
==== Front
Cancer Control
Cancer Control
spccx
CCX
Cancer Control : Journal of the Moffitt Cancer Center
1073-2748
1526-2359
SAGE Publications Sage CA: Los Angeles, CA

39259658
10.1177_10732748241284821
10.1177/10732748241284821
Research Article
Long Noncoding RNAs MALAT1 and HOTTIP Act as Serum Biomarkers for Hepatocellular Carcinoma
https://orcid.org/0000-0002-1972-2148
Bao Han PhD 1
Jiang Yutian MSc 2
Wang Ning PhD 3
Su Hongying PhD 1
Han Xiangjun PhD 1
1 Department of Interventional Radiology, 159407 The First Hospital of China Medical University , Shenyang, China
2 Department of Interventional Therapy, 117747 The Affiliated Yantai Yuhuangding Hospital of Qingdao University , Yantai, China
3 Department of Radiology, 85024 Shengjing Hospital of China Medical University , Shenyang, China
Xiangjun Han, PhD, Department of Interventional Radiology, The First Hospital of China Medical University, 155 Nanjing North Street, Shenyang 110001, China. Email: xjhan@cmu.edu.cn
11 9 2024
Jan-Dec 2024
31 1073274824128482122 6 2024
17 8 2024
22 8 2024
© The Author(s) 2024
2024
SAGE Publications Inc, unless otherwise noted. Manuscript content on this site is licensed under Creative Common Licences
https://creativecommons.org/licenses/by-nc/4.0/ This article is distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 License (https://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial use, reproduction and distribution of the work without further permission provided the original work is attributed as specified on the SAGE and Open Access pages (https://us.sagepub.com/en-us/nam/open-access-at-sage).

Background

Circulating tumor markers with satisfactory sensitivity and specificity play crucial roles in cancer diagnosis and therapy. This prospective study aimed to evaluate the potential of circulating lncRNAs as biomarkers for hepatocellular carcinoma (HCC).

Methods

A total of 74 patients with HCC and 94 healthy controls were enrolled. The expression levels of candidate genes in serum were detected by qRT-PCR. Receiver operating characteristic (ROC) curve analysis and logistic regression were employed to investigate the diagnostic capacity of lncRNAs. The analysis of 3-year overall survival (OS) was conducted using the Kaplan-Meier method and log-rank test.

Results

Of the 9 candidate genes, 6 lncRNAs could be stably detected in serum. The expression levels of circulating MALAT1 and HOTTIP in HCC patients were significantly higher than those in controls (P < 0.001). ROC analysis showed that MALAT1 and HOTTIP were more effective than alpha-fetoprotein (AFP) (P < 0.010) in the diagnosis of HCC, with AUCs of 0.896 and 0.899, respectively. Additionally, a panel consisting of MALAT1, HOTTIP, and AFP was constructed to obtain an AUC of 0.968 with a sensitivity of 87.8% and specificity of 94.7% in HCC diagnosis. Moreover, the upregulation of MALAT1 was not only related to multiple tumor lesions, HCV infection, AST level, and AFP level, but also suggested shorter OS. A high expression level of HOTTIP was associated with metastasis.

Conclusion

Serum MALAT1 and HOTTIP play indicative roles as non-invasive biomarkers for HCC.

long noncoding RNA
hepatocellular carcinoma
biomarker
diagnosis
prognosis
National Natural Science Foundation of China https://doi.org/10.13039/501100001809 81901846 Special Funds for Science and Technology Innovation of Shenyang F15-199-1-43 typesetterts10
cover-dateJanuary-December 2024
==== Body
pmcIntroduction

Hepatocellular carcinoma (HCC) is one of the most fatal malignant tumors, ranking fifth in incidence and third in tumor-related deaths worldwide. The annual new cases of and deaths due to HCC in China account for approximately 51% of the world total. 1 Due to the insidious progression and insufficient typical early clinical symptoms of primary hepatic cancer, most patients lose the opportunity for radical treatment when they seek medical consultation, resulting in a 5-year survival rate of less than 20%. 2 Therefore, improving the screening and diagnosis of HCC plays a particularly important role in improving patient prognosis. Alpha-fetoprotein (AFP), a serum tumor marker for HCC, has been widely used clinically. However, it is still challenging to diagnose HCC at an early stage with a sensitivity limited to 65% and of <40% for preclinical prediction. 3 PIVKA-II, an immature form of prothrombin, has recently been proposed as an effective serum HCC marker. However, the level of PIVKA-II could be influenced by various factors, such as vitamin K deficiency, coagulation disorders, and liver diseases. 4 Therefore, finding novel biomarkers with higher specificity and sensitivity is necessary for HCC screening and diagnosis.

