
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)13110-6
10.1016/j.heliyon.2024.e37079
e37079
Research Article
ARMCX3 regulates ROS signaling, affects neural differentiation and inflammatory microenvironment in dental pulp stem cells
Zhou Quanying
Lei Yi leiyi22@126.com
⁎
Department of Stomatology, Wuhan Ninth Hospital, Wuhan, Hubei, 430080, China
⁎ Corresponding author. Department of Stomatology, Wuhan Ninth Hospital, No. 20, Jilin Street, Qingshan District, Wuhan, Hubei, 430080, China. leiyi22@126.com
28 8 2024
15 9 2024
28 8 2024
10 17 e3707918 6 2024
25 8 2024
27 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Background

The neural differentiation of dental pulp stem cells (DPSCs) exhibits great potential in the treatment of dental pulp repair and neurodegenerative diseases. However, the precise molecular mechanisms underlying this process remain unclear. This study was designed to reveal the roles and regulatory mechanisms of the armadillo repeat-containing X-linked 3 (ARMCX3) in neural differentiation and inflammatory microenvironment in human DPSCs (hDPSCs).

Methods

We treated hDPSCs with porphyromonas gingivalis lipopolysaccharide (Pg-LPS) to simulate the inflammatory microenvironment. Then the lentiviral vectors were introduced to construct stable cell lines with ARMCX3 knockdown or overexpression. The expression of neural-specific markers, ARMCX3 and inflammation factors were estimated by immunofluorescence (IF), quantitative real-time polymerase chain reaction (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA) assays. Additionally, we used IF assays and specific kits to investigate the regulatory role of ARMCX3 on reactive oxygen species (ROS) signaling. Moreover, a ROS inhibitor was utilized to verify whether ROS inhibition reversed the effects of ARMCX3 in Pg-LPS-treated hDPSCs.

Results

This work illustrated that Pg-LPS treatment significantly enhanced ARMCX3 expression and inflammatory response, and inhibited neural differentiation in hDPSCs. ARMCX3 knockdown effectively accelerated neural differentiation and controlled inflammatory cytokines at a lower level in hDPSCs in the presence of Pg-LPS. Additionally, knockdown of ARMCX3 notably reduced ROS production and ROS inhibition effectively eliminated the roles of ARMCX3 overexpression in hDPSCs. Besides, all results were proved to be statistically significant.

Conclusion

This investigation proved that ARMCX3 affected neural differentiation and inflammation microenvironment in hDPSCs at least partly by mediating ROS signal. These findings provided a new perspective on the mechanism of neural differentiation of hDPSCs and help to better explore the therapeutic schedule of pulpitis and neurodegenerative diseases.

Keywords

Neural differentiation
Inflammation microenvironment
ARMCX3
ROS signal
==== Body
pmc1 Introduction

In recent years, stem cells have shown great potential in treating nerve injuries and defects [1,2], because stem cells could replenish nerve tissue by generating neuron-like cells [3]. Dental pulp stem cells (DPSCs), originate from the neural crest, exhibit obvious higher expression of neuronal marker compared with other stem cells [4,5]. DPSCs could differentiate into neurons and glial cells, and exert neuroprotective abilities [6,7]. Besides, cells regulate their microenvironment by producing a variety of factors, and paracrine interaction also play a modulatory effect on neighboring cells [8]. It is well known that the tumor microenvironment, as an ecological system of tumor cells, is crucial for the development of diverse cancers, including gastric cancer [9], cholangiocarcinoma [10] and pancreatic cancer [11], and affects the effectiveness of therapeutic interventions [10]. Inflammatory response is a key factor in the microenvironment [12,13]. DPSCs have the ability of self-renewal, and also regulate dental pulp repair and regeneration by affecting immune and inflammatory responses [[14], [15], [16]], and the inflammatory microenvironment has been proved to be vital for the differentiation of DPSCs [17]. For example, Hong et al. demonstrated that OCT4A up-regulates the self-renewal ability of hDPSCs by targeting FTX in the inflammatory microenvironment [18]. Chen et al. revealed that SNHG7 accelerates osteogenic differentiation of hDPSCs in inflammatory environments through hsa-miR-6512e3p expression [19].

Previous studies have pointed out that inflammation and pulp regeneration are mutually antagonistic processes [20] and inflammation plays a crucial role in the self-repair process of the dental pulp [17]. The production of excessive inflammatory factors destroys the pulp structure and causes tissue necrosis. However, moderate inflammatory response is beneficial to the development of DPSCs Specifically, on the on hand, high levels of inflammatory stimulation prevented osteogenic differentiation of hDPSCs [21,22]. The unresolved inflammation is one of the reasons why damaged pulp cannot be fully repaired [16]. Besides, several genes such as Resolvin E1 promotes differentiation of hDPSCs by resolving inflammation [16]. On the other hand, moderate inflammatory level initiates the proliferation, migration and differentiation of DPSCs, ultimately accelerates tissue regeneration [16,17,20]. For instance, Liu et al. discovered that low dose of pro-inflammatory factor TNF-α [17] enhances the differentiation ability of hDPSCs [23]. Therefore, maintaining a low level of inflammatory activation is essential for pulp repair.

