
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00830-7
10.1016/j.psj.2024.104251
104251
METABOLISM AND NUTRITION
Effects of baicalin and chlorogenic acid on growth performance, slaughter performance, antioxidant capacity, immune function and intestinal health of broilers
Liu Xingbo *
Ji Yunru *
Miao Zhiguo †
Lv Huiyuan *‡
Lv Zengpeng *
Guo Yuming *
Nie Wei caunw@163.com
*1
⁎ State Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing, 100193, China
† College of Animal Science and Veterinary Medicine, Henan institute of Science and Technology, Xinxiang 453003,China
‡ Beijing Centre Biology Co., Ltd., Beijing 102218, China
1 Corresponding author: caunw@163.com
22 8 2024
11 2024
22 8 2024
103 11 10425128 6 2024
19 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
This study aimed to investigate the effects of baicalin and chlorogenic acid (BC) on growth performance, intestinal barrier function, antioxidant capacity, intestinal microbiota, and mucosal metabolism in broilers. A total of 720 twenty-one-day-old broilers were randomly allocated into 3 groups, with 6 replicates per group and 40 chickens per replicate. They were fed a basal diet (Con group) or a basal diet supplemented with 250 or 400 mg/kg BC (BC250 and BC400 groups) for 40 consecutive days. The results revealed that 250 mg/kg BC significantly increased 60-d body weight and average daily gain during 39 to 60 d (P < 0.05). Furthermore, Supplementation with 250 mg/kg BC improved the antioxidant capacity and immunity of broilers, as evidenced by increased (P < 0.05) superoxide dismutase and decreased (P < 0.05) malondialdehyde levels in serum and ileum, as well as increased (P < 0.05) immunoglobulin G levels. Supplementation with 250 mg/kg BC enhanced intestinal development by improving intestinal morphology and promoting the proliferation of intestinal crypts. Moreover, Supplementation with 250 mg/kg BC improved (P < 0.05) intestinal permeability, up-regulated (P < 0.05) the expression of tight junction-related genes (Occludin and ZO-1), and down-regulated (P < 0.05) the expression of pro-inflammatory genes (IL-2, IL-8, and IFN-γ). 16S rRNA sequencing revealed significant enrichment of Microbacteriaceae, Micromonosporaceae, Anaerovoracaceae, and Coriobacteriaceae in the BC250 group. Metabolomics showed that 250 mg/kg BC up-regulated the lysosome, foxo signaling pathway, glycosylphosphatidylinositol (GPI)-anchor biosynthesis, and oxidative phosphorylation pathways, while down-regulating the biosynthesis of cofactors pathway. In conclusion, supplementing diets with 250 mg/kg BC is recommended to modulate intestinal microbiota, mucosal metabolism, and antioxidant capacity, thereby improving broiler growth performance and intestinal health.

Key words

baicalin
chlorogenic acid
growth performance
antioxidant capacity
microbiome
==== Body
pmcINTRODUCTION

Broilers face multiple stressors during growth, such as heat stress, exposure to mycotoxins, and viral infections, which significantly elevate the risk of gut health issues (Mishra and Jha, 2019). A healthy intestine serves as a crucial barrier against pathogenic microorganisms. Conversely, a compromised gut leads to reduced growth performance, intestinal inflammation, and diarrhea in broilers (Wan et al., 2022; Cheng et al., 2022; Lv et al., 2023). Plant extracts have garnered significant attention from nutritionists due to their anti-inflammatory, antimicrobial, and antioxidant properties. Numerous studies have demonstrated that plant extracts can have a positive impact on the gut health of broilers (Liang et al., 2021; Ye et al., 2021; Cheng et al., 2022).

Baicalin, a flavonoid compound derived from the dried roots of scutellaria baicalensis, is recognized for its protective effects on the gastrointestinal system. It has been shown to relieve intestinal damage induced by avian pathogenic Escherichia coli (Cheng et al., 2022), treat ulcerative colitis in rats (Shen et al., 2019), and alleviate rotavirus damp heat diarrhea (Shen et al., 2020). Studies have demonstrated that baicalin exhibits various pharmacological effects, including antibacterial, anti-inflammatory, and antioxidant properties. For instance, baicalin has significantly increased the activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and catalase (CAT) in colonic tissues, inhibited the IKK/IKB/NF-kB signaling pathway and reduced the levels of inflammatory cytokines such as IL-1β and TNF-α, thereby alleviating ulcerative colitis (Shen et al., 2019). Furthermore, baicalin has been shown to enhance intestinal barrier function by up-regulating the mRNA expression of ZO-1, Claudin-1, and Occludin in a broiler model of avian pathogenic Escherichia coli infection (Cheng et al., 2022). Interestingly, baicalin has been shown to engage in inter-crosstalk with gut microbes to modulate gut barrier function, as reported by Huang et al. (2019). Chlorogenic acid belongs to polyphenolic compounds commonly found in various plants, including fruits, vegetables, and certain herbs (Lu et al., 2020). Chlorogenic acid has been reported to possess pharmacological effects, such as anti-inflammatory and antioxidant properties (Wang et al., 2022). Furthermore, chlorogenic acid has demonstrated beneficial effects on intestinal health. Chlorogenic acid has been suggested to promote intestinal health through several mechanisms, including regulation of the intestinal microbiota (Ye et al., 2021), enhancement of intestinal stem cell activity (Qin et al., 2023), and inhibition of the NF-κB signaling pathway (Zhao et al., 2023). Baicalin possesses significant anti-inflammatory and antioxidant properties, while chlorogenic acid is known for its strong antioxidant and antibacterial effects. The combination of these two components may synergistically enhance each other's efficacy. Previous research by our team found that a complex plant extract with baicalin and chlorogenic acid (BC) as the main active ingredients mitigated the effects of lipopolysaccharides on broiler growth performance and immunity (Lv et al., 2023). However, there is still a lack of research on the use of BC in healthy broilers. With the growing demand for alternatives to antibiotics in broiler production, exploring the potential benefits of plant extracts becomes increasingly important. Therefore, the objective of this study was to investigate the effects of BC on antioxidant capacity, immunity, intestinal health, and growth performance in healthy broilers.

MATERIALS AND METHODS

Animal Welfare Statement

The project was approved by the Animal Protection and Utilization Committee of China Agricultural University (AW31903202-1-2) and conducted in compliance with the Guidelines for Laboratory Animals established by the Ministry of Science and Technology in Beijing, China.

Animals, Diets and Experimental Design

A total of 720 twenty-one-day-old broilers (Ma Huang chicken, a local breed in China) were selected for the experiment and randomly allocated into 3 treatment groups, each consisting of 6 replicates of 40 chickens. The treatment groups were: control group (fed basal diet), BC250 group (fed basal diet supplemented with 250 mg/kg BC), and BC400 group (fed basal diet supplemented with 400 mg/kg BC). The experimental period of 40 d was divided into 2 stages: from d 21 to 38 and from d 39 to 60. The BC product used in this experiment has been introduced by Wan et al. (2022). In brief, the BC product was provided by Beijing Centre Biology Co., Ltd. (Beijing, China). It was made from lonicera hypoglauca and scutellaria baicalensis extracts, mixed with an appropriate amount of glucose, and the contents of chlorogenic acid and baicalin in the BC product at 2.29 mg/g and 27.69 mg/g, respectively.

The basal diet was formulated based on the Feeding Standard of Chicken, China (NY/T 33-2004), and the composition and nutrient content of the basal diet were detailed in Table 1. Immunization and feeding management followed standard procedures for broiler chickens. The broilers were housed on the ground and provided with ad libitum access to feed and water.Table 1 Composition and nutrients levels of the basal diet (as-fed basis).

Table 1Ingredient (%)	D 21–38	D 39–60	
Corn	61.90	62.90	
Soybean meal, 46%	27.50	25.00	
Soybean oil	2.80	3.50	
Low-gluten flour	4.00	5.00	
Dicalcium phosphate	0.80	0.80	
Limestone	1.50	1.35	
DL-methionine	0.25	0.20	
Sodium chloride	0.25	0.25	
Premix1	1.00	1.00	
Total	100	100	
Analyzed nutrients levels		
Dry matter, %	89.34	88.73	
Crude protein, %	19.14	18.24	
Calcium, %	0.86	0.79	
Total phosphorus, %	0.64	0.59	
Calculated nutrients levels		
Metabolizable energy, kcal/kg	3010.00	3070.00	
Available phosphorus, %	0.48	0.47	
Lysine, %	1.12	1.05	
Methionine, %	0.55	0.50	
1 The premix provided the following per kilogram of the diet: VA 6,000 IU; VD3 2,000 IU; VE 30 mg; VK3 2 mg; VB1 3 mg; VB2 5 mg; VB12 1 mg; pantothenic acid 800 mg; choline chloride 1,500 mg; nicotinic acid 30 mg; pyridoxine 3 mg; folic acid 500 mg; biotin 0.2 mg; Fe 100 mg; Cu 8 mg; Mn 100 mg; Zn 100 mg; I 0.42 mg; Se 0.3 mg.

