubated at 37 °C for 20 min. The intracellular Ca2+ levels were measured by flow cytometry instrument.

2.9 Measurement of reactive oxygen species (ROS)

The cells (n = 3 for each group) were washed with PBS and incubated with 10 μM DCFH-DA (Beyotime, S0033S, China) at 37 °C for 20 min. Cells were then washed twice with PBS and analyzed by flow cytometry instrument or microscope (Olympus, Japan).

2.10 Quantitative real-time PCR (qRT-PCR)

FastPure®Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, China) was used to extract total RNA from cells (n = 3 for each group). RNA concentration was quantified by NanoDrop Ultra-Micro spectrophotometer (Thermo, USA). Total RNA (1000 ng/sample) was reverse‐transcribed into cDNA using the PrimeScript RT reagent Kit (Takara, JAPAN), followed by qPCR with SYBR Green (Vazyme, China) using QuantStudio6 Flex Real-Time PCR System (Thermo, USA). β-actin was reference. The sequences of the forward (F) and reverse (R) primers such as glucose transporter 2 (GLUT2), pyruvate kinase M2 (PKM2), lactate dehydrogenase A (LDHA), glucose-6-phosphatase (G6pase), phosphoenolpyruvate carboxykinase 1 (PCK-1), glutathione peroxidase 4 (GPX4), catalase (CAT), interleukin6 (IL-6), interleukin1β (IL-1β), and tumor necrosis factor α (TNF-α) were presented in Table 1.Table 1 The primer sequences for RT-PCR.

Table 1Gene name	Forward sequence (5′–3′)	Reverse sequence (5′–3′)	
β-actin	CACAGAGCCTCGCCTTTGC	CCATCACGCCCTGGTGC	
GLUT2	AATTGCTCCAACCGCTCTCA	CTAATAAGAATGCCCGACGAT	
PKM-2	TGTCTGGAGAAACAGCCAAG	TCCTCGAATAGCTGCAAGTG	
LDHA	ATGGCAACTCTAAAGGATCAGC	CCAACCCCAACAACTGTAATCT	
G6pase	TACGTGATGGTCACATCTACTCT	TTCTGCAACAGCAATGCCTGA	
PCK-1	GGCTACAACTTCGGCAAATACC	GGAAGATCTTGGGCAGTTTGC	
IL-6	GCCAGAGCTGTGCAGATGAG	TCAGCAGGCTGGCATTTG	
TNF-α	AGCCCTGGTATGAGCCCATCTATC	TCCCAAAGTAGACCTGCCCAGAC	
IL-1β	AGCTACGAATCTCCGACCAC	CGTTATCCCATGTGTCGAAGAA	
GPX4	CCGCTGTGGAAGTGGATGAAGATC	CTTGTCGATGAGGAACTGTGGAGAG	
CAT	GTGCGGAGATTCAACACTGCCA	CGGCAATGTTCTCACACAGACG	

2.11 Western blot

The collected cells (n = 3 for each group) were lysed in RIPA buffer (Fudebio-tech, China), and the lysate was centrifuged at 12,000×g at 4 °C for 10 min. The levels of proteins in the supernatant were determined using a BCA kit (Beyotime, China). Equal amounts of cell lysate (30 μg protein) were separated by 10 % sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, Beyotime, China) and were transferred to polyvinylidene difluoride (PVDF, Millipore, USA) membrane. The membranes were blocked with 5 % non-fat dry milk for 1.5 h, and then incubated with the different primary antibodies such as phosphorylation-insulin receptor substrate-1 (P-IRS-1, Ser307, 2381, 1:1000, CST), IRS-1 (3407S, 1:1000, CST), phosphoinositide 3-kinase (PI3K, 4249, 1:1000, CST), hexokinase-2(HK-2, 2867, 1:1000, CST), PKM-2 (4053, 1:1000, CST), LDHA (2012, 1:1000, CST), phosphorylation-glycogen synthase kinase-3β (P-GSK-3β, 5558, 1:1000, CST), GSK-3β (27C10, 1:1000, CST), glycogen phosphorylase (PYGL, A6710, 1:1000, Abcloanl), phosphorylation-protein kinase B (P-AKT, AP1453, 1:1000, Abcloanl), and AKT (A22533, 1:1000, Abcloanl) overnight. After washing the membrane with TBST, the membranes were incubated at room temperature with secondary antibodies for 1 h. The immunoblots were visualized by enhanced chemiluminescence (Fudebio-tech, China) and captured by Chemiluminescent Imaging System (Tanon Science & Technology, China). Relative levels of protein were quantified by ImageJ software.

2.12 Statistical analysis

All quantitative data were expressed as the mean ± SD. Comparisons between two groups were analyzed using Student's t-test, and comparisons between more than two groups were made using One-way ANOVA with Student–Newman–Keuls (SNK) multiple comparison test to identify differences among means. A value of P < 0.05 was considered statistically significant. Statistical analyses were performed by SPSS 25.0, and graphs were created using GraphPad Prism 8.

