
==== Front
J Nanobiotechnology
J Nanobiotechnology
Journal of Nanobiotechnology
1477-3155
BioMed Central London

2780
10.1186/s12951-024-02780-2
Research
Thermosensitive hydrogel as a sustained release carrier for mesenchymal stem cell-derived extracellular vesicles in the treatment of intrauterine adhesion
Yu Shujun 123
Zhang Xinru 4
Li Wenwen 123
Lu Yueda 1
Xu Xuan 123
Hu Ruomeng 123
Liu Hongjiang 123
Wang Ying 123
Xing Qiong joan2004207@163.com

123
Wei Zhaolian weizhaolian_1@126.com

123
Wang Jianye wangjianye9@126.com

123
1 https://ror.org/03t1yn780 grid.412679.f 0000 0004 1771 3402 Department of Obstetrics and Gynecology, Reproductive Medicine Center, First Affiliated Hospital of Anhui Medical University, No 218 Jixi Road, Hefei, Anhui 230022 China
2 https://ror.org/03xb04968 grid.186775.a 0000 0000 9490 772X NHC Key Laboratory of Study on Abnormal Gametes and Reproductive Tract, Anhui Medical University, No 81 Meishan Road, Hefei, Anhui 230032 China
3 https://ror.org/03m01yf64 grid.454828.7 0000 0004 0638 8050 Engineering Research Center of Biopreservation and Artificial Organs, Ministry of Education, No 81 Meishan Road, Hefei, Anhui 230032 China
4 https://ror.org/03xb04968 grid.186775.a 0000 0000 9490 772X School of Basic Medical Science, Anhui Medical University, No 81 Meishan Road, Hefei, Anhui 230032 China
17 9 2024
17 9 2024
2024
22 57028 4 2024
14 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Intrauterine adhesion (IUA), a prevalent etiology of female infertility, is attributed to endometrial damage. However, conventional therapeutic interventions for IUA are plagued by high recurrence rates. Human umbilical cord mesenchymal stem cell-derived extracellular vesicles (hUCMSC-EVs) demonstrate the promising therapeutic effects on IUA, but the current efficacy of extracellular vesicles (EVs) is hindered by lower retention and bioavailability. In this study, a thermosensitive hydrogel was utilized as a prolonged release carrier to improve the retention and bioavailability of hUCMSC-EVs in IUA treatment. The hydrogel-EVs complex effectively prolonged EVs retention in human endometrial stromal cells and an IUA mouse model. The complex exhibited superior protection against cellular injury, significantly alleviated endometrial damage, inhibited fibrosis, suppressed inflammation, and improved fertility compared to EVs alone. The results indicated that thermosensitive hydrogel enhanced the therapeutic capacity of EVs for IUA by prolonging their retention in the uterine environment. The hydrogel-EVs complex provides a novel strategy for the sustained release of hUCMSC-EVs in the treatment of IUA.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at 10.1186/s12951-024-02780-2.

Keywords

Thermosensitive hydrogel
Mesenchymal stem cell
Extracellular vesicles
Intrauterine adhesion
Endometrial damage
National Natural Science Foundation of China82171619 Anhui Provincial Health Research ProjectAHWJ2023A20010 Anhui Provincial Natural Science Foundation for Universities2022AH051193 Anhui Institute of Translational Medicine Funding Project2022zhyx-C24 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Intrauterine adhesion (IUA), a prevalent gynecological disorder for infertility, is predominantly caused by recurrent intrauterine operations and infections. In clinical, IUA is characterized by menstrual volume reduce, amenorrhea, recurrent abortion, and infertility, which poses a serious threat to reproductive health of women at childbearing age [1, 2]. It is widely acknowledged that the mechanisms of IUA are mainly related to abnormal endometrial stem cells, hyperactive fibroblast, and deficiency of estrogen receptors. Endometrial stromal cells (EndoSCs) play an important role in periodic growth and regeneration of endometrium. Pathological repair of the endometrium occurs when injury to the endometrial basal layer results in a diminished count and compromised functionality of endometrial stem cells [3]. Meanwhile, multiple cytokines in uterine tissues, such as TNF-α, IL-1β and TGF-β, are increased to regulate the proliferation and migration of myofibroblasts, known for their significant role in extracellular matrix (ECM) remodeling [4]. However, a sustained response to these up-regulated cytokines induces the imbalance between biosynthesis and degradation of ECM, leading to the dysfunction of uterine homeostasis and endometrial fibrosis [5]. The fibrous tissue that replaces normal endometrium lacks angiogenesis and expression of estrogen receptor, resulting in impaired reproductive capacity. The primary therapeutic approach for IUA focused on hysteroscopic surgery. Nevertheless, the high postoperative recurrence rate and suboptimal therapeutic effects for IUA remain clinical challenges [6].

Extracellular vesicles (EVs), as important paracrine products of mesenchymal stem cells (MSCs), are of significant importance in mediating intercellular communication and promoting wound healing [7–9]. As a cell-free therapy, human umbilical cord mesenchymal stem cell-derived extracellular vesicles (hUCMSC-EVs) containing biological molecules are safe and effective, with low risks of tumorigenesis [10, 11]. The therapeutic potential of hUCMSC-EVs have been demonstrated in various diseases [12, 13]. hUCMSC-EVs could enhance endometrium regeneration and fertility restoration through promoting polarization of anti-inflammatory macrophages [14]. In addition to anti-inflammatory and angiogenic effects, hUCMSC-EVs could also inhibit the progress of fibrosis [15]. Despite the apparent advantages of hUCMSC-EVs, there are still challenges to overcome. The intravenously delivered EVs are rapidly cleared by monocytes/macrophages in circulation, resulting in few EVs reaching the damaged endometrium to exert their effects. Furthermore, the intrauterine-injected EVs are not retained for extended periods due to fluid flow and smooth muscle peristalsis, resulting in low bioavailability and limited therapeutic efficacy. Thus, enhancing the retention and efficiency of hUCMSC-EVs in the uterine microenvironment is imperative.

Due to favorable biocompatibility and degradability, as well as certain mechanical strength and porous structure, hydrogel has been widely applied as tissue engineering scaffolds, wound dressings, and drug delivery carriers [16–18]. The thermosensitive hydrogel undergo a sol-gel transition as the certain temperature, thus it not only provides a physical scaffold for the damaged tissues but also facilitates sustained drug release. Various biodegradable polymers, such as poly (D, L-lactic acid-co-glycolic acid) (PLGA) and poly (ε-caprolactone) (PCL), have been coupled with poly(ethylene glycol) (PEG) to generate thermosensitive copolymers [19]. The thermosensitive hydrogels composed of PEG-polyester copolymers effectively prevented postoperative abdominal adhesion in rat model [20, 21]. A novel thermosensitive hydrogel of PEG-polyester copolymers has been developed as a carrier for an anti-inflammatory agent and anti-VEGF antibody to treat corneal neovascularization [22]. The co-encapsulation of thermosensitive hydrogel and drugs did not impact their respective properties and facilitated sustained drug release. As an in situ hydrogel system for local administration, thermosensitive hydrogel exhibits the benefits of high local drug concentration, sustained release, and minimal invasiveness.

In our study, we utilized a thermosensitive hydrogel composed of poly (ε-caprolactone-co-lactide)-b-poly (ethylene glycol)-bpoly (ε-caprolactone-co-lactide) (PCLA-PEG-PCLA). The hUCMSC-EVs was isolated and combined with thermosensitive hydrogel for IUA treatment. Our results showed that hydrogel-EVs complex significantly improved the retention of hUCMSC-EVs in uterine cavity of mice with IUA. The enhanced therapeutic effects and the mechanism of hydrogel-EVs complex were confirmed in IUA mice model.

Materials and methods

Isolation and identification of hUCMSC-EVs

Human umbilical cord tissues were obtained from healthy parturient undergoing cesarean section and hUCMSCs were isolated according to previous study. In Brief, the umbilical cord tissues were washed with 1×PBS and cut into tissue pieces of 0.5-1 mm3. These tissue pieces were then cultured in DMEM/F12 supplemented with 20% fetal calf serum (Gibco, USA). The third generation of hUCMSCs was collected once the cell density reached 80%.

The culture supernatant of hUCMSCs was collected and centrifuged at 3000×g for 10 min to remove cells and cellular debris. The resulting supernatant was then mixed with extracellular vesicle isolation solution (Umibio, China) and incubated at 2-8 ℃ for 2 h, followed by centrifugation at 10,000×g for 60 min. The sediment containing EVs was collected and resuspended in 200 µL of PBS. The EVs were further purified through centrifugation. Then, the extracted EVs were identified. The morphology of EVs was observed using transmission electron microscopy (TEM, FEI, USA). The particle size of EVs was evaluated by nanoparticle tracking analysis (NTA) at VivaCellBiosceinces with ZetaView PMX 110 (Particle Metrix, Germany). The expressions of EVs markers CD63 and Tsg101 were detected by western blot (WB). The EVs were stored at -80 ℃ and used for subsequent experiments.

Synthesis of thermosensitive polymers and preparation of hydrogel-EVs complex

The thermosensitive hydrogel composed of PCLA-PEG-PCLA was prepared as previously reported [23]. Briefly, The PCLA-PEG-PCLA copolymers were achieved by polymerization of CL and LA using PEG as an initiator and stannous octoate as a catalyst. PEG was subjected to a vacuum at 120 ℃ for 2 h to remove any residual water content. Subsequently, the reaction vessel was cooled to room temperature to the sequential introduction of CL, LA and stannous octoate. The reaction was performed at 130 ℃ for 12 h under an atmosphere of argon to mitigate any oxidative interference. The copolymer was purified by washing with water at approximately 70 ℃. The purified copolymer was then stored at -20 ℃ until further use.