Growth Performance

On d 21, 38, and 60, broilers were weighed by replicate for body weight (BW) and feed consumption to calculate average daily gain (ADG) and average daily feed intake (ADFI). Feed conversion ratio (FCR) was determined by dividing ADFI by ADG. Dead chickens were observed and recorded for mortality calculations and corrective feed intake.

Slaughter Performance and Sample Collection

On d 38 and 60, two broilers close to the average body weight were selected per replicate. One broiler per replicate was used for determining slaughter performance. Broilers were euthanized by jugular vein bleeding, and measurements were taken for slaughter weight, half-eviscerated weight, eviscerated weight, breast muscle weight, leg muscle weight, and abdominal fat weight following the performance ferms and measurement for poultry (NY/T 823-2004). Subsequently, carcass rate, semi-eviscerated rate, eviscerated rate, breast muscle rate, leg muscle rate, and abdominal fat rate were calculated.

Blood was collected from the wing vein of another broiler, centrifuged at 3,000 × g for 10 min, and the serum was separated and stored at -20°C. Following this, the broiler were euthanized by jugular vein bleeding, and the liver, spleen, bursa fabricius, duodenum, jejunum, and ileum were isolated and weighed. Additionally, the lengths of the duodenum, jejunum, and ileum were measured and recorded. A 1-cm sample from the middle section of the ileum was extracted and fixed in a 4% paraformaldehyde solution for preservation. Following the collection of ileal contents, the ileum was dissected longitudinally, and washed with a PBS solution to remove any adherent material. The ileal mucosa was then scraped using a slide, transferred into a freezing tube, and stored at -80°C.

Relative Organ Weights and Intestinal Length

Relative organ weight and intestinal length were calculated according to Ding et al. (2020). Relative organ weight (g/kg) = organ weight (g)/live body weight (kg); Relative intestinal length (cm/kg) = intestinal length (cm)/live body weight (kg).

Intestinal Morphology

Ileal samples preserved in 4% paraformaldehyde solution were embedded in paraffin, sectioned (5 μm thickness), and stained with hematoxylin and eosin (H&E). For each section, ten intact villi were selected, observed, and photographed using a light microscope (Leica DM750, Shanghai, China). Subsequently, the villus height (VH) and crypt depth (CD) were measured using Image-Pro software (MediaCybernetics, Rockville, MD), and the villus height to crypt depth ratio (VH/CD) was calculated.

Analysis of Serum Parameters

The levels of SOD, total antioxidant capacity (T-AOC), and malondialdehyde (MDA) in serum were measured using commercial kits (Nanjing Jiancheng Institute of Biological Engineering, Nanjing, China). Similarly, the levels of immunoglobulin G (IgG) and immunoglobulin M (IgM) in serum were determined using enzyme-linked immunosorbent assay kits (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). Additionally, the levels of endotoxin, D-lactate, and diamine oxidase (DAO) in serum were assessed using commercial kits (Beijing Jinhai Kecum Biotechnology Development Co., Ltd., Beijing, China). All assay procedures were strictly conducted following the instructions provided with each kit.

Analysis of Ileal Secretory Immunoglobulin A and Antioxidant Capacity

The ileal tissue was homogenized with saline at a weight/volume ratio of 1:9, and the supernatant was collected after centrifugation 3,000 × g for 10 min. Subsequently, the levels of SOD, T-AOC, and MDA in the supernatant were measured using commercial kits (Nanjing Jiancheng Institute of Biological Engineering, Nanjing, China). The protein concentration in the supernatant was determined using a BCA protein concentration assay kit (Betotime Biotechnology Co., Ltd. Beijing, China). Furthermore, the level of secretory immunoglobulin A (sIgA) in the supernatant was assessed using an enzyme-linked immunosorbent assay kit (Cloud-Clone Corp., Wuhan, China). All assay procedures were strictly conducted following the instructions provided with each kit.

Immunohistochemistry

The ileal paraffin sections were deparaffinized using xylene, and antigens were repaired using EDTA antigen repair solution (pH 9.0). Peroxidase activity was blocked by incubating the sections for 25 min at room temperature, shielded from light, using a 3% hydrogen peroxide solution. Subsequently, nonspecific binding was blocked by treating the sections with 3% BSA at room temperature for 30 min. The sections were then incubated overnight at 4°C with primary antibody (mouse monoclonal antibodies to proliferating cell nuclear antigen (PCNA), ab29, Abcam, Cambridge, UK; 1:10,000). After washing the sections with PBS solution (pH 7.4), they were incubated with secondary antibody (goat anti-mouse IgG, GB23301, Servicebio, Wuhan, China; 1:200) at room temperature for 50 min. Finally, the sections were stained with DAB staining solution, counterstained with hematoxylin, dehydrated, and sealed. Each section was examined using a light microscope (Leica DM750, Shanghai, China), and 4 random images were captured. The mean optical density (OD) values of PCNA-immunopositive material in the intestinal glands were analyzed using Image-Pro software (MediaCybernetics, Rockville, MD).

Quantitative real-time PCR Analysis

Total RNA was extracted from the ileal mucosa of broilers at 60 d using RNAiso Plus reagent (Takara, Tokyo, Japan). The quality and concentration of RNA were assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific Inc., Walldorf, Germany). 1 μL of RNA was utilized for cDNA synthesis using the PrimeScript RT reagent kit with gDNA Eraser (Takara, Tokyo, Japan). Subsequently, qRT-PCR was conducted using the TB Green Premix Ex Taq kit (Takara, Tokyo, Japan) and the Applied Biosystems 7,500 Fast Real-Time PCR System (Foster City, CA). The PCR reaction conditions were as follows: pre-denaturation at 95°C for 30 s; denaturation at 95 °C for 5 s and annealing at 60°C for 30 s. A total of 40 cycles were performed. β-actin served as the internal reference gene, and the relative expression of mRNA of the target gene was calculated by the 2−ΔΔCt method. The primer sequences were provided in Table 2.Table 2 Primer sequence used for quantitative real-time PCR.

Table 2Gene names	Primers sequence (5’→3’)	Accession no.	
Claudin-1	F: AAGTGCATGGAGGATGACCA
R: GCCACTCTGTTGCCATACCA	NM_001013611.2	
Occludin	F: AGTTCGACACCGACCTGAAG
R: TCCTGGTATTGAGGGCTGTC	NM_205128.1	
ZO-1	F: ACAGCTCATCACAGCCTCCT
R: TGAAGGGCTTACAGGAATGG	XM_015278981.1	
IL-1β	F: TCATCTTCTACCGCCTGGAC
R: GTAGGTGGCGATGTTGACCT	NM_204524.1	
IL-2	F: GAGTGCACCCAGCAAACTCT
R: CCGGTGTGATTTAGACCCGT	NM_204153.1	
IL-4	F: GTGCCCACGCTGTGCTTAC
R: AGGAAACCTCTCCCTGGATGTC	NM_001007079.1	
IL-8	F: GGCTTGCTAGGGGAAATGA
R:AGCTGACTCTGACTAGGAAACTGT	NM_205498.1	
TNF-α	F: CCCCTACCCTGTCCCACAA
R: TGAGTACTGCGGAGGGTTCAT	NM_204267.1	
TGF-β2	F: TCATCACCAGGACAGCGTTA
R: TGTGATGGAGCCATTCATGT	NM_001031045.3	
NF-kB	F: TGGAGAAGGCTATGCAGCTT
R: CATCCTGGACAGCAGTGAGA	NM_205134.1	
MyD88	F: TGCAAGACCATGAAGAACGA
R: TCACGGCAGCAAGAGAGATT	NM_001030962.3	
TLR4	F:GATGCATCCCCAGTCCGTG
R:CCAGGGTGGTGTTTGGGATT	NM_001030693	
β-actin	F: GAGAAATTGTGCGTGACATCA
R: CCTGAACCTCTCATTGCCA	NM_205518.1	
Abbreviations: IL-1β, interleukin-1β; IL-2, interleukin-2; IL-4, interleukin-4; IL-8, interleukin-8; TGF-β2, transforming growth factor beta 2; TNF-α, tumor necrosis factor alpha; ZO-1, zonula occludens-1; NF-κB, nuclear factor κB; MyD88, myeloid differentiation factor 88; TLR4, Toll-Like Receptor 4.