3 Results

3.1 IR-HepG2 cell model establishment and Cd treatment

HepG2 cells were exposed to varying concentrations of PA (0.125 mM, 0.25 mM, 0.5 mM, and 1 mM). The lowest glucose consumption levels were observed in HepG2 cells exposed to 0.25 mM PA (P<0.001, Fig. 1A). Additionally, the phosphorylation level of AKT was significantly decreased (P<0.01, Fig. 1B and C) in HepG2 cells exposed to 0.25 mM PA. The expression of PCK-1 and G6pase was significantly up-regulated, and the level of glucose production was increased in HepG2 cells exposed to 0.25 mM PA (P<0.05, Fig. 2C–E).Fig. 1 IR-HepG2 cell model establishment and Cd treatment (n = 3 for each group). A: Glucose consumption levels; B: Protein expression of P-AKT and AKT in HepG2 cells treated with 0.25 mM PA; C: The quantization of P-AKT/AKT protein expression levels; D: Effect of Cd on HepG2 cell viability; E: Effect of Cd on IR-HepG2 cells viability. *P < 0.05, **P < 0.01, ***P < 0.001, vs. CON group.

Fig. 1

Fig. 2 The effect of Cd on glucose metabolism in IR-HepG2 cells (n = 3 for each group). A: Glucose consumption levels; B: The quantization of GLUT2 relative expression level; C: Glucose production levels; D: The quantization of PCK-1 relative expression levels; E: The quantization of G6Pase relative expression levels; F: The expression of glycogen synthesis and decomposition related protein; G: The quantization of P-GSK-3β/GSK-3β protein expression levels; H: The quantization of PYGL protein expression levels. *P < 0.05, **P < 0.01, ***P < 0.001, vs. CON group. #P < 0.05, # #P < 0.01, # # #P < 0.001, vs. IR-HepG2 cells group.

Fig. 2

HepG2 cells were treated with different concentrations of CdCl2 (0–40 μM) for 24 h. The viability of HepG2 cell was significant decreased when CdCl2 concentration exceeded 10 μM (P<0.05, Fig. 1D). Culturing cells with varying concentrations of CdCl2 (0–20 μM) and 0.25 mM PA for 24 h revealed that Cd significantly influenced the viability of IR-HepG2 cells when the CdCl2 concentration exceeded 5 μM (P < 0.05, Fig. 1E). So, 1 μM and 2 μM CdCl2 were finally selected for subsequent experiments.

3.2 Cd improved glucose metabolism disorders

Compared to the control, the glucose consumption was no significant change in Cd-exposed HepG2 cells, IR-HepG2 cells showed lower glucose consumption levels (P<0.05, Fig. 2A). However, Cd (1 μM and 2 μM) significantly increased glucose consumption levels in IR-HepG2 cells (P<0.01, Fig. 2A). It was found that Cd (1 μM and 2 μM) had no effects on the expression of GLUT2 in HepG2 cells. The expression of GLUT2 in IR-HepG2 cells was lower than that in the control. Cd (1 μM and 2 μM) significantly up-regulated the expression of GLUT2 in IR-HepG2 cells (P<0.05, Fig. 2B).

Compared with the control, IR-HepG2 cells exhibited significantly increased glucose production levels and significant up-regulation of expression of PCK-1 and G6pase (P<0.05, Fig. 2C–E). In comparison with IR-HepG2, Cd (2 μM) significantly decreased glucose production levels and down regulated the expression of PCK-1 and G6pase in IR-HepG2 cells (P<0.05, Fig. 2C–E).

The protein expression of P-GSK-3β/GSK-3β in IR-HepG2 cells was significantly decreased compared with the control (P<0.01, Fig. 2F and G). Cd (2 μM) significantly promoted the protein expression of P-GSK-3β/GSK-3β in IR-HepG2 cells (P<0.05, Fig. 2F and G). The expression of PYGL was not significant change in Cd (1 μM and 2 μM) exposed HepG2 cells, IR-HepG2 cells and Cd (1 μM and 2 μM) exposed IR-HepG2 cells (P > 0.05, Fig. 2H).

3.3 Cd activated IRS-1/PI3K/AKT signaling pathway

Compared with the control, it was found that Cd (1 μM and 2 μM) had no effects on the expression of phosphorylated IRS-1 (Ser307), PI3K and phosphorylated AKT in HepG2 cells. There was a significant increase in the phosphorylation level of IRS-1 (Ser307), a significant decrease in the expression of PI3K protein, and a significant decrease in the phosphorylation level of AKT in IR-HepG2 cells (P<0.05, Fig. 3A–D). Compared with IR-HepG2, significantly decreased phosphorylation levels of IRS-1(Ser307) and increased expression of PI3K protein were found in Cd exposed (1 μM and 2 μM) IR-HepG2 cells, and significantly increased phosphorylation levels of AKT were only found in 2 μM Cd exposed IR-HepG2 cells (P<0.05, Fig. 3A–D).Fig. 3 The effect of Cd on IRS-1/PI3K/AKT pathway in IR-HepG2 cells (n = 3 for each group). A The expression of IRS-1/PI3K/AKT pathway related protein; B: The quantization of P-IRS-1 (Ser307)/IRS-1 protein expression levels; C: The quantization of PI3K protein expression levels; D: The quantization of P-AKT/AKT protein expression levels. *P < 0.05, **P < 0.01, vs. CON group; #P < 0.05, # #P < 0.01, vs. IR-HepG2 cells group.