Long noncoding RNAs (lncRNAs) are a group of nucleic acid sequences with lengths of more than 200 nucleotides and no protein coding ability. 5 Recently, an increasing number of lncRNAs have been examined and identified, and some of them have been reported to play critical roles in modulating cancer epigenetics and regulating important biological processes.6-8 Previous studies have shown that several lncRNAs in HCC tissues have significantly higher expression levels than those in adjacent liver tissues.9-11 In addition, lncRNAs have been confirmed to have satisfactory stability in plasma. 12 Hence, finding appropriate lncRNAs in blood circulation to serve as markers represents a promising clinical research direction.

Although circulating lncRNAs have been reported as biomarkers for HCC, different researchers yielded inconsistent results. Therefore, more experiments will help promote the progress in this field. We conducted the present study to identify appropriate lncRNAs as circulating HCC markers. Furthermore, their diagnostic efficacy and predictive value as noninvasive markers for HCC were also evaluated.

Materials and Methods

Patients

A total of 168 patients were enrolled in this study, namely, 74 consecutive patients diagnose with HCC at our institution from October 2018 to August 2019, and 94 healthy controls. All patients in the HCC group were confirmed by pathological examination or clinical diagnosis according to the World Health Organization (WHO) criteria, and patients who had received chemotherapy or radiotherapy were excluded. Data were collected prospectively on all patients from the medical records and personal interviews, including demographics, tumor features, laboratory data, and follow-up. Tumor features included number, size and vascular invasion. Laboratory data included levels of albumin (ALB), alanine transaminase (ALT), aspartic transaminase (AST), total bilirubin (TBIL), prothrombin time (PT), hepatitis B surface antigen (HBsAg), anti-hepatitis C virus (anti-HCV), and AFP. Patients from HCC group received ablation or chemoembolization treatment, which were chosen based on the Barcelona Clinic Liver Cancer (BCLC) approach. The follow-up time in HCC group ranged from 4 to 36 months (median 16 months). The research protocol was approved by the Ethics Committee of The First Hospital of China Medical University (2018-215-2). Written informed consent was obtained from every participant and all patient details have been de-identified. The reporting of this study conforms to REMARK guidelines. 13

Plasma Samples

Whole-blood samples obtained with ethylene diamine tetraacetic acid (EDTA) anticoagulation were centrifuged at 3000 r/min for 10 min at 4°C to separate the blood cells. The supernatants were collected and centrifuged at 12,000 r/min for 10 min at 4°C to completely remove cellular components. Then, plasma was collected and stored at −80°C for further use.

RNA Extraction

Total RNA was extracted from 400 μL of cell-free plasma using a mirVana PARIS Kit (Ambion, Austin, TX, USA) and eluted with 100 μL of preheated (95°C) elution solution according to the manufacturer’s protocol as described previously. 14 RNA samples were stored at −80°C until further analysis.

Quantitative Real-Time PCR (qRT‒PCR)

Nine candidate lncRNAs (HOTAIR, MVIH, MALAT1, PVT1, UCA1, URHC, H19, HOTTIP, and HEIH) abnormally expressing in HCC were used in this process on the basis of a previous literature review.10,11,15-21 Reverse transcription reactions were carried out in 100 μL of total RNA using the PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Shiga, Japan). The quality of RNA samples was assessed with a Nanodrop 2000 spectrophotometer (Thermo, CA, USA), and the 260/280 nm absorbance ratio was limited to 1.8-2.0. Then, real-time PCR was performed using SYBR Premix EX Tap II (TaKaRa, Shiga, Japan). GAPDH was evaluated as a housekeeping gene for the qPCRs. The primers used are listed in Table 1. All reactions were carried out on a LightCycler 480 Real Time PCR System (Roche, Basel, Switzerland) according to the manufacturer’s instructions. A melt-curve analysis was carried out at the end of each reaction to verify the specificity. The 2−ΔΔCt method was used to evaluate the relative expression level of candidate genes in HCC blood samples in comparison to healthy controls. Each sample was repeated in triplicate.Table 1. Primers of 9 Candidate lncRNAs and Housekeeping Gene.