The members belonging to Armadillo repeat-containing X-linked (Armcx) family contain multiple Armadillo domains [24]. Increasing evidence showed that Armcx family are closely related to the malignant development of various tumors [25,26]. For example, it is reported that overexpressed ARMCX1 suppresses gastric cancer metastasis by mediating PAR-1/Rho GTPase signal [27]. ARMCX3, localized on the X chromosome, has been proved to be tightly associated with mitochondrial dynamics [25]. Additionally, recent studies illustrated that ARMCX3 is highly expressed in the central nervous system and exerts a vital role in the regulation of neuronal mitochondrial transport, including calcium ions (Ca2+) [24]. Moreover, bioinformatic analysis demonstrated the increased expression of ARMCX3 in inflammatory periodontal tissue [28]. However, the specific roles of ARMCX3 in neural differentiation of DPSCs and modulation of their inflammatory environment are uncovered.

Lipopolysaccharide (LPS), as a major component of the cell wall of Gram-negative bacteria, is produced at a high level in pulpitis tissues [29] and is often used to construct inflammation models in vitro [30]. In the preliminary experiment, we employed porphyromonas gingivalis (Pg) LPS (Pg-LPS) to activate the inflammatory response of human DPSCs (hDPSCs) and discovered that Pg-LPS treatment notably suppressed neural differentiation and increased the expression of ARMCX3 in hDPSCs. Therefore, we hypothesized that ARMCX3 might affect the differentiation of hDPSCs in the inflammatory microenvironment.

In this study, we revealed that Pg-LPS effectively upregulated ARMCX3 expression in hDPSCs. The knockdown of ARMCX3 reduced the level of inflammatory response, and promoted neural differentiation of hDPSCs. This work was likely to provide a promising target for the repair of pulp injury and the treatment of neurodegenerative diseases.

2 Materials and methods

2.1 Neural differentiation of hPDSCs

The hDPSCs (CP-H231, China) were cultured in a specific complete medium (CM-H231, Pricella, China). The cells were grown in a cell incubator (HH.CP-T, JTONE, China) containing 5 % CO2 at 37 °C for 48 h.

For the induction of neural differentiation, passages 3–5 of hDPSCs were seeded into 6-well plates (2 × 104 cells/well). Then the Neurobasal medium (21103049, Gibco, USA) with 40 ng/mL Recombinant Human bFGF Protein (M9406, AbMole, USA), 20 ng/mL Recombinant Human EGF Protein (M9415, AbMole, USA), 1 × B-27 (17504044, Gibco, USA) and 1 % Penicillin-Streptomycin solution (60162ES76, YESEN, China) was added to each well. The cells were induced in a cell incubator (HH.CP-T, JTONE, China) containing 5 % CO2 at 37 °C for 7 days and the medium was changed every 3 days. The steps were displayed in Supplementary Fig. S1.

2.2 Construction of stable cell lines

For overexpression of ARMCX3, full-length ARMCX3 cDNA was cloned into pCDH-CMV-MCS-EF1-Puro plasmid (V006738#, NovoPro, China) and the empty plasmid was used as negative control. To knock down ARMCX3, the fragments of short harpin (sh)-ARMCX3 (5′-CCACCTTGTTTATATGGTAAA-3′) were constructed into pLKO.1 puro plasmids (V010450#, NovoPro, China) and plasmids with scrambled sh-RNAs (sh-NC, 5′-UAAGGCUAUGAAGAGAUA-3′) were regarded as negative controls. Next, the Liposomal Transfection Reagent (40802ES01, YESEN, China) was employed to transfect the above plasmids and auxiliary plasmids (DR8.91 and VSVG) into HEK293T cells according to the manufacturer's instructions. After 48 h and 72 h, the supernatant was collected and added to hDPSCs in the logarithmic growth phase, followed by adding 2 μg/ml Polybrene (40804ES76, YESEN, China). After 24 h, the positive cells were screened using 25 μg/ml Ampicillin (ST007, Beyotime, China), which were regarded as stable cell lines.

2.3 Establishment of inflammation microenvironment and detection of inflammatory cytokines

For the induction of inflammation response, 1 μg/mL Pg-LPS (tlrl-pglps, Invivogen, USA) was employed to stimulate stable hDPSCs for 24 h as reported in previous study [17]. The inflammatory cytokines including interleukin (IL)-6, IL-8 and tumor necrosis factor alpha (TNF-α) were quantified with corresponding ELISA kits (Jining Shiye, China) abiding by the manufacturer's protocol.

2.4 Quantitative real-time PCR (qRT-PCR)

TRIzol reagent (19201ES60, YESEN, China) was introduced to obtain total RNA from stable Pg-LPS-treated hDPSCs abiding by the instructions. Then qRT-PCR reaction was performed using One Step qRT-PCR Enzyme Mix (13197ES92, YESEN, China) as described in the manufacturer's guidelines. The transcription levels of all genes were referenced by β-actin. All information of primers were listed in Table 1.Table 1 Primers information.

