
==== Front
Redox Rep
Redox Rep
Redox Report : Communications in Free Radical Research
1351-0002
1743-2928
Taylor & Francis

39284589
2394714
10.1080/13510002.2024.2394714
Version of Record
Research Article
Research Article
Activation of the Nrf2/Keap1 signaling pathway mediates the neuroprotective effect of Perillyl alcohol against cerebral hypoxic-ischemic damage in neonatal rats
REDOX REPORT
Y. FANG ET AL.
Fang Yu ab*
Zheng Yihui ab*
Gao Qiqi ab
Pang Mengdan ab
Wu Yiqing ab
Feng Xiaoli ab
Tao Xiaoyue ab
Hu Yingying ab
Lin Zhenlang abc
https://orcid.org/0000-0003-2163-8006
Lin Wei ab
a Department of Pediatrics, The Second School of Medicine, The Second Affiliated Hospital and Yuying Children’s Hospital of Wenzhou Medical University, Wenzhou, Zhejiang, People’s Republic of China
b Key Laboratory of Perinatal Medicine of Wenzhou, The Second Affiliated Hospital and Yuying Children’s Hospital of Wenzhou Medical University, Wenzhou, Zhejiang, People’s Republic of China
c Key Laboratory of Structural Malformations in Children of Zhejiang Province, The Second Affiliated Hospital and Yuying Children’s Hospital of Wenzhou Medical University, Wenzhou, Zhejiang, People’s Republic of China
CONTACT Wei Lin linwei1110@163.com Department of Pediatrics, The Second School of Medicine, The Second Affiliated Hospital and Yuying Children’s Hospital of Wenzhou Medical University, Wenzhou, Zhejiang, People’s Republic of China; Key Laboratory of Perinatal Medicine of Wenzhou, The Second Affiliated Hospital and Yuying Children’s Hospital of Wenzhou Medical University, Wenzhou, Zhejiang, People’s Republic of China;
Zhenlang Lin linzhenlang@hotmail.com Department of Neonatology, The Second Affiliated Hospital and Yuying Children’s Hospital of Wenzhou Medical University, 325000, Wenzhou, People’s Republic of China
* These authors contribute equally to this study.

16 9 2024
2024
16 9 2024
29 1 2394714Nova techset20 8 2024
Converted to JATS 1.2 by Nova Techset20 8 2024
© 2024 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group
2024
The Author(s)
https://creativecommons.org/licenses/by-nc/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. The terms on which this article has been published allow the posting of the Accepted Manuscript in a repository by the author(s) or with their consent.

ABSTRACT

Neonatal hypoxic-ischemic encephalopathy (HIE) is a severe disease with a poor prognosis, whose clinical treatment is still limited to therapeutic hypothermia with limited efficacy. Perillyl alcohol (POH), a natural monoterpene found in various plant essential oils, has shown neuroprotective properties, though its effects on HIE are not well understood. This study investigates the neuroprotective effects of POH on HIE both in vitro and in vivo. We established an in vitro model using glucose deprivation and hypoxia/reperfusion (OGD/R) in PC12 cells, alongside an in vivo model via the modified Rice-Vannucci method. Results indicated that POH acted as an indirect antioxidant, reducing inducible nitric oxide synthase and malondialdehyde production, maintaining content of antioxidant molecules and enzymes in OGD/R-induced PC12 cells. In vivo, POH remarkably lessened infarct volume, reduced cerebral edema, accelerated tissue regeneration, and blocked reactive astrogliosis after hypoxic-ischemic brain injury. POH exerted antiapoptotic activities through both the intrinsic and extrinsic apoptotic pathways. Mechanistically, POH activated Nrf2 and inactivated its negative regulator Keap1. The use of ML385, a Nrf2 inhibitor, reversed these effects. Overall, POH mitigates neuronal damage in HIE by combating oxidative stress, reducing inflammation, and inhibiting apoptosis via the Nrf2/Keap1 pathway, suggesting its potential for HIE treatment.

KEYWORDS

Perillyl alcohol
hypoxic-ischemic encephalopathy
Nrf2
Keap1
glucose deprivation and hypoxia/reperfusion
oxidative stress
apoptosis
treatment
National Natural Science Foundation of China 10.13039/501100001809 82271747 82201902 Natural Science Fund of Zhejiang Province 10.13039/501100004731 Y23H040013 Medical and Health Science and Technology Program of Zhejiang Province 2023RC048 Key Science and Technology Projects of Wenzhou Medical University KYYW202207 This work was supported by the National Natural Science Foundation of China (82271747, 82201902), Natural Science Fund of Zhejiang Province (Y23H040013), Medical and Health Science and Technology Program of Zhejiang Province (2023RC048), Key Science and Technology Projects of Wenzhou Medical University (KYYW202207).
==== Body
pmc1. Introduction

Neonatal hypoxic-ischemic encephalopathy (HIE), induced by perinatal asphyxia, is a form of brain damage that causes death and disability in newborns. At present, clinical treatment of HIE is still limited to therapeutic hypothermia with limited efficacy [1], emphasizing the need to develop effective, safe, but inexpensive treatments, allowing families to sustain beneficial interventions and enhance the long-term prognosis of newborns.

Oxidative stress and inflammation caused by hypoxia/hypoglycemia and reoxygenation have been established as the main factors for the onset and sequelae of HIE [2]. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a well-characterized transcription factor that activates under oxidative or electrophilic stresses to safeguard the organism against oxidative stress and inflammation. Kelch ECH-associating protein 1 (Keap1) functions as a cytoplasmic repressor of Nrf2. It has been established that Keap1 overexpression represses Nrf2 transcription and nuclear accumulation [3]. Under physiological conditions, Keap1 binds to Nrf2 in the cytoplasm, then Nrf2 is polyubiquitinylated and degraded by cullin-3 (Cul3)-based E3 ubiquitin ligase complex. As a result of oxidative or electrophilic stresses, the cystine residue at the active site of Keap1 is oxidized, preventing the binding between Nrf2 and Keap1. Nrf2 is then phosphorylated and transported into the nucleus, which binds to DNA by antioxidative response element (ARE) to counter-activate target genes and inhibit damage [4–7]. Studies have substantiated that Nrf2 directly regulates several antioxidant and detoxification genes [6], including NAD(P)H quinone dehydrogenase 1 [8], glutathione (GSH) [9], glutathione peroxidase (GPX) [10] and heme oxygenase-1 (HO-1) [11].

Perillyl alcohol (POH) is a monoterpene found in the essential oils of various plants, including mint, cherry, citrus fruit, and lemongrass. Over the past few years, POH has displayed various pharmacological properties, such as anti-oxidation, anti-inflammatory, anti-cancer, and neuroprotection [12,13]. In middle cerebral artery occlusion rat models, POH improved grip strength in a flexion test and motor coordination during spontaneous motor activity [14]. In a model of Parkinson's disease involving unilateral 6-hydroxydopamine lesion, the supplementation of POH was found to mitigate behavioral abnormalities, including loss of coordination, diminished rearing, and motor asymmetry. Moreover, POH has been reported to lower intracellular oxidative stress, mitochondrial dysfunction, neuroinflammation, and apoptosis in lesioned animals [15]. Additionally, research has indicated that POH could limit NLRP3 inflammasome activation to rescue dopaminergic neurons [16] and prevent cerebrovascular dysfunction and blood–brain barrier breakdown [17]. Collectively, these findings suggest that POH may be an emerging therapeutic molecule with clinical value in neurological diseases.

Previous research has established the neuroprotective properties of POH. However, its impact on HIE remains unexplored. Therefore, this study endeavored to ascertain the effect of POH on HIE via both in vitro and in vivo models, while delving into the underlying mechanisms to offer valuable insights for future investigations.

2. Materials and methods

2.1. Reagents

POH (purity (HPLC) ≥ 98%), was purchased from Solarbio (IP0870; Beijing, China), was a natural extract derived from plants of the Cymbopogon genus. It is a colorless to light yellow liquid with a molecular formula of C10H16O and a molecular weight of 152.23. ML385 (purity ≥ 99%) was purchased from Medchem Express (HY-100523; New Jersey, United States).