The morphology of thermosensitive hydrogel was examined by scanning electron microscopy (SEM, FEI Helios 600i, USA). The hydrogel was freeze-dried under vacuum for 48 h following cross-sectioning. The hydrogel-EVs complex was sputter-coated with gold and observed under SEM at a magnification of 12 k. The rheological property of thermosensitive hydrogel was investigated at different temperatures and shear strain by a 25 mm parallel-plate rheometer (MCR302, Anton Paar, Austria). We measured the storage modulus (G’) and loss modulus (G’’) of the thermosensitive hydrogel at a temperature range of 0 ℃ to 42 ℃. Additionally, we examined the variations of G’ and G’’ in response to shear strain, ranging from 8.1 × 10− 6 to 1.08, at 37 ℃ with a frequency of 1 Hz.

To get the hydrogel-EVs complex, 1 mL of hUCMSC-EVs was added into the 20% (w/v) PCLA-PEG-PCLA solution in a 1:1 volume ratio under stirring conditions at 0 ℃, followed by sterilization with 0.2 μm filters. The final concentration of hUCMSC-EVs was 600 µg/mL. The mixture was then incubated at 37 ℃ for 30 min, allowing the hydrogel-EVs complex to cross-link into a hydrogel.

Establishment of cell model

Human endometrial tissues were obtained from healthy women who voluntarily donated them. The tissues were washed three times with 1×PBS, and then cut into pieces of 1-2 mm3. These tissue pieces were incubated with 0.1% collagenase (sigma, USA) at 37 ℃ for 40-60 min. The digested tissues were filtered through a 100-mesh filter to collect cell suspensions, which were then passed through a 38 μm filter to isolate hEndoSCs. The hEndoSCs were collected by centrifugation at 1200 rpm for 10 min and cultured in DMEM/F12 supplemented with 20% fetal calf serum and 1% penicillin and streptomycin. After 24 h of culture, non-adherent cells were removed, and the remaining adherent cells were collected. The hEndoSCs were stimulated with Mifepristone (MFT, 60 µmol/L) for 48 h [24], followed by treatment with hydrogel or EVs or hydrogel-EVs complex. The cells were cultured on multi-well plates at 37 ℃ and 5% CO2.

Establishment of IUA mice model

The IUA model was constructed using 8-week-old female C57BL/6 mice according to previous report [25]. In brief, intrauterine injection of absolute ethanol was performed for 20 s. The uterine cavity was then rinsed with normal saline and treated with hydrogel, EVs, or hydrogel-EVs complex. The uterus was restored to its normal position and abdominal cavity was closed using sutures. After two weeks of treatment, the mice were sacrificed to collect uterine tissues and blood samples.

Cell scratch assay

The migration ability of the damaged endometrium was assessed through the cell scratch assay. Briefly, following treatment of hEndoSCs with MFT, a scratch was created using a 200 µL pipette tip. The cell debris was gently washed with PBS, and images were captured after 24 h and 48 h. The closure of the scratch was quantified by calculating the ratio of the remaining open area to the initial scratch area.

Pathological staining

The uterine tissues were harvested from the mice after euthanization on day 14. Subsequently, the uterine tissues were fixed with 4% paraformaldehyde and embedded in paraffin. Thin sections of 3-4 μm thickness were obtained for pathological staining. After deparaffinization, rehydration was performed in 100%, 90%, 80%, and 70% ethanol, followed by HE (Solarbio, G1120, China), Sirius red (Solarbio, G1472, China) and Masson staining (Solarbio, G1340, China). Staining images were obtained by Olympus Microscope BX53/IX71.

Immunohistochemistry

Immunohistochemistry was conducted on the uterine tissues as previously described. After deparaffinization, rehydration was performed in 100%, 90%, 80%, and 70% ethanol, followed by staining with the indicated antibodies of HMGB1 (Bioss, bs-0664R, China), TNF-α (Abcam, ab1793, UK), IL-1β (Abcam, ab2105, UK), α-SMA (Bioss, bsm-33187 M, China), TGF-β (Abcam, ab31913, UK) and CD31 (Bioss, bs-0195R, China). Immunohistochemical images were obtained by Olympus Microscope BX53.

Immunofluorescent staining

Immunofluorescent staining was performed according to previous research. For paraffin sections, deparaffinization and rehydration steps were carried out. Subsequently, cell culture slides were incubated with 5% BSA for 30 min, followed by staining with the indicated antibodies of PCNA (Abcam, ab92552, UK) and Vimentin (Affinity, BF8006, USA). Nuclei staining was performed using DAPI. Immunofluorescent staining images were obtained by Zeiss Microscope LSM800.

Western blot

Tissue and cell lysates were used for the reduced sodium dodecyl sulfate polyacrylamide hydrogel electrophoresis. After separation of protein sample, bands were transferred to PVDF membrane. The PVDF membrane was then sealed with 5% skim milk for 2 h. Afterwards the membrane was incubated with the primary antibody overnight at 4 ℃ and the secondary antibody for 2 h at room temperature. The first antibodies used is HMGB1 (Bioss, bs-0664R, China), TNF-α (Abcam, ab1793, UK), IL-1β (Abcam, ab2105, UK), α-SMA (Bioss, bsm-33187 M, China), TGF-β (Abcam, ab31913, UK), Smad2 (Bioss, bs-0718R, China), p-Smad2 (Bioss, bs-19438R, China) and CD31 (Bioss, bs-0195R, China). The above antibodies are used according to the manufacturer’s instructions.

Quantitative real time polymerase chain reaction (qRT-PCR)

Total RNA of uterine tissues and cells was extracted using trizol reagent (Invitrogen, USA). The Reverse transcription to cDNA was executed according to the protocol of the kit instructions (Biosharp, China). The specific primer sequences employed for amplification of the pertinent genes are enumerated in Table 1. The qRT-PCR analysis was conducted utilizing a PCR thermal cycler (Roche LightCycler480, Switzerland). Normalization of the expression data was diligently performed against the mRNA levels of GAPDH. The comparative 2-△△CT method was employed to quantitatively assess the expression levels of the designated target genes.

Table 1 Primer sequence of genes used in qRT-PCR

Gene name	Forward primer sequence
(5’-3’)	Reward primer sequence
(5’-3’)	
HMGB1	GCTGACAAGGCTCGTTATGAA	CCTTTGATTTTGGGGCGGTA	
TNF-α	CAGGAGGGAGAACAGAAACTCCA	CCTGGTTGGCTGCTTGCTT	
IL-1β	TCCAGGATGAGGACATGAGCAC	GAACGTCACACACCAGCAGGTTA	
TGF-β1	GGATACCAACTATTGCTTCAGCTCC	AGGCTCCAAATATAGGGGCAGGGTC	
α-SMA	CCCAGACATCAGGGAGTAATGG	TCTATCGGATACTTCAGCGTCA	
CD31	ACGCTGGTGCTCTATGCAAG	TCAGTTGCTGCCCATTCATTCA	
Vimentin	TCCACAGCACCTAGTCT	GGGGGATGAGGAATAGAGGCT	
PCNA	CTTGCTGGGATATTAGCTCCA	CAGCGGTAGGTGTCGAAGC	
GAPDH	AGGTCGGTGTGAACGGATTTG	GGGGTCGTTGATGGCAACA	

Enzyme-linked immunosorbent assay (ELISA)

ELISA was conducted to measure the levels of TNF-α and IL-1β in mice serum according to manufacturer’s instructions. 50 µL of mice serum samples and standard samples were added to sampling wells, followed by the addition of 50 µL of Antibody Cocktail to each well. The plate was then sealed and incubated at room temperature for 1 h. Subsequently, the plate was washed three times with 1×Wash Buffer PT, ensuring removal of any excess liquid after the final wash. Next, 100 µL of TMB developer solution was added to each well and incubated in the dark for 10 min. Following this, 100 µL of stop solution was added to each well, and the optical density (OD) value at 450 nm was analyzed. The ELISA Kits used were Mouse TNF-α ELISA Kit (Abcam, ab208348, USA) and Mouse IL-1β ELISA Kit (Abcam, ab197742, UK).

Flow cytometry

The apoptosis of hEndoSCs was also assessed by flow cytometry. The culture supernatant of cells and adherent hEndoSCs digested by trypsin were collected and then centrifuged at 1000 rpm for 5 min. The resulting sediment was resuspended in 1 mL of precooled PBS. After another round of centrifugation, the sediment was resuspended in 100 µL of 1×Annexin V Binding Buffer. Subsequently, 2.5 µL of Annexin V-FITC Reagent and 2.5 µL of PI Reagent were added to the cell suspension and thoroughly mixed. After a 15-minute incubation at room temperature in the dark, 400 µL of 1×Annexin V Binding Buffer was added, and the sample was immediately analyzed using BD FACS Celesta.

Flow cytometry was used to examine the proportions of Ly6C+ monocytes and Ly6G+ neutrophils in peripheral blood. The blood samples of mice were collected following eyeball removal, yielding approximately 200-300 µL of blood. An equal volume of red blood cell lysis buffer (Solarbio, R1010) was then added, and the mixture was incubated on ice for 10 min. Subsequently, the sample was centrifuged at 800 rpm at 4 ℃ to collect the pellet. Following this, 100 µL of red blood cell lysis buffer was added, and the sample was incubated on ice for an additional 5 min. The mixture was then centrifuged at 800 rpm at 4 ℃ to collect the cell pellet. Then collected cell was incubated rat serum for 20 min, followed by Ly6C-APC (Biolegend, USA) and Ly6G-Alexa Fluor 488 (Biolegend, 127625, USA) antibodies. After washing with 1×PBS, cell suspensions were analyzed using BD FACS Celesta.