Table 1Gene	Forward (5′-3′)	Reverse (5′-3′)	
ARMCX3	GAGTGTGAATGCTGAAAATCAGCG	TCTCAGTCCAGCAAGCTGCACA	
βIII-Tubulin	GGCCAAGGGTCACTACACG	GCAGTCGCAGTTTTCACACTC	
GFAP	AACAACCTGGCTGCGTAT	ACTGCCTCGTATTGAGTGC	
COX-2	TGAGTACCGCAAACGCTTCTC	TGGACGAGGTTTTTCCACCAG	
iNOS	AGCAACTACTGCTGGTGGTG	TCTTCAGAGTCTGCCCATTG	
β-actin	TAGCACAGCCTGGATAGCAACGTAC	CACCTTCTACAATGAGCT GCGTGTG	

2.5 Western blot assay

Total proteins collected by radioimmunoprecipitation (RIPA) lysis buffer (GD-Y2014, Shanghai Guduo Biotechnology Co., LTD, China) were isolated utilizing SDS-PAGE (WBK510-02, Shanghai Yongke Biotechnology Co., LTD, China), followed by shifting onto polyvinylidene fluoride (PVDF) membranes (WBF101, Shanghai Yongke Biotechnology Co., LTD, China). Then the membranes were treated with western blocking buffer (BP304, Shanghai Yongke Biotechnology Co., LTD, China) for 10 min and incubated with primary antibody (Table 2) overnight. Next, the membranes were incubated with second for 2 h antibody and protein bands were observed with enhanced chemiluminescence (ECL) kit (WBK101-01, Shanghai Yongke Biotechnology Co., LTD, China.Table 2 Antibodies information.

Table 2Antibody	Item No.	Supplier	Country	Dilution	
ARMCX3	25705-1-AP	Proteintech	USA	1:1000	
β-actin	AC038	Abclonal	China	1:5000	

2.6 Immunofluorescence (IF)

The expression of neural-specific marker GFAP in hDPSCs was detected as described previously [31]. Simply, after 7 days of neural differentiation, the stable hDPSCs treated with Pg-LPS were immobilized with 4 % paraformaldehyde (P1110, Solarbio, China) for 30 min and permeated with 0.3 % Triton X-100 (T8200, Solarbio, China) for 10 min. The cells were then incubated with GFAP Rabbit mAb (A19058, Abclonal, China, 1:100) at 4 °C overnight. Next, the cells were treated with Goat anti-Rabbit IgG-AF488 Antibody (abs20025, Absin, China) for 2 h, followed by staining with 2 μg/ml DAPI dihydrochloride (C1002, Beyotime, China). Finally, the images were captured with confocal microscope (BZ-X, Keyence, Japan).

2.7 Reactive oxygen species (ROS) assay

The ROS levels in hDPSCs were measured with Reactive Oxygen Species Assay Kit (50101ES01, YESEN, China) abiding by the kit's protocol. The collected hDPSCs were incubated with 10 μM Dichloro-dihydro-fluorescein diacetate (DCFH-DA) for 15 min. Then the ROS content was observed by IF assay and the data were normalized with control group as the internal reference.

To block ROS signal, the hDPSCs were pre-treated with 5 mM Acetylcysteine (NAC, HY-B0215, MCE, USA) for 1 h.

2.8 Detection of oxidative stress indexes

The content of malondialdehyde (MDA), glutathione (GSH) and catalase (CAT) was estimated by Malondialdehyde (MDA) Content Assay Kit (BC0025, Solarbio, China), Reduced Glutathione (GSH) Content Assay Kit (BC1175, Solarbio, China) and Catalase (CAT) Activity Assay Kit (BC0205, Solarbio, China) according to the manufacturer's guidelines.

2.9 Measurement of total Ca2+ content

The stable hDPSCs treated with Pg-LPS were harvested and re-suspended in a new centrifuge tube. Then the 1 N Hcl (T8230, Solarbio, China) was added to the centrifuge tube and the Ca2+ level was detected with Calcium Assay kit (ab102505, Abcam, UK) abiding by the kit's instruction. Finally, a microplate reader (JC-MB36, Qingdao Juchuang Jiaheng Analytical Instrument Co., LTD, China) was employed to record the absorbance at 575 nm.

2.10 Statistical analysis

The data were analyzed with Graphpad Prism 8.0 (GraphPad Software, USA) and presented as mean ± standard deviation (SD). Statistical differences were estimated with Student's t-test (two groups) or analysis of variance (ANOVA) (multiple groups). The *p < 0.05, **p < 0.01 and ***p < 0.001 was considered as statistical significance.