Primary antibodies: SOD2/MnSOD (AF5144; Affinity, United States), iNOS (ab178945; Abcam, United Kingdom), GPX4 (WH292781; ABclonal, Wuhan, China), TNF-α (ab66579; Abcam, United Kingdom), IL-6 (21865-1-AP; Proteintech, Wuhan, China), GAPDH (10494-1-AP; Proteintech, Wuhan, China), Nrf2 (#12721; Cell Signaling Technology, United States), Keap1 (WL03285; Wanleibio, China), β-actin (#3700; Cell Signaling Technology, United States), HistoneH3 (#4499; Cell Signaling Technology, United States), BAX (ab32503; Abcam, United Kingdom), BCL2 (ab196495; Abcam, United Kingdom), Caspase-8 (WL03426; Wanleibio, China), Caspase-8 p18 (WL00659; Wanleibio, China), Caspase-3/Cleaved Caspase-3 (WL02117; Wanleibio, China), Cytochrome c (#4272; Cell Signaling Technology, United States), MAP2 (17490-1-AP; Proteintech, Wuhan, China), GFAP (16825-1-AP; Proteintech, Wuhan, China).

Bioworld (OH, United States) provided the secondary antibodies of Goat Anti-Rabbit IgG and Alexa Fluor®488 labeled. Gibco (Grand Island, NY, United States) provided Dulbecco's modified eagle medium (DMEM) and fetal bovine serum (FBS). The Cell-Counting Kit-8 (CCK-8) was from Dojindo (Kumano, Japan). Solarbio (Beijing, China) provided the Micro reduced GSH Assay Kit and Micro MDA Assay Kit. The nuclear stain 4’,6-diamidino-2phenylindole (DAPI) and bovine serum albumin (BSA) were from Beyotime (Shanghai, China). Solvents and chemicals were all of analytical grade and purchased from Chinese commercial suppliers.

2.2. Cell culture

The Type Culture Bank of the Chinese Academy of Sciences (Shanghai, China) provided the differentiated PC12 cells. A humidified incubator with 5%(v/v) CO2 was used to culture the cells in DMEM supplemented with 10% (v/v) FBS at 37°C. The culture medium in the cell culture plates was replaced every 48 hours. All experiments were carried out after cells reached 70-80% (/v) confluence.

2.3. Glucose deprivation and hypoxia/reperfusion

We established a model of glucose deprivation and hypoxia/reperfusion (OGD/R) in PC12 cells to simulate the pathological process of HIE in vitro [18,19]. Briefly, PC12 cells were incubated in glucose-free DMEM after being washed with phosphate buffer solution (PBS). The cells were exposed to hypoxia (1%(v/v) O2, 5%(v/v) CO2, and 94%(v/v) N2) at 37 °C in a humidified chamber (Thermo Scientific, USA) for 4 hours. Next, we transferred the cells to a full culture medium with oxygen for 12 hours/24 hours.

Prior to hypoxia, the experimental groups were subjected to pretreatment with varying concentrations of POH and/or ML385 (5 μM) for a duration of 0.5 h. The drugs were maintained in the replaced medium during the whole OGD/R experiment. The concentration of ML385 used was based on the previous literature [20,21]. Normal control cells were cultured in a normoxic incubator until the cells in the experimental group were processed.

2.4. Cell counting kit-8 (CCK-8) assay

PC12 cells were seeded at a density of 1 × 105 cells/ml in 96-well plastic plates and treated with OGD/R after growth for 12 hours. A CCK-8 colorimetric assay was performed after 24 hours of reperfusion. Each well was filled with 100 μL of CCK-8 (10 mg/mL) dissolved in full culture medium. The plates were then incubated at 37 °C in normoxia for 1 hour. The optical density (OD) was read at 450 nm on a microplate reader (Thermo Scientific, Varioskan LUX).

2.5. Measurement of malondialdehyde (MDA) and glutathione (GSH) content

PC12 cells were seeded in 100 mm dishes. Following OGD/R, the PC12 cells were harvested, homogenized, and counted by a cell counting plate after washing with cold PBS. The content of MDA and GSH was determined using commercial assay kits. MDA content was presented as nmol/106cell and GSH as ug/106cell.

2.6. Immunofluorescence staining

For immunofluorescence analyses, PC12 cells were first incubated with 4%(w/v) paraformaldehyde for 15 minutes after being washed with PBS. Next, the cells were exposed to 0.1%(v/v) Triton X-100 for 15 minutes and incubated in 5%(v/v) BSA for 60 minutes at 37°C. Primary antibody cleaved caspase-3, an indicator of apoptosis, was applied at 4°C for 12 hours, followed by incubation with Alexa Fluor® 488-labeled conjugated secondary antibodies (1:200) at 37°C for 1 hour. In addition, the nuclei were stained with DAPI, and images were captured using a fluorescence microscope (NIKON, NI-U).

2.7. Neonatal hypoxic-ischemic (HI) brain injury and drug administration

Sprague Dawley (SD) rats weighing between 200–250 g were procured from the Animal Center of the Chinese Academy of Sciences (Shanghai, China) and were housed under specific pathogen-free (SPF) conditions. Adult SD rats were permitted to mate and breed. Experiments were conducted on rat pups born on postnatal day 7 (P7). We generated a modified Rice-Vannucci model as previously described [22,23]. In a nutshell, the pups were anesthetized using isoflurane, followed by isolation, ligation, and excision of the left common carotid artery within 5 minutes. Following the surgery, the postoperative pups were allowed to recover in the presence of their mother for 1 hour. After resting, the pups were moved into a humidified mixed and confined space containing 92%(v/v) N2 and 8%(v/v) O2 at a flow rate of 3 L/min for 2 hours. The whole process was carried out on a 37°C heat-resistant blanket. The pups in the sham group underwent exposure of their left common carotid arteries without actual artery ligation and hypoxia. Finally, we returned all pups to their mothers to await the next experiments. Pups received drugs daily for the next few days as follows: In the POH treatment group, pups were injected intraperitoneally with different concentrations of POH (25, 50, 100 mg/kg) directly after hypoxia at intervals of 24 hours until euthanasia. The POH + ML385 group received intraperitoneal injections of POH (100 mg/kg) and ML385 (30 mg/kg). The concentration of ML385 was based on the previous literature [24]. Sham and HI rats received an identical volume of sterile normal saline 0.9%(w/v) simultaneously. The study adhered strictly to the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals for animal care and experimentation. Additionally, the Laboratory Animal Ethics Committee of Wenzhou Medical University approved the study (Ethics number of animal experiments: wydw2022-0506).

2.8. Infarct volume measurement

An infarct volume measurement was performed by 2,3,5-triphenyltetrazolium chloride (TTC) staining [25]. We collected brain tissue from P8 rat pups 24 hours after HI injury. Brain tissues were frozen at −20 °C for 20 minutes, then sectioned into 2mm-thick coronal sections and submerged in 1%(w/v) TTC (Sigma, United States) solution for 30 minutes in a dark 37°Cwater bath. Subsequently, 4%(w/v) paraformaldehyde (PFA) was transferred into the vessels for 24 h. Brain infarct volume was computed by Image-Pro Plus version 6.0 software (Media Cybernetics, United States). All sections of each brain tissue would be measured to calculate the total area. The following formula was used to calculated percent infarct: [(total area of contralateral hemisphere) − (area of un-infarcted area of injured hemisphere)]/(total area of contralateral hemisphere).

2.9. Quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from brain tissues utilizing the TRIzol Reagent (Invitrogen, United States) and subsequently converted into cDNA utilizing the ReverTra Ace qPCR RT Kit (TOYOBO, Japan). The CFX96Real-TimePCR System (Bio-Rad Laboratories, California, United States) was used to perform qRT-PCR. The thermal cycling conditions included an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The primers of specific genes were designed by the NCBI Primer-Blast Tool (Table 1). We normalized the collected cycle threshold (Ct) values to the β-actin level and quantified the relative mRNA expression of target genes by the 2-ΔΔCt method. Table 1. The primer sequences used for real-time PCR.