Gene	Forword Primer	Reverse Primer	
HOTAIR	GGAAAGATCCAAATGGGACCA	CTAGGAATCAGCACGAAGCAAA	
MALAT1	AGTTCAGTGTTGGGGCAATC	GTTCTTCCGCTCAAATCCTG	
MVIH	AATTTTGCACATCTGAACAGCC	TTCAAAATCCCACTACGCCCA	
HEIH	CCTCTTGTGCCCCTTTCTT	ATGGCTTCTCGCATCCTAT	
PVT1	ATCCACCCTCTTGTCTGATTTTCT	AATCCACAGGGTTCAGGAAGTC	
UCA1	CTCTCCTATCTCCCTTCACTGA	CTTTGGGTTGAGGTTCCTGT	
URHC	TGTTTATGTGAGAGGAGAAAGGAAG	CACTAGAGGTCTGCAAATAAAGTGA	
H19	CCGGACACAAAACCCTCTAGCT	TGTTCCGATGGTGTCTTTGATG	
HOTTIP	CCTAAAGCCACGCTTCTTTG	TGCAGGCTGGAGATCCTACT	
GAPDH	GGGAGCCAAAAGGGTCATCA	GCATGGACTGTGGTCATGAGT	

Public Data Collection

Public databases were used to compare and validate the expression differences of candidate genes in hepatocellular carcinoma and normal tissue samples. Transcriptome expression data of HCC patients were obtained from the TCGA-LIHC (https://portal.gdc.cancer.gov/) database. To compensate the deficiency of normal samples, normal liver tissue samples in the GTEx database (https://xenabrowser.net/datapages/) were used. In addition, the clinical as well as prognostic information was obtained from the same website.

Statistical Analysis

Continuous variables are expressed as the means ± SDs, and categorical variables are expressed as a number. The differences were compared using t test for continuous variables and the chi-square test or Fisher’s exact test for categorical variables. If lncRNAs were found to be significant, receiver operating characteristic (ROC) curve analysis was conducted to obtain the cutoff value, sensitivity and specificity. Combined ROC analysis was conducted on the basis of a logistic regression model. Pearson’s correlation analysis was used to reveal the correlation between the serum lncRNA levels and biochemical parameters. Three-year overall survival (OS) was calculated using the Kaplan-Meier method, and the differences were compared using the log-rank test. The sample size justification of validation set was performed using an online simple size calculator (https://www.trialdesign.org/) with alpha value of 0.05 and power of 90%. The expression levels from TCGA and GTEx datasets between two groups were calculated by the Wilcoxon’s test using R software (https://www.r-project.org/). Statistical analysis was performed using SPSS Statistics 26.0 (IBM SPSS, Shanghai, China) and GraphPad Prism 9.0 (GraphPad Software, LLC., Boston, MA, USA). A two-sided P value of <0.050 was considered statistically significant.

Results

Patient Characteristics

A total of 168 patients were enrolled in this study, namely, 74 patients in the HCC group and 94 healthy controls. Table 2 summarizes the clinical baseline characteristics of all participants. There were no significant differences in age, sex, smoking, alcoholism, ALB level, TBIL level or PT between the two groups at baseline. Compared with those in the control group, the AST and AFP levels in the HCC group were significantly increased (P < 0.050), and the ALT level was slightly higher. For the HCC group patients, 54.05% had a single intrahepatic lesion, others had multiple masses, and 13.51% had portal vein invasion. The proportions of subjects with BCLC stage 0, A, B, C, and D HCC were 2.70%, 36.49%, 24.32%, 36.49%, and 0%, respectively.Table 2. Baseline Characteristics of Patients in the HCC Group and the Control Group.