3 Results

3.1 ARMCX3 knockdown facilitates neural differentiation of hDPSCs

First, hDPSCs were treated with Pg-LPS for 24 h to activate intracellular inflammatory state. Fig. 1A showed that Pg-LPS treatment significantly up-regulated the expression of ARMCX3 in hDPSCs (***p < 0.001) (Fig. 1A). To verify the detailed functions of ARMCX3 in hDPSCs, we designed stable ARMCX3‐knockdown cell line (***p < 0.001) (Fig. 1B and C). As expected, the increased level of ARMCX3 in Pg-LPS treated hDPSCs was notably down-regulated by ARMCX3 knockdown (***p < 0.001) (Fig. 1D and E). Subsequently, the neural differentiation specific medium was employed to induce neural differentiation of hDPSCs. After 7 days, differentiated hDPSCs exhibited a distinct neuro-like vertebral shape with longer synapses. Besides, Pg-LPS treatment obviously blocked the neural differentiation of DPSCs, while ARMCX3 knockdown effectively reversed the effects of Pg-LPS on DPSC (Fig. 1F). Additionally, IF assay verified that Pg-LPS notably down-regulated the level of neural-specific marker GFAP, whereas ARMCX3 deficiency dramatically increased that in hDPSCs (Fig. 1G). Meanwhile, we measured the expression of GFAP and neuron specific marker βIII-Tubulin in hDPSCs after induction. Fig. 1H illustrated Pg-LPS treatment reduced the level GFAP and βIII-Tubulin during neural-like differentiation of hDPSCs, which was notably counteracted by ARMCX3 knockdown (*p < 0.05, **p < 0.01, ***p < 0.001) (Fig. 1H). These findings indicated that ARMCX3 knockdown facilitated neural differentiation of hDPSCs under Pg-LPS treatment.Fig. 1 ARMCX3 knockdown facilitates neural differentiation of hDPSCs. (A) The expression level of ARMCX3 in Pg-LPS-treated hDPSCs tested via qRT-PCR assay. (B–E) The expression level of ARMCX3 tested by qRT-PCR and Western blot assay (Figs. S2 and S3). (F) The detection of neural differentiation ability of Pg-LPS-treated hDPSCs. (G) The expression level of neural-specific marker GFAP (neural-specific marker) tested via IF assay. (H) The expression level of GFAP and βIII-Tubulin (neuron specific marker) tested via qRT-PCR assay. Scale bar = 50 μm *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 1

3.2 ARMCX3 knockdown reduces inflammation response in hDPSCs

Next, we estimated the expression level of pro-inflammatory cytokines (IL-6, IL-8 and TNF-α) produced by Pg-LPS-treated hDPSCs. Fig. 2A indicated that Pg-LPS promoted the secretion of pro-inflammatory cytokines, while ARMCX3 deficiency effectively decreased that in hDPSCs (**p < 0.01, ***p < 0.001) (Fig. 2A). Additionally, further assay pointed out that ARMCX3 knockdown notably down-regulated the production of inflammation factors including COX2 and iNOS in hDPSCs in the presence of Pg-LPS (**p < 0.01, ***p < 0.001) (Fig. 2B). These data demonstrated that ARMCX3 knockdown could control Pg-LPS-induced inflammation at a lower level in hDPSCs.Fig. 2 ARMCX3 knockdown reduces inflammation response in hDPSCs. (A) The protein level of pro-inflammatory cytokines in Pg-LPS-treated hDPSCs determined by ELISA assay. (B) The mRNA level of COX2 and iNOS in Pg-LPS-treated hDPSCs tested via qRT-PCR assay. **p < 0.01, ***p < 0.001.

Fig. 2

3.3 ARMCX3 knockdown suppresses ROS signal in hDPSCs

Since the oxidative stress induced by ROS production is closely associated with inflammation response [[32], [33], [34]], we asked whether ARMCX3 deficiency inhibits cytokine expression by decreasing ROS generation. As exhibited in Fig. 3A, Pg-LPS treatment up-regulated the level of ROS, which was notably offset through ARMCX3 knockdown in hDPSCs (***p < 0.001) (Fig. 3A). Besides, we evaluated the antioxidant status in Pg-LPS-treated hDPSCs by measuring the levels of GSH, CAT and MDA. The data indicated that Pg-LPS significantly reduced the content of GSH and antioxidant enzymes CAT, and up-regulated the production of MDA. However, knockdown of ARMCX3 exhibited the opposite results in hDPSCs (*p < 0.05, **p < 0.01, ***p < 0.001) (Fig. 3B and C). Moreover, previous studies proved that the occurrence of oxidative stress is usually accompanied by Ca2+ overload [35,36]. As expected, Pg-LPS treatment increased the level of Ca2+, whereas ARMCX3 deficiency effectively reduced that in hDPSCs (**p < 0.01, ***p < 0.001) (Fig. 3D). These observations illustrated that ARMCX3 downregulation exert a distinct role in inhibiting ROS signal in Pg-LPS-treated hDPSCs.Fig. 3 ARMCX3 knockdown suppresses ROS signal in Pg-LPS-treated hDPSCs. (A) The production level of ROS in Pg-LPS-treated hDPSCs detected by IF assay. (B&C) The content of oxidative stress related indicators in Pg-LPS-treated hDPSCs detected by specific kits. (D) The level of Ca2+ in Pg-LPS-treated hDPSCs. *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 3