Gene	Accession numbers	Forward primers	Reverse primers	
HO-1	XM_063277782.1	AAGAGGCTAAGACCGCCTTC	CCTCTGGCGAAGAAACTCTGT	
β-ACTIN	XM_017600160.3	CCTGTGGCATCCATGAAACT	TAGGAGCCAGGGCAGTAATC	

2.10. Western blot analysis

The harvested cerebral cortex tissue and PC12 cells were lysed with radioimmunoprecipitation assay (RIPA) lysis buffer containing 1 mM phenylmethylsulfonyl fluoride (PMSF). Nuclear and cytoplasmic fractions were extracted using a nuclear and cytoplasmic protein extraction kit (P0027; Beyotime, China), and protein quantification was done by a BCA assay (P0012; Beyotime, China). The extracted proteins (40 µg) were separated using SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, United States). Following a 2-hour blocking period at room temperature with 5%(w/v) nonfat milk, the membranes were subjected to overnight incubation at 4°C with primary antibodies, succeeded by secondary antibodies incubation for 2–3 hours at room temperature. The blots were visualized with an enhanced chemiluminescence system (Bio-Rad, United States) and quantitatively analyzed utilizing Image Lab version 5.2.1 software (Bio-Rad, United States).

2.11. Histological staining

The pups were euthanized with isoflurane at 7d post-HI. Cardiac perfusion of rat pups was sequentially performed with 20 ml of normal saline and 4%(w/v) PFA. These rat brain specimens were collected and postfixed overnight at 4°C in 4%(w/v) PFA. The specimens were embedded in paraffin and subsequently sectioned into 5µm-thick coronal slices for histological staining. The brain slices underwent dewaxing, hydration, and staining with H&E or Nissl solution (Solarbio, Beijing, China) to illustrate the functional neuron hemispheric integrity. These histological staining results were assessed and recorded using a fluorescence microscope (NIKON, NI-U).

2.12. Immunohistochemical staining

Paraffin sections of coronal brain tissue were dried at 65°C for 3 hours. Then the sections underwent deparaffinization in xylene and subsequent hydration in gradient alcohol. To retrieve the antigen, the sections were subjected to boiling in citrate buffer for a duration of 2 minutes. Following cooling, sections were blocked with 5%(v/v) BSA dissolved in 0.3%(v/v) Triton X-100 (PBS) for 30 minutes at 37 °C and subsequently incubated with GFAP (1:200) primary antibody for 60 minutes at 37 °C. After rinsing with PBS, sections were incubated with the appropriate secondary antibody at 37°C for 30 minutes, colored with a DAB kit (ORIGENE, United States), and counter-stained with hematoxylin for 30 s. The sections were observed and captured using a fluorescence microscope (NIKON, NI-U), and the degree of positive staining was assessed quantitatively through the utilization of Image J software (National Institutes of Health, United States).

2.13. Statistical analysis

The data were presented as mean ± SD, which was derived from a minimum of three independent experiments. Data from a normally distributed population were subsequently analyzed using one-way analysis of variance (ANOVA) for intergroup comparisons,followed by Tukey's test. A P-value < 0.05 was statistically significant. Statistical analyses were conducted by GraphPad Prism version 9.0 software (GraphPad Software, United States).

3. Results

3.1. POH attenuated PC12 cell death induced by OGD/R

First, POH cytotoxicity on PC12 cells was tested using the CCK-8 assay. In this respect, PC12 cells were cultured with specific doses of POH (0, 25, 50, 100, 200, 400, 800 µM) under normoxic conditions for 12 h or 24 h. As shown in Figure 1A, treatment with 0–800 µM POH for 12 h exhibited no cytotoxicity on PC12 cells. However, upon extending the treatment duration to 24 h (Figure 1B), the viability of PC12 cells with high dose POH (800 µM) declined significantly. Besides, it was noted that PC12 cells stimulated by OGD/R exhibited a decrease in viability, while a significant increase in viability was observed with low dose POH (Figure 1C). Among all doses tested, 50 µM yielded the most significant effect. As mentioned above, cytotoxicity of POH appeared to follow a dose- and time-dependent pattern, and 50μM POH was adopted in the following experiments, which yielded a significant protective effect but no cytotoxicity. Figure 1. Cytotoxicity of POH on PC12 cells and protective effects on OGD/R-stimulated PC12 cells. (A, B) PC12 cells treated with different doses of POH for 12 and 24 hours under normoxic conditions, and cell viability was determined by CCK8. (C) Effects of POH treatment in different concentrations on cell viability of OGD/R-stimulated PC12 cells. The values were represented as the mean ± SD (n = 5). ∗∗∗P < .001 vs. the control group; ##P < .01 and ###P < .001 vs. the OGD/R group.

3.2. POH attenuated oxidative stress and inflammatory cytokine outburst in OGD/ R-induced PC12 cells

As POH protected PC12 cells against OGD/R insult, we evaluated oxidative stress and inflammation levels to verify whether POH possessed antioxidant and anti-inflammatory properties. The expression levels of MDA and iNOS were measured as biomarkers of oxidative stress in the cell, along with GSH, SOD2, and GPX4 as antioxidant activity. It has been established that reactive oxygen species (ROS) causes irreversible damage when produced at high levels or for extended periods [26]. The level of intracellular MDA can be measured to determine the extent of lipid peroxidation, which occurs when ROS cause the breakdown of polyunsaturated lipids. Elevated levels of MDA serve as an indicator of membrane damage and destruction [27]. It has been established that following an injury, the induction of iNOS releases neurotoxic nitric oxide [28]. SOD2 and GPX4 are crucial components of the enzymatic antioxidant system, while GSH is a fundamental molecule in the nonenzymatic system. As shown in Figure 2A-F, OGD/R injury cells showed significantly higher oxidative stress levels (compared to the control group), while POH-treated synchronized cells remained low. Furthermore, GSH, SOD2, and GPX4 in the OGD/R group were substantially diminished compared to the control group but were upregulated in the POH group. To evaluate inflammation levels in PC12 cells, the expression of two pro-inflammatory cytokines was measured: TNF-α and IL-6. The western blot analysis of PC12 cell lysates (Figure 2C) revealed that OGD/R-induced injury activated the inflammatory cytokines outburst. Importantly, POH treatment could reverse these changes to a certain extent. The findings above demonstrated that POH relieved oxidative stress and inflammation induced by OGD/R in PC12 cells. Figure 2. Effects of POH on oxidative stress and inflammation on OGD/R-stimulated PC12 cells. (A, B) MDA and GSH content analyzed by commercial assay kits (n = 4). (C) Representative images of iNOS, SOD2, GPX4, TNF-α, and IL-6 by western blot. (C-H) Quantitative analysis of protein expressions above (n ≥ 3). The values were represented as the mean ± SD. ∗P < .05, ∗∗P < .01, ∗∗∗P < .001 and ∗∗∗∗P < .0001.

3.3. POH-activated Nrf2/Keap1 signaling pathway attenuated apoptosis in OGD/ R-induced PC12 cells

We then investigated whether POH regulated the Nrf2/Keap1 signaling pathway. Under inflammatory or oxidative stress conditions, Nrf2/Keap1 signaling plays a crucial role in neuron survival [7]. Proteins from PC12 cells were extracted separately from their nucleus and cytoplasm. According to Figure 3B-E, Nrf2 expression in the nucleus and cytoplasm of PC12 cells in OGD/R groups was significantly decreased, while Keap1 increased in the cytoplasm. Moreover, a significant upregulation in Nrf2 and downregulation in Keap1 were observed in the presence of POH. The results showed that POH upregulated the level of Nrf2 in the cytoplasm and promoted its translocation into the nuclei after OGD/R. Figure 3. Effects of POH on Nrf2/Keap1 pathway-related and apoptosis-related proteins on OGD/R-stimulated PC12 cells. (A) Effects of POH and ML385 on cell viability of OGD/R- stimulated PC12 cells (n = 8). (B) Representative images of Nrf2/Keap1 pathway-related and apoptosis-related proteins by western blot. N-Nrf2 means Nrf2 in the nucleus and c-Nrf2 in the cytoplasm. (C-F) Quantitative analysis of protein expressions above (n ≥ 3). (G) Representative fluorescence image of cleaved caspase-3 (green) with DAPI (blue) (n = 4), scale bar = 100μm. The values were represented as the mean ± SD. ∗P < .05, ∗∗P < .01 and ∗∗∗P < .001 vs. the sham group; ###P < .001 vs. the HI group; &&& P < .001 vs. the HI + POH group.