MTT assay

The viability of hEndoSCs was detected using MTT assay Kit (Abcam, ab211091, USA) according to the manufacturer’s instruction. The hEndoSCs in logarithmic phase were harvested and the cell suspension with appropriate concentration was prepared. The suspension was then added to a 96-well plate and incubated for 6-24 h. Subsequent to various treatments, cells were incubated for the appropriate duration. The culture supernatant was removed, and 90 µL of fresh culture medium along with 10 µL of MTT solution was added, followed by a 4-hour incubation. Afterwards, the supernatant was removed, and 110 µL of Formazan solution was added to each well, with shaking for 10 min. The OD value at 490 nm for each well was measured.

Tunel staining

TUNEL staining was performed to detect cell apoptosis in uterine tissues collected on slides. The One-step TUNEL in Situ Apoptosis Kit (Elabscience, E-CK-A324, China) was used following the manufacturer’s instruction. After dewaxing and hydration, the paraffin sections were rinsed with PBS three times for 5 min each. The liquid surrounding the sliced tissue was then removed, and 100 µL of 1×Proteinase K was added to each sample, followed by an incubation at 37 ℃ for 20 min. After a second round of rinsing, 100 µL of TdT Equilibration Buffer was added to each sample, followed by an incubation in a wet box at 37 ℃ in the dark for 10 to 30 min. Following the third rinse, excess liquid was removed, and DAPI was added to the samples and incubated for 5 min to stain the nucleus. Finally, after the last rinse, a sealing agent containing anti-fluorescence quencher was used to seal the sections.

Statistical analysis

Data are presented as mean ± standard deviation (SD). Student’s t tests were conducted to compare data between two groups. For multi-group comparisons, one-way ANOVA was used. Statistical analysis was performed using GraphPad (Graphpad Prism Software Inc., CA, USA). p < 0.05 (*) indicates a significant difference. Two asterisks (**) and three asterisks (***) represent p < 0.01 and p < 0.001, respectively.

Results

Characterization of hUCMSC-EVs and thermosensitive hydrogel

We isolated EVs from the medium supernatant of hUCMSCs, and the hUCMSC-EVs were then characterized through TEM, WB, and NTA. The image of TEM showed that hUCMSC-EVs were round-like vesicles bounded by the membrane (Fig. 1A). The result of WB indicated that hUCMSC-EVs exerted the positive expression of CD63 and Tsg101, and negative expression of GAPDH (Fig. 1B). In addition, the diameter of EVs were determined to be approximately 100-150 nm based on NTA (Fig. 1C). The morphology of thermosensitive hydrogel was observed using SEM. The image of SEM indicated that the thermosensitive hydrogel was porous and capable of efficiently encapsulating EVs (Fig. 1D). Moreover, we analyzed the storage modulus (G’) and loss modulus (G’’) of the hydrogel with the temperature ranged from 0 ℃ to 42 ℃ and shear strain response (Fig. 1E-F). The phase of thermosensitive hydrogel was obtained at 4 ℃ and 37 ℃ (Figure S1A). The results showed that the phase transition of hydrogel from sol to gel occurred at 37 ℃.

Fig. 1 Characterization of hUCMSC-EVs and thermosensitive hydrogel. EVs derived from hUCMSCs were identified by (A) TEM, (B) WB, and (C) NTA. (D) SEM images of the thermosensitive hydrogel and hydrogel-EVs complex. The red arrow indicated the hUCMSC-EVs. (E) G’ and G’’ of thermosensitive hydrogel were analyzed at different temperatures. (F) G’ and G’’ of thermosensitive hydrogel as a function of shear strain

To confirm the biocompatibility of thermosensitive hydrogel, we assessed the toxicity of hydrogel to uterine tissue and hEndoSCs. The thermosensitive hydrogel was injected into uterine cavity of mice, and assessments were conducted after 2 weeks. HE staining showed that the thickness of endometrium and the number of glands had no significant change after intrauterine injection of hydrogel (Figure S1B). Furthermore, Masson and Sirius Red staining demonstrated that the hydrogel did not induce endometrial fibrosis (Figure S1B). This suggested that the thermosensitive hydrogel exhibited biocompatibility with uterine tissues. hEndoSCs were cocultured with hydrogel and the cell viability and apoptosis were detected by MTT and flow cytometry. The hydrogel neither inhibited the viability of hEndoSCs, nor increased the apoptosis (Figure S1C-D). To further evaluate the biological safety of thermosensitive hydrogel on other vital organs, we also detected the histopathological damage of mice hearts, livers, spleens, lungs and kidneys in the NC and Gel groups, as well as several important serum biochemical indicators such as aspartate aminotransferase (AST), alanine aminotransferase (ALT), creatinine (Cre), and blood urea nitrogen (BUN). The results demonstrated that there was no significant difference in serum ALT, AST, Cre, and BUN levels between the two groups (Figure S1E). In addition, the hearts, livers, spleens, lungs, and kidneys of mice in the Gel group exhibited normal morphology similar to those in the NC group, with no significant infiltration of inflammatory cells (Figure S1F). All these results indicated the excellent biocompatibility of thermosensitive hydrogel.

Sustained release of hUCMSC-EVs from hydrogel-EVs complex

Considering the limitations of EVs therapy, where EVs could not remain in uterine cavity and exert continuous therapeutic effects, we combined hUCMSC-EVs with the thermosensitive hydrogel to achieve the hydrogel-EVs complex. To check the sustained release of hydrogel-EVs complex, the co-culture experiments were conducted by mixing PKH26-labeled hydrogel-EVs complex with hEndoSCs (Fig. 2A). The CD63, the positive marker of EVs, in the culture supernatant and the PKH26 in hEndoSCs were assessed at different time points (6, 12, 18, and 24 h). The results revealed that EVs released by hydrogel-EVs complex exhibited prolonged retention in both the culture supernatant and hEndoSCs compared without hydrogel, indicating the sustained release capability of the hydrogel (Fig. 2B-C). In addition, the sustained release effects of the hydrogel on EVs in vivo were investigated. DiR-labeled hydrogel-EVs complex were injected into the intrauterine cavity of IUA mice. The fluorescence were then checked at specific time points using an IVIS (Lumina Imaging System) (Fig. 2D). Strong fluorescence signals of DiR were detected in both groups after injections, gradually diminishing over time. Importantly, the DiR signals in the Gel + EVs group were stronger and remained longer compared to those in the EVs group beyond 3 days post-injection (Fig. 2E-F). These results indicated that the thermosensitive hydrogel significantly enhanced the retention of hUCMSC-EVs both in vitro and in vivo.

Fig. 2 Sustained release of hUCMSC-EVs by thermosensitive hydrogel in vitro and in vivo. (A) Scheme of the co-culture of EVs or hydrogel-EVs complex with hEndoSCs. (B) The CD63 level in the culture supernatant of hEndoSCs was detected by WB, and the relative CD63 protein level was analyzed. (C) Uptake of PKH26-labeled EVs by hEndoSCs at specific time points was performed using laser confocal microscope, and the relative integral density of PKH26 was analyzed. (D) Scheme of evaluating the retention of EVs in vivo with or without thermosensitive hydrogel. (E) DiR fluorescence signal in mice were performed at indicated time points by IVIS Lumina Imaging System (n = 3). (F) The fluorescence signal activity of DiR was expressed as [Photons(107)/s/cm2/sr]/[µw/cm2]. Data were expressed as mean ± SD. n = 5. *, p < 0.05, **, p < 0.01, and ***, p < 0.001. Scale bar = 50 μm

The hydrogel-EVs complex effectively inhibited hEndoSCs apoptosis and dysfunction

To evaluate the effect of sustained release of EVs, the hydrogel-EVs complex was co-cultured with damaged hEndoSCs. Previous studies have indicated that MFT acts as an antagonist of the progesterone receptor, leading to a significant induction of apoptosis in hEndoSCs [24]. The hydrogel-EVs complex was co-cultured with hEndoSCs stimulated by MFT to check the effect of sustained release of EVs on the apoptosis. MTT assay was conducted to evaluate hEndoSCs viability in all groups (NC, MFT, MFT + Gel, MFT + EVs and MFT + Gel + EVs group). We found that MFT significantly inhibited viability of hEndoSCs, while EVs or hydrogel-EVs complex obviously improved the viability. And the cell viability in MFT + Gel + EVs group was superior compared to the MFT + EVs group (Fig. 3A). Additionally, the proliferative capacity of hEndoSCs, as estimated by PCNA protein and mRNA levels (Fig. 3B-D), was significantly increased in MFT + Gel + EVs group compared with MFT and MFT + EVs group. Moreover, compared with MFT group, the percentage of Annexin V+ PI+ hEndoSCs in MFT + Gel + EVs group significantly decreased, while that in MFT + EVs group showed a mild decrease (Fig. 3E). These findings indicate that the hydrogel-EVs complex may offer more effective protection against apoptosis for hEndoSCs compared to EVs alone. To further investigate the role of hydrogel-EVs complex on hEndoSCs function, we detected the expression of vimentin, a marker of hEndoSCs integrity. As shown in Fig. 3F and H, hydrogel-EVs complex was able to obviously inhibit the down-regulation of vimentin. Similarly, the mRNA level of Vimentin was also increased in MFT + Gel + EVs group compared with both MFT group and MFT + EVs group (Fig. 3G). Moreover, we detected the migration ability of hEndoSCs in each group using cell scratch assay (Figure S2). Results showed that hydrogel-EVs complex significantly reversed the decreased migration ability of hEndoSCs induced by MFT, compared to hydrogel or EVs. These observations indicated that sustained release of EVs emerged as a potent strategy for protecting against hEndoSCs apoptosis and maintaining hEndoSCs function.