Fig. 3

3.4 Cd enhanced glycolysis

Compared to the control, the protein expression of HK-2, PKM-2, and LDHA were not significantly change in IR-HepG2 cells. Cd (2 μM) significantly increased the protein expression of HK-2, PKM-2 and LDHA in IR-HepG2 cells (P<0.05, Fig. 4A–F). The intracellular lactic acid level in IR-HepG2 cells was slightly higher than that in the control, but the difference was not statistically significant (P = 0.48, Fig. 4G). The lactate in the IR-HepG2 cell culture medium was significantly higher than that in the control, and Cd at dosing of 2 μM significantly increased the lactate in the IR-HepG2 cell culture medium (P<0.001, Fig. 4H).Fig. 4 The effect of Cd on glycolysis in IR-HepG2 cells (n = 3 for each group). A: The expression of glycolysis related protein; B: The quantization of HK-2 protein expression levels; C: The quantization of PKM-2 protein expression levels; D: The quantization of LDHA protein expression levels; E: The quantization of PKM-2 relative expression levels; F: The quantization of LDHA relative expression levels; G: Intracellular lactate levels; H: Extracellular lactate levels.*P < 0.05, ***P < 0.001, vs. CON group; #P < 0.05, # #P < 0.01, # # #P < 0.001, vs. IR-HepG2 cells group.

Fig. 4

3.5 Cd aggravated mitochondria damage and oxidative stress

Mitochondrial membrane potential (MMP) levels in IR-HepG2 cells were significantly lower than those in the control (P<0.001, Fig. 5A). Cd (1 μM and 2 μM) significantly reduced MMP levels in IR-HepG2 cells (P<0.001, Fig. 5A). Compared with the control group, the intracellular calcium levels were significantly increased in Cd-exposed (1 μM and 2 μM) HepG2 cells and IR-HepG2 cells (P<0.001, Fig. 5B). Cd (1 μM and 2 μM) substantially and significantly increased intracellular calcium levels in IR-HepG2 cells (P<0.001, Fig. 5). Compared to the control group, increased ROS were found in IR-HepG2 cells, but it was not statistically significant. Cd (2 μM) significantly increased intracellular ROS levels in IR-HepG2 cells (P<0.05, Fig. 5C and D). Significant inhibition of gene expression of antioxidant such as GPX4 and CAT were found in IR-HepG2 cells, Cd (2 μM) significantly inhibited the gene expression of GPX4 in IR-HepG2 cells (P<0.05, Fig. 5E).Fig. 5 The effect of Cd on mitochondrial damage and oxidative stress in IR-HepG2 cells (n = 3 for each group). A: Mitochondrial membrane potential levels; B: Calcium level; C: ROS levels; D: Intracellular ROS fluorescence levels; E: The quantization of GPX4 and CAT relative expression levels. **P < 0.01, ***P < 0.001, vs. CON group; #P < 0.05, # # #P < 0.001, vs. IR-HepG2 cells group.

Fig. 5

3.6 Cd promoted the inflammatory response

Compared with the control, IR-HepG2 cells exhibited a significant up-regulation in the expression of TNF-α and IL-1β (P<0.05, Fig. 6B and C), while there was no significant alteration in the expression of IL-6 (P = 0.85, Fig. 6A). Compared with IR-HepG2, Cd (1 μM) significantly up-regulated expression of IL-6 in IR-HepG2 cells (P<0.05, Fig. 6A). Cd (2 μM) significantly up-regulated expression of TNF-α and IL-1β in IR-HepG2 cells (P<0.05, Fig. 6B and C).Fig. 6 The effect of Cd on inflammatory factors in IR-HepG2 cells (n = 3 for each group). A: The quantization of IL-6 relative expression levels; B: The quantization of TNF-α relative expression levels C: The quantization of IL-1β relative expression levels. *P < 0.05, **P < 0.01, vs. CON group; # #P < 0.01, vs. IR-HepG2 cells group.

Fig. 6

4 Discussion

Several lines of evidence show that Cd is closely associated with insulin resistance and glucose metabolic disorders in epidemiological or experimental studies [6,11,30]. However, the glucose metabolic effects of Cd on insulin resistant individuals are scarce. Previously, we reported that Cd exposure resulted in decreased blood glucose levels in diabetic mice via inhibiting hepatic glucongenesis and promoting hepatic glycolysis [16]. In current study, we found that Cd (1 μM and 2 μM) had no obvious effect on glucose metabolism in HepG2 cells. However, Cd enhanced glucose uptake, inhibited gluconeogenesis and activated the insulin signaling pathway in IR-HepG2 cells.

The effects of Cd exposure on HepG2 cells are different from IR-HepG2 cells. No obvious effects on glucose metabolism were found in HepG2 cells exposed Cd. It is reported that HepG2 cells were exposed to 3 μM Cd for 72 h resulted in reduced glucose uptake and increased gluconeogenesis. Human mature adipocytes were treated with 10 μM Cd for 48 h resulted in insulin resistance [31,32]. The inconsistent results might be due to the low exposure dosing and short exposure period of Cd in current study. However, lack of detection of intracellular Cd concentration and metallothionein levels were the limits of the current study.