For a deeper comprehension of the role of Nrf2/Keap1 in POH protection, ML385, a specific Nrf2 inhibitor, was added to the experiment. Existing studies have verified that ML385 blocks the binding of Nrf2 to ARE and revealed a dose- and time-dependent decrease in Nrf2 mRNA and protein levels [21,29]. As expected, the activation of Nrf2 by POH was inhibited by ML385 (Figure 3B). Following treatment with POH and ML385, as demonstrated in Figure 3A, there was a significant reduction of almost 20% in the number of viable PC12 cells (in comparison to the POH group), which was similar to the reduction observed in the OGD/R group. This implies that the activation of Nrf2 may play an essential role in safeguarding the protective effects of POH.

We next evaluated the expression levels of various apoptosis-related proteins to further validate the molecular mechanism underlying POH's effects. According to western blot analysis (Figure 3B), OGD/R injury increased the expression of pro-apoptotic protein BAX while antiapoptotic protein BCL2 was decreased, which increased the BAX/BCL2 ratio, whereas POH treatment altered this change in reverse. We corroborated this experimental result by performing immunofluorescence staining for the cleaved caspase-3 (Figure 3G). We found increased fluorescence intensity of cleaved caspase-3 in the model group. POH downregulated the fluorescence intensity and inhibited the occurrence of apoptosis. As expected, the antiapoptotic effect of POH was relieved by ML385, further confirming that the activation of Nrf2 is key to the neuroprotective effect.

3.4. POH attenuated hypoxic-ischemic brain injury in neonatal rats

The results obtained from the in vitro model should be carefully considered when extrapolating to in vivo conditions. To further investigate the applicability of these results in vivo, we conducted experiments on neonatal rats to evaluate the neuroprotective effects of POH on HI-induced brain injury. TTC staining was used to assess the cerebral infarct volume in neonatal rats to determine whether POH could alleviate the HI brain injury. Immediately following HI, pups were intraperitoneally injected with POH at 25, 50, and 100 mg/kg concentrations. We collected brain tissue from P8 rat pups 24 hours after HI injury. Results and quantitative analysis of TTC staining (Figure 4AB) revealed that POH decreased the volume of cerebral infarction caused by HI. In addition, the optimal results were obtained at 100 mg/kg, which was used as the standard concentration in the subsequent experiments. Subsequently, changes in the overall anatomical structure of the brain were recorded at 3 days post-HI injury (P 10). As shown in Figure 4CD, the HI group exhibited more edema and liquefaction, but the affected area was attenuated to some extent by POH administration. These observations indicated that POH administration could lessen cerebral damage after HI in newborn rats. Figure 4. POH attenuated hypoxic-ischemic brain injury in neonatal rats. (A) Representative TTC staining images of coronary brains 24 hours after HI injury. Scale bar = 1 mm. (B) Quantitative analysis of infarct volume based on TTC staining (n = 4). (C) Representative images of the general anatomical structure of brains 3 days after HI injury. Scale bar = 1 mm. (D) An injured hemisphere's residual brain volume is defined as its ratio to the contralateral hemisphere. (n = 5). The values were represented as the mean ± SD. ∗P < .05 and ∗∗∗P < .001 vs. the sham group; #P < .05, ##P < .01 and ###P < .001 vs. the HI group; &&& P < .001 vs. the HI + POH (25 mg/kg) group; @@ P < .01 vs. the HI + POH (50 mg/kg) group; %% P < .01 vs. the HI + POH (100 mg/kg) group.

3.5. POH-activated Nrf2/Keap1 signaling pathway attenuated oxidative stress and apoptosis after HI brain injury in neonatal rats

Subsequently, we investigated the impact of POH on the Nrf2/Keap1 signaling pathway in the context of HI-induced brain injury, utilizing qRT-PCR (Figure 5A) and western blot (Figure 5B). We extracted mRNA and protein from rat brain tissue and found that the protein levels of Nrf2 and Keap1 in rat brain tissue showed varying degrees of increase in the presence of POH. Additionally, HO-1, a downstream molecule of Nrf2, was upregulated following POH treatment both in the mRNA and protein. However, the regulatory effects of POH on these proteins were reversed upon administration of ML385. The above results once again confirmed that POH upregulate the Nrf2/Keap1 signaling pathway, thereby activating the transcription and translation of its downstream target gene. Figure 5. POH-activated Nrf2/Keap1 signaling pathway attenuated oxidative stress and apoptosis after HI brain injury in neonatal rats. (A) HO-1 mRNA expression in brain tissues 24 hours after HI injury, normalized to β-actin (n = 4). (B-L) Protein expressions of the Nrf2/Keap1 pathway-, oxidative stress- and apoptosis-related proteins were revealed by western blot 24 hours after HI injury and quantitative analyses (n ≥ 3). The values were represented as the mean ± SD. ∗P < .05, ∗∗P < .01, ∗∗∗P < .001 and ∗∗∗∗P < .0001 vs. the sham group; ###P < .001 vs. the HI group.

The next experiments assessed the effects of POH on oxidative stress and apoptosis levels in neonatal rat brains. According to western blot analysis (Figure 5B-D), the antioxidant enzymes SOD2 and GPX4 were upregulated by POH, suggesting that POH exerted antioxidant activities in vivo. It is now understood that there are two main branches of apoptosis in cells: intrinsic and extrinsic. Bcl-2 family proteins positively or negatively regulate intrinsic apoptosis by sensing various internal stress signals. The release of cytochrome C is induced by Bcl-2 family proteins. In contrast, caspase 8 is involved in initiating extrinsic apoptosis and is known as apoptosis ‘initiator’ caspase. Caspase 3, known as the ‘executioner’, is a main effector of caspase, the downstream effector of both intrinsic and extrinsic apoptosis pathways [30,31]. For the present experiment, we assessed the expression of the above apoptosis-related proteins in each group. As shown in Figure 5H-K, HI injury increased the BAX/BCL2 ratio, promoted the release of cytochrome c and activated caspase 8 and caspase 3, mitigated by POH treatment. The results suggested that POH might exert antiapoptotic activities in vivo through intrinsic and extrinsic apoptotic pathways. Importantly, the above antioxidant and antiapoptotic abilities of POH were all relieved by ML385. These findings reiterate the critical role of the Nrf2/Keap1 signaling pathway in the antioxidant and antiapoptotic activities of POH.

3.6. POH preserved brain tissue structure by activating the Nrf2/Keap1 signaling pathway after HI brain injury in neonatal rats

Subsequently, we assessed the neuroprotective effects of POH. HE and Nissl staining (Figure 6) were performed first to observe the morphology of the neuron and the integrity of the Nissl body after HI injury. Neurons in the cortex and hippocampus (CA1 region, dentate gyrus (DG) region, CA3 region) were neatly arranged and oval or round in the sham group. The nuclei were clear and intact. Moreover, the Nissl bodies surrounding the nuclei were large and numerous. In contrast, the neurons in the injured region showed pyknotic nuclei, which were disordered or absent, with few Nissl bodies present. In the POH treatment group, we found that the extent of neuron degeneration and necrosis decreased dramatically, and a higher number of neurons and Nissl bodies was observed. In contrast, ML385 partially suppressed the increase in neuronal density and morphological recovery following POH administration. Figure 6. POH promoted brain tissue structure morphological recovery after HI brain injury in neonatal rats. (A, B) Representative HE and Nissl staining images of rat brain specimens in the cortex 7 days after HI injury . Images of 4× have scale bars of 200μm; Images of 10× have scale bars of 100μm; Images of 20× have scale bars of 50μm. (C, D) Representative HE and Nissl staining images of rat brain specimens in the hippocampus CA1 region, hippocampus DG region, and CA3 region 7 days after HI injury. Images of 4× have scale bars of 200μm; Images of 20× have scale bars of 50μm. (E) Number of cells in the cortex, hippocampal CA1 region, hippocampus DG region, and CA3 region in each group (n = 5). (F) Number of neurons in the cortex, hippocampal CA1 region, hippocampus DG region, and CA3 region in each group (n = 5). Disorganized arrangement of neuronal cells in brain tissue (black arrows). Acute ischemia and hypoxia lead to neuronal necrosis, presenting ‘red neuron’ changes, characterized by: neuronal shrinkage and Nissl body loss (yellow arrows); strong eosinophilia of the cytoplasm (red arrows); and pronounced basophilia of the condensed nucleus (blue arrows, which may ultimately result in nuclear fragmentation). The arrows indicate representative positions. The values were represented as the mean ± SD. ∗P < .05, ∗∗P < .01 and ∗∗∗P < .001 vs. the sham group; #P < .05 and ##P < .01 vs. the HI group; && P < .01 and &&& P < .001 vs. the HI + POH group.