Fig. 3 The enhanced protective effects of hydrogel-EVs complex on hEndoSCs injury. hEndoSCs were stimulated by MFT (60 µmol/L) for 24 h, followed by treatment with hydrogel, EVs, or hydrogel-EVs complex. (A) hEndoSCs viability was analyzed by MTT assay. (B) PCNA protein level was detected by WB. GAPDH served as control for normalization. (C) The mRNA level of PCNA in hEndoSCs was detected by qRT-PCR. (D) Immunofluorescence staining of PCNA in hEndoSCs, with analysis of the relative optical density of PCNA. (E) The hEndoSCs apoptosis was analyzed by flow cytometry. The proportions of Annexin V+ PI+ cells were calculated. (F) The protein and (G) mRNA levels of Vimentin in hEndoSCs were analyzed by WB and qRT-PCR. GAPDH served as control for normalization of WB. (H) Immunofluorescence staining of Vimentin in hEndoSCs. The relative optical density of Vimentin was analyzed. Data were expressed as mean ± SD. n = 5. *, p < 0.05, **, p < 0.01, and ***, p < 0.001. Scale bar = 50 μm

Hydrogel-EVs complex significantly inhibited endometrial injury in the IUA mice model

To evaluate the effects of hydrogel-EVs complex to IUA, we administered the hydrogel-EVs complex via uterine injection in a mouse model of IUA (Fig. 4A-B). We monitored the body weights of mice during treatments. There was no significant difference in the initial body weights of mice among the groups. After treatments for two weeks, a slight increase in body weights of mice was observed in each group, but there was no significant difference among the groups (Figure S1G). The obtained uterine tissues were represented in Fig. 4C. The uterine tissues of mice with IUA exhibited abnormal uterine cavity with reduction in endometrial thickness and glandular number. The IUA + Gel + EVs group displayed the recovery in endometrial thickness and glandular number, while the IUA + Gel or IUA + EVs groups did not exhibit the same improvement (Fig. 4D-E). Furthermore, we examined cell apoptosis in the mice uterus using Annexin V and TUNEL staining. Our observations indicated a significant increase in cell apoptosis in the IUA group, but hydrogel-EVs complex effectively inhibited cell apoptosis (Fig. 4F-G). These findings suggested that the thermosensitive hydrogel significantly enhanced the efficacy of EVs to inhibit endometrial injury in IUA.

Fig. 4 Treatment of hydrogel-EVs complex alleviated endometrial injury. (A) Schematic representation of the animal experiments conducted. Female C57BL/6 mice received intrauterine injections of 95% ethanol for 20 s, followed by treatment with hydrogel, EVs, or hydrogel-EVs complex. Two weeks post-treatment, the mice were euthanized to collect blood and uterine tissues. (B) Detailing images illustrating the specific steps for establishing an IUA mouse model. (1) Access the abdominal cavity and expose the uterus. (2) Clamp the uterus and administer regents into the uterine cavity for grouping treatment. (3) Restore the uterus to original anatomical position and close the incision. (C) Representative images of uteruses after treatment. (D) The uterine tissues as indicated were performed for HE staining. (E) Relative thickness and the gland number of endometrium were analyzed. (F) Immunohistochemistry of Annexin V and TUNEL staining in the indicated uterine tissues. (G) The relative optical density of Annexin V was analyzed. Data were expressed as mean ± SD. n = 5. *, p < 0.05, **, p < 0.01, and ***, p < 0.001. Scale bar = 50 μm

Hydrogel-EVs complex remarkably ameliorated endometrial fibrosis

In order to investigate the potential role of hydrogel-EVs complex in reducing endometrial fibrosis, Sirius red and Masson staining were conducted on the uteruses of mice in each group. As shown in Fig. 5A and Figure S3A, the degree of endometrial fibrosis was significantly increased in the IUA mice. This fibrosis was notably attenuated in both the IUA + EVs group and the IUA + Gel + EVs group, with the most significant improvement observed in the IUA + Gel + EVs group. To further investigate the inhibitory effect of hydrogel-EVs complex on endometrial fibrosis, we examined the fibrosis-related factors. Our findings revealed a significant upregulation in the expression of TGF-β, α-SMA, and p-Smad2 in the uteruses of mice with IUA compared to normal mice (Fig. 5B-C and Figure S3B-C), indicating the presence of severe endometrial fibrosis in the IUA mice. The expression of TGF-β and α-SMA notably decreased following treatment with EVs or hydrogel-EVs complex, and particularly decreased in the IUA + Gel + EVs group (Fig. 5B-C and Figure S3B-C). To evaluate angiogenesis of endometrial tissue, CD31 levels were examined in IUA mice after the administration of hydrogel-EVs complex. Our results demonstrated that the hydrogel-EVs complex effectively promoted angiogenesis, as indicated by the increased CD31 levels in the uterus (Fig. 5B-C and Figure S3B-C). Furthermore, we observed a decrease in the mRNA levels of TGF-β and α-SMA, along with an increase in the mRNA expression of CD31 in the IUA + Gel + EVs group compared to the IUA group (Fig. 5D). These findings suggested that the thermosensitive hydrogel significantly enhanced the protective effect of hUCMSC-EVs on endometrial fibrosis.

Fig. 5 Hydrogel-EVs complex significantly inhibited endometrial fibrosis. (A) Uterine tissues as indicated were subjected to Sirius red and Masson staining. (B) The immunohistochemistry of TGF-β, α-SMA, and CD31 were obtained. (C) WB for TGF-β, α-SMA, CD31, Smad2 and p-Smad2 were checked. GAPDH served as control for normalization of WB. (D) The mRNA expression of TGF-β, α-SMA, and CD31 were measured by qRT-PCR. Data were expressed as mean ± SD. n = 5. *, p < 0.05, **, p < 0.01, and ***, p < 0.001. Scale bar = 50 μm

Hydrogel-EVs complex obviously suppressed inflammatory response

Considering the fact that IUA is a classic chronic inflammatory process characterized by an up-regulation of pro-inflammatory cytokines [26, 27], we investigated the proportional changes of Ly6C+ monocytes and Ly6G+ neutrophils and the levels of TNF-α and IL-1β in peripheral blood after IUA challenge. The results obtained from flow cytometry and ELISA demonstrated a significant elevation in monocytes, neutrophils, and pro-inflammatory cytokines in the peripheral blood of IUA mice compared to normal mice (Fig. 6A-D), indicating the presence of an immune disorder in IUA mice. However, after treatment with EVs or hydrogel-EVs complex, there was a noticeable decrease in these immune cells, particularly in the IUA + Gel + EVs group (Fig. 6A-C). Subsequently, the proportional changes of monocytes/macrophages in the uterine tissues of mice were investigated. The macrophages in the uterine tissues were initially isolated, and the frequency of CD45+CD11b+Ly6G−Ly6Chigh macrophages was then determined by flow cytometry. The results showed the significant decreased proportions of Ly6Chigh macrophages in IUA mice treated with hydrogel-EVs complex than that of IUA mice (Figure S4). To further investigate the attenuation of the inflammatory response in the IUA + Gel + EVs group, we measured the serum levels of TNF-α and IL-1β in mice of each group. As shown in Fig. 6D, the levels of TNF-α and IL-1β were mildly decreased in the IUA + EVs group, but significantly decreased in the IUA + Gel + EVs group. A similar decrease in the protein and mRNA levels of TNF-α and IL-1β was observed in the uterus of the IUA + Gel + EVs group (Fig. 6E-G and S5A-B), suggesting a lower degree of inflammatory response in this group. We also investigated the level of HMGB1, a damage-associated molecular pattern involved in inflammatory injury [28]. Our results demonstrated that the protein (Fig. 6H-I) and mRNA (Fig. 6J) levels of HMGB1 were down-regulated in the IUA + Gel + EVs group compared to the IUA group. These findings suggested that hydrogel-EVs complex played a suppressive role in the inflammatory response of IUA.

Fig. 6 Hydrogel-EVs complex obviously suppressed inflammatory response in mice with IUA. (A) Peripheral blood collected from mice was used for flow cytometry, and then the proportions of (B) Ly6C+ monocytes and (C) Ly6G+ neutrophils were analyzed (n = 4). (D) TNF-α and IL-1β in serum were analyzed by ELISA. Uterine tissues as indicated were performed by (E) immunohistochemistry, (F) WB and (G) qRT-PCR for TNF-α and IL-1β. The uteruses indicated were used for (H) immunohistochemistry, (I) WB, and (J) qRT-PCR analysis of HMGB1. GAPDH served as control for normalization of WB. The average optical density of HMGB1 was analyzed. Data were expressed as mean ± SD. n = 5. *, p < 0.05, **, p < 0.01, and ***, p < 0.001. Scale bar = 50 μm

Hydrogel-EVs complex significantly improved reproductive capacity

To evaluate the enhanced effect of hydrogel-EVs complex, we investigated the reproductive capacity of IUA mice and its biosafety on the offspring of mice. We observed a significant improvement in the number of embryo implantation and live offspring in IUA mice treated with the hydrogel-EVs complex compared to those treated with the hydrogel or EVs alone (Fig. 7A-B). These findings suggested that the hydrogel-EVs complex exhibited a more potent therapeutic effect on the reproductive capacity of mice with IUA. Importantly, no malformed newborn mice were observed in any of the groups (Fig. 7A), indicating the reproductive safety of intrauterine injection of hydrogel-EVs complex.