Free fatty acids, such as PA, can successfully induce insulin resistance in HepG2 cells [29,33,34]. Hepatic insulin resistance is characterized by suppressed glycogen synthesis, enhanced gluconeogenesis, compromised cellular glucose uptake, and disrupted insulin signaling cascade [35]. In the current study, we found that PA treated HepG2 cells exhibited reduced glucose uptake and increased gluconeogenesis. We also found disrupted IRS-1/PI3K/AKT insulin signaling cascade in PA-treated HepG2 cells, which was evidenced by significantly reduced expression of PI3K protein and phosphorylation of AKT, as well as significantly increased phosphorylation of IRS-1 (Ser307). These findings indicated that PA-treated HepG2 cells developed glucose metabolic disorder and insulin resistance [29].

Cd ameliorated the glucose metabolic disorder in IR-HepG2 cells. The improvement effect of Cd on glucose metabolic disorder in IR-HepG2 cells was evident by the activation of the insulin signaling pathway, which promoted glucose uptake and inhibited gluconeogenesis. In the current study, we found that Cd increased glucose consumption levels and significantly upregulated the expression of GLUT2 in IR-HepG2 cells, indicating that Cd enhanced glucose uptake. This may be related to that Cd activated insulin signaling pathway in IR-HepG2 cells. Our study observed that Cd promoted PI3K expression and induced AKT phosphorylation, suggesting that Cd activated the insulin signaling pathway. The activation of insulin signaling pathway facilitated GLUT2 translocation, which in turn improved glucose transport into hepatocytes to increase glucose uptake [36]. In parallel with our results, a study also reported that carboxylate of Cd enhanced glucose uptake in diabetic mice by activated insulin signaling pathway [37].

The activation of the insulin signaling pathway also promotes glycogen synthesis and suppresses hepatic gluconeogenesis. Our study found that Cd increased the phosphorylation of GSK-3β, a key enzyme in glycogen synthesis, suggesting a potential role for Cd in promoting glycogen synthesis in IR-HepG2 cells. Similar findings were also found that Cd increased GSK-3β activity and hepatic glycogen synthesis in Wistar rats [38]. Meanwhile, we found that Cd suppressed the expression of G6Pase and PCK-1, which are critical enzymes in hepatic gluconeogenesis, resulting in inhibited glucose production in IR-HepG2 cells. These findings provided clear support for our previous study that the inhibitory effect of Cd on hepatic gluconeogenesis, led to decreased blood glucose in diabetic mice [16].

A key observation of our current study is when Cd had no obvious effects on glucose metabolism in HepG2 cells, it had an ameliorated effect on glucose metabolism disorder in IR-HepG2 cells. We speculate that the result might be the hormesis effect of low-dose Cd in a state of metabolic disorder. Coincidentally, one study also reported that Cd improved hepatic metabolism disorder in NAFLD mice at low dosing exposure [17]. Likewise, some pollutants such as perfluorooctanoate and bisphenol F have been reported to improve metabolism disorder in metabolic syndrome animals at low dosing exposure [39,40]. However, the ameliorated effects of Cd on glucose metabolism under insulin resistance are never reported. This phenomenon deserves further exploration.

Currently, because of widespread Cd pollution, the effects of Cd exposure on glucose metabolism attract considerable attention. However, there is no consensus on the relationship between Cd and glucose metabolism disorder. Several cross-sectional studies have reported that Cd exposure induces insulin resistance, disturbs glucose metabolism in adolescents, and increases the prevalence of prediabetes in adults [30,41,42]. Likewise, chronic Cd exposure has also been linked to hepatic insulin resistance and increased blood glucose levels in rats [10,43]. In contrast, some studies have found no association between Cd exposure and glucose metabolism disorder [[44], [45], [46]]. One epidemiological investigation found that urinary Cd levels were not associated with diabetes [45]. Moreover, a study found that blood Cd levels were not linked to diabetes prevalence after adjusting for age, sex, BMI, region, smoking, alcohol consumption, and other factors [13]. In animal experiments, Cd exposure did not result in insulin resistance and hyperglycemia in mice [14]. In current study, we found that Cd (1 μM and 2 μM) had no significant effects on glucose metabolism in HepG2 cells, it had an ameliorated effect on glucose metabolism disorder in IR-HepG2 cells. The different roles of Cd in glucose metabolism might be influenced by multiple factors, including the toxicokinetics of Cd in vivo and in vitro, exposure duration or doses, nutritional condition, or other unknown factors.

In current study, we found that Cd caused mitochondrial impairment and oxidative stress in IR-HepG2 cells. Meanwhile, Cd significantly inhibited the expression of GPX4 in IR-HepG2 cells and reduced antioxidant capacity of IR-HepG2 cells. Cd substantially increased intracellular calcium content in IR-HepG2 cells, inducing mitochondrial calcium overload, which led to the decrease of mitochondrial membrane potential and induced mitochondria damage [47]. Additionally, damaged mitochondria produced ROS and inhibited antioxidant levels, which further damage mitochondria [[48], [49], [50]].