16S rRNA Sequencing for Microbiota Analysis

Total genomic DNA was extracted from the ileal mucosa of 60-day-old broilers using the FastDNA Spin Kit for Soil (MP Biomedicals, Southern California, CA). PCR amplification targeting the V3-V4 variable region of the 16S rRNA gene was conducted using primers 338F (5′-ACTCCTACGGGGAGGCAGCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′). PCR amplification conditions, product recovery, paired-end (PE) library construction, illumina sequencing, and operational taxonomic units (OTUs) clustering analysis processes were conducted following our established protocols (Ji et al., 2024).

All data analyses were conducted on the Majorbio Cloud platform (https://cloud.majorbio.com). Mothur software (http://www.mothur.org/wiki/Calculators) was utilized to calculate the alpha diversity index, and the wilcoxon rank-sum test was employed to analyze intergroup differences in alpha diversity. Principal component analysis (PCA) and partial least squares discriminant analysis (PLS-DA) were utilized to examine the similarity of microbial community structure among samples, and in combination with the adonis test, to analyze the significance of differences in microbial community structure among sample groups. Linear discriminant analysis effect size (LEfSe) analysis (http://huttenhower.sph.harvard.edu/LEfSe) (LDA > 2.0, P < 0.05) was used to identify the significantly abundant taxa (phylum to genus) of bacteria among the different groups. Functional prediction analysis was conducted using PICRUSt software (https://github.com/picrust/picrust2).

Untargeted Metabolomics Analysis

Metabolite extraction of ileal mucosa was conducted according to Li et al. (2022). The LC-MS/MS analysis of sample was conducted on a Thermo UHPLC-Q Exactive HF-X system equipped with an ACQUITY HSS T3 column (100 mm × 2.1 mm i.d., 1.8 μm; Waters, Milford, MA) at Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). Chromatographic and mass spectrometric conditions were as described by Li et al. (2022). The LC/MS raw data were preprocessed using Progenesis QI (Waters Corporation, Milford, MA) software, and the metabolites were identified by searching databases, with the main databases being HMDB (http://www.hmdb.ca/), Metlin (https:// metlin.scripps.edu/), and Majorbio databases.

The R package “ropls” (Version 1.6.2) was used to perform orthogonal partial least squares discriminant analysis (OPLS-DA), along with 200-cycle interactive validation to evaluate the stability of the model. Metabolites with VIP>1 and P < 0.05 were determined as significantly different metabolites based on the variable importance in the projection (VIP) obtained by the OPLS-DA model and the p-value generated by student's t-test. Differential metabolites between the 2 groups were mapped into their biochemical pathways through metabolic enrichment and pathway analysis based on the KEGG database (http://www.genome.jp/kegg/). The Python package “scipy.stats” (https://docs.scipy.org/doc/scipy/) was used to perform enrichment analysis to obtain the most relevant biological pathways for experimental treatments.

Statistical Analysis

All analyses were carried out using IBM-SPSS 25.0 software (SPSS. Inc., Chicago, IL). Two-tailed Student's t-test was used for direct comparisons between two groups, while One-way ANOVA with Tukey's post hoc test was employed for comparisons among three groups. Data were presented as mean ± standard error of the mean, with statistical significance set at P < 0.05.

RESULTS

Growth and Slaughter Performance

Table 3 illustrates that BC exhibited a tendency to enhance the BW of broilers at day 38 compared to the Con group. Moreover, dietary supplementation with BC quadratically increased (P < 0.05) the BW at day 60 and ADG from d 39 to 60, with the highest BW at d 60 and ADG from d 39 to 60 were observed in the BC250 group. BC displayed a tendency to increase ADFI (P = 0.067) from d 39 to 60 and ADG (P = 0.051) from d 21 to 60, and to decrease (P = 0.051) the FCR from d 21 to 60. Throughout the entire experimental period, the ADG increased by 5.63% and FCR decreased by 2.88% of broilers in BC250 group compared to the Con group. As shown in Table 4, there were no significant differences in slaughter performance among the treatment groups.Table 3 Effect of baicalin and chlorogenic acid on the growth performance of broilers.

Table 3	Con	BC250	BC400	SEM	P-value	
					ANOVA	Linear	Quadratic	
Body weight, g								
D 21	293.33	294.58	295.00	0.723	0.647	0.361	0.933	
D 38	744.58	781.35	774.71	7.341	0.098	0.092	0.148	
D 60	1,790.70b	1,876.85a	1,841.82ab	14.634	0.050	0.133	0.041	
21–38 d								
ADFI, g/d	60.34	62.55	61.22	0.472	0.188	0.492	0.093	
ADG, g/d	24.61	26.75	26.41	0.476	0.159	0.132	0.216	
FCR	2.45	2.35	2.32	0.030	0.177	0.082	0.536	
Mortality rate, %	0.63	0.63	1.00	0.333	0.881	0.665	0.815	
39–60 d								
ADFI, g/d	115.68	119.00	114.95	0.779	0.067	0.548	0.026	
ADG, g/d	47.71b	50.13a	48.53ab	0.404	0.039	0.397	0.016	
FCR	2.43	2.38	2.37	0.015	0.267	0.147	0.474	
Mortality rate, %	1.28	0.00	1.02	0.341	0.316	0.831	0.142	
21-60 d								
ADFI, g/d	90.78	93.28	90.77	0.560	0.111	0.887	0.041	
ADG, g/d	37.45	39.56	38.66	0.358	0.051	0.148	0.038	
FCR	2.43	2.36	2.35	0.015	0.051	0.026	0.286	
Mortality rate, %	1.88	0.63	2.00	0.351	0.233	0.794	0.099	
Abbreviations: Con, control group; BC250, basal diet supplemented with 250 mg/kg BC; BC400, basal diet supplemented with 400 mg/kg BC; SEM, standard error of the mean; ADFI, average daily feed intake; ADG, average daily gain; FCR, feed conversion ratio.

a,b Values with different superscripts in the same row are significantly different (P < 0.05).

Table 4 Effect of baicalin and chlorogenic acid on the slaughter performance of broilers on d 60.

Table 4	Con	BC250	BC400	SEM	P-value	
ANOVA	Linear	Quadratic	
Carcass rate, %	90.44	90.09	90.26	0.230	0.841	0.704	0.662	
Eviscerated rate, %	66.09	67.07	67.53	0.436	0.394	0.182	0.984	
Semi-eviscerated rate, %	82.29	82.70	82.50	0.374	0.915	0.785	0.755	
Breast muscle rate, %	17.14	18.94	17.67	0.964	0.763	0.738	0.522	
Leg muscle rate, %	24.45	24.96	24.07	0.523	0.815	0.916	0.538	
Abdominal fat rate, %	2.20	1.70	2.15	0.144	0.336	0.676	0.170	
Abbreviations: Con, control group; BC250, basal diet supplemented with 250 mg/kg BC; BC400, basal diet supplemented with 400 mg/kg BC; SEM, standard error of the mean.

Relative Organ Weights and Intestinal Development

As shown in Table 5, the relative length of ileum in the BC250 group was significantly higher than that in the Con group (P < 0.05). Further revealed that 250 mg/kg BC significantly increased the VH and VH/CD at d 38, and significantly increased the VH/CD at d 60 (P < 0.05) (Table 6). Remarkably, the optimal impact on broiler ileum development and growth performance was observed with the 250 mg/kg BC dosage compared to the 500 mg/kg BC dosage. Subsequently, the influence of 250 mg/kg BC on PCNA, a marker of cell proliferation, was meticulously examined. The findings indicated a substantial increase in PCNA-positive cells within the ileal crypts of broilers in the BC250 group (P < 0.05) (Figure 1). These results underscore the significant potential of 250 mg/kg BC in promoting intestinal proliferation and development of broilers.Table 5 Effect of baicalin and chlorogenic acid on the relative organ weights and intestinal length of broilers on d 60.