3.4 Inhibition of ROS blocks the effects of ARMCX3 on neural differentiation of hDPSCs

To verify whether the roles of ARMCX3 in the neural differentiation of hDPSCs is dependent on ROS signal, we constructed stable ARMCX3-overexpression hDPSCs (***p < 0.001) (Fig. 4A and B). Subsequently, the cells were treated with NAC, the ROS inhibitor, to blocked ROS generation. As exhibited in Fig. 4C, the overexpressed ARMCX3 up-regulated the level of ROS in Pg-LPS-treated hDPSCs, which was notably reversed by NAC treatment (*p < 0.05, **p < 0.01, ***p < 0.001) (Fig. 4C). Neural induction experiment showed that ARMCX3 overexpression further suppressed neural differentiation of hDPSCs under Pg-LPS treatment, while NAC treatment effectively restored differentiation ability of hDPSCs (Fig. 4D). Additionally, ARMCX3 upregulation dramatically reduced the expression of neuro-associated markers GFAP and βIII-Tubulin in Pg-LPS-treated hDPSCs, whereas the effects were also counteracted remarkably by NAC treatment (*p < 0.05, **p < 0.01, ***p < 0.001) (Fig. 4E and F). All these findings suggested that ROS production was closely involved in ARMCX3-mediated neural differentiation of hDPSCs.Fig. 4 Inhibition of ROS blocks the effects of ARMCX3 on neural differentiation of hDPSCs. (A&B) The expression level of ARMCX3 tested by qRT-PCR and Western blot assay (Fig. S4). (C) The production level of ROS detected by IF assay. (D) The detection of neural differentiation ability of hDPSCs. (E) The expression level of GFAP (neural-specific marker) tested via IF assay. (F) The expression level of GFAP and βIII-Tubulin (neuron specific marker) tested via qRT-PCR assay. Scale bar = 50 μm *p < 0.05, **p < 0.01, ***p < 0.001.

Fig. 4

3.5 Inhibition of ROS blocks the effects of ARMCX3 on inflammation microenvironment in hDPSCs

Furthermore, Fig. 5A proved that ARMCX3 overexpression further up-regulated the level of pro-inflammatory cytokines (IL-6, IL-8 and TNF-α) secreted through Pg-LPS-treated hDPSCs, which was effectively reversed by NAC treatment (**p < 0.01, ***p < 0.001) (Fig. 5A). Meanwhile, NAC reduced the expression of COX2 and iNOS activated by ARMCX3 overexpression in hDPSCs under Pg-LPS treatment (**p < 0.01, ***p < 0.001) (Fig. 5B). Taken together, these data verified that overexpressed ARMCX3 further triggered inflammation response in Pg-LPS-treated hDPSCs at least partly by ROS generation.Fig. 5 Inhibition of ROS blocks the effects of ARMCX3 on inflammation microenvironment in hDPSCs. (A) The expression level of pro-inflammatory cytokines in Pg-LPS-treated hDPSCs determined by ELISA assay. (B) The mRNA level of COX2 and iNOS in Pg-LPS-treated hDPSCs tested via qRT-PCR assay. **p < 0.01, ***p < 0.001.

Fig. 5

4 Discussion

Overall, this work firstly revealed the roles of ARMCX3 in hDPSCs. Specifically, ARMCX3 knockdown notably promoted neural differentiation and suppressed inflammation response in hDPSCs under Pg-LPS treatment. Besides, deletion of the ARMCX3 obviously reduced ROS production, while ARMCX3 overexpression exert a opposite role. Moreover, the inhibitor of ROS signal effectively reversed the effects of overexpressed ARMCX3 in neural differentiation and inflammation response in Pg-LPS-treated hDPSCs.

Dental pulp, the unmineralized oral tissue, is crucial to the sensation and defense reserve of teeth [37]. Promoting pulp repair can help restore the function of damaged teeth and avoid sequelae such as tooth loss [37,38]. However, there are still some knowledge gaps in the molecular mechanism of pulp inflammation, which needs to be further explored. Additionally, neurodegenerative diseases are regarded as a vital cause of disability and death [39]. Facial nerve is easily damaged and axon regeneration is difficult due to overstrain. Unsatisfactory treatment for nerve injury will seriously reduce patients' quality of life [40]. Hence, it is imperative to reveal the pathogenic mechanisms related to neurodegenerative diseases, which will have a great impact on human health in the future. Previous reports illustrated that pulp is innervated by a variety of nerves [41]. These nerve fibers can produce diverse signaling molecules to regulate tooth germ development. Additionally, dental pulp nerve regeneration plays a crucial role in pulp repair [42]. Emerging evidence revealed that dental pulp contains a variety of cells [[43], [44], [45]] including abundant stem cells [45]. Thereinto, DPSCs are isolated from the dental pulp tissue of the third molar [45], which exhibited rapid proliferation and strong self-renewal ability [[46], [47], [48]]. What's more, DPSCs have the potential for multidirectional differentiation, including odontoblast differentiation and neuronal differentiation [3,17]. Recent studies illustrated that DPSCs has neuroprotective properties and is a promising tool for treating neurodegenerative diseases as well as neurological disorders [3,49]. Therefore, exploring the molecular mechanism of neural differentiation of DPSCs is important not only for dental pulp injury, but also for various neurological diseases.

Inflammation is an indispensable stage in the process of pulp repair [50]. Accumulating evidence reported that excessive inflammation will cause irreparable injury to pulp tissue [51]. It is vital to control the inflammatory response at a lower level for regulating osteogenic differentiation of DPSCs and pulp repair [[6], [7], [8]]. For example, Chen et al. revealed that Resolvin E1 facilitates pulp repair by accelerating inflammation resolution [16]. Liang et al. found that circFKBP5 inhibits apoptosis as well as inflammation, thereby promoting osteogenic differentiation of DPSCs [52]. However, the detailed roles of inflammation in neural differentiation of DPSCs is still less studied. Interestingly, we constructed an in vitro inflammatory model by treating hDPSCs with 1 μg/ml Pg-LPS, and discovered that Pg-LPS treatment notably inhibited the neural differentiation of hDPSCs. The related molecular mechanism still needs to be further explored.