Fig. 7 Hydrogel-EVs complex markedly improved reproductive capacity of mice with IUA. (A) Representative images of embryos and newborn mice in each group. (B) The numbers of implanted embryos (n = 5) and newborn mice (n = 3) in each group were counted and analyzed. Data were expressed as mean ± SD. *, p < 0.05, **, p < 0.01, and ***, p < 0.001

Discussion

The current administration methods face challenges in maintaining sufficient retention of EVs within the uterine cavity, thereby hindering effective treatment outcomes for IUA. In our study, EVs derived from hUCMSCs were isolated and combined with thermosensitive hydrogel to form hydrogel-EVs complex. We found that thermosensitive hydrogel facilitated the sustained release of hUCMSC-EVs, effectively prolonging their retention period. Hydrogel-EVs complex presented a superior ability to protect hEndoSCs against cell apoptosis and dysfunction. The thermosensitive hydrogel could significantly strengthen effectiveness of hUCMSC-EVs on relieving the endometrial damage and fibrosis, suppressing inflammatory response, as well as improving reproductive capacity in IUA mice.

Damage to the basal layer of the endometrium, primarily induced by intrauterine operations and infections, represents a leading causative factor for IUA, which pathologically characterized primarily by endometrial fibrosis [1, 2, 5]. Many studies have underscored that the pivotal role of TGF-β1 in the origination and progression of IUA [4], and the inhibition of the TGF-β1/Smad signaling pathway could serve as an effective therapeutic strategy to mitigate endometrial fibrosis [29]. TGF-β is widely recognized as a classic pro-fibrotic factor due to its ability to activate myofibroblast cells [30]. Upon TGF-β receptor activation, Smad2 is phosphorylated and translocated to the nucleus along with Smad3 and Smad4 [30, 31]. In the nucleus, they activate the transcription of target genes, thereby regulating the fibrosis process. α-SMA serves as a crucial biomarker for myofibroblast cell activation, exerting a significant impact on the fibrosis process [32, 33]. Our results showed that EVs combined with hydrogel substantially suppressed the expression of TGF-β, p-Smad2 and α-SMA in uterine tissues, thereby attenuating endometrial fibrosis in IUA models.

Collagen deposition initially functions as a protective response to wound healing in various inflammatory diseases. However, if the damage persists, recurs, or reaches a severe level, normal tissue repair could progress into severe tissue fibrosis [34]. Endometrial fibrosis, characterized by excessive ECM deposition, is a chronic inflammatory process that often leads to endometrial dysfunction [2]. The inflammatory response significantly contributes to the aggravation of endometrial injury [35]. Inflammatory factors including IL-6 and CXCL-8 promote inflammatory response through NF-κB signaling pathway and subsequently aggravate endometrial ischemia and hypoxia, leading to endometrial necrosis and menstrual dysfunction [36]. Simultaneously, an uncontrolled inflammatory response may accelerate ECM deposition and promote the progression of fibrosis [37]. In our study, hydrogel-EVs complex significantly reduced the proportions of Ly6C+ monocytes and Ly6G+ neutrophils in peripheral blood and decreased the levels of TNF-α and IL-1β both in peripheral blood and uterine tissues, effectively suppressing inflammation and alleviating endometrial fibrosis of IUA mice.

Currently, the prevailing methods for administering EVs in the treatment of IUA are primarily intravenous and intrauterine injections [29, 38]. Rapid clearance by monocytes/macrophages and retained short-term hinder the EVs accumulation at the damaged endometrial site, thus diminishing therapeutic efficacy. Enhancing the efficiency of EV-based treatments has thus become a critical research focus. Strategies such as multiple administrations and large dosages have been considered to enhance the therapeutic outcomes of EVs treatment [39]. However, these strategies significantly escalate the costs associated with EVs generation, isolation and storage, as well as the time required to EVs administration, which is expensive and time-consuming. EVs are a vital component of the paracrine secretion from MSCs, encapsulating a diverse array of molecular constituents such as DNA, RNA, and proteins. And their functions have intimately association with the original stem cells [9, 40]. Therefore, many strategies have been explored to modulate the microenvironment and gene expression of donor cells to enhance the therapeutic potential of EVs [41]. Techniques such as 3D culturing of MSCs have been shown to foster cell proliferation and increase EVs production [42]. The stimulus provided by certain chemical molecules and hormones, for example, hypoxia [43], Ca2+, and cytokines, have been demonstrated to elevate EV secretion and influence the gene expression profiles relevant to EV production [44]. To improve the therapeutic efficacy of EVs, advanced methods including electroporation [45] and adenovirus transfection [46] are employed to load EVs with specific therapeutic agents. EVs derived from CTF1-modified bone marrow stem cells (BMSCs) exhibit enhanced abilities to promote angiogenesis and inhibit fibrosis in injured endometrium, effectively improving endometrial receptivity [47]. EVs derived from TNF-α pretreated MSCs are rich in Galectin-1, which promoted polarization of macrophages to M2 anti-inflammatory phenotype, significantly inhibiting inflammatory response and endometrial fibrosis [48].

Due to the unique shape of the uterine cavity, EVs injected at the site of endometrial injury may flow out of the body along the vagina. Simple injections do not allow sufficient time for EVs to exert their therapeutic effects, compromising their efficacy. To address this issue, an EVs carrier suitable for endometrial injury is needed. Various biomaterials have been utilized for the treatment of IUA [6, 49, 50]. Traditional anti-adhesion materials have some drawbacks, such as low biocompatibility of intrauterine devices and Foley balloon catheters, and the possibility of amniotic membrane inducing immune responses [51]. Therefore, the biomaterials with good biocompatibility and biodegradability should be considered in IUA treatment. A scaffold based on human amniotic ECM, which contained a certain amount of estradiol and PLGA, not only provided support for uterine cavity but also significantly promoted the proliferation of endometrial cells, promoting endometrial regeneration [52]. Furthermore, researchers have developed a PGS scaffold to encapsulate BMSCs, which is beneficial for the recovery of endometrial injury by facilitating the attachment and growth of BMSCs [53]. The hydrogel used in our study exhibited stable thermosensitive properties and good biocompatibility. After injection into the uterine cavity, the thermosensitive hydrogel transformed into a gel state that allowed EVs to remain in the uterine cavity for an extended period and be continuously released through the biodegradation of the hydrogel for IUA treatment. The thermosensitive hydrogel itself could act as a physical barrier to prevent IUA. Nevertheless, it is essential to recognize that the controlled release of EVs is dependent on the rate of hydrogel degradation, which poses a challenge in terms of precise control.

As carriers for delivering and releasing EVs, hydrogel-EVs complex emerges as a potential strategy for the treatment of various diseases [54–57]. To meet the specific requirements for the treatment of diseases, various methods such as adjusting pore size and adding new peptide sequences could be employed to modify hydrogel [17, 58, 59]. A peptide-modified scaffold, based on hyaluronic acid hydrogel and an adhesive peptide, were developed to promote the adhesive growth of MSCs, enable sustained release of EVs, and aid in the repair of spinal cord injuries [60, 61]. The injectable bioglass-hydrogel scaffold has been shown to control and extend the release of Li+, thereby significantly promoting both osteogenesis and angiogenesis. Furthermore, it has been found to indirectly regulate the polarization of macrophages, which in turn enhances bone regeneration in diabetic conditions [62].

Although the therapeutic efficacy of the hydrogel-EVs complex has been supported by numerous studies, its clinical application in medicine still faces several challenges. It is essential to identify the specific active components of EVs that contribute to therapeutic effects on IUA. Improving the methods and efficiency of EVs extraction, as well as enhancing the targeting capabilities of EVs, are critical areas for future research. Moreover, the optimization of hydrogel properties and functions is crucial for advancing the clinical application of EVs delivery system. Addressing these issues will have substantial implications for facilitating the clinical application of the hydrogel-EVs complex. While hydrogel-EVs complex has demonstrated significant potential in the treatment of IUA, further investigation is needed for its clinical application. We are dedicated to developing viable EVs delivery systems to establish a foundation for developing potent therapeutic strategies for IUA.

Conclusion

In this study, we investigated the thermosensitive hydrogel as a sustained release carrier for hUCMSC-EVs in the treatment of IUA. The key findings demonstrated that the hydrogel significantly prolonged EVs retention both in vitro and in a mouse model of IUA. The hydrogel-EVs complex exhibited superior protective effects on endometrial cells and more potent amelioration of pathological features in the IUA mouse model compared to EVs alone. Specifically, the complex showed enhanced ability to relieve endometrial injury, inhibit fibrosis, suppress inflammation, and improve reproductive capacity. The hydrogel-EVs complex attenuated the TGF-β/Smad signaling pathway and related profibrotic processes. This was evidenced by downregulated expression of TGF-β, α-SMA and p-Smad2 in the uterine tissues. In summary, the thermosensitive hydrogel could strengthen the therapeutic effectiveness of hUCMSC-EVs for IUA by promoting long-term EVs retention in the uterine cavity.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Acknowledgements

This work was supported by National Natural Science Foundation of China (No.82171619), Anhui Provincial Health Research Project (No.AHWJ2023A20010), Anhui Provincial Natural Science Foundation for Universities (No.2022AH051193) and the Anhui Institute of Translational Medicine Funding Project (No.2022zhyx-C24).

Author contributions

S.Y. and X.Z. conducted the experiments, analyzed data, and wrote the manuscript. W.L., X.X. and H.L. fed mice and participated in the animal studies. Y.L., R.H. and Y.W. analyzed and interpreted data. J.W., Z.W. and Q.X. designed the study, guided the experiments, and revised this manuscript. All authors approved the final manuscript.

Data availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

All experiments involving human tissues were conducted in accordance with the Helsinki criteria and approved by the Ethics Committees of Anhui Medical University. All experiments involving mice were conducted in accordance with protocols approved by the Animal Ethics Committee of Anhui Medical University.