Table 5	Con	BC250	BC400	SEM	P-value	
					ANOVA	Linear	Quadratic	
Relative weight, g/kg BW								
Liver	19.32	19.76	21.71	0.665	0.295	0.180	0.429	
Spleen	1.36	1.61	1.36	0.057	0.112	0.531	0.048	
Bursa fabricius	0.77	1.21	1.05	0.113	0.296	0.234	0.309	
Duodenum	6.72	7.24	7.52	0.253	0.432	0.205	0.976	
Jejunum	13.15	13.47	13.58	0.358	0.878	0.618	0.968	
Ileum	10.52	11.22	10.24	0.325	0.535	0.964	0.281	
Relative length, cm/kg BW								
Duodenum	18.81	19.09	19.44	0.290	0.716	0.441	0.827	
Jejunum	40.99	41.05	38.73	0.601	0.210	0.186	0.227	
Ileum	39.52b	42.85a	38.11b	0.807	0.017	0.441	0.006	
Con, control group; BC250, basal diet supplemented with 250 mg/kg BC; BC400, basal diet supplemented with 400 mg/kg BC; SEM, standard error of the mean.

a,b Values with different superscripts in the same row are significantly different (P<0.05).

Table 6 Effect of baicalin and chlorogenic acid on the intestinal morphology of broilers.

Table 6	Con	BC250	BC400	SEM	P-value	
ANOVA	Linear	Quadratic	
D 38								
VH, μm	840.00b	945.74a	823.62b	17.803	0.001	0.320	0.000	
CD, μm	126.29	117.09	114.31	2.563	0.159	0.073	0.528	
VH/CD	6.65c	7.83a	7.20b	0.152	0.000	0.039	0.000	
D 60								
VH, μm	961.15	1097.44	994.18	24.792	0.055	0.363	0.025	
CD, μm	107.17	107.61	99.99	2.649	0.491	0.323	0.517	
VH/CD	8.97b	10.26a	9.94ab	0.240	0.042	0.044	0.093	
Abbreviations: Con, control group; BC250, basal diet supplemented with 250 mg/kg BC; BC400, basal diet supplemented with 400 mg/kg BC; SEM, standard error of the mean; VH, villus height; CD, crypt depth.

a,b Values with different superscripts in the same row are significantly different (P < 0.05).

Figure 1 Effect of baicalin and chlorogenic acid on the proliferation of intestinal crypt cells of broilers. (A) The representative images of immunohistochemistry of proliferating cell nuclear antigen (PCNA) on the ileum (scale bar = 100 μm). (B) Statistical analysis of PCNA content. *P < 0.05 versus the Con group.

Figure 1

Antioxidant Capacity and Immunity

As shown in Table 7, dietary supplementation with BC linearly increased (P < 0.05) the levels of T-AOC and SOD, while linearly decreasing (P < 0.05) the levels of MDA both in serum and ileum, in comparison to the Con group. Furthermore, there were no significant discrepancies observed in the T-AOC, SOD, and MDA levels between the BC250 and BC400 groups, indicating a consistent effect across these dosage levels. As shown in Table 8, IgG levels in serum displayed a linear and quadratic increase with increasing levels of BC in the diet (P < 0.05). This further emphasizing the immunomodulatory potential of BC.Table 7 Effect of baicalin and chlorogenic acid on the antioxidant capacity of broilers on d 60.

Table 7	Con	BC250	BC400	SEM	P-value	
ANOVA	Linear	Quadratic	
Serum								
T-AOC, U/mL	9.30b	10.05ab	10.51a	0.189	0.025	0.007	0.875	
SOD, U/Ml	158.12b	168.52a	166.05a	1.661	0.007	0.004	0.133	
MDA, nmol/mL	4.58a	4.01b	4.04b	0.102	0.015	0.006	0.310	
Ileum								
T-AOC, mmol/g prot	0.18b	0.19ab	0.21a	0.005	0.055	0.039	0.174	
SOD, U/mg prot	19.99b	22.11a	22.75a	0.482	0.034	0.011	0.740	
MDA, nmol/mg prot	2.38a	1.83b	1.73b	0.107	0.017	0.006	0.532	
Abbreviations: Con, control group; BC250, basal diet supplemented with 250 mg/kg BC; BC400, basal diet supplemented with 400 mg/kg BC; SEM, standard error of the mean; T-AOC, total antioxidant capacity; SOD, superoxide dismutase; MDA, malondialdehyde.

a,b Values with different superscripts in the same row are significantly different (P<0.05).

Table 8 Effect of baicalin and chlorogenic acid on the immunity of broilers on d 60.

Table 8	Con	BC250	BC400	SEM	P-value	
ANOVA	Linear	Quadratic	
IgG, μg/Ml	1104.91b	1295.64a	1214.60a	27.718	0.003	0.005	0.011	
IgM, μg/Ml	124.38	131.52	130.88	4.330	0.777	0.520	0.791	
sIgA, ng/mg prot	0.63	0.55	0.30	0.064	0.150	0.096	0.291	
Abbreviations: Con, control group; BC250, basal diet supplemented with 250 mg/kg BC; BC400, basal diet supplemented with 400 mg/kg BC; SEM, standard error of the mean; IgG, immunoglobulin G; IgM, immunoglobulin M; sIgA, secretory immunoglobulin A.

a,b Values with different superscripts in the same row are significantly different (P < 0.05).

Intestinal Barrier Function

Compared with the Con group, 250 mg/kg BC significantly reduced endotoxin and D-lactate levels at d 38, and significantly reduced endotoxin, DAO and D-lactate levels at day 60 (P < 0.05). A total of 400 mg/kg BC significantly reduced endotoxin at day 38, and significantly reduced DAO and D-lactate levels at day 60 (P < 0.05) (Figures 2A and 2B). It was further found that 250 mg/kg and 400 mg/kg BC significantly up-regulated (P < 0.05) Occludin and ZO-1 mRNA expression levels (Figure 2C). Additionally, 250 mg/kg and 400 mg/kg BC significantly down-regulated (P < 0.05) IL-8, IFN-γ and MyD88 mRNA expression levels. Notably, 250 mg/kg BC significantly decreased IL-2 mRNA expression levels, while 400 mg/kg BC significantly reduced IFN-γ/IL-4 levels (P < 0.05) (Figures 2D–2F). These findings highlight the positive impact of BC supplementation on immunity and intestinal barrier function.Figure 2 Effect of baicalin and chlorogenic acid on the proliferation of intestinal barrier function of broilers. (A and B) Intestinal permeability indexes on d 38 and 60. (C) Relative expression of tight junction protein genes in ileal mucosa on d 60. (D–F) Relative expression of inflammatory cytokine genes in ileal mucosa on d 60. *P<0.05 versus the Con group.

Figure 2

Microbiota Analysis

Venn diagrams shown that the Con and BC250 groups shared 335 identical core OTUs. Additionally, the BC250 group exhibited 202 unique OTUs, whereas the Con group contained 88 unique OTUs (Figure 3A). PCA analysis did not reveal significant differences between the microbial communities of the Con and BC250 groups (Figure 3B). This outcome suggests that the differences in microbial communities may not be linearly separable, and we employed PLS-DA analysis, a supervised multivariate statistical analysis method, to discriminate between different categories and capture potential differences in microbial community structure and composition more effectively. PLS-DA analysis demonstrated a significant disparity in microbial structure and composition between the Con and BC250 groups (Figure 3C). Figure 3D showed that 250 mg/kg BC had a tendency to increase Chao and Pd indices (P < 0.1), suggesting that 250 mg/kg BC increased microbial community diversity and richness.Figure 3 Effect of baicalin and chlorogenic acid on ileal microbiota diversity of broilers. (A) Venn diagram of OTUs level. (B) Principal component analysis (PCA) scores plot of the samples. (C) Partial least squares discriminant analysis (PLS-DA) scores plot of the samples. (D) The α-diversity parameters including Ace, Chao, Sobs, Shannon, Simpson, and Pd index.