As an adaptive response to mitochondrial damage, cells may enhance glycolysis to meet energy needs [51,52]. Our study found that Cd increased the expression of key glycolytic enzymes, HK2 and PKM2 in IR-HepG2 cells, enhancing glycolytic capacity, which increased glucose consumption. These observations align with findings from our previous research, which Cd significantly promoted liver glycolysis, leading to decrease blood glucose in diabetic mice [16]. Nevertheless, our research found that Cd increased the expression of LDHA in IR-HepG2 cells and elevated lactic acid levels in the culture medium. Based on our results, we speculate that Cd-induced mitochondrial damage hinders pyruvate, a product of glycolysis, transport into the mitochondria. This interruption prevents pyruvate proceeding TCA cycle to generate energy, leading to compensatory increases in glycolysis in cytoplasm to meet energy needs. Moreover, it simultaneously promotes the conversion of pyruvate into lactic acid in the cytoplasm, resulting in elevated lactic acid levels. The elevation of lactic acid levels could then potentially induce an inflammatory response [[53], [54], [55]]. In current study, we found that Cd aggravated inflammation in IR-HepG2 cells. Therefore, despite Cd ameliorates glucose metabolism disorder in IR-HepG2 cells, it is also necessary to further study the negative effects caused by Cd in IR-HepG2 cells.

One study reported that HepG2 might not be the most accurate model to study liver insulin signaling [56]. In current study, the only HepG2 cell line was utilized, which was a major limit. Other hepatocyte cell line or primary hepatocyte cell should be test in the future study. Additionally, mechanism of Cd activates insulin signaling pathway in IR-HepG2 cells while causing mitochondrial damage and oxidative stress is not fully understood. We speculate that the two kinds of effects were through different pathways. However, it can not be excluded other possibilities. There are evidence indicating that ROS are involved in activation of insulin signaling pathway [57,58]. Moreover, the long-term effects of Cd exposure on HepG2 and IR-HepG2 cells were unclear. Further study in this field would help us to understand glucose metabolism in diabetes under Cd pollution.

5 Conclusions

Our study is the first to find low dosing Cd improved glucose metabolism disorder in IR-HepG2. These findings are consistent with our previous animal study and provide novel insights into Cd exposure in insulin resistant individuals. Nevertheless, we can not ignore the toxicity of Cd. A number of studies have reported that Cd, as an environmental endocrine disruptor, can lead to hepatocyte glucose metabolism disorder.

Data and code availability

Data will be made available on request.

CRediT authorship contribution statement

Changhao Li: Writing – original draft, Investigation, Conceptualization. Ke Lin: Investigation, Data curation, Conceptualization. Liang Xiao: Data curation, Conceptualization. Yilimilai Dilixiati: Data curation, Conceptualization. Yuan Huo: Data curation, Conceptualization. Zengli Zhang: Writing – review & editing, Supervision, Project administration.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A Supplementary data

The following is the Supplementary data to this article:Multimedia component 1

Multimedia component 1

Acknowledgements

This research was supported by the National Natural Science Foundation of China (No.81773414).

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e37325.
==== Refs
References