Consent for publication

This work has not been published previously and is not under consideration for publication elsewhere. Its publication is approved by all the authors and tacitly or explicitly by the responsible authorities where the work was carried out; if accepted, it will not be published elsewhere in the same form, in English or any other language, including electronically, without the written consent of the copyright holder.

Competing interests

The authors declare no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Shujun Yu, Xinru Zhang and Wenwen Li contributed equally to this work.
==== Refs
References

1. Yu D Wong YM Cheong Y Xia E Li TC Asherman syndrome–one century later Fertil Steril 2008 89 759 79 18406834
Yu D, Wong YM, Cheong Y, Xia E, Li TC. Asherman syndrome–one century later. Fertil Steril. 2008;89:759–79.18406834
2. Lee WL, Liu CH, Cheng M, Chang WH, Liu WM, Wang PH. Focus on the Primary Prevention of Intrauterine Adhesions: current Concept and Vision. Int J Mol Sci 2021, 22.
3. Gargett CE Nguyen HP Ye L Endometrial regeneration and endometrial stem/progenitor cells Rev Endocr Metab Disord 2012 13 235 51 22847235
Gargett CE, Nguyen HP, Ye L. Endometrial regeneration and endometrial stem/progenitor cells. Rev Endocr Metab Disord. 2012;13:235–51.22847235
4. Salma U, Xue M, Ali Sheikh MS, Guan X, Xu B, Zhang A, et al. Role of transforming growth factor-beta1 and smads signaling pathway in intrauterine adhesion. Mediators Inflamm. 2016;2016:4158287.
5. Ang CJ Skokan TD McKinley KL Mechanisms of regeneration and fibrosis in the Endometrium Annu Rev Cell Dev Biol 2023 39 197 221 37843929
Ang CJ, Skokan TD, McKinley KL. Mechanisms of regeneration and fibrosis in the Endometrium. Annu Rev Cell Dev Biol. 2023;39:197–221.37843929
6. Ma J Zhan H Li W Zhang L Yun F Wu R Lin J Li Y Recent trends in therapeutic strategies for repairing endometrial tissue in intrauterine adhesion Biomater Res 2021 25 40 34819167
Ma J, Zhan H, Li W, Zhang L, Yun F, Wu R, Lin J, Li Y. Recent trends in therapeutic strategies for repairing endometrial tissue in intrauterine adhesion. Biomater Res. 2021;25:40.34819167
7. Raposo G Stahl PD Extracellular vesicles: a new communication paradigm? Nat Rev Mol Cell Biol 2019 20 509 10 31324871
Raposo G, Stahl PD. Extracellular vesicles: a new communication paradigm? Nat Rev Mol Cell Biol. 2019;20:509–10.31324871
8. Kalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes. Science 2020, 367.
9. An Y Lin S Tan X Zhu S Nie F Zhen Y Gu L Zhang C Wang B Wei W Exosomes from adipose-derived stem cells and application to skin wound healing Cell Prolif 2021 54 e12993 33458899
An Y, Lin S, Tan X, Zhu S, Nie F, Zhen Y, Gu L, Zhang C, Wang B, Wei W, et al. Exosomes from adipose-derived stem cells and application to skin wound healing. Cell Prolif. 2021;54:e12993.33458899
10. Abbaszadeh H Ghorbani F Derakhshani M Movassaghpour A Yousefi M Human umbilical cord mesenchymal stem cell-derived extracellular vesicles: a novel therapeutic paradigm J Cell Physiol 2020 235 706 17 31254289
Abbaszadeh H, Ghorbani F, Derakhshani M, Movassaghpour A, Yousefi M. Human umbilical cord mesenchymal stem cell-derived extracellular vesicles: a novel therapeutic paradigm. J Cell Physiol. 2020;235:706–17.31254289
11. Kou M Huang L Yang J Chiang Z Chen S Liu J Guo L Zhang X Zhou X Xu X Mesenchymal stem cell-derived extracellular vesicles for immunomodulation and regeneration: a next generation therapeutic tool? Cell Death Dis 2022 13 580 35787632
Kou M, Huang L, Yang J, Chiang Z, Chen S, Liu J, Guo L, Zhang X, Zhou X, Xu X, et al. Mesenchymal stem cell-derived extracellular vesicles for immunomodulation and regeneration: a next generation therapeutic tool? Cell Death Dis. 2022;13:580.35787632
12. Yaghoubi Y Movassaghpour A Zamani M Talebi M Mehdizadeh A Yousefi M Human umbilical cord mesenchymal stem cells derived-exosomes in diseases treatment Life Sci 2019 233 116733 31394127
Yaghoubi Y, Movassaghpour A, Zamani M, Talebi M, Mehdizadeh A, Yousefi M. Human umbilical cord mesenchymal stem cells derived-exosomes in diseases treatment. Life Sci. 2019;233:116733.31394127
13. Li K Yan G Huang H Zheng M Ma K Cui X Lu D Zheng L Zhu B Cheng J Zhao J Anti-inflammatory and immunomodulatory effects of the extracellular vesicles derived from human umbilical cord mesenchymal stem cells on osteoarthritis via M2 macrophages J Nanobiotechnol 2022 20 38
Li K, Yan G, Huang H, Zheng M, Ma K, Cui X, Lu D, Zheng L, Zhu B, Cheng J, Zhao J. Anti-inflammatory and immunomodulatory effects of the extracellular vesicles derived from human umbilical cord mesenchymal stem cells on osteoarthritis via M2 macrophages. J Nanobiotechnol. 2022;20:38.
14. Xin L Lin X Zhou F Li C Wang X Yu H Pan Y Fei H Ma L Zhang S A scaffold laden with mesenchymal stem cell-derived exosomes for promoting endometrium regeneration and fertility restoration through macrophage immunomodulation Acta Biomater 2020 113 252 66 32574858
Xin L, Lin X, Zhou F, Li C, Wang X, Yu H, Pan Y, Fei H, Ma L, Zhang S. A scaffold laden with mesenchymal stem cell-derived exosomes for promoting endometrium regeneration and fertility restoration through macrophage immunomodulation. Acta Biomater. 2020;113:252–66.32574858
15. Zhang Y Hao Z Wang P Xia Y Wu J Xia D Fang S Xu S Exosomes from human umbilical cord mesenchymal stem cells enhance fracture healing through HIF-1alpha-mediated promotion of angiogenesis in a rat model of stabilized fracture Cell Prolif 2019 52 e12570 30663158
Zhang Y, Hao Z, Wang P, Xia Y, Wu J, Xia D, Fang S, Xu S. Exosomes from human umbilical cord mesenchymal stem cells enhance fracture healing through HIF-1alpha-mediated promotion of angiogenesis in a rat model of stabilized fracture. Cell Prolif. 2019;52:e12570.30663158
16. Tan SH Chua DAC Tang JRJ Bonnard C Leavesley D Liang K Design of hydrogel-based scaffolds for in vitro three-dimensional human skin model reconstruction Acta Biomater 2022 153 13 37 36191774
Tan SH, Chua DAC, Tang JRJ, Bonnard C, Leavesley D, Liang K. Design of hydrogel-based scaffolds for in vitro three-dimensional human skin model reconstruction. Acta Biomater. 2022;153:13–37.36191774
17. Liang Y He J Guo B Functional hydrogels as Wound Dressing to Enhance Wound Healing ACS Nano 2021 15 12687 722 34374515
Liang Y, He J, Guo B. Functional hydrogels as Wound Dressing to Enhance Wound Healing. ACS Nano. 2021;15:12687–722.34374515
18. Yu H, Gao R, Liu Y, Fu L, Zhou J, Li L. Stimulus-responsive hydrogels as Drug Delivery systems for inflammation targeted therapy. Adv Sci (Weinh) 2023:e2306152.
19. Shi J Yu L Ding J PEG-based thermosensitive and biodegradable hydrogels Acta Biomater 2021 128 42 59 33857694
Shi J, Yu L, Ding J. PEG-based thermosensitive and biodegradable hydrogels. Acta Biomater. 2021;128:42–59.33857694
20. Zhang Y Gao C Li X Xu C Zhang Y Sun Z Liu Y Gao J Thermosensitive methyl cellulose-based injectable hydrogels for post-operation anti-adhesion Carbohydr Polym 2014 101 171 8 24299762
Zhang Y, Gao C, Li X, Xu C, Zhang Y, Sun Z, Liu Y, Gao J. Thermosensitive methyl cellulose-based injectable hydrogels for post-operation anti-adhesion. Carbohydr Polym. 2014;101:171–8.24299762
21. Yang B Gong C Zhao X Zhou S Li Z Qi X Zhong Q Luo F Qian Z Preventing postoperative abdominal adhesions in a rat model with PEG-PCL-PEG hydrogel Int J Nanomed 2012 7 547 57
Yang B, Gong C, Zhao X, Zhou S, Li Z, Qi X, Zhong Q, Luo F, Qian Z. Preventing postoperative abdominal adhesions in a rat model with PEG-PCL-PEG hydrogel. Int J Nanomed. 2012;7:547–57.
22. Shi H Zhu Y Xing C Li S Bao Z Lei L Lin D Wang Y Chen H Xu X An injectable thermosensitive hydrogel for dual delivery of diclofenac and avastin(R) to effectively suppress inflammatory corneal neovascularization Int J Pharm 2022 625 122081 35934166
Shi H, Zhu Y, Xing C, Li S, Bao Z, Lei L, Lin D, Wang Y, Chen H, Xu X. An injectable thermosensitive hydrogel for dual delivery of diclofenac and avastin(R) to effectively suppress inflammatory corneal neovascularization. Int J Pharm. 2022;625:122081.35934166