Variable	HCC (n = 74)	Control (n = 94)	P value	
Age	59.07 ± 9.67	61.91 ± 12.26	0.104	
Sex			0.242	
 Male	55	62		
 Female	19	32		
Smoking			0.717	
 Negative	43	52		
 Positive	31	42		
Alcoholism			0.163	
 Negative	41	62		
 Positive	33	32		
Laboratory data				
 ALB (g/L)	36.25 ± 4.50	35.18 ± 5.60	0.184	
 ALT (U/L)	50.55 ± 50.47	36.02 ± 46.38	0.054	
 AST (U/L)	54.72 ± 38.37	36.89 ± 44.13	0.007 a	
 TBIL (μmol/L)	18.45 ± 10.50	15.48 ± 23.18	0.309	
 PT (s)	14.44 ± 1.62	14.10 ± 2.00	0.239	
 AFP (ng/mL)	416.10 ± 528.90	12.57 ± 21.71	<0.001 a	
Tumor characteristics				
 Number of lesions				
  Solitary	40 (54.05%)			
  Multiple	34 (45.95%)			
 Tumor size				
  <5 cm	31 (41.89%)			
  ≥5 cm	43 (58.11%)			
 Vascular invasion				
  Absent	64 (86.49%)			
  Present	10 (13.51%)			
BCLC stage				
 0	2 (2.70%)			
 A	27 (36.49%)			
 B	18 (24.32%)			
 C	27 (36.49%)			
 D	0 (0%)			
aIndicates statistically significant, P < 0.050.

Screening of lncRNAs Related to HCC in the Training Set

After numbering all serum samples, 20 pairs of samples in HCC group and control group were randomly selected and classified into the training set, and the remaining samples after randomization were used to form the validation set. The characteristics of training and validation sets are listed in Table 3. The results showed that 6 lncRNAs (HOTTAIR, MVIH, MALAT1, H19, HOTTIP and HEIH) could be stably detected in the plasma of HCC patients and healthy controls, and the other 3 lncRNAs were excluded due to their low detection levels (Figure 1). In addition, compared with the control group, the serum expression levels of MALAT1 and HOTTIP were significantly upregulated in HCC patients (P < 0.050). There was no significant difference in the expression levels of the remaining 4 lncRNAs (HOTAIR, MVIH, HEIH and H19) between the HCC group and the control group (Table 4, Figure 2).Table 3. Baseline Characteristics of the Training and Validation Sets.

Variable	Training Set (n = 40)	Validation Set (n = 128)	
HCC (n = 20)	Control (n = 20)	HCC (n = 54)	Control (n = 74)	
Age	60.1 ± 9.82	59.6 ± 13.56	58.69 ± 9.68	62.54 ± 11.91	
Sex	
 Male	12	10	43	52	
 Female	8	10	11	22	
Smoking	
 Negative	12	11	31	41	
 Positive	8	9	23	33	
Alcoholism	
 Negative	11	13	30	49	
 Positive	9	7	24	25	
Laboratory data	
 ALB (g/L)	36.73 ± 4.85	35.43 ± 5.64	36.07 ± 4.40	35.11 ± 5.63	
 ALT (U/L)	36.8 ± 23.81	24.60 ± 30.76	55.65 ± 56.63	39.11 ± 49.49	
 AST (U/L)	42.20 ± 20.14	28.85 ± 30.27	59.35 ± 42.44	39.07 ± 47.11	
 TBIL (μmol/L)	14.54 ± 6.48	12.86 ± 11.08	19.9 ± 11.36	16.19 ± 25.50	
 PT (s)	14.50 ± 1.63	13.51 ± 2.01	14.41 ± 1.63	14.26 ± 1.98	
 AFP (ng/mL)	258.70 ± 488.80	7.50 ± 5.75	474.4 ± 535.6	13.93 ± 24.14	
Tumor characteristics	
 Number of lesions	
 Solitary	13		27		
 Multiple	7		27		
 Tumor size					
 <5 cm	9		22		
 ≥5 cm	11		32		
 Vascular invasion	
 Absent	17		47		
 Present	3		7		
 BCLC stage	
 0	0		2		
 A	9		18		
 B	3		15		
 C	8		19		
 D	0		0		

Figure 1. Heatmap of lncRNAs expression levels in plasma samples from 20 HCC patients and 20 healthy controls in the training set.