1 Dosoky W.M. Farag S.A. Almuraee A.A. Youssef I.M. Awlya O.F.A. Abusudah W.F. Vitamin C and/or garlic can antagonize the toxic effects of cadmium on growth performance, hematological, and immunological parameters of growing Japanese quail Poultry Sci. 103 3 2024 103457 10.1016/j.psj.2024.103457
2 Bhattacharyya K. Sen D. Laskar P. Saha T. Kundu G. Ghosh Chaudhuri A. Ganguly S. Pathophysiological effects of cadmium(II) on human health-a critical review J. Basic Clin. Physiol. Pharmacol. 34 3 2023 249 261 10.1515/jbcpp-2021-0173 34766742
3 Xing W. Wang L. Gu W. Liang M. Wang Z. Fan D. Zhang B. Association of blood cadmium and metabolic syndrome: a cross-sectional analysis of National Health and Nutrition Examination Survey 2017-2020 Environ. Sci. Pollut. Res. Int. 30 10 2023 27150 27162 10.1007/s11356-022-24177-0 36378388
4 Akhtar E. Roy A.K. Haq M.A. von Ehrenstein O.S. Ahmed S. Vahter M. A longitudinal study of rural Bangladeshi children with long-term arsenic and cadmium exposures and biomarkers of cardiometabolic diseases Environ. Pollut. 271 2021 116333 10.1016/j.envpol.2020.116333
5 Yin G. Zhao S. Zhao M. Xu J. Ge X. Wu J. Joint and interactive effects of metal mixtures on liver damage: epidemiological evidence from repeated-measures study Ecotoxicol. Environ. Saf. 274 2024 116178 10.1016/j.ecoenv.2024.116178
6 Åkesson A. Barregard L. Bergdahl I.A. Nordberg G.F. Nordberg M. Skerfving S. Non-renal effects and the risk assessment of environmental cadmium exposure Environ. Health Perspect. 122 5 2014 431 438 10.1289/ehp.1307110 24569905
7 Sommar J.N. Svensson M.K. Björ B.M. Elmståhl S.I. Hallmans G. Lundh T. End-stage renal disease and low level exposure to lead, cadmium and mercury; a population-based, prospective nested case-referent study in Sweden Environ. Health 12 2013 9 10.1186/1476-069x-12-9 23343055
8 Debertin J.G. Holzhausen E.A. Walker D.I. Pacheco B.P. James K.A. Alderete T.L. Corlin L. Associations between metals and metabolomic profiles related to diabetes among adults in a rural region Environ. Res. 243 2024 117776 10.1016/j.envres.2023.117776
9 Pedro E.M. da Rosa Franchi Santos L.F. Scavuzzi B.M. Iriyoda T.M.V. Peixe T.S. Lozovoy M.A.B. Trace elements associated with systemic lupus erythematosus and insulin resistance Biol. Trace Elem. Res. 191 1 2019 34 44 10.1007/s12011-018-1592-7 30600500
10 Treviño S. Waalkes M.P. Flores Hernández J.A. León-Chavez B.A. Aguilar-Alonso P. Brambila E. Chronic cadmium exposure in rats produces pancreatic impairment and insulin resistance in multiple peripheral tissues Arch. Biochem. Biophys. 583 2015 27 35 10.1016/j.abb.2015.07.010 26253262
11 Sarmiento-Ortega V.E. Moroni-González D. Díaz A. Eduardo B. Samuel T. Oral subacute exposure to cadmium LOAEL dose induces insulin resistance and impairment of the hormonal and metabolic liver-adipose Axis in wistar rats Biol. Trace Elem. Res. 200 10 2022 4370 4384 10.1007/s12011-021-03027-z 34846673
12 da Costa C.S. de Oliveira T.F. Dos Santos F.C.F. Padilha A.S. Krause M. Carneiro M. Subacute cadmium exposure changes different metabolic functions, leading to type 1 and 2 diabetes mellitus features in female rats Environ. Toxicol. 2024 10.1002/tox.24306
13 Moon S.S. Association of lead, mercury and cadmium with diabetes in the Korean population: the korea national health and nutrition examination survey (KNHANES) 2009-2010 Diabet. Med. 30 4 2013 e143 e148 10.1111/dme.12103 23278294
14 Zhang J. Wang Y. Fu L. Feng Y.J. Ji Y.L. Wang H. Xu D.X. Subchronic cadmium exposure upregulates the mRNA level of genes associated to hepatic lipid metabolism in adult female CD1 mice J. Appl. Toxicol. 38 7 2018 1026 1035 10.1002/jat.3612 29572893
15 Wu W. Ren J. Wang J. Wang J. Yu D. Zhang Y. Metalloestrogens exposure and risk of gestational diabetes mellitus: evidence emerging from the systematic review and meta-analysis Environ. Res. 248 2024 118321 10.1016/j.envres.2024.118321
16 Li M. Wang S. Liu X. Sheng Z. Li B. Li J. Cadmium exposure decreases fasting blood glucose levels and exacerbates type-2 diabetes in a mouse model Endocrine 76 1 2022 53 61 10.1007/s12020-021-02974-w 35041127
17 Young J.L. Cave M.C. Xu Q. Kong M. Xu J. Lin Q. Whole life exposure to low dose cadmium alters diet-induced NAFLD Toxicol. Appl. Pharmacol. 436 2022 115855 10.1016/j.taap.2021.115855
18 Galicia-Garcia U. Benito-Vicente A. Jebari S. Larrea-Sebal A. Siddiqi H. Uribe K.B. Pathophysiology of type 2 diabetes mellitus Int. J. Mol. Sci. 21 17 2020 10.3390/ijms21176275