Figure 3

At the phylum level, Firmicutes and Actinobacteriota were the predominant phyla, collectively constituting over 95% of the entire phylum level (Figure 4A). Furthermore, the top five microorganisms at the family level in both groups were identified as Lactobacillaceae, Corynebacteriaceae, Clostridiaceae, Enterococcaceae, and Brevibacteriaceae. Notably, Lactobacillaceae dominated in both the Con and BC250 groups, representing 81.35% and 70.80%, respectively (Figure 4B). At the genus level, the top five microorganisms in both groups were Lactobacillus, Corynebacterium, Candidatus_Arthromitus, Enterococcus, and Brevibacterium. Lactobacillus was the most abundant genus in both the Con and BC250 groups, accounting for 81.35% and 70.80%, respectively (Figure 4C). Furthermore, LEfSe analysis revealed that Microbacteriaceae, Micromonosporaceae, Micromonosporales, Stackebrandtia, Anaerovoracaceae, unclassified__f__Microbacteriaceae, Faecalicoccus, unclassified__f__Lachnospiraceae, Coriobacteriaceae, and unclassified__f__Coriobacteriaceae were significantly enriched in the BC250 group compared to the Con group (Figure 4D).Figure 4 Effect of baicalin and chlorogenic acid on intestinal microbial composition of broilers. (A) Microbial composition bar plot analysis at the phylum levels. (B) Microbial composition bar plot analysis at the family levels. (C) Microbial composition bar plot analysis at the genus levels. (D) Linear discriminant analysis effect size (LEfSe) bar plot of intestinal microbiota (LDA > 2.0).

Figure 4

Metabolic functions of the intestinal microbiota were predicted utilizing PICRUSt2 based on the KEGG database (Figure 5). Comparative analysis revealed notable differences between the Con and BC250 groups. Specifically, in the BC250 group, there was a significant increase in metabolic pathways such as Ascorbate and aldarate metabolism, MAPK signaling pathway - plant, Phosphatidylinositol signaling system, Arginine and proline metabolism, Citrate cycle (TCA cycle), Pantothenate and CoA biosynthesis, and Fatty acid metabolism. Conversely, metabolic pathways including Sphingolipid metabolism, Protein export, DNA replication, Galactose metabolism, and Glycolysis/Gluconeogenesis exhibited significant decreases compared to the Con group (Figure 5).Figure 5 Differences in level 3 pathways derived from PICRUSt2 analysis based on the KEGG database. *P < 0.05 versus the Con group.

Figure 5

Untargeted Metabolomics Analysis

Metabolite profiles of ileal mucosa were further estimated using untargeted LC-MS/MS-based metabolomics techniques in both positive and negative ion modes. We identified a total of 1554 metabolites for further analysis after eliminating impurity peaks and removing duplicate ions in both modes. OPLS-DA analysis revealed a significant separation of ileal mucosal metabolites between the Con and BC250 groups (Figure 6A). Validation of the OPLS-DA model was performed through 200 permutation tests (R2Y (cum) = 0.99, Q2 (cum) = 0.472), ensuring that overfitting did not occur (Figure 6B). Subsequently, 48 differential metabolites were identified based on VIP>1 and P < 0.05 for OPLS-DA, with 9 metabolites up-regulated and 39 metabolites down-regulated in the BC250 group compared to the Con group (Figure 6C, Table 9). Categorization of the 48 differential metabolites through HMDB compound analysis revealed their classification into 9 classes, with Organic acids and derivatives, and Lipids and lipid-like molecules being the predominant categories, constituting 69.77% of the total compound classification (Figure 6D). Moreover, KEGG pathway enrichment analysis demonstrated significant up-regulation of pathways including Lysosome, FoxO signaling pathway, Glycosylphosphatidylinositol (GPI)-anchor biosynthesis, and Oxidative phosphorylation in the BC250 group compared to the Con group. Conversely, Biosynthesis of cofactors was significantly down-regulated (Figure 6E, Table 10).Figure 6 Differential analysis of mucosal metabolites between the Con group and the BC250 group. (A) Orthogonal Partial Least Squares Discriminant Analysis (OPLS-DA) score chart between the Con and BC250 groups. (B) OPLS-DA permutation testing plots. (C) Volcano maps of differential metabolites between the Con and BC250 groups. (D) Metabolite HMDB Super class classification map. (E) KEGG pathway analysis of metabolite differences between the Con and BC250 groups. *P < 0.05, **P < 0.01.

Figure 6

Table 9 Identification of different metabolites in the ileal mucosa between Con and BC250 groups.

Table 9Metabolite	M/Z	Retention time	VIP	FC	P-value	
Down-regulated						
Val Gln	246.14	0.82	6.34	0.09	0.00	
Gallocatechin	613.16	1.80	4.36	0.73	0.01	
LysoPE(18:4(6Z,9Z,12Z,15Z)/0:0)	496.24	3.52	4.03	0.68	0.02	
Oxidized Glutathione	611.15	2.06	4.00	0.77	0.02	
Glutathione oxidized	613.16	1.50	3.67	0.81	0.01	
Benazepril	488.21	2.04	3.37	0.80	0.01	
Ritipenem	352.05	0.90	3.32	0.80	0.02	
Gemfibrozil 1-O-beta-Glucuronide	425.18	5.66	2.94	0.76	0.05	
Guanadrel	258.15	2.93	2.70	0.83	0.03	
Ile Arg	288.20	1.95	2.67	0.85	0.04	
25-Acetylvulgaroside	459.27	6.66	2.64	0.84	0.02	
Cysteine-glutathione disulfide	427.09	0.76	2.61	0.91	0.01	
Leucyl-Valine	229.16	2.62	2.53	0.82	0.03	
Atenolol	267.17	2.15	2.51	0.85	0.05	
N-Acetyl-a-neuraminic acid	332.09	0.56	2.47	0.90	0.01	
Asparagine-betaxanthin	308.09	1.27	2.45	0.92	0.04	
Cysteineglutathione disulfide	425.08	0.77	2.43	0.92	0.01	
Vigabatrin	281.15	3.20	2.41	0.85	0.02	
N-Methylputrescine	125.11	0.48	2.39	0.85	0.01	
L-erythro-4-Hydroxyarginine	232.14	0.51	2.39	0.87	0.03	
Tyrosyl-Leucine	295.16	2.80	2.38	0.87	0.04	
Prenalterol	243.17	0.56	2.31	0.89	0.03	
L-Canaline	176.10	0.69	2.23	0.91	0.03	
Arginylisoleucine	286.19	1.68	2.09	0.87	0.04	
Nicotinic Acid	124.04	0.88	1.94	0.94	0.02	
Val Val	217.15	2.09	1.91	0.93	0.03	
Lysylisoleucine	260.20	1.46	1.82	0.94	0.02	
Isonicotinic acid	124.04	1.19	1.80	0.94	0.02	
Arg Leu	288.20	1.59	1.68	0.94	0.03	
PIP(18:1(9Z)/18:1(11Z))	941.51	5.92	1.65	0.95	0.05	
Alpha-Cyperol	441.37	5.71	1.63	0.96	0.02	
Chrysophanol	255.06	5.21	1.59	0.95	0.04	
Spermic acid 2	233.15	2.81	1.57	0.94	0.03	
2,3,4,5-Tetrahydro-2-pyridinecarboxylic acid	277.12	4.29	1.48	0.95	0.05	
4-alpha-Methyl-5-alpha-cholest-7-en-3-beta-ol	423.36	5.71	1.41	0.97	0.03	
3-Gonal	278.25	5.82	1.37	0.97	0.01	
Linolenic Acid	296.26	5.81	1.25	0.97	0.01	
FAHFA(16:0/13-O-18:0)	556.53	5.81	1.09	0.98	0.03	
FAHFA(16:0/11-O-18:0)	556.53	6.00	1.01	0.98	0.05	
Up-regulated						
N-Linoleoyl Serine	366.26	6.02	2.99	1.18	0.03	
Glucose pyruvate acetate	307.06	2.37	2.31	1.15	0.03	
5-Fluorodeoxyuridine monophosphate	362.98	0.70	1.80	1.06	0.01	
1-(13Z,16Z-docosadienoyl)-glycero-3-phosphate	535.30	6.31	1.58	1.04	0.02	
ADP	426.02	0.80	1.53	1.04	0.01	
L-Felinine	190.09	2.80	1.49	1.05	0.04	
S-Allyl-L-cysteine	162.06	1.97	1.30	1.03	0.02	
Serylserine	227.04	0.52	1.22	1.02	0.03	
O-Phosphoethanolamine	140.01	0.52	1.16	1.02	0.02	
Abbreviations: FC, fold change, BC250 group vs. Con group; VIP, variable importance in the projection; M/Z, mass-to-charge ratio.

Table 10 Pathway enrichment analysis of metabolites with significant differences in the ileal mucosa.