Table 4. The 2−ΔCt Values of 6 Stably Detected lncRNAs in Serum Samples.

Gene	HCC	Control	P value	
HOTAIR	0.0104 ± 0.0264	0.0166 ± 0.0444	0.594	
MVIH	0.0034 ± 0.0077	0.0134 ± 0.0259	0.107	
MALAT1	0.6273 ± 1.0400	0.0205 ± 0.0170	0.013 a	
H19	0.2577 ± 0.1754	0.2307 ± 0.2277	0.677	
HOTTIP	0.3713 ± 0.6133	0.0038 ± 0.0045	0.011 a	
HEIH	0.0371 ± 0.0027	0.0712 ± 0.0904	0.115	
aIndicates statistical significance, P < 0.050.

Figure 2. Relative expression levels of 6 stably detected lncRNAs in serum. The expression levels of MALAT1 (C) and HOTTIP (E) were significantly upregulated in HCC patients compared with healthy controls. There was no significant difference in the expression levels of the other 4 lncRNAs (A, B, D and F). Data on the relative expression of serum lncRNAs are presented after log10 transformation. *** indicates P < 0.001, **** indicates P < 0.0001.

Confirmation of the Selected lncRNAs by the Validation Set

The sample size justification for validation set was based on results from training set. The recommended minimum sample size for MALAT1 and HOTTIP were 73 and 69, respectively. The sample size of the validation set in this study was considered sufficient to reflect the differences in the selected genes. To validate the accuracy and specificity of MALAT1 and HOTTIP as HCC biomarkers, we next examined the expression level of two selected lncRNAs in the validation set composed of the 128 remaining samples. As shown in Figure 3, the relative expression levels of MALAT1 and HOTTIP in the plasma of HCC patients were significantly higher than those in healthy controls, and the results were consistent with those in the training set. Finally, we merged the total samples for further analysis.Figure 3. Comparison of the selected lncRNA expression levels in the validation set. The serum expression levels of MALAT1 (A) and HOTTIP (B) in the HCC group were significantly higher than those in the control group. Data on the relative expression levels of serum lncRNAs are presented after log10 transformation. **** indicates P < 0.0001.

Relationship Between the Expression Levels of Plasma lncRNAs and Clinical Variables

To further explore the value of MALAT1 and HOTTIP overexpression in HCC patients, the correlation between lncRNA expression levels and clinical variables was analyzed. Patients were categorized into high- and low-expression groups according to the median serum MALAT1 and HOTTIP levels, respectively. Clinical data were classified into positive and negative groups based on different criteria. As shown in Table 5, the expression level of MALAT1 in plasma was positively correlated with multiple tumor lesions (P = 0.005) and HCV infection (P = 0.032). Patients with high serum HOTTIP expression levels showed increased metastasis formation (P = 0.042). The metastatic status was defined as either local lymph node infiltration or distant organ involvement. There was no obvious relationship between the expression levels of the two lncRNAs and other clinical characteristics, such as sex, age, tumor size, vascular invasion, HBV infection and Child‒Pugh score. In addition, the relative expression level of MALAT1 was positively correlated with the levels of AFP (r = 0.301, P = 0.019, Figure 4A) and AST (r = 0.312, P = 0.015, Figure 4D) in 74 HCC patients. There was a slight positive correlation between the levels of ALT and MALAT1, but it was not significant (r = 0.239, P = 0.064, Figure 4C). No association between serum HOTTIP levels and biochemical variables was observed (Figure 5). Notably, the expression levels of measured lncRNAs may be affected by confounding factors such as liver disease severity, and we observed significantly higher AST values in HCC group than in controls, and a positive correlation between MALAT1 expression levels and AST. However, Child-Pugh scores, which represent liver function classes, were not found to correlate with MALAT1 and HOTTIP expression levels.Table 5. Clinicopathological Relevance Analysis of MALAT1 and HOTTIP Expression in HCC Patients.