Previous studies have shown that neuronal dendrites express MAP-2, a structural protein that maintains microtubules against depolymerization and is a biomarker for healthy neurons [32]. Consequently, we then evaluated the expression of MAP2 protein by western blot to assess the stability of microtubule function in groups (Figure 7D). Compared to the HI group, a significant increase in MAP-2 expression was observed in the POH group, which was mitigated by treatment with the inhibitor. Figure 7. POH restrained reactive astrogliosis after HI brain injury in neonatal rats. (A, B) Representative GFAP (Brown) immunohistochemical stainingimages of rat brain specimens in the cortex, hippocampus CA1 region, DG region, and CA3 region 7 days after HI injury (Black arrows: GFAP-stained astrocytes). Images of 4× have scale bars of 200μm; Images of 10× have scale bars of 100μm; Images of 20× have scale bars of 50μm; Images of 40× have scale bars of 20μm. (C) The quantitation of GFAP staining intensity by Image J (n = 5). (D-F) Protein expressions of GFAP and MAP2 were revealed by western blot 24 hours after HI injury and quantitative analyses (n = 3). The values were represented as the mean ± SD. ∗P < .05, ∗∗P < .01, ∗∗∗P < .001 and ∗∗∗∗P < .0001 vs. the sham group; #P < .05 and ##P < .01 vs. the HI group; && P < .01 and &&& P < .001 vs. the HI + POH group.

GFAP is the primary intermediate filament found in astrocytes. An abnormal increase in GFAP is indicative of changes in the astrocyte cytoskeleton’s integrity and is widely regarded as a reliable marker of reactive astrogliosis or astrocyte reactivity in cases of neuroinflammation or nerve injuries [33]. To observe the changes in GFAP, we performed immunohistochemical staining and western blot analysis. Compared to the HI group (Figure 7A-C), POH treatment significantly decreased GFAP-positive staining in the ipsilateral hemisphere. However, this effect was suppressed by ML385 treatment. Based on the western blot analysis (Figure 7D), POH treatment significantly lowered the protein expression of GFAP, whereas ML385 suppressed this change, consistent with immunohistochemistry staining.

Taken together, our results indicated that POH promoted morphological recovery of brain tissue, increased neuron density, stabilized microtubule function, and inhibited reactive astrogliosis after HI brain injury in neonatal rats by activating the Nrf2/Keap1 signaling pathway, thus exerting a neuroprotective effect.

4. Discussion

Neonatal hypoxic-ischemic encephalopathy refers to brain injury in neonates and fetuses due to a reduction or pause in cerebral blood flow and partial or complete hypoxia due to perinatal asphyxia. Currently, the only clinical therapy strategy for HIE is therapeutic hypothermia, but it must be administered within a limited therapeutic time window (within 6 h after birth). Moreover, children with severe HIE may not experience significant therapeutic benefits from this therapy [34,35]. As a result, there is an urgent need to find an adjuvant/ alternative therapy for therapeutic hypothermia to improve the therapeutic effect of HIE. Perillyl alcohol (POH) is a naturally occurring monoterpene. Over the past few decades, POH has been recognized as having neuroprotective properties. Additionally, research demonstrated that POH can safely, effectively, controllably, rapidly, and reversibly open the blood–brain barrier (BBB) without any apparent adverse reactions [36]. Furthermore, there are detailed reports on the pharmacokinetics of POH in plasma and cerebrospinal fluid (CSF) [37]. Animal models have shown favorable distribution of POH in brain tissues. Based on previous research, the present study presented hitherto undocumented evidence that the administration of POH effectively suppressed neuronal injury via in vitro and in vivo models of HIE. Firstly, a preliminary in vitro evaluation of POH's therapeutic efficacy was conducted. Given that the PC12 cell line derived from rat adrenal medulla pheochromocytoma possesses neuroendocrine characteristics, it is extensively used in neurophysiology and neuropharmacology [38]. After OGD/R, POH administration increased PC12 cell viability and repressed oxidative stress, inflammation, and apoptosis. In further in vivo investigation, except for its antioxidant and antiapoptotic properties, POH remarkably lessened infarct volume, reduced cerebral edema, promoted the brain tissue structure morphological recovery, and blocked reactive astrogliosis during hypoxic-ischemic brain injury. By using the Nrf2 inhibitor ML385, we were able to establish that the activation of the Nrf2/Keap1 signaling pathway was the primary mediator of the therapeutic effects of POH.

Oxidative stress represents a pivotal element in the HIE pathological cascade [39]. Due to the high oxygen consumption, deficient antioxidative capacity, abundance of unsaturated fatty acids, and elevated Fe2 + availability for ROS production, the immature brain is particularly susceptible to oxidation [40,41]. Liu et al. confirmed that OGD/R induces ROS generation and lipid peroxidation in rat primary cortical neurons [27]. Similarly, we found significant upregulation of MDA in post-OGD/R PC12 cells, which was then decreased by POH administration. Endogenous antioxidant mechanisms consist of enzymatic and nonenzymatic defense mechanisms. Enzymatic mechanisms include superoxide dismutase, catalase, and GPX, while non-enzymatic mechanisms involve GSH, Vitamin C, Vitamin E, Melatonin, among others [42]. In the present study, we observed that POH acted as an indirect antioxidant by inducing both endogenous antioxidants and enzymes. Isoflurane is a commonly used anesthetic known to potentially increase the transcription levels of hypoxia-inducible factor (HIF) and its target genes, exerting organ-protective effects [43]. We acknowledge that the use of isoflurane euthanasia in our vivo study may have altered some of the observed results. However, it is important to note that all test subjects underwent the same euthanasia procedure, thereby maintaining relative consistency for all measurements and comparisons. Conducting further research to explore ways to minimize or account for the impact of isoflurane on HIF and its target genes during euthanasia and sample collection would be beneficial. This aspect requires further and more detailed investigation, and we hope that future studies will consider these factors to gain a clearer understanding of this topic.

In addition to the early necrosis of cells in the ischaemic core, the secondary energy failure in HIE brings about delayed neuronal death dominated by apoptosis in the peripheral area, which contributes significantly to the final loss of brain cells after HI insult [2,44,45]. Therefore, a variety of apoptosis-related proteins were detected in our study to confirm POH's antiapoptotic properties. Previous studies have shown that oxidative stress induced by neonatal HI injury damages mitochondria [46]. The insult mediated by HI is responsible for modulating the Bcl-2 family proteins, thereby triggering the onset of Bax-dependent mitochondrial outer membrane permeabilization (MOMP) and consequent cytochrome c release. The cytosolic cytochrome c then recruits and activates Apaf-1 and caspase-9 to form the apoptosome, subsequently activating caspase 3, leading to intrinsic apoptosis. In the meantime, inflammatory astroglia and microglia release death receptor ligands, which activate death receptors, activate caspase 8, and lead to extrinsic apoptosis [46,47]. In our current study, we observed that inducing HI injury increased the BAX/BCL2 ratio, promoted the release of cytochrome c and activated the reactive astrogliosis and caspase8 in neonatal rats. This, in turn, triggered the activation of caspase3, leading to the induction of the execution phase of apoptotic cascades. However, the administration of POH was found to attenuate these changes in the rats. Based on these results, POH might inhibit HI-induced apoptosis endogenously and exogenously.