Table 10Pathway	Metabolites	P-value	
Drug metabolism - other enzymes	Isonicotinic acid, 5-Fluorodeoxyuridine monophosphate	0.01	
Lysosome	ADP	0.01	
FoxO signaling pathway	ADP	0.01	
Glycosylphosphatidylinositol (GPI)-anchor biosynthesis	O-Phosphoethanolamine	0.01	
Biosynthesis of cofactors	Glutathione oxidized, Nicotinic Acid, Oxidized Glutathione, ADP	0.03	
Oxidative phosphorylation	ADP	0.03	

DISCUSSION

Natural plant extracts have garnered significant attention from nutritionists due to their positive impact on broiler growth performance and intestinal health (Pliego et al., 2022). Research by Wan et al. (2022) demonstrated that BC effectively alleviated colitis in mice by modulating oxidative stress and intestinal microbiota. Furthermore, Lv et al. (2023) discovered that 500 mg/kg BC improved the body weight and FCR of broilers challenged with lipopolysaccharide, while also enhancing intestinal health and immunity in broilers. In this study, the highest growth performance was achieved with the supplementation of 250 mg/kg BC in the diet. The enhanced growth performance observed with BC supplementation may be due to its capacity to modulate gut microbiota composition and improve intestinal barrier function. The findings of the current study are consistent with numerous previous reports that have highlighted the positive impact of baicalin or chlorogenic acid on broiler growth performance (Liu et al., 2022; Lv et al., 2023; Wan et al., 2024). However, this study did not observe significant changes in the slaughter performance of broilers following the supplementation with BC. Conversely, research by Xie et al. (2023) indicated that chlorogenic acid had a beneficial effect on the slaughter performance of finishing pigs. Discrepancies in these results may be attributed to variations in test animals, dosage and composition of additives, as well as differences in basal diets.

There has been significant interest in natural antioxidants derived from plant sources, which have the potential to mitigate oxidative processes and counteract the detrimental effects of reactive oxygen species (ROS) (Gulcin, 2020). Baicalin has been discovered to mitigate oxidative stress in diabetic nephropathy by activating the Nrf2 signaling pathway and increasing levels of CAT, SOD, and GSH-Px (Ma et al., 2021). Furthermore, numerous studies have demonstrated that chlorogenic acid enhances the antioxidant capacity of broilers by augmenting the activities of antioxidant enzymes such as SOD, CAT, and GSH-Px (Liu et al., 2022; Wang et al., 2022; Pan et al., 2023; Zha et al., 2023). Antioxidant enzyme activity constituted a vital aspect of the body's defense mechanism against oxidative stress, playing a crucial role in neutralizing free radicals. In our study, we observed that BC increased serum levels of T-AOC and SOD. This increase in T-AOC and SOD levels indicated a reinforcement of the body's antioxidant capacity. Furthermore, the BC significantly reduced serum levels of MDA, a product of lipid peroxidation. The reduction in MDA levels suggests a mitigation of oxidative damage to the organism (Jiang et al., 2023).

Serum immunoglobulin levels serve as indicators of the immune status of the organism. Among these, IgG stands out as the predominant antibody class in humoral immunity, constituting approximately 75% of all immunoglobulins. Consistent with findings from a previous study (Lv et al., 2023), our research observed an increase in serum IgG levels following supplementation with BC. This suggests that BC enhanced the immunity of broilers. The enhancement of body physiology and metabolism exerted a positive influence on the overall health of broilers. Improved antioxidant capacity and immunity likely contributed to the enhanced growth performance observed in broilers. In conclusion, these findings indicate that BC can serve as an antioxidant and immune adjuvant, augmenting the antioxidant capacity and immunity of broilers, thus promoting their overall health.

A healthy and well-developed gastrointestinal tract ensures efficient digestion and nutrient absorption during growth and development. In the present study, 250 mg/kg BC significantly increased the relative length of the ileum. This extension in the relative length of the ileum likely suggests an expansion in the surface area available for nutrient absorption in the intestine (Lan et al., 2020). Similarly, intestinal morphology plays a crucial role in the digestion and absorption of nutrients. Features such as VH, CD, and the VH/CD are important indicators of intestinal digestion and absorption function (Gao et al., 2024). In the present study, 250 mg/kg BC led to an increase in VH and VH/CD. Consistent with our findings, Lv et al. (2023) reported that BC increased VH and VH/CD in the jejunum of broilers challenged with lipopolysaccharide. Higher VH and VH/CD signify an expansion of the intestinal absorptive surface area and an enhancement in intestinal digestion and absorption (Feng et al., 2023; Hu et al., 2023; Gao et al., 2024). Meanwhile, our investigation further revealed that 250 mg/kg BC significantly increased the expression level of PCNA in ileal crypt cells. PCNA serves as a marker of cell proliferation, and its heightened level signifies increased proliferative activity among crypt cells. This aids in maintaining the renewal of intestinal epithelial cells and fosters intestinal development (Roostaee et al., 2016; Dong et al., 2024).

The functional integrity of the intestinal barrier ensured proper absorption of nutrients and protected the intestinal lumen from toxic and harmful substances (Schoultz and Keita, 2020). Serum levels of DAO, D-lactate, and endotoxin were closely linked to the function of the intestinal mucosal barrier. Under normal physiological conditions, these substances were found at low levels in the serum. However, when the intestinal barrier function was impaired, resulting in increased intestinal permeability, serum levels of DAO, D-lactate, and endotoxin (Ding et al., 2022; Ji et al., 2024). The beneficial impact of baicalin on intestinal barrier function has been observed in avian pathogenic Escherichia coli-induced intestinal injury in broilers (Cheng et al., 2022), ulcerative colitis in rats (Shen et al., 2019), and rotavirus damp heat diarrhea in mices (Shen et al., 2020). Protective effects of chlorogenic acid on intestinal barrier function have also been documented in several studies (Liu et al., 2022; Pan et al., 2023; Zhao et al., 2023). Similar to these findings, the present study found that BC reduced intestinal permeability and improved intestinal barrier function. ZO-1, Claudin-1, and Occludin are key proteins that constituted the intestinal mucosal barrier, and they worked together to maintain mucosal barrier function and regulate intestinal permeability (Ding et al., 2022). Consistent with a previous study (Wan et al., 2022), the addition of BC to the diet significantly up-regulated the mRNA expression levels of Occludin and ZO-1. The alterations in the mRNA expression levels of Occludin and ZO-1 may represent a molecular mechanism for the improvement of intestinal barrier function (Hu et al., 2023). Additionally, the mucosal immune system regulates immune homeostasis and maintains the integrity of mucosal barrier function (Kayama et al., 2020). In this study, BC significantly decreased mRNA expression levels of IL-8 and IFN-γ, while significantly increased mRNA expression levels of TGF-β2. IL-8 and IFN-γ are pro-inflammatory cytokines, while TGF-β2 is an anti-inflammatory cytokine. Therefore, BC exhibited potential anti-inflammatory effects and helped improve intestinal immunity in broilers. Similar results were reported by Wan et al. (2022), who found that BC decreased serum levels of pro-inflammatory cytokines (IL-6, TNF-α, IL-1β) and increased serum levels of anti-inflammatory cytokines (IL-10) in colitis mice.