Feature	Patients	MALAT1 (n = 74)	HOTTIP (n = 74)	
Low	High	P value	Low	High	P value	
Sex				0.790			0.790	
 Male	55	27	28		28	27		
 Female	19	10	9		9	10		
Age				0.239			0.814	
 <60	43	19	24		21	22		
 ≥60	31	18	13		16	15		
Tumor number				0.005 a			0.162	
 Solitary	40	26	14		17	23		
 Multiple	34	11	23		20	14		
Tumor size				0.099			0.099	
 <5 cm	31	19	12		12	19		
 ≥5 cm	43	18	25		25	18		
Metastasis				0.278			0.042 a	
 No	56	30	26		31	25		
 Yes	18	7	11		5	13		
Vascular invasion				0.174			0.174	
 No	64	34	30		34	30		
 Yes	10	3	7		3	7		
HbsAg				1.000			0.278	
 Negative	18	9	9		7	11		
 Positive	56	28	28		30	26		
Anti-HCV				0.032 a			0.760	
 Negative	63	34	27		30	31		
 Positive	11	3	10		7	6		
Child‒Pugh score				0.790			0.425	
 A (5-6)	55	28	27		29	26		
 B (7-9)	19	9	10		8	11		
aIndicates statistically significant, P < 0.050.

Figure 4. Correlation between serum MALAT1 and biochemical parameters in HCC patients. The expression level of MALAT1 in plasma was positively correlated with the levels of AFP (A) and AST (D). No significant relationships were found between MALAT1 and other biochemical variables (B, C, E and F).

Figure 5. Relevance analysis of plasma HOTTIP with biochemical parameters in HCC patients. No significant relationships were found between HOTTIP and biochemical variables, including AFP (A), ALB (B), ALT (C), AST (D), PT (E), and TBIL (F).

Diagnostic Value of MALAT1 and HOTTIP in HCC Detection

ROC curve analysis was conducted to evaluate the efficacy of the serum lncRNAs MALAT1 and HOTTIP as diagnostic indicators for HCC detection. As shown in Figure 6, when HCC patients were tested against healthy controls, the AUC for MALAT1 was 0.896 (95% CI: 0.848-0.945), with a sensitivity of 75.7% and specificity of 92.6% at the cutoff value of 0.0449. The AUC of plasma HOTTIP for distinguishing HCC patients from healthy controls was 0.899 (95% CI: 0.854-0.944) at the cutoff value of 0.0191 with optimal sensitivity and specificity values of 94.6% and 73.4%, respectively. AFP, as a commonly used biomarker for HCC screening, was also evaluated as the control. The AUC of AFP was 0.763 (95% CI: 0.685-0.842), with a sensitivity and specificity of 63.5% and 88.3%, respectively. The diagnostic efficacy comparison revealed that MALAT1 and HOTTIP were more effective than AFP (P < 0.010). Moreover, the combination of each lncRNA with AFP obtained a higher predictive power than AFP alone, and the merged AUC was 0.924 (95% CI: 0.881-0.967) for MALAT1 with AFP (Y = −2.403 + 22.256× MALAT1 + 0.02 × AFP) and 0.942 (95% CI: 0.909-0.976) for HOTTIP with AFP (Y = −2.37 + 17.333× HOTTIP +0.02 × AFP). In addition, the merged AUC of MALAT1 and HOTTIP increased to 0.955 (95% CI: 0.928-0.981) after analysis with the following formula: Y = −2.909 + 29.473× MALAT1 + 12.629 × HOTTIP, indicating a significantly better diagnostic efficiency than AFP alone (P < 0.001). The highest accuracy for HCC discrimination was obtained with a diagnostic panel consisting of serum MALAT1, HOTTIP, and AFP, yielding an AUC of 0.968 (95% CI: 0.945-0.991) with a sensitivity of 87.8% and specificity of 94.7% (Y = −3.6 + 22.275× MALAT1 + 13.941 × HOTTIP +0.022 × AFP). However, the panel including MALAT1, HOTTIP, and AFP did not show a significant difference compared with the combination of MALAT1 and HOTTIP (P = 0.142).Figure 6. ROC analysis of single lncRNAs and merged factors for diagnosing HCC. (A) ROC analysis of MALAT1, HOTTIP, and AFP for predicting HCC (MALAT1 vs HOTTIP P = 0.934, MALAT1 vs AFP P = 0.002, HOTTIP vs AFP P = 0.003). (B) Diagnostic efficacy of the combinations of serum lncRNAs and AFP to discriminate HCC patients from healthy controls. The diagnostic panel was established with serum MALAT1, HOTTIP, and AFP (MALAT1&HOTTIP vs MALAT1&AFP P = 0.144, MALAT1&HOTTIP vs HOTTIP&AFP P = 0.407, MALAT1&AFP vs HOTTIP&AFP P = 0.456 Panel vs MALAT1&AFP P = 0.016, Panel vs HOTTIP&AFP P = 0.029, Panel vs MALAT1&HOTTIP P = 0.142).