ARMCX3 is a recently reported member of the Armcx family [24,53], and there are few studies on its roles. Recent reporters revealed that ARMCX3 is involved in the processes of various diseases, such as obesity [54] and non-small cell lung cancer [25]. Bioinformatics analysis found that ARMCX3 expression was up-regulated in inflammatory periodontal tissues, suggesting that ARMCX3 might be associated with the process of pulp repair. Additionally, it has been reported that ARMCX3 exerts an obvious high expression in neurons and regulates the function of neuronal mitochondria [24,53]. Emerging evidence proved that ARMCX3 inhibited the proliferation of neurotropic progenitor cells by targeting Wnt signals, ultimately affecting the development of the chicken spinal cord [55]. More interesting, we discovered that Pg-LPS treatment notably increased the expression of ARMCX3 in hDPSCs. These findings aroused our interest in exploring the roles of ARMCX3 in inflammation microenvironment and neural differentiation in DPSCs.

GFAP is a specific protein of astrocytes, which exerts a series of functions in the central nervous system [56]. βIII-Tubulin is a marker of neurons, expressed in the early process of brain development [57]. Therefore, GFAP and βIII-Tubulin are commonly used to detect neural differentiation. This work proved that knockdown of ARMCX3 effectively up-regulated the expression level of GFAP and βIII-Tubulin in Pg-LPS-treated hDPSCs, while ARMCX3 overexpression played the opposite role. These results suggested that ARMCX3 knockdown promoted neural differentiation of hDPSCs in the presence of Pg-LPS. Besides, our findings also hinted that ARMCX3 might be involved in the development of neurons and even the central nervous system. In the future study, we will interfere with ARMCX3 expression in neurons to verify the roles of ARMCX3 in the development of the central nervous system. Moreover, ARMCX3 deficiency also suppressed inflammation response induced by Pg-LPS in hDPSCs, indicating that ARMCX3 participated in the regulation of the inflammatory microenvironment.

It is well known that excess ROS production leads to oxidative stress, closely linked to inflammatory responses in various diseases [34,58,59]. Besides, LPS can activate both inflammatory reaction and ROS generation remarkably [34], which is consistent with our present results. Moreover, ARMCX3 knockdown significantly reduced ROS level, up-regulated the expression of CAT (antioxidant enzyme) and GSH (non-enzymatic antioxidant) in hDPSCs. Meanwhile, the ARMCX3 down-regulation obviously decreased the level of Ca2+ triggered by ROS generation. These data implied that ARMCX3 might exerts its role in hDPSCs by ROS signal. To verify the hypothesis, we introduced NAC, a vital inhibitor of ROS signal, to treat hDPSCs that overexpress ARMCX3 in the presence of Pg-LPS. The results showed that after blocking ROS production, the inhibitory effects of ARMCX3 overexpression on neural differentiation also partially disappeared. Furthermore, ROS inhibition effectively abolished inflammation cytokines induced through ARMCX3 overexpression in Pg-LPS-treated hPDSC. This result verified that ARMCX3 affected inflammation microenvironment by mediating ROS signal. Collectively, our data established that ARMCX3 inhibited neural differentiation and enhanced inflammation response in hPDSCs via ROS generation.

Nevertheless, there are several limitations in this work. For example, it is unclear whether ARMCX3 regulates the differentiation in other directions of hPDSCs. We will induce hDPSCs differentiation in different directions in the absence of ARMCX3 to further investigate the effect of ARMCX3 on hDPSCs development. Besides, the molecular network through which ARMCX3 regulates neural differentiation of hDPSCs is unknown. More experiments will be conducted to uncover signaling pathways and downstream targets related to the role of ARMCX3 in neural differentiation of hDPSCs.

5 Conclusion

In summary, this study verified for the first time that ARMCX3 deficiency accelerated neural differentiation and suppressed the inflammatory microenvironment in hPDSC at least partly by mediating ROS signaling. These findings provided a promising therapeutic target for the treatment of pulpitis and diverse neurological diseases.

Data availability statement

Data included in article/supp. material/referenced in article.

Fundings

None.

CRediT authorship contribution statement

Quanying Zhou: Writing – original draft, Validation, Investigation, Formal analysis, Data curation. Yi Lei: Writing – review & editing, Project administration, Methodology, Investigation, Data curation, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A Supplementary data

The following are the Supplementary data to this article:figs1 figs1

figs2 figs2

Fig. S3 Fig. S3

figs4 figs4

Acknowledgements

None.