19 Petersen M.C. Shulman G.I. Mechanisms of insulin action and insulin resistance Physiol. Rev. 98 4 2018 2133 2223 10.1152/physrev.00063.2017 30067154
20 Birkenfeld A.L. Shulman G.I. Nonalcoholic fatty liver disease, hepatic insulin resistance, and type 2 diabetes Hepatology 59 2 2014 713 723 10.1002/hep.26672 23929732
21 Szendroedi J. Schmid A.I. Chmelik M. Toth C. Brehm A. Krssak M. Muscle mitochondrial ATP synthesis and glucose transport/phosphorylation in type 2 diabetes PLoS Med. 4 5 2007 e154 10.1371/journal.pmed.0040154 17472434
22 Sarmiento-Ortega V.E. Moroni-González D. Diaz A. Brambila E. Treviño S. ROS and ERK pathway mechanistic approach on hepatic insulin resistance after chronic oral exposure to cadmium NOAEL dose Biol. Trace Elem. Res. 201 8 2023 3903 3918 10.1007/s12011-022-03471-5 36348173
23 Merali Z. Singhal R.L. Protective effect of selenium on certain hepatotoxic and pancreotoxic manifestations of subacute cadmium administration J. Pharmacol. Exp. Therapeut. 195 1 1975 58 66
24 Chapatwala K.D. Boykin M. Butts A. Rajanna B. Effect of intraperitoneally injected cadmium on renal and hepatic gluconeogenic enzymes in rats Drug Chem. Toxicol. 5 3 1982 305 317 10.3109/01480548209041060 7151723
25 Wan H. Wang B. Cui Y. Wang Y. Zhang K. Chen C. Low-level lead exposure promotes hepatic gluconeogenesis and contributes to the elevation of fasting glucose level Chemosphere 276 2021 130111 10.1016/j.chemosphere.2021.130111
26 Nguyen H.D. An evaluation of the effects of mixed heavy metals on prediabetes and type 2 diabetes: epidemiological and toxicogenomic analysis Environ. Sci. Pollut. Res. Int. 30 34 2023 82437 82457 10.1007/s11356-023-28037-3 37326729
27 Camsari C. Folger J.K. McGee D. Bursian S.J. Wang H. Knott J.G. Smith G.W. Effects of periconception cadmium and mercury Co-administration to mice on indices of chronic diseases in male offspring at maturity Environ. Health Perspect. 125 4 2017 643 650 10.1289/ehp481 27814245
28 Tshivhase A.M. Matsha T. Raghubeer S. Resveratrol attenuates high glucose-induced inflammation and improves glucose metabolism in HepG2 cells Sci. Rep. 14 1 2024 1106 10.1038/s41598-023-50084-6 38212345
29 Zhang Q. Kong X. Yuan H. Guan H. Li Y. Niu Y. Mangiferin improved palmitate-induced-insulin resistance by promoting free fatty acid metabolism in HepG2 and C2C12 cells via PPARα: mangiferin improved insulin resistance J. Diabetes Res. 2019 2019 2052675 10.1155/2019/2052675
30 Pizzino G. Irrera N. Bitto A. Pallio G. Mannino F. Arcoraci V. Cadmium-induced oxidative stress impairs glycemic control in adolescents Oxid. Med. Cell. Longev. 2017 2017 6341671 10.1155/2017/6341671
31 Gasser M. Lenglet S. Bararpour N. Sajic T. Wiskott K. Augsburger M. Cadmium acute exposure induces metabolic and transcriptomic perturbations in human mature adipocytes Toxicology 470 2022 153153 10.1016/j.tox.2022.153153
32 Oishi Y. Ohnishi M. Kobayashi-Hattori K. Takita T. Noguchi T. Cadmium cation increases the production and mRNA levels of insulin-like growth factor-binding protein-1 in HepG2 Biosci. Biotechnol. Biochem. 71 5 2007 1334 1337 10.1271/bbb.60679 17485842
33 Zhou Y.J. Xu N. Zhang X.C. Zhu Y.Y. Liu S.W. Chang Y.N. Chrysin improves glucose and lipid metabolism disorders by regulating the AMPK/PI3K/AKT signaling pathway in insulin-resistant HepG2 cells and HFD/STZ-Induced C57bl/6J mice J. Agric. Food Chem. 69 20 2021 5618 5627 10.1021/acs.jafc.1c01109 33979145
34 Song L. Li Y. Xu M. Exogenous nucleotides ameliorate insulin resistance induced by palmitic acid in HepG2 cells through the IRS-1/AKT/FOXO1 pathways Nutrients 16 12 2024 10.3390/nu16121801
35 Mo J. Zhou Y. Yang R. Zhang P. He B. Yang J. Ginsenoside Rg1 ameliorates palmitic acid-induced insulin resistance in HepG2 cells in association with modulating Akt and JNK activity Pharmacol. Rep. 71 6 2019 1160 1167 10.1016/j.pharep.2019.07.004 31675670
36 Sole S.S. Srinivasan B.P. Aqueous extract of tamarind seeds selectively increases glucose transporter-2, glucose transporter-4, and islets' intracellular calcium levels and stimulates β-cell proliferation resulting in improved glucose homeostasis in rats with streptozotocin-induced diabetes mellitus Nutr. Res. 32 8 2012 626 636 10.1016/j.nutres.2012.06.015 22935346
37 Bano S. Khan A.U. Asghar F. Usman M. Badshah A. Ali S. Computational and pharmacological evaluation of ferrocene-based acyl ureas and homoleptic cadmium carboxylate derivatives for anti-diabetic potential Front. Pharmacol. 8 2017 1001 10.3389/fphar.2017.01001 29387011