Nuclear factor erythroid 2-related factor 2 (Nrf2) is a well-characterized transcription factor and is known to play a significant role in the body's inherent ability to resist oxidative stress. Nrf2 activation is widely considered a prospective therapeutic target for conditions characterized by mitochondrial dysfunction and oxidative stress [48]. Among them, the association between Nrf2 and neurological disorders has received much more attention. For instance, Peng Ren et al. demonstrated that APP/PS1 mice (a mouse model of Alzheimer's disease) with genetic removal of Nrf2 showed reinforced activation of astrocytes and microglia, promoting Alzheimer's disease-like pathology [49]. Tawfeeq Shekh-Ahmad et al. demonstrated that acute Keap1 inhibition following status epilepticus could activate Nrf2 and suppress the development of epilepsy [50]. In our previous studies, Nrf2 activation has been proven to improve the assessment of long-term functional and structural end-points after HI brain injury in neonatal rats [23,51]. The present study examines a diminution of Keap1 in the cytosol and a marked accumulation of Nrf2 protein in the cytosol and nucleus after POH administration in post-OGD/R PC12 cells, indicating the Nrf2 upregulation and nuclear translocation motivated by the molecule. Furthermore, our in vivo experiments further demonstrated that POH upregulate the Nrf2/Keap1 signaling pathway, thereby activating the transcription and translation of its downstream target gene. Heme oxygenase-1 (HO-1, HMOX1, EC 1.14.99.3) is one of the genes regulated downstream by Nrf2 [52]. As a phase II antioxidant enzyme, HO-1 catalyzes the degradation of heme, producing iron ions, carbon monoxide (CO), and biliverdin. Biliverdin is rapidly reduced to bilirubin by biliverdin reductase (BVR). These active molecules can accelerate the resolution of intracellular oxidative stress and inflammation [53,54]. Bilirubin has been shown to possess significant antioxidant and anti-inflammatory properties, alleviating inflammatory damage in endothelial cells [55] and improving collagen-induced arthritis in mice [56]. Additionally, CO is considered an important signaling molecule, playing significant roles in the nervous system [57] and various physiological and pathological processes [58]. The specific roles of these downstream active molecules in ischemia-reperfusion brain injury in rats warrant further investigation. In addition, ML385, a neoteric and specific inhibitor of Nrf2, reversed the regulatory effects of POH on the pathway, as well as the neuroprotective properties of POH. Based on the aforementioned findings, we hypothesized that the therapeutic benefits of POH are primarily mediated via the activation of the Nrf2/Keap1 signaling pathway. Notably, our investigation revealed an incongruous impact of OGD/R treatment on PC12 cells and HI treatment on neonatal rats with regards to the Nrf2 signaling pathway. Specifically, OGD/R treatment led to a downregulation of the Nrf2 signaling pathway in PC12 cells, whereas HI treatment resulted in an upregulation of the same pathway in neonatal rats. It is imperative to acknowledge that PC12 cells do not represent primary neurons and that in vivo studies may not be directly comparable to in vitro studies. There are inherent differences between these models. However, our study specifically focuses on examining the regulation of Nrf2 by POH. Currently, there is no consensus on the protein expression level, target genes, or subcellular localization of Nrf2 in cerebral ischemia disease, which is an area that requires further research. For example, it has been found that Nrf2 upregulation at the mRNA and protein level both in the cytoplasm and nucleus in transient middle cerebral artery occlusion (t-MCAO) rats [59]. Conversely, some studies have reported Nrf2 suppression during t-MCAO [60], while others reported no change in Nrf2 [61]. It is highly conceivable that these discrepancies are due to various experimental variables such as gender, age, observation time points after HI, and site of the brain sample, warranting further research. However, most studies have demonstrated the critical role of Nrf2 activation in safeguarding against ischemia-reperfusion-induced brain damage, aligning with our findings [59–62].

Some limitations were noted in this study. In the conventional sense, we typically consider the typical pathways for small molecule activation of the Nrf2 signaling pathway acted by covalently modifying Keap1 cysteines, thereby liberating Nrf2 from targeted ubiquitination and degradation. In this study, we have demonstrated that POH exerts neuroprotective effects by activating the Nrf2 signaling pathway. However, the specific mechanism still requires further research, such as how POH activates Nrf2, which presumably involves the covalent modifications of Keap1. From a clinical perspective, preclinical neuroprotective drug testing should incorporate postischemic treatment and structural and long-term functional outcomes [63,64]. In our present studies, we initiated POH treatment soon after HI and evaluated the structural end-points by HE and Nissl staining. Our data suggest that POH post-HI treatment showed promise for restoring neuronal density and brain tissue structure morphology and stabilizing microtubule function in neonatal rats after HI injury. However, further investigations are warranted to ascertain the optimal duration of POH treatment. Additionally, while PC12 cells are frequently employed in nervous system research, the use of primary cortical nerve cells in OGD/R experiments is preferable to accurately replicate the hypoxic-ischemic injury conditions that occur in vivo. The specific mechanism of how POH activates Nrf2 in our study is still at an early stage. We have confirmed that POH treatment can significantly promote the upregulation and nuclear translocation of Nrf2 in HIE models. However, we have yet to directly prove the specific mechanism by which POH or its metabolites activate Nrf2. Further experiments and research are needed to provide more definitive evidence.

5. Conclusion

To conclude, the present study has provided evidence that POH treatment decreased infarct volume, enhanced tissue recovery morphologically, and mitigated the extent of neuron degeneration and necrosis in neonatal rats following HI brain injury. The present study presents a schematic diagram (Figure 8), illustrating the potential mechanism of perillyl alcohol for its neuroprotective effect. Our in vivo and in vitro experiments showed that POH effectively counters oxidative stress and apoptosis by activating Nrf2/Keap1 signaling. These findings suggest that POH has the potential to serve as an innovative therapy for hypoxic-ischemic encephalopathy, although further investigations are warranted to fully elucidate its potential clinical utility. Figure 8. Schematic diagram (by Figdraw) illustrates the potential mechanism of perillyl alcohol for its neuroprotective effect. Hypoxic-ischemic injury resulted in the excessive generation of reactive oxygen species (ROS) within nerve cells, thereby inducing oxidative stress, lipid peroxidation, and mitochondrial dysfunction. Concurrently, hypoxic-ischemic injury triggered reactive astrogliosis in rat brain tissue, ultimately culminating in nerve cell apoptosis. The administration of perillyl alcohol impeded the binding of Nrf2 and Keap1 within nerve cells, thereby stimulating the up-regulation of Nrf2 and its nuclear translocation. Nrf2 subsequently binded to the antioxidant response element (ARE) within the nucleus, thereby promoting the up-regulation of downstream antioxidant/phase II detoxifying enzymes, ultimately mitigating the oxidative stress induced by hypoxic-ischemic injury. The attenuation of oxidative stress modulated the BCL2 family proteins, thereby inhibiting the occurrence of mitochondrial dysfunction and preventing the release of cytochrome C (CytC) from the mitochondria, ultimately blocking the intrinsic apoptosis. Additionally, perillyl alcohol demonstrated the ability to impede reactive astrogliosis in brain tissue and the release of death factors, including TNF-α, by activated astrocytes. This action prevented the activation of death receptors on nerve cell membranes, inhibited the activation of caspase8, and ultimately prevented the occurrence of exogenous apoptosis.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Availability of data and materials

All data associated with this study are present in the paper. Any information for this study is available by contacting the corresponding authors upon reasonable request.
==== Refs
References