23. Zhang Z Ni J Chen L Yu L Xu J Ding J Biodegradable and thermoreversible PCLA-PEG-PCLA hydrogel as a barrier for prevention of post-operative adhesion Biomaterials 2011 32 4725 36 21482434
Zhang Z, Ni J, Chen L, Yu L, Xu J, Ding J. Biodegradable and thermoreversible PCLA-PEG-PCLA hydrogel as a barrier for prevention of post-operative adhesion. Biomaterials. 2011;32:4725–36.21482434
24. Wang J, Hu R, Xing Q, Feng X, Jiang X, Xu Y, et al. Exosomes derived from umbilical cord mesenchymal stem cells alleviate mifepristone-induced human endometrial stromal cell injury. Stem Cells Int. 2020;2020:6091269.
25. Kim YY Choi BB Lim JW Kim YJ Kim SY Ku SY Efficient production of murine uterine damage model Tissue Eng Regen Med 2019 16 119 29 30989039
Kim YY, Choi BB, Lim JW, Kim YJ, Kim SY, Ku SY. Efficient production of murine uterine damage model. Tissue Eng Regen Med. 2019;16:119–29.30989039
26. Xiao L Song Y Huang W Yang S Fu J Feng X Zhou M Expression of SOX2, NANOG and OCT4 in a mouse model of lipopolysaccharide-induced acute uterine injury and intrauterine adhesions Reprod Biol Endocrinol 2017 15 14 28253866
Xiao L, Song Y, Huang W, Yang S, Fu J, Feng X, Zhou M. Expression of SOX2, NANOG and OCT4 in a mouse model of lipopolysaccharide-induced acute uterine injury and intrauterine adhesions. Reprod Biol Endocrinol. 2017;15:14.28253866
27. Wang Y, Wang Y, Wu Y, Wang Y. Dulaglutide ameliorates Intrauterine Adhesion by suppressing inflammation and epithelial-mesenchymal transition via inhibiting the TGF-beta/Smad2 signaling pathway. Pharmaceuticals (Basel) 2023, 16.
28. Chen R Kang R Tang D The mechanism of HMGB1 secretion and release Exp Mol Med 2022 54 91 102 35217834
Chen R, Kang R, Tang D. The mechanism of HMGB1 secretion and release. Exp Mol Med. 2022;54:91–102.35217834
29. Yao Y Chen R Wang G Zhang Y Liu F Exosomes derived from mesenchymal stem cells reverse EMT via TGF-beta1/Smad pathway and promote repair of damaged endometrium Stem Cell Res Ther 2019 10 225 31358049
Yao Y, Chen R, Wang G, Zhang Y, Liu F. Exosomes derived from mesenchymal stem cells reverse EMT via TGF-beta1/Smad pathway and promote repair of damaged endometrium. Stem Cell Res Ther. 2019;10:225.31358049
30. Frangogiannis N Transforming growth factor-beta in tissue fibrosis J Exp Med 2020 217 e20190103 32997468
Frangogiannis N. Transforming growth factor-beta in tissue fibrosis. J Exp Med. 2020;217:e20190103.32997468
31. Feng XH Derynck R Specificity and versatility in tgf-beta signaling through Smads Annu Rev Cell Dev Biol 2005 21 659 93 16212511
Feng XH, Derynck R. Specificity and versatility in tgf-beta signaling through Smads. Annu Rev Cell Dev Biol. 2005;21:659–93.16212511
32. Klingberg F Hinz B White ES The myofibroblast matrix: implications for tissue repair and fibrosis J Pathol 2013 229 298 309 22996908
Klingberg F, Hinz B, White ES. The myofibroblast matrix: implications for tissue repair and fibrosis. J Pathol. 2013;229:298–309.22996908
33. Shinde AV Humeres C Frangogiannis NG The role of alpha-smooth muscle actin in fibroblast-mediated matrix contraction and remodeling Biochim Biophys Acta Mol Basis Dis 2017 1863 298 309 27825850
Shinde AV, Humeres C, Frangogiannis NG. The role of alpha-smooth muscle actin in fibroblast-mediated matrix contraction and remodeling. Biochim Biophys Acta Mol Basis Dis. 2017;1863:298–309.27825850
34. Wynn TA Ramalingam TR Mechanisms of fibrosis: therapeutic translation for fibrotic disease Nat Med 2012 18 1028 40 22772564
Wynn TA, Ramalingam TR. Mechanisms of fibrosis: therapeutic translation for fibrotic disease. Nat Med. 2012;18:1028–40.22772564
35. Paiva P Lockhart MG Girling JE Olshansky M Woodrow N Marino JL Hickey M Rogers PA Identification of genes differentially expressed in menstrual breakdown and repair Mol Hum Reprod 2016 22 898 912 27609758
Paiva P, Lockhart MG, Girling JE, Olshansky M, Woodrow N, Marino JL, Hickey M, Rogers PA. Identification of genes differentially expressed in menstrual breakdown and repair. Mol Hum Reprod. 2016;22:898–912.27609758
36. Evans J Salamonsen LA Winship A Menkhorst E Nie G Gargett CE Dimitriadis E Fertile ground: human endometrial programming and lessons in health and disease Nat Rev Endocrinol 2016 12 654 67 27448058
Evans J, Salamonsen LA, Winship A, Menkhorst E, Nie G, Gargett CE, Dimitriadis E. Fertile ground: human endometrial programming and lessons in health and disease. Nat Rev Endocrinol. 2016;12:654–67.27448058
37. Eming SA Wynn TA Martin P Inflammation and metabolism in tissue repair and regeneration Science 2017 356 1026 30 28596335
Eming SA, Wynn TA, Martin P. Inflammation and metabolism in tissue repair and regeneration. Science. 2017;356:1026–30.28596335
38. Riau AK Ong HS Yam GHF Mehta JS Sustained Delivery System for Stem Cell-Derived exosomes Front Pharmacol 2019 10 1368 31798457
Riau AK, Ong HS, Yam GHF, Mehta JS. Sustained Delivery System for Stem Cell-Derived exosomes. Front Pharmacol. 2019;10:1368.31798457
39. Zhao J Ding Y He R Huang K Liu L Jiang C Liu Z Wang Y Yan X Cao F Dose-effect relationship and molecular mechanism by which BMSC-derived exosomes promote peripheral nerve regeneration after crush injury Stem Cell Res Ther 2020 11 360 32811548
Zhao J, Ding Y, He R, Huang K, Liu L, Jiang C, Liu Z, Wang Y, Yan X, Cao F, et al. Dose-effect relationship and molecular mechanism by which BMSC-derived exosomes promote peripheral nerve regeneration after crush injury. Stem Cell Res Ther. 2020;11:360.32811548
40. Zou J Yang W Cui W Li C Ma C Ji X Hong J Qu Z Chen J Liu A Wu H Therapeutic potential and mechanisms of mesenchymal stem cell-derived exosomes as bioactive materials in tendon-bone healing J Nanobiotechnol 2023 21 14
Zou J, Yang W, Cui W, Li C, Ma C, Ji X, Hong J, Qu Z, Chen J, Liu A, Wu H. Therapeutic potential and mechanisms of mesenchymal stem cell-derived exosomes as bioactive materials in tendon-bone healing. J Nanobiotechnol. 2023;21:14.
41. Mondal J Pillarisetti S Junnuthula V Saha M Hwang SR Park IK Lee YK Hybrid exosomes, exosome-like nanovesicles and engineered exosomes for therapeutic applications J Control Release 2023 353 1127 49 36528193
Mondal J, Pillarisetti S, Junnuthula V, Saha M, Hwang SR, Park IK, Lee YK. Hybrid exosomes, exosome-like nanovesicles and engineered exosomes for therapeutic applications. J Control Release. 2023;353:1127–49.36528193
42. Haraszti RA Miller R Stoppato M Sere YY Coles A Didiot MC Wollacott R Sapp E Dubuke ML Li X Exosomes produced from 3D cultures of MSCs by tangential Flow Filtration Show Higher Yield and Improved Activity Mol Ther 2018 26 2838 47 30341012
Haraszti RA, Miller R, Stoppato M, Sere YY, Coles A, Didiot MC, Wollacott R, Sapp E, Dubuke ML, Li X, et al. Exosomes produced from 3D cultures of MSCs by tangential Flow Filtration Show Higher Yield and Improved Activity. Mol Ther. 2018;26:2838–47.30341012
43. Hu N Cai Z Jiang X Wang C Tang T Xu T Chen H Li X Du X Cui W Hypoxia-pretreated ADSC-derived exosome-embedded hydrogels promote angiogenesis and accelerate diabetic wound healing Acta Biomater 2023 157 175 86 36503078
Hu N, Cai Z, Jiang X, Wang C, Tang T, Xu T, Chen H, Li X, Du X, Cui W. Hypoxia-pretreated ADSC-derived exosome-embedded hydrogels promote angiogenesis and accelerate diabetic wound healing. Acta Biomater. 2023;157:175–86.36503078
44. Pan W Chen H Wang A Wang F Zhang X Challenges and strategies: scalable and efficient production of mesenchymal stem cells-derived exosomes for cell-free therapy Life Sci 2023 319 121524 36828131
Pan W, Chen H, Wang A, Wang F, Zhang X. Challenges and strategies: scalable and efficient production of mesenchymal stem cells-derived exosomes for cell-free therapy. Life Sci. 2023;319:121524.36828131
45. Liang G Zhu Y Ali DJ Tian T Xu H Si K Sun B Chen B Xiao Z Engineered exosomes for targeted co-delivery of miR-21 inhibitor and chemotherapeutics to reverse drug resistance in colon cancer J Nanobiotechnol 2020 18 10