38 Borges L.P. Brandão R. Godoi B. Nogueira C.W. Zeni G. Oral administration of diphenyl diselenide protects against cadmium-induced liver damage in rats Chem. Biol. Interact. 171 1 2008 15 25 10.1016/j.cbi.2007.09.005 17950719
39 Lv Z. Tang Z. Huang S. Hu X. Peng C. Chen Y. In vivo hypoglycemic effects of bisphenol F exposure in high-fat diet mice Chemosphere 311 Pt 1 2023 137066 10.1016/j.chemosphere.2022.137066
40 Li X. Wang Z. Klaunig J.E. The effects of perfluorooctanoate on high fat diet induced non-alcoholic fatty liver disease in mice Toxicology 416 2019 1 14 10.1016/j.tox.2019.01.017 30711707
41 Nie X. Wang N. Chen Y. Chen C. Han B. Zhu C. Blood cadmium in Chinese adults and its relationships with diabetes and obesity Environ. Sci. Pollut. Res. Int. 23 18 2016 18714 18723 10.1007/s11356-016-7078-2 27312901
42 Chen X. Li P. Huang Y. Lv Y. Xu X. Nong H. Joint associations among non-essential heavy metal mixtures and nutritional factors on glucose metabolism indexes in US adults: evidence from the NHANES 2011-2016 Food Funct. 15 5 2024 2706 2718 10.1039/d3fo05439j 38376466
43 Moroni-González D. Sarmiento-Ortega V.E. Diaz A. Brambila E. Treviño S. Pancreatic antioxidative defense and heat shock proteins prevent islet of langerhans cell death after chronic oral exposure to cadmium LOAEL dose Biol. Trace Elem. Res. 202 8 2024 3714 3730 10.1007/s12011-023-03955-y 37955768
44 Barregard L. Bergström G. Fagerberg B. Cadmium exposure in relation to insulin production, insulin sensitivity and type 2 diabetes: a cross-sectional and prospective study in women Environ. Res. 121 2013 104 109 10.1016/j.envres.2012.11.005 23261793
45 Swaddiwudhipong W. Mahasakpan P. Limpatanachote P. Krintratun S. Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: a population study Environ. Res. 110 6 2010 612 616 10.1016/j.envres.2010.06.002 20561611
46 Wang Y. Xu T. Zhang Y. He Y. Fang J. Xu Y. Jin L. Interaction between depression and non-essential heavy metals (Cd, Pb, and Hg) on metabolic diseases J. Trace Elem. Med. Biol. 85 2024 127484 10.1016/j.jtemb.2024.127484
47 Delmotte P. Sieck G.C. Endoplasmic reticulum stress and mitochondrial function in airway smooth muscle Front. Cell Dev. Biol. 7 2019 374 10.3389/fcell.2019.00374 32010691
48 Wang J. Zhu H. Liu X. Liu Z. Oxidative stress and Ca(2+) signals involved on cadmium-induced apoptosis in rat hepatocyte Biol. Trace Elem. Res. 161 2 2014 180 189 10.1007/s12011-014-0105-6 25123461
49 Zhu M. Yan M. Musa M. Li Y. Zhang Y. Zou X. MicroRNA-129-1-3p protects chicken granulosa cells from cadmium-induced apoptosis by down-regulating the MCU-mediated Ca(2+) signaling pathway Ecotoxicol. Environ. Saf. 269 2024 115906 10.1016/j.ecoenv.2023.115906
50 Alnahdi A. John A. Raza H. Augmentation of glucotoxicity, oxidative stress, apoptosis and mitochondrial dysfunction in HepG2 cells by palmitic acid Nutrients 11 9 2019 10.3390/nu11091979
51 Li T. Han J. Jia L. Hu X. Chen L. Wang Y. PKM2 coordinates glycolysis with mitochondrial fusion and oxidative phosphorylation Protein Cell 10 8 2019 583 594 10.1007/s13238-019-0618-z 30887444
52 Ma Y.L. Kong C.Y. Guo Z. Wang M.Y. Wang P. Liu F.Y. Semaglutide ameliorates cardiac remodeling in male mice by optimizing energy substrate utilization through the Creb5/NR4a1 axis Nat. Commun. 15 1 2024 4757 10.1038/s41467-024-48970-2 38834564
53 Lin H.C. Chen Y.J. Wei Y.H. Lin H.A. Chen C.C. Liu T.F. Lactic acid fermentation is required for NLRP3 inflammasome activation Front. Immunol. 12 2021 630380 10.3389/fimmu.2021.630380
54 Tollens T. Janzing H. Broos P. The pathophysiology of the acute compartment syndrome Acta Chir. Belg. 98 4 1998 171 175 9779242
55 Sun J. Chen Y. Wang T. Ali W. Ma Y. Yuan Y. Baicalin and N-acetylcysteine regulate choline metabolism via TFAM to attenuate cadmium-induced liver fibrosis Phytomedicine 125 2024 155337 10.1016/j.phymed.2024.155337
56 Molinaro A. Becattini B. Solinas G. Insulin signaling and glucose metabolism in different hepatoma cell lines deviate from hepatocyte physiology toward a convergent aberrant phenotype Sci. Rep. 10 1 2020 12031 10.1038/s41598-020-68721-9
57 Dobrocsyova V. Slamkova M. Krskova K. Balazova L. Suski M. Olszanecki R. AVE0991, a nonpeptide angiotensin 1-7 receptor agonist, improves glucose metabolism in the skeletal muscle of obese Zucker rats: possible involvement of prooxidant/antioxidant mechanisms Oxid. Med. Cell. Longev. 2020 2020 6372935 10.1155/2020/6372935
58 Lipko M. Debski B. Mechanism of insulin-like effect of chromium(III) ions on glucose uptake in C2C12 mouse myotubes involves ROS formation J. Trace Elem. Med. Biol. 45 2018 171 175 10.1016/j.jtemb.2017.10.012 29173475