1 Jacobs SE, Berg M, Hunt R, et al. Cooling for newborns with hypoxic ischaemic encephalopathy. Cochrane Database Syst Rev. 2013 Jan 31;2013 (1 ):Cd003311.23440789
2 Millar LJ, Shi L, Hoerder-Suabedissen A, et al. Neonatal Hypoxia Ischaemia: mechanisms, models, and therapeutic challenges. Front Cell Neurosci. 2017;11 :78. doi:10.3389/fncel.2017.00078 28533743
3 Itoh K, Wakabayashi N, Katoh Y, et al. Keap1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. 1999 Jan 1;13 (1 ):76–86. doi:10.1101/gad.13.1.76 9887101
4 Zhang X, Ding M, Zhu P, et al. New insights into the Nrf-2/HO-1 signaling axis and Its application in pediatric respiratory diseases. Oxid Med Cell Longev. 2019;2019 :3214196.31827672
5 Tonelli C, Chio IIC, Tuveson DA. Transcriptional regulation by Nrf2. Antioxid Redox Signal. 2018 Dec 10;29 (17 ):1727–1745. doi:10.1089/ars.2017.7342 28899199
6 Baird L, Yamamoto M. The molecular mechanisms regulating the KEAP1-NRF2 pathway. Mol Cell Biol. 2020 Jun 15;40 (13 ):e00099-20.32284348
7 Chakkittukandiyil A, Sajini DV, Karuppaiah A, et al. The principal molecular mechanisms behind the activation of Keap1/Nrf2/ARE pathway leading to neuroprotective action in Parkinson's disease. Neurochem Int. 2022 Jun;156 :105325. doi:10.1016/j.neuint.2022.105325 35278519
8 Itoh K, Chiba T, Takahashi S, et al. An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun. 1997 Jul 18;236 (2 ):313–322. doi:10.1006/bbrc.1997.6943 9240432
9 Wu KC, Cui JY, Klaassen CD. Beneficial role of Nrf2 in regulating NADPH generation and consumption. Toxicol Sci. 2011 Oct;123 (2 ):590–600. doi:10.1093/toxsci/kfr183 21775727
10 Rangasamy T, Cho CY, Thimmulappa RK, et al. Genetic ablation of Nrf2 enhances susceptibility to cigarette smoke-induced emphysema in mice. J Clin Invest. 2004 Nov;114 (9 ):1248–1259. doi:10.1172/JCI200421146 15520857
11 Lee JM, Calkins MJ, Chan K, et al. Identification of the NF-E2-related factor-2-dependent genes conferring protection against oxidative stress in primary cortical astrocytes using oligonucleotide microarray analysis. J Biol Chem. 2003 Apr 4;278 (14 ):12029–12038. doi:10.1074/jbc.M211558200 12556532
12 Santos JG, Da Cruz WMS, Schönthal AH, et al. Efficacy of a ketogenic diet with concomitant intranasal perillyl alcohol as a novel strategy for the therapy of recurrent glioblastoma. Oncol Lett. 2018 Jan;15 (1 ):1263–1270.29391903
13 Chen TC, da Fonseca CO, Levin D, et al. The Monoterpenoid Perillyl alcohol: anticancer agent and medium to overcome biological barriers. Pharmaceutics. 2021 Dec 16;13 (12 ):2167.34959448
14 Tabassum R, Vaibhav K, Shrivastava P, et al. Perillyl alcohol improves functional and histological outcomes against ischemia-reperfusion injury by attenuation of oxidative stress and repression of COX-2, NOS-2 and NF-κB in middle cerebral artery occlusion rats. Eur J Pharmacol. 2015 Jan 15;747 :190–199. doi:10.1016/j.ejphar.2014.09.015 25240714
15 Anis E, Zafeer MF, Firdaus F, et al. Perillyl alcohol mitigates behavioural changes and limits cell death and mitochondrial changes in unilateral 6-OHDA lesion model of Parkinson's disease through alleviation of oxidative stress. Neurotox Res. 2020 Aug;38 (2 ):461–477. doi:10.1007/s12640-020-00213-0 32394056
16 Ahmed S, Panda SR, Kwatra M, et al. Perillyl alcohol attenuates NLRP3 inflammasome activation and rescues dopaminergic neurons in experimental In vitro and In Vivo models of Parkinson's disease. ACS Chem Neurosci. 2022 Jan 5;13 (1 ):53–68. doi:10.1021/acschemneuro.1c00550 34904823
17 Marin AA, Murillo O, Sussmann RA, et al. Perillyl alcohol reduces parasite sequestration and cerebrovascular dysfunction during experimental cerebral malaria. Antimicrob Agents Chemother. 2023 May 1;65 (5 ):e00004-21. doi:10.1128/AAC.00004-21 33649109
18 Tabakman R, Jiang H, Shahar I, et al. Neuroprotection by NGF in the PC12 in vitro OGD model: involvement of mitogen-activated protein kinases and gene expression. Ann N Y Acad Sci. 2005 Aug;1053 :84–96.16179511
19 Vaudry D, Stork PJ, Lazarovici P, et al. Signaling pathways for PC12 cell differentiation: making the right connections. Science. 2002 May 31;296 (5573 ):1648–1649. doi:10.1126/science.1071552 12040181
20 Qi S, Zhang X, Fu Z, et al. (±)-5-bromo-2-(5-fluoro-1-hydroxyamyl) benzoate protects against oxidative stress injury in PC12 cells exposed to H(2)O(2) through activation of Nrf2 pathway. Front Pharmacol. 2022;13 :943111. doi:10.3389/fphar.2022.943111 35935850
21 Singh A, Venkannagari S, Oh KH, et al. Small molecule inhibitor of NRF2 selectively intervenes therapeutic resistance in KEAP1-deficient NSCLC tumors. ACS Chem Biol. 2016 Nov 18;11 (11 ):3214–3225. doi:10.1021/acschembio.6b00651 27552339
22 Vannucci RC, Vannucci SJ. Perinatal hypoxic-ischemic brain damage: evolution of an animal model. Dev Neurosci. 2005 Mar-Aug;27 (2-4 ):81–86. doi:10.1159/000085978 16046840
23 Zheng Y, Li L, Chen B, et al. Chlorogenic acid exerts neuroprotective effect against hypoxia-ischemia brain injury in neonatal rats by activating Sirt1 to regulate the Nrf2-NF-κB signaling pathway. Cell Commun Signal. 2022 Jun 10;20 (1 ):84. doi:10.1186/s12964-022-00860-0 35689269
24 Xian P, Hei Y, Wang R, et al. Mesenchymal stem cell-derived exosomes as a nanotherapeutic agent for amelioration of inflammation-induced astrocyte alterations in mice. Theranostics. 2019;9 (20 ):5956–5975. doi:10.7150/thno.33872 31534531
25 Wang F, Li R, Tu P, et al. Total Glycosides of Cistanche deserticola promote neurological function recovery by inducing neurovascular regeneration via Nrf-2/Keap-1 pathway in MCAO/R rats. Front Pharmacol. 2020;11 :236. doi:10.3389/fphar.2020.00236 32256351
26 Popa-Wagner A, Mitran S, Sivanesan S, et al. ROS and brain diseases: the good, the bad, and the ugly. Oxid Med Cell Longev. 2013;2013 :963520.24381719
27 Liu X, Ma Y, Wei X, et al. Neuroprotective effect of licochalcone A against oxygen-glucose deprivation/reperfusion in rat primary cortical neurons by attenuating oxidative stress injury and inflammatory response via the SIRT1/Nrf2 pathway. J Cell Biochem. 2018 Apr;119 (4 ):3210–3219. doi:10.1002/jcb.26477 29105819
28 Ergenekon E, Gücüyener K, Erbaş D, et al. Cerebrospinal fluid and serum nitric oxide levels in asphyxiated newborns. Biol Neonate. 1999 Oct;76 (4 ):200–206. doi:10.1159/000014159 10473893
29 Dodson M, de la Vega MR, Cholanians AB, et al. Modulating NRF2 in disease: timing Is everything. Annu Rev Pharmacol Toxicol. 2019 Jan 6;59 :555–575. doi:10.1146/annurev-pharmtox-010818-021856 30256716
30 Roberts JZ, Crawford N, Longley DB. The role of ubiquitination in apoptosis and necroptosis. Cell Death Differ. 2022 Feb;29 (2 ):272–284. doi:10.1038/s41418-021-00922-9 34912054
31 Zhuang J, Xie L, Zheng L. A glimpse of programmed cell death among bacteria, animals, and plants. Front Cell Dev Biol. 2021;9 :790117. doi:10.3389/fcell.2021.790117 35223864