Prognostic Implication of Plasma MALAT1 and HOTTIP Expression in Overall Survival

OS was defined as the time from diagnosis until death or the last follow-up time, which largely represents prognosis. To investigate the predictive value of serum MALAT1 and HOTTIP, a 3-year OS analysis was conducted on 74 HCC patients by using Kaplan-Meier analysis and log-rank tests. High- and low-expression groups were divided according to the median expression levels of lncRNAs in plasma. Patients with HCC in the high serum MALAT1 expression group had significantly shorter OS (Figure 7A, P = 0.002). No significant difference in prognosis between patients with high and low expression levels of HOTTIP was observed (Figure 7B, P = 0.284).Figure 7. Cumulative survival rate according to different serum lncRNA expression levels in 74 HCC patients. (A) High serum MALAT1 expression levels result in shorter patient survival. (B) No statistically significant difference was found between the high and low serum HOTTIP expression groups.

Validation of the Predictive Role of MALAT1 and HOTTIP in Hepatocellular Carcinoma

To further explore the diagnostic and prognostic effects of MALAT1 and HOTTIP, the mRNA expression of tumor tissues from patients with hepatocellular carcinoma in TCGA (n = 152) and normal liver tissues in the GTEx dataset (n = 152) were collected as external validation. The expression levels of MALAT1 and HOTTIP were significantly higher in hepatocellular carcinoma tissues than in normal liver tissues (Figure 8A–B). Consistently, patients with hepatocellular carcinoma exhibiting high expression of MATLAT1 had significantly shorter OS, and patients exhibiting high expression of HOTTIP also had a trend towards poor prognosis, which further suggested the reliability of these two lncRNAs as screening and prognostic predictors (Figure 8C–D).Figure 8. Validation of the predictive role of MALAT1 and HOTTIP in TCGA-LIHC cohorts. (A-B) Boxplot shows the expression difference of MALAT1 and HOTTIP between HCC and adjacent normal liver tissues. (C) High expression of MALAT1 is correlated with shorter OS in HCC patients. (D) Patients with high HOTTIP expression tend to have a shorter OS.

Discussion

HCC is a common, life-threatening clinical disease with high morbidity and mortality. 22 Currently, AFP and PIVKA-II are biomarkers for HCC screening and diagnosis. However, the sensitivity and specificity are not perfect in clinic applications, particularly for early-stage HCC, resulting in only 20% of HCC patients receiving curative treatment through surgical resection, ablation treatment, or liver transplantation. 3 Therefore, it is important to find promising biomarkers for HCC to improve patient prognosis. Several lncRNAs have been reported to be highly expressed in HCC tissue, and some of them can be detected in serum. 23 However, the results from different studies are not exactly consistent. For example, significantly high levels of serum HULC, MALAT1, UCA1 and H19 in HCC patients with a comparison of healthy controls were reported by several literatures.24-27 While Li et al. reported the relative expression levels of 8 HCC-associated lncRNAs, the authors noted that high expression level of HULC was observed, low expression level of UCA1 in HCC patients was identified and no significance was demonstrated for MALAT1 in HCC patients in contrast to controls. 28 Luo et al also reported the expression level of H19 with a result of no difference between HCC and controls. 29 Therefore, identifying appropriate lncRNAs and employing them to screen and diagnose HCC still need further investigation. The present study revealed that the lncRNAs MALAT1 and HOTTIP were significantly over-expressed in the serum of HCC patients, and both of them showed a higher diagnostic value than AFP. Additionally, the combination of MALAT1, HOTTIP and AFP demonstrated the best predictive power. At present, the detection kit based on 7 microRNA combinations has been used for early diagnosis of HCC. 30 MALAT1 and HOTTIP, which are also non-coding RNAs, are expected to constitute a lncRNA panel for HCC diagnosis and prognosis in the future.