Liang G, Zhu Y, Ali DJ, Tian T, Xu H, Si K, Sun B, Chen B, Xiao Z. Engineered exosomes for targeted co-delivery of miR-21 inhibitor and chemotherapeutics to reverse drug resistance in colon cancer. J Nanobiotechnol. 2020;18:10.
46. Wang B Zhang A Wang H Klein JD Tan L Wang ZM Du J Naqvi N Liu BC Wang XH miR-26a limits muscle wasting and Cardiac fibrosis through exosome-mediated microRNA transfer in chronic kidney disease Theranostics 2019 9 1864 77 31037144
Wang B, Zhang A, Wang H, Klein JD, Tan L, Wang ZM, Du J, Naqvi N, Liu BC, Wang XH. miR-26a limits muscle wasting and Cardiac fibrosis through exosome-mediated microRNA transfer in chronic kidney disease. Theranostics. 2019;9:1864–77.31037144
47. Zhu Q Tang S Zhu Y Chen D Huang J Lin J Exosomes Derived from CTF1-Modified bone marrow stem cells promote endometrial regeneration and restore fertility Front Bioeng Biotechnol 2022 10 868734 35497344
Zhu Q, Tang S, Zhu Y, Chen D, Huang J, Lin J. Exosomes Derived from CTF1-Modified bone marrow stem cells promote endometrial regeneration and restore fertility. Front Bioeng Biotechnol. 2022;10:868734.35497344
48. Li J Pan Y Yang J Wang J Jiang Q Dou H Hou Y Tumor necrosis factor-alpha-primed mesenchymal stem cell-derived exosomes promote M2 macrophage polarization via Galectin-1 and modify intrauterine adhesion on a novel murine model Front Immunol 2022 13 945234 36591221
Li J, Pan Y, Yang J, Wang J, Jiang Q, Dou H, Hou Y. Tumor necrosis factor-alpha-primed mesenchymal stem cell-derived exosomes promote M2 macrophage polarization via Galectin-1 and modify intrauterine adhesion on a novel murine model. Front Immunol. 2022;13:945234.36591221
49. Li X Lv HF Zhao R Ying MF Samuriwo AT Zhao YZ Recent developments in bio-scaffold materials as delivery strategies for therapeutics for endometrium regeneration Mater Today Bio 2021 11 100101 34036261
Li X, Lv HF, Zhao R, Ying MF, Samuriwo AT, Zhao YZ. Recent developments in bio-scaffold materials as delivery strategies for therapeutics for endometrium regeneration. Mater Today Bio. 2021;11:100101.34036261
50. Wu F Lei N Yang S Zhou J Chen M Chen C Qiu L Guo R Li Y Chang L Treatment strategies for intrauterine adhesion: focus on the exosomes and hydrogels Front Bioeng Biotechnol 2023 11 1264006 37720318
Wu F, Lei N, Yang S, Zhou J, Chen M, Chen C, Qiu L, Guo R, Li Y, Chang L. Treatment strategies for intrauterine adhesion: focus on the exosomes and hydrogels. Front Bioeng Biotechnol. 2023;11:1264006.37720318
51. Kou L Jiang X Xiao S Zhao YZ Yao Q Chen R Therapeutic options and drug delivery strategies for the prevention of intrauterine adhesions J Control Release 2020 318 25 37 31830539
Kou L, Jiang X, Xiao S, Zhao YZ, Yao Q, Chen R. Therapeutic options and drug delivery strategies for the prevention of intrauterine adhesions. J Control Release. 2020;318:25–37.31830539
52. Chen Y Fei W Zhao Y Wang F Zheng X Luan X Zheng C Sustained delivery of 17beta-estradiol by human amniotic extracellular matrix (HAECM) scaffold integrated with PLGA microspheres for endometrium regeneration Drug Deliv 2020 27 1165 75 32755258
Chen Y, Fei W, Zhao Y, Wang F, Zheng X, Luan X, Zheng C. Sustained delivery of 17beta-estradiol by human amniotic extracellular matrix (HAECM) scaffold integrated with PLGA microspheres for endometrium regeneration. Drug Deliv. 2020;27:1165–75.32755258
53. Xiao B Yang W Lei D Huang J Yin Y Zhu Y You Z Wang F Sun S PGS scaffolds promote the in vivo survival and directional differentiation of bone marrow mesenchymal stem cells restoring the morphology and function of wounded rat uterus Adv Healthc Mater 2019 8 e1801455 30734535
Xiao B, Yang W, Lei D, Huang J, Yin Y, Zhu Y, You Z, Wang F, Sun S. PGS scaffolds promote the in vivo survival and directional differentiation of bone marrow mesenchymal stem cells restoring the morphology and function of wounded rat uterus. Adv Healthc Mater. 2019;8:e1801455.30734535
54. Wang C Wang M Xu T Zhang X Lin C Gao W Xu H Lei B Mao C Engineering Bioactive Self-Healing Antibacterial exosomes Hydrogel for promoting Chronic Diabetic Wound Healing and Complete skin regeneration Theranostics 2019 9 65 76 30662554
Wang C, Wang M, Xu T, Zhang X, Lin C, Gao W, Xu H, Lei B, Mao C. Engineering Bioactive Self-Healing Antibacterial exosomes Hydrogel for promoting Chronic Diabetic Wound Healing and Complete skin regeneration. Theranostics. 2019;9:65–76.30662554
55. Fan L Liu C Chen X Zheng L Zou Y Wen H Guan P Lu F Luo Y Tan G Exosomes-Loaded Electroconductive Hydrogel synergistically promotes tissue repair after spinal cord Injury via Immunoregulation and Enhancement of Myelinated Axon Growth Adv Sci (Weinh) 2022 9 e2105586 35253394
Fan L, Liu C, Chen X, Zheng L, Zou Y, Wen H, Guan P, Lu F, Luo Y, Tan G, et al. Exosomes-Loaded Electroconductive Hydrogel synergistically promotes tissue repair after spinal cord Injury via Immunoregulation and Enhancement of Myelinated Axon Growth. Adv Sci (Weinh). 2022;9:e2105586.35253394
56. Ju Y Hu Y Yang P Xie X Fang B Extracellular vesicle-loaded hydrogels for tissue repair and regeneration Mater Today Bio 2023 18 100522 36593913
Ju Y, Hu Y, Yang P, Xie X, Fang B. Extracellular vesicle-loaded hydrogels for tissue repair and regeneration. Mater Today Bio. 2023;18:100522.36593913
57. Li S Liu J Liu S Jiao W Wang X Chitosan oligosaccharides packaged into rat adipose mesenchymal stem cells-derived extracellular vesicles facilitating cartilage injury repair and alleviating osteoarthritis J Nanobiotechnol 2021 19 343
Li S, Liu J, Liu S, Jiao W, Wang X. Chitosan oligosaccharides packaged into rat adipose mesenchymal stem cells-derived extracellular vesicles facilitating cartilage injury repair and alleviating osteoarthritis. J Nanobiotechnol. 2021;19:343.
58. Cao H Duan L Zhang Y Cao J Zhang K Current hydrogel advances in physicochemical and biological response-driven biomedical application diversity Signal Transduct Target Ther 2021 6 426 34916490
Cao H, Duan L, Zhang Y, Cao J, Zhang K. Current hydrogel advances in physicochemical and biological response-driven biomedical application diversity. Signal Transduct Target Ther. 2021;6:426.34916490
59. Conley BM Yang L Bhujel B Luo J Han I Lee KB Development of a nanohybrid peptide hydrogel for enhanced intervertebral disc repair and regeneration ACS Nano 2023 17 3750 64 36780291
Conley BM, Yang L, Bhujel B, Luo J, Han I, Lee KB. Development of a nanohybrid peptide hydrogel for enhanced intervertebral disc repair and regeneration. ACS Nano. 2023;17:3750–64.36780291
60. Li L Xiao B Mu J Zhang Y Zhang C Cao H Chen R Patra HK Yang B Feng S A MnO(2) nanoparticle-dotted hydrogel promotes spinal cord repair via regulating reactive oxygen species Microenvironment and synergizing with mesenchymal stem cells ACS Nano 2019 13 14283 93 31769966
Li L, Xiao B, Mu J, Zhang Y, Zhang C, Cao H, Chen R, Patra HK, Yang B, Feng S, et al. A MnO(2) nanoparticle-dotted hydrogel promotes spinal cord repair via regulating reactive oxygen species Microenvironment and synergizing with mesenchymal stem cells. ACS Nano. 2019;13:14283–93.31769966
61. Li L Zhang Y Mu J Chen J Zhang C Cao H Gao J Transplantation of human mesenchymal stem-cell-derived exosomes immobilized in an Adhesive Hydrogel for Effective Treatment of spinal cord Injury Nano Lett 2020 20 4298 305 32379461
Li L, Zhang Y, Mu J, Chen J, Zhang C, Cao H, Gao J. Transplantation of human mesenchymal stem-cell-derived exosomes immobilized in an Adhesive Hydrogel for Effective Treatment of spinal cord Injury. Nano Lett. 2020;20:4298–305.32379461
62. Wu Z Bai J Ge G Wang T Feng S Ma Q Liang X Li W Zhang W Xu Y Regulating macrophage polarization in high glucose microenvironment using Lithium-modified Bioglass-Hydrogel for Diabetic Bone Regeneration Adv Healthc Mater 2022 11 e2200298 35388979
Wu Z, Bai J, Ge G, Wang T, Feng S, Ma Q, Liang X, Li W, Zhang W, Xu Y, et al. Regulating macrophage polarization in high glucose microenvironment using Lithium-modified Bioglass-Hydrogel for Diabetic Bone Regeneration. Adv Healthc Mater. 2022;11:e2200298.35388979