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e37079.
==== Refs
References

1 Yi S. Application of stem cells in peripheral nerve regeneration Burns Trauma 8 2020 tkaa002 32346538
2 Al-Maswary A.A. Exploring the neurogenic differentiation of human dental pulp stem cells PLoS One 17 11 2022 e0277134
3 Prateeksha P. KLF2 regulates neural differentiation of dental pulp-derived stem cells by modulating autophagy and mitophagy Stem Cell Rev Rep 19 8 2023 2886 2900 37642902
4 Zhou H. Metal-organic framework materials promote neural differentiation of dental pulp stem cells in spinal cord injury J. Nanobiotechnol. 21 1 2023 316
5 Kaukua N. Glial origin of mesenchymal stem cells in a tooth model system Nature 513 7519 2014 551 554 25079316
6 Song M. Human dental pulp stem cells are more effective than human bone marrow-derived mesenchymal stem cells in cerebral ischemic injury Cell Transplant. 26 6 2017 1001 1016 28105979
7 Irfan M. Chung S. C5L2 modulates BDNF production in human dental pulp stem cells via p38α pathway Sci. Rep. 13 1 2023 74 36593314
8 Liu B. Dental pulp stem cells induce anti-inflammatory phenotypic transformation of macrophages to enhance osteogenic potential via IL-6/GP130/STAT3 signaling Ann. Transl. Med. 11 2 2023 90 36819570
9 Rihawi K. Tumor-associated macrophages and inflammatory microenvironment in gastric cancer: novel translational implications Int. J. Mol. Sci. 22 8 2021
10 Carloni R. Targeting tumor microenvironment for cholangiocarcinoma: opportunities for precision medicine Transl Oncol 25 2022 101514
11 Di Federico A. Immunotherapy in pancreatic cancer: why do we keep failing? A focus on tumor immune microenvironment, predictive biomarkers and treatment outcomes Cancers 14 10 2022
12 Gu Y. The proteomic characterization of the peritumor microenvironment in human hepatocellular carcinoma Oncogene 41 17 2022 2480 2491 35314790
13 Tan Z. The role of tumor inflammatory microenvironment in lung cancer Front. Pharmacol. 12 2021 688625
14 De Miguel M.P. Immunosuppressive properties of mesenchymal stem cells: advances and applications Curr. Mol. Med. 12 5 2012 574 591 22515979
15 Cassatella M.A. Toll-like receptor-3-activated human mesenchymal stromal cells significantly prolong the survival and function of neutrophils Stem Cell. 29 6 2011 1001 1011
16 Chen J. Resolvin E1 accelerates pulp repair by regulating inflammation and stimulating dentin regeneration in dental pulp stem cells Stem Cell Res. Ther. 12 1 2021 75 33482900
17 Kang W. TAS2R supports odontoblastic differentiation of human dental pulp stem cells in the inflammatory microenvironment Stem Cell Res. Ther. 13 1 2022 374 35902880
18 Hong H. The pluripotent factor OCT4A enhances the self-renewal of human dental pulp stem cells by targeting lncRNA FTX in an LPS-induced inflammatory microenvironment Stem Cell Res. Ther. 14 1 2023 109 37106382
19 Chen W. SNHG7 promotes the osteo/dentinogenic differentiation ability of human dental pulp stem cells by interacting with hsa-miR-6512-3p in an inflammatory microenvironment Biochem. Biophys. Res. Commun. 581 2021 46 52 34653678
20 Cooper P.R. Inflammation-regeneration interplay in the dentine-pulp complex J. Dent. 38 9 2010 687 697 20580768
21 Ran R. Depletion of EREG enhances the osteo/dentinogenic differentiation ability of dental pulp stem cells via the p38 MAPK and Erk pathways in an inflammatory microenvironment BMC Oral Health 21 1 2021 314 34154572
22 Hu H.M. Artemisinin protects DPSC from hypoxia and TNF-α mediated osteogenesis impairments through CA9 and Wnt signaling pathway Life Sci. 277 2021 119471
23 Liu Y.K. Zhou Z.Y. Liu F. Transcriptome changes during TNF-α promoted osteogenic differentiation of dental pulp stem cells (DPSCs) Biochem. Biophys. Res. Commun. 476 4 2016 426 430 27237976
24 López-Doménech G. The Eutherian Armcx genes regulate mitochondrial trafficking in neurons and interact with Miro and Trak2 Nat. Commun. 3 2012 814 22569362
25 Du J. Alex3 suppresses non-small cell lung cancer invasion via AKT/Slug/E-cadherin pathway Tumour Biol 39 7 2017 1010428317701441
26 Mirra S. ARMCX3 mediates susceptibility to hepatic tumorigenesis promoted by dietary lipotoxicity Cancers 13 5 2021
27 Pang L. ALEX1, a novel tumor suppressor gene, inhibits gastric cancer metastasis via the PAR-1/Rho GTPase signaling pathway J. Gastroenterol. 53 1 2018 71 83 28315004
28 Liu J. Screening of crosstalk and pyroptosis-related genes linking periodontitis and osteoporosis based on bioinformatics and machine learning Front. Immunol. 13 2022 955441
29 Arruda-Vasconcelos R. Investigation of microbial profile, levels of endotoxin and lipoteichoic acid in teeth with symptomatic irreversible pulpitis: a clinical study Int. Endod. J. 54 1 2021 46 60 32892394