The intestinal microbiota interacted with the intestinal mucosal barrier in a variety of ways and worked together to maintain the homeostasis and health status of the intestinal internal environment (Gao et al., 2024; Ji et al., 2024). The present study demonstrated an increasing trend of Chao and Pd indices in the BC250 group, and combined with PLS-DA analysis, indicated that BC improved the diversity and richness of the microbial community. Increased diversity of the intestinal microbiota was more helpful in maintaining the stability of the intestinal ecosystem (Feng et al., 2023). In the present study, LEfSe analysis revealed that Microbacteriaceae, Micromonosporaceae, Anaerovoracaceae, and Coriobacteriaceae were significantly enriched in the BC250 group. Microbacteriaceae, Micromonosporaceae, and Coriobacteriaceae all belong to the phylum Actinobacteria. It has been found that some bacteria in Microbacteriaceae can produce bioactive substances with antimicrobial activity (Shashkov et al., 2021). In young adults infected with human immunodefciency virus, Microbacteriaceae, Rikenellaceae, and Ruminococcaceae were significantly reduced in the intestinal tract, leading to intestinal dysbiosis and mucosal damage (Qing et al., 2019). Micromonosporaceae was considered an important source of antibiotics, known for synthesizing aminoglycoside, enediyne, and oligosaccharide antibiotics (Hirsch and Valdés, 2010). Coriobacteriaceae was an important component of the gut microbiota that influenced host physiology, with some Coriobacteriaceae involved in bile acid metabolism, steroid conversion, and activation of dietary polyphenols (Clavel et al., 2014). Additionally, it was reported that Anaerovoracaceae could promote the production of short-chain fatty acids (acetic and butyric acids), which were beneficial for intestinal health (Jia et al., 2023). In summary, the changes in the abundance of these microbial communities after dietary supplementation with BC may have a positive impact on the gut health of broilers. To better elucidate the effects of microbiota on host physiology, PICRUSt2 was used to predict the metabolic functions of intestinal microbiota. The results showed that BC significantly increased nutrient metabolism (including Arginine and Proline Metabolism, Citrate Cycle (TCA Cycle), Pantothenate and CoA Biosynthesis, Fatty Acid Metabolism, Ascorbate and Aldarate Metabolism) and signal transduction (Phosphatidylinositol Signaling System). These findings suggested improved energy utilization, nutrient absorption, and underscored the positive effects of BC on intestinal microbiota. Additionally, Sphingolipid Metabolism, Protein Export, DNA Replication, and Galactose Metabolism were significantly down-regulated in the BC250 group, a change that may have contributed to the regulation of cell growth and the reduction of unnecessary metabolic activities (Spiegel and Merrill, 1996; Azmi et al., 2021; Chandel, 2021).

Metabolomics of the intestinal mucosa can reflect the metabolic characteristics and functional status of the mucosa, aiding in understanding the modulatory effects of BC on intestinal health. The results of this study indicated that differential metabolites associated with lysosome (adenosine diphosphate [ADP]), FoxO signaling pathway [ADP], glycosylphosphatidylinositol [GPI]-anchor biosynthesis (O-Phosphoethanolamine), and oxidative phosphorylation (ADP) were significantly upregulated in the BC250 group. Conversely, Biosynthesis of Cofactors (Glutathione oxidized, Nicotinic Acid)-related differential metabolites were significantly down-regulated in the BC250 group. The up-regulation of ADP helps induce the synthesis of adenosine triphosphate (ATP) through the oxidative phosphorylation pathway, thereby increasing cellular energy supply and improving cellular functional status (Rigoulet et al., 2020). O-Phosphoethanolamine serves as an important precursor for phospholipid synthesis and is involved in regulating several key cellular functions, including processes such as cell membrane renewal and cell proliferation (Chen et al., 2019). Supplementation with O-Phosphoethanolamine has also been reported to treat acute pancreatitis (Sakai et al., 2012). Glutathione oxidized is the oxidized form of glutathione, which usually reflects the state of intracellular oxidative stress. A decrease in glutathione oxidized may reflect a decrease in intracellular oxidative stress and an improvement in cellular antioxidant capacity (Wen et al., 2023). The decrease in Nicotinic Acid may affect the synthesis of coenzymes such as nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP), thereby reducing inflammatory pathways dependent on the involvement of NAD (Orlandi et al., 2020; Chen et al., 2023). In summary, BC may have regulated the physiological functions and metabolic status of intestinal tissues by affecting these key metabolites and metabolic pathways, thereby improving intestinal health.

CONCLUSIONS

The results of this study showed that the dietary supplementation with BC enhanced the antioxidant capacity and immunity of broilers. The 250 mg/kg BC group exhibited the most significant improvements in growth performance and intestinal development. Therefore, a dietary supplementation of 250 mg/kg BC is recommended. Additionally, untargeted metabolomics and 16S sequencing analyses revealed that 250 mg/kg BC improved intestinal microbiota and regulated intestinal mucosal metabolism, thereby enhancing broiler intestinal health. Collectively, this study provided a scientific basis for the use of BC as an intestinal health conditioner.

ACKNOWLEDGMENTS

Funding for this study was provided by Innovative Research Team (in Science and Technology) in University of Henan Province (22IRTSTHN026 ). The authors thank Beijing Centre Biology Co., Ltd. for providing baicalin and chlorogenic acid for this study.