32 Bodakuntla S, Jijumon AS, Villablanca C, et al. Microtubule-Associated proteins: structuring the cytoskeleton. Trends Cell Biol. 2019 Oct;29 (10 ):804–819. doi:10.1016/j.tcb.2019.07.004 31416684
33 Kumar A, Fontana IC, Nordberg A. Reactive astrogliosis: a friend or foe in the pathogenesis of Alzheimer's disease. J Neurochem. 2023 Feb;164 (3 ):309–324. doi:10.1111/jnc.15565 34931315
34 Sabir H, Bonifacio SL, Gunn AJ, et al. Unanswered questions regarding therapeutic hypothermia for neonates with neonatal encephalopathy. Semin Fetal Neonatal Med. 2021 Oct;26 (5 ):101257. doi:10.1016/j.siny.2021.101257 34144931
35 Tsuda K, Shibasaki J, Isayama T, et al. Three-year outcome following neonatal encephalopathy in a high-survival cohort. Sci Rep. 2022 May 13;12 (1 ):7945. doi:10.1038/s41598-022-12091-x 35562399
36 Wang W, Marín-Ramos NI, He H, et al. NEO100 enables brain delivery of blood‒brain barrier impermeable therapeutics. Neuro Oncol. 2021 Jan 30;23 (1 ):63–75. doi:10.1093/neuonc/noaa206 32877532
37 Nehra G, Andrews S, Rettig J, et al. Intranasal administration of the chemotherapeutic perillyl alcohol results in selective delivery to the cerebrospinal fluid in rats. Sci Rep. 2021 Mar 18;11 (1 ):6351. doi:10.1038/s41598-021-85293-4 33737566
38 Greene LA, Tischler AS. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci U S A. 1976 Jul;73 (7 ):2424–2428. doi:10.1073/pnas.73.7.2424 1065897
39 Htun Y, Nakamura S, Kusaka T. Hydrogen and therapeutic gases for neonatal hypoxic-ischemic encephalopathy: potential neuroprotective adjuncts in translational research. Pediatr Res. 2021 Mar;89 (4 ):753–759. doi:10.1038/s41390-020-0998-z 32505123
40 Singh-Mallah G, Nair S, Sandberg M, et al. The role of mitochondrial and endoplasmic reticulum reactive oxygen species production in models of perinatal brain injury. Antioxid Redox Signal. 2019 Sep 20;31 (9 ):643–663. doi:10.1089/ars.2019.7779 30957515
41 Qin X, Cheng J, Zhong Y, et al. Mechanism and treatment related to oxidative stress in neonatal hypoxic-ischemic encephalopathy. Front Mol Neurosci. 2019;12 :88. doi:10.3389/fnmol.2019.00088 31031592
42 Shaw P, Kumar N, Sahun M, et al. Modulating the antioxidant response for better oxidative stress-inducing therapies: How to take advantage of Two sides of the same medal? Biomedicines. 2022 Mar 31;10 (4 ):823.35453573
43 Hieber S, Huhn R, Hollmann MW, et al. Hypoxia-inducible factor 1 and related gene products in anaesthetic-induced preconditioning. Eur J Anaesthesiol. 2009 Mar;26 (3 ):201–206. doi:10.1097/EJA.0b013e3283212cbb 19244689
44 Li B, Concepcion K, Meng X, et al. Brain-immune interactions in perinatal hypoxic-ischemic brain injury. Prog Neurobiol. 2017 Dec;159 :50–68. doi:10.1016/j.pneurobio.2017.10.006 29111451
45 Lipton P. Ischemic cell death in brain neurons. Physiol Rev. 1999 Oct;79 (4 ):1431–1568. doi:10.1152/physrev.1999.79.4.1431 10508238
46 Zhao M, Zhu P, Fujino M, et al. Oxidative stress in hypoxic-ischemic encephalopathy: molecular mechanisms and therapeutic strategies. Int J Mol Sci. 2016 Dec 10;17 (12 ):2078.27973415
47 Thornton C, Jones A, Nair S, et al. Mitochondrial dynamics, mitophagy and biogenesis in neonatal hypoxic-ischaemic brain injury. FEBS Lett. 2018 Mar;592 (5 ):812–830. doi:10.1002/1873-3468.12943 29265370
48 Esteras N, Abramov AY. Nrf2 as a regulator of mitochondrial function: energy metabolism and beyond. Free Radic Biol Med. 2022 Aug 20;189 :136–153. doi:10.1016/j.freeradbiomed.2022.07.013 35918014
49 Ren P, Chen J, Li B, et al. Nrf2 ablation promotes Alzheimer's disease-like pathology in APP/PS1 transgenic mice: The role of neuroinflammation and oxidative stress. Oxid Med Cell Longev. 2020;2020 :3050971.32454936
50 Shekh-Ahmad T, Eckel R, Dayalan Naidu S, et al. KEAP1 inhibition is neuroprotective and suppresses the development of epilepsy. Brain. 2018 May 1;141 (5 ):1390–1403. doi:10.1093/brain/awy071 29538645
51 Fu C, Zheng Y, Zhu J, et al. Lycopene exerts neuroprotective effects after hypoxic-ischemic brain injury in neonatal rats via the nuclear factor erythroid-2 related factor 2/nuclear factor-κ-gene binding pathway. Front Pharmacol. 2020;11 :585898. doi:10.3389/fphar.2020.585898 33390957
52 Alam J, Stewart D, Touchard C, et al. Nrf2, a Cap'n'Collar transcription factor, regulates induction of the heme oxygenase-1 gene. J Biol Chem. 1999 Sep 10;274 (37 ):26071–8. doi:10.1074/jbc.274.37.26071 10473555
53 Wunder C, Potter RF. The heme oxygenase system: its role in liver inflammation. Curr Drug Targets Cardiovasc Haematol Disord. 2003 Sep;3 (3 ):199–208.12871038
54 Saha S, Buttari B, Panieri E, et al. An overview of Nrf2 signaling pathway and Its role in inflammation. Molecules. 2020 Nov 23;25 (22 ):5474.33238435
55 Kawamura K, Ishikawa K, Wada Y, et al. Bilirubin from heme oxygenase-1 attenuates vascular endothelial activation and dysfunction. Arterioscler Thromb Vasc Biol. 2005 Jan;25 (1 ):155–160. doi:10.1161/01.ATV.0000148405.18071.6a 15499042
56 Bonelli M, Savitskaya A, Steiner CW, et al. Heme oxygenase-1 end-products carbon monoxide and biliverdin ameliorate murine collagen induced arthritis. Clin Exp Rheumatol. 2012 Jan-Feb;30 (1 ):73–78.22325451
57 Verma A, Hirsch DJ, Glatt CE, et al. Carbon monoxide: a putative neural messenger. Science. 1993 Jan 15;259 (5093 ):381–384. doi:10.1126/science.7678352 7678352
58 Motterlini R, Otterbein LE. The therapeutic potential of carbon monoxide. Nat Rev Drug Discov. 2010 Sep;9 (9 ):728–743. doi:10.1038/nrd3228 20811383
59 An P, Wu T, Yu H, et al. Hispidulin protects against focal cerebral ischemia reperfusion injury in rats. J Mol Neurosci. 2018 Jun;65 (2 ):203–212. doi:10.1007/s12031-018-1086-2 29799104
60 Janyou A, Wicha P, Jittiwat J, et al. Dihydrocapsaicin attenuates blood brain barrier and cerebral damage in focal cerebral ischemia/reperfusion via oxidative stress and inflammatory. Sci Rep. 2017 Sep 5;7 (1 ):10556. doi:10.1038/s41598-017-11181-5 28874782
61 Zhang W, Song JK, Yan R, et al. Diterpene ginkgolides protect against cerebral ischemia/reperfusion damage in rats by activating Nrf2 and CREB through PI3 K/Akt signaling. Acta Pharmacol Sin. 2018 Aug;39 (8 ):1259–1272. doi:10.1038/aps.2017.149 29542683
62 Liu L, Locascio LM, Doré S. Critical role of Nrf2 in experimental ischemic stroke. Front Pharmacol. 2019;10 :153. doi:10.3389/fphar.2019.00153 30890934
63 Dirnagl U, Endres M. Found in translation: preclinical stroke research predicts human pathophysiology, clinical phenotypes, and therapeutic outcomes. Stroke. 2014 May;45 (5 ):1510–1518. doi:10.1161/STROKEAHA.113.004075 24652307
64 Fisher M, Feuerstein G, Howells DW, et al. Update of the stroke therapy academic industry roundtable preclinical recommendations. Stroke. 2009 Jun;40 (6 ):2244–2250. doi:10.1161/STROKEAHA.108.541128 19246690