30 Xu F. The potential application of concentrated growth factor in pulp regeneration: an in vitro and in vivo study Stem Cell Res. Ther. 10 1 2019 134 31109358
31 Zhou W. TIGAR promotes neural stem cell differentiation through acetyl-CoA-mediated histone acetylation Cell Death Dis. 10 3 2019 198 30814486
32 Mao W. RORα suppresses cancer-associated inflammation by repressing respiratory complex I-dependent ROS generation Int. J. Mol. Sci. 22 19 2021
33 Das N. Intra-tumor ROS amplification by melatonin interferes in the apoptosis-autophagy-inflammation-EMT collusion in the breast tumor microenvironment Heliyon 10 1 2024 e23870
34 Sul O.J. Ra S.W. Quercetin prevents LPS-induced oxidative stress and inflammation by modulating NOX2/ROS/NF-kB in lung epithelial cells Molecules 26 22 2021
35 Zheng N. Oxidative stress-induced cardiomyocyte apoptosis is associated with dysregulated Akt/p53 signaling pathway J. Recept. Signal Transduct. Res. 40 6 2020 599 604 32460597
36 Yao X. Hsp90 protected chicken primary myocardial cells from heat-stress injury by inhibiting oxidative stress and calcium overload in mitochondria Biochem. Pharmacol. 209 2023 115434
37 Zhu L. In vitro and in vivo evaluation of a nanoparticulate bioceramic paste for dental pulp repair Acta Biomater. 10 12 2014 5156 5168 25182220
38 Dalli M. Çolak H. Mustafa Hamidi M. Minimal intervention concept: a new paradigm for operative dentistry J Investig Clin Dent 3 3 2012 167 175
39 Global, regional, and National burden of neurological disorders 1990-2016: a systematic analysis for the Global Burden of Disease Study 2016 Lancet Neurol. 18 5 2019 459 480 30879893
40 Xu W. VEGFA-modified DPSCs combined with LC-YE-PLGA NGCs promote facial nerve injury repair in rats Heliyon 9 4 2023 e14626
41 Moe K. Development of the pioneer sympathetic innervation into the dental pulp of the mouse mandibular first molar Arch. Oral Biol. 53 9 2008 865 873 18436190
42 Han Q. Nell-1 promotes the neural-like differentiation of dental pulp cells Biochem. Biophys. Res. Commun. 513 2 2019 515 521 30979495
43 Al Madhoun A. Dental pulp stem cells derived from adult human third molar tooth: a brief review Front. Cell Dev. Biol. 9 2021 717624
44 Diomede F. Decellularized dental pulp, extracellular vesicles, and 5-azacytidine: a new tool for endodontic regeneration Biomedicines 10 2 2022
45 Tatullo M. Dental pulp stem cells: function, isolation and applications in regenerative medicine J Tissue Eng Regen Med 9 11 2015 1205 1216 24850632
46 Xiao Z. The potential therapy with dental tissue-derived mesenchymal stem cells in Parkinson's disease Stem Cell Res. Ther. 12 1 2021 5 33407864
47 Mattei V. Role of lipid rafts in neuronal differentiation of dental pulp-derived stem cells Exp. Cell Res. 339 2 2015 231 240 26586565
48 Aydin S. Şahin F. Stem cells derived from dental tissues Adv. Exp. Med. Biol. 1144 2019 123 132 30635857
49 Heng B.C. EphrinB2 signalling modulates the neural differentiation of human dental pulp stem cells Biomed Rep 9 2 2018 161 168 29963307
50 Rechenberg D.K. Galicia J.C. Peters O.A. Biological markers for pulpal inflammation: a systematic review PLoS One 11 11 2016 e0167289
51 Irfan M. The role of complement C5a receptor in DPSC odontoblastic differentiation and in vivo reparative dentin formation Int. J. Oral Sci. 14 1 2022 7 35087028
52 Liang C. CircFKBP5 suppresses apoptosis and inflammation and promotes osteogenic differentiation Int. Dent. J. 73 3 2023 377 386 36244799
53 Serrat R. The non-canonical Wnt/PKC pathway regulates mitochondrial dynamics through degradation of the arm-like domain-containing protein Alex3 PLoS One 8 7 2013 e67773
54 Gavaldà-Navarro A. The armadillo-repeat containing X-linked protein 3, ARMCX3, is a negative regulator of the browning of adipose tissue associated with obesity Int. J. Obes. 46 9 2022 1652 1661
55 Mirra S. Function of Armcx3 and Armc10/SVH genes in the regulation of progenitor proliferation and neural differentiation in the chicken spinal cord Front. Cell. Neurosci. 10 2016 47 26973462
56 Hol E.M. Pekny M. Glial fibrillary acidic protein (GFAP) and the astrocyte intermediate filament system in diseases of the central nervous system Curr. Opin. Cell Biol. 32 2015 121 130 25726916
57 Jiang Y.Q. Oblinger M.M. Differential regulation of beta III and other tubulin genes during peripheral and central neuron development J. Cell Sci. 103 Pt 3 1992 643 651 1478962
58 Kang R. Deoxynivalenol induced apoptosis and inflammation of IPEC-J2 cells by promoting ROS production Environ. Pollut. 251 2019 689 698 31108302
59 Park H.S. Kim S.R. Lee Y.C. Impact of oxidative stress on lung diseases Respirology 14 1 2009 27 38 19144046