DISCLOSURES

The authors declare no conflicts of interest.
==== Refs
REFERENCES

Azmi A.S. Uddin M.H. Mohammad R.M. The nuclear export protein XPO1 - from biology to targeted therapy Nat. Rev. Clin. Oncol. 18 2021 152 169 33173198
Chandel N.S. Carbohydrate metabolism Cold Spring Harb Perspect. Biol. 13 2021 a040568
Chen Y.T. Huang H.C. Hsieh Y.J. Fu S.H. Li L. Chen C.L. Chu L.J. Yu J.S. Targeting amine- and phenol-containing metabolites in urine by dansylation isotope labeling and liquid chromatography mass spectrometry for evaluation of bladder cancer biomarkers J. Food Drug Anal. 27 2019 460 474 30987717
Chen C. Yan W. Tao M. Fu Y. NAD(+) metabolism and immune regulation: new approaches to inflammatory bowel disease therapies Antioxidants (Basel) 12 2023 1230 37371959
Cheng X. Cao Z. Luo J. Hu R. Cao H. Guo X. Xing C. Yang F. Zhuang Y. Hu G. Baicalin ameliorates APEC-induced intestinal injury in chicks by inhibiting the PI3K/AKT-mediated NF-κB signaling pathway Poult. Sci. 101 2022 101572
Clavel T. Lepage P. The family coriobacteriaceae The Prokaryotes 2014 Springer Berlin, Heidelberg 201 238
Ding X. Yang C. Wang P. Yang Z. Ren X. Effects of star anise (Illicium verum Hook. f) and its extractions on carcass traits, relative organ weight, intestinal development, and meat quality of broiler chickens Poult. Sci. 99 2020 5673 5680 33142485
Ding Y. Hu Y. Yao X. He Y. Chen J. Wu J. Wu S. Zhang H. He X. Song Z. Dietary essential oils improves the growth performance, antioxidant properties and intestinal permeability by inhibiting bacterial proliferation, and altering the gut microbiota of yellow-feather broilers Poult. Sci. 101 2022 102087
Dong X. Lu S. Tian Y. Ma H. Wang Y. Zhang X. Sun G. Luo Y. Sun X. Bavachinin protects the liver in NAFLD by promoting regeneration via targeting PCNA J. Adv. Res. 55 2024 131 144 36801384
Feng J. Li Z. Ma H. Yue Y. Hao K. Li J. Xiang Y. Min Y. Quercetin alleviates intestinal inflammation and improves intestinal functions via modulating gut microbiota composition in LPS-challenged laying hens Poult. Sci. 102 2023 102433
Gao M. Liao C. Fu J. Ning Z. Lv Z. Guo Y. Probiotic cocktails accelerate baicalin metabolism in the ileum to modulate intestinal health in broiler chickens J. Anim. Sci. Biotechnol. 15 2024 25 38369501
Gulcin I. Antioxidants and antioxidant methods: an updated overview Arch. Toxicol. 94 2020 651 715 32180036
Hirsch A.M. Valdés M. Micromonospora: an important microbe for biomedicine and potentially for biocontrol and biofuels Soil. Biol. Biochem. 42 2010 536 542
Hu Z. Liu L. Guo F. Huang J. Qiao J. Bi R. Huang J. Zhang K. Guo Y. Wang Z. Dietary supplemental coated essential oils and organic acids mixture improves growth performance and gut health along with reduces Salmonella load of broiler chickens infected with Salmonella Enteritidis J. Anim. Sci. Biotechnol. 14 2023 95 37391807
Huang T. Liu Y. Zhang C. Pharmacokinetics and bioavailability enhancement of baicalin: a review Eur. J. Drug Metab. Pharmacokinet. 44 2019 159 168 30209794
Ji Y. Liu X. Lv H. Guo Y. Nie W. Effects of Lonicerae flos and Turmeric extracts on growth performance and intestinal health of yellow-feathered broilers Poult. Sci. 103 2024 103488
Jia B. Li Y. Zi X. Gu X. Yuan H. Jeppesen E. Zeng Q. Nutrient enrichment drives the sediment microbial communities in Chinese mitten crab Eriocheir sinensis culture Environ. Res. 223 2023 115281
Jiang Z. Su W. Li W. Wen C. Du S. He H. Zhang Y. Gong T. Wang X. Wang Y. Jin M. Lu Z. Bacillus amyloliquefaciens 40 regulates piglet performance, antioxidant capacity, immune status and gut microbiota Anim. Nutr. 12 2023 116 127 36632621
Kayama H. Okumura R. Takeda K. Interaction between the microbiota, epithelia, and immune cells in the intestine Annu. Rev. Immunol. 38 2020 23 48 32340570
Lan R. Li Y. Chang Q. Zhao Z. Dietary chitosan oligosaccharides alleviate heat stress-induced intestinal oxidative stress and inflammatory response in yellow-feather broilers Poult. Sci. 99 2020 6745 6752 33248590
Li C. Al-Dalali S. Zhou H. Xu B. Influence of curing on the metabolite profile of water-boiled salted duck Food. Chem. 397 2022 133752
Liang W. Li H. Zhou H. Wang M. Zhao X. Sun X. Li C. Zhang X. Effects of Taraxacum and Astragalus extracts combined with probiotic Bacillus subtilis and Lactobacillus on Escherichia coli-infected broiler chickens Poult. Sci. 100 2021 101007
Liu H. Chen P. Lv X. Zhou Y. Li X. Ma S. Zhao J. Effects of chlorogenic acid on performance, anticoccidial indicators, immunity, antioxidant status, and intestinal barrier function in coccidia-infected broilers Animals (Basel) 12 2022 963 35454210
Lu H. Tian Z. Cui Y. Liu Z. Ma X. Chlorogenic acid: a comprehensive review of the dietary sources, processing effects, bioavailability, beneficial properties, mechanisms of action, and future directions Compr. Rev. Food Sci. Food Saf. 19 2020 3130 3158 33337063
Lv H. Li P. Wang Z. Gao M. Li G. Nie W. Xiao L. Lv Z. Guo Y. Effects of dietary supplemental chlorogenic acid and baicalin on the growth performance and immunity of broilers challenged with lipopolysaccharide Life (Basel) 13 2023 1645 37629502
Ma L. Wu F. Shao Q. Chen G. Xu L. Lu F. Baicalin alleviates oxidative stress and inflammation in diabetic nephropathy via Nrf2 and MAPK signaling pathway Drug Des. Devel. Ther. 15 2021 3207 3221
Ministry of Agriculture of the People's Republic of China Feeding standard of chicken (NY/T 33-2004) 2004 Chinese Ministry of Agriculture Beijing, China
Ministry of Agriculture of the People's Republic of China Performance ferms and measurement for poultry (NYT 823-2004) 2004 Chinese Ministry of Agriculture Beijing, China
Mishra B. Jha R. Oxidative stress in the poultry gut: potential challenges and interventions Front. Vet. Sci. 6 2019 60 30886854
Orlandi I. Alberghina L. Vai M. Nicotinamide, nicotinamide riboside and nicotinic acid-emerging roles in replicative and chronological aging in yeast Biomolecules 10 2020 604 32326437
Pan Y. Lin H. Jiao H. Zhao J. Wang X. Effects of in ovo feeding of chlorogenic acid on antioxidant capacity of postnatal broilers Front. Physiol. 14 2023 1091520
Pliego A.B. Tavakoli M. Khusro A. Seidavi A. Elghandour M. Salem A.Z.M. Marquez-Molina O. Rivas-Caceres R.Rene Beneficial and adverse effects of medicinal plants as feed supplements in poultry nutrition: a review Anim. Biotechnol. 33 2022 369 391 32744150
Qin Y. Wang S. Huang W. Li K. Wu M. Liu W. Han J. Chlorogenic acid improves intestinal morphology by enhancing intestinal stem-cell activity J. Sci. Food. Agric. 103 2023 3287 3294 36698257
Qing Y. Xie H. Su C. Wang Y. Yu Q. Pang Q. Cui F. Gut microbiome, short-chain fatty acids, and mucosa injury in young adults with human immunodeficiency virus infection Dig. Dis. Sci. 64 2019 1830 1843 30560340
Rigoulet M. Bouchez C.L. Paumard P. Ransac S. Cuvellier S. Duvezin-Caubet S. Mazat J.P. Devin A. Cell energy metabolism: an update Biochim. Biophys. Acta. Bioenerg. 1861 2020 148276
Roostaee A. Benoit Y.D. Boudjadi S. Beaulieu J.F. Epigenetics in intestinal epithelial cell renewal J. Cell. Physiol. 231 2016 2361 2367 27061836
Sakai A. Nishiumi S. Shiomi Y. Kobayashi T. Izumi Y. Kutsumi H. Hayakumo T. Azuma T. Yoshida M. Metabolomic analysis to discover candidate therapeutic agents against acute pancreatitis Arch. Biochem. Biophys. 522 2012 107 120 22483684
Schoultz I. Keita A.V. The intestinal barrier and current techniques for the assessment of gut permeability Cells. 9 2020 1909 32824536
Shashkov A.S. Tul'skaya E.M. Potekhina N.V. Dmitrenok A.S. Senchenkova S.N. Zaychikov V.A. Dorofeeva L.V. Evtushenko L.I. D-Rhamnan and pyruvate-containing teichuronic acid from the cell wall of Rathayibacter sp. VKM Ac-2759 Biochem (Moscow) 86 2021 506 516
Shen J. Cheng J. Zhu S. Zhao J. Ye Q. Xu Y. Dong H. Zheng X. Regulating effect of baicalin on IKK/IKB/NF-kB signaling pathway and apoptosis-related proteins in rats with ulcerative colitis Int. Immunopharmacol. 73 2019 193 200 31103874
Shen J. Chen J.J. Zhang B.M. Zhao J. Chen L. Ye Q.Y. Ling Q.H. Chen Y.Y. Zhong Z.Y. Huang Q.W. Baicalin is curative against rotavirus damp heat diarrhea by tuning colonic mucosal barrier and lung immune function Dig. Dis. Sci. 65 2020 2234 2245 31802384
Spiegel S. Merrill A.H. Jr Sphingolipid metabolism and cell growth regulation FASEB. J. 10 1996 1388 1397 8903509
Wan S. Wang L. Hao Z. Zhu L. Mao X. Li H. Sun P. Yin W. Fan K. Zhang H. Li B. Nie W. Li Z. Sun N. Baicalin ameliorates the gut barrier function and intestinal microbiota of broiler chickens Acta Biochim. Biophys. Sin. 56 2024 634 644 38511207
Wan F. Wang M. Zhong R. Chen L. Han H. Liu L. Zhao Y. Lv H. Hou F. Yi B. Zhang H. Supplementation with Chinese medicinal plant extracts from Lonicera hypoglauca and Scutellaria baicalensis mitigates colonic inflammation by regulating oxidative stress and gut microbiota in a colitis mouse model Front. Cell. Infect. Microbiol. 11 2022 798052
Wang H. Zhao Y. Zhang Y. Yang T. Zhao S. Sun N. Tan H. Zhang H. Wang C. Fan H. Effect of chlorogenic acid via upregulating resolvin D1 inhibiting the NF-κB pathway on chronic restraint stress-induced liver inflammation J. Agric. Food Chem. 70 2022 10532 10542 35975781
Wen R.J. Dong X. Zhuang H.W. Pang F.X. Ding S.C. Li N. Mai Y.X. Zhou S.T. Wang J.Y. Zhang J.F. Baicalin induces ferroptosis in osteosarcomas through a novel Nrf2/xCT/GPX4 regulatory axis Phytomedicine 116 2023 154881
Xie K. Sun Y. Deng L. Yu B. Luo Y. Huang Z. Mao X. Yu J. Zheng P. Yan H. Li Y. Li H. He J. Effects of dietary chlorogenic acid supplementation on growth performance, meat quality, and muscle flavor substances in finishing pigs Foods 12 2023 3047 37628046
Ye X. Liu Y. Hu J. Gao Y. Ma Y. Wen D. Chlorogenic acid-induced gut microbiota improves metabolic endotoxemia Front. Endocrinol. (Lausanne) 12 2021 762691
Zha P. Wei L. Liu W. Chen Y. Zhou Y. Effects of dietary supplementation with chlorogenic acid on growth performance, antioxidant capacity, and hepatic inflammation in broiler chickens subjected to diquat-induced oxidative stress Poult. Sci. 102 2023 102479
Zhao Y. Wang C. Yang T. Feng G. Tan H. Piao X. Chen D. Zhang Y. Jiao W. Chen Y. Sha J. Fan H. Chlorogenic acid alleviates chronic stress-induced intestinal damage by inhibiting the P38MAPK/NF-κB pathway J. Agric. Food. Chem. 71 2023 9381 9390 37293923