This study compared the serum lncRNA expression between patients with HCC and healthy controls, resulting in the identification of two lncRNAs as candidate biomarkers for HCC diagnosis. As a common clinical biomarker in HCC diagnosis, AFP was used as the control. The AUC of AFP in our study was similar to those in previous studies.29,31,32 Importantly, both MALAT1 and HOTTIP showed increased discriminatory power for distinguishing HCC patients from non-HCC patients, with AUCs of 0.896 and 0.899, respectively (MALAT1 vs AFP P = 0.002, HOTTIP vs AFP P = 0.003). The results indicate that MALAT1 and HOTTIP are more effective than AFP with satisfactory potential as novel biomarkers for HCC diagnosis. Moreover, we further explored the combined application of MALAT1, HOTTIP and AFP to improve the diagnostic efficacy of HCC. The panel combining MALAT1, HOTTIP and AFP achieved the best discrimination power (AUC: 0.968, 95% CI: 0.945-0.991) for HCC. Therefore, combining serum lncRNAs, including MALAT1 and HOTTIP, with AFP is of great significance for improving the identification of HCC. It is important to point out that although the AUC of the panel is larger than the AUC of the combination of MALAT1 and HOTTIP, there is no significant difference between the two formulas (Panel vs MALAT1&HOTTIP P = 0.142). After analyzing the regression coefficients of the three markers in the formula of the panel (Y = −3.6 + 22.275× MALAT1 + 13.941 × HOTTIP +0.022 × AFP), the coefficient of AFP was lower than the two lncRNAs by a large margin, indicating its limited role in the diagnosis of HCC. The regression coefficient is a parameter that represents the influence magnitude of the independent variable X on the dependent variable Y. Thus, despite the addition of the marker AFP, there was no statistical difference between the panel and the combination of MALAT1 and HOTTIP.

MALAT1, also known as metastasis-associated lung adenocarcinoma transcript 1, has a length of more than 8000 nt, is located on chromosome 11q13 and is highly conserved in multiple species. 33 Tritaphy et al showed that MALAT1 can affect the phosphorylation of the serine/arginine (SR) protein at the cellular level, thereby regulating the splicing process of pre-mRNA and playing an important role in a variety of tumor biological behaviors. 34 Here, we revealed that serum MALAT1 was significantly upregulated in HCC patients, which was consistent with previous studies.14,25 Moreover, we investigated the correlation between circulating MALAT1 and clinicopathological features of HCC patients. The high level of MALAT1 expression in plasma was positively correlated with multiple tumors and hepatitis C virus infection. Moreover, a significant association between serum MALAT1 and AFP as well as AST was observed in patients with HCC. MALAT1, one of the first lncRNAs identified, has been reported to act as an important metastasis-relevant oncogene. 35 Meta-analysis and multiomics analyses have demonstrated the upregulation of MALAT1 in HCC tissues and indicated that the overexpression of MALAT1 is significantly related to tumor number and AFP.25,36,37 However, there are few studies on the expression of MALAT1 in the plasma of patients with HCC, and the conclusions are inconsistent. Konishi et al confirmed that plasma MALAT1 levels were progressively and significantly elevated in hepatic disease as well as HCC patients and were associated with liver damage but not related to AFP. The researchers concluded that plasma MALAT1 might be derived from not only HCC tissues but also damaged hepatocytes due to hepatitis viral infection, steatosis, and other hepatic diseases. 14 Toraih et al reported that serum MALAT1 overexpression in HCV-related HCC had an AUC of 0.79 to distinguish cancer patients from healthy controls. Correlation analysis showed a positive correlation of MALAT1 with TBIL and AST. 25 Huang et al. demonstrated a significantly higher level of MALAT1 in HCC patients than in healthy controls, whereas there was no association between serum MALAT1 levels and clinicopathological characteristics. 24 Our study not only demonstrated the upregulation of serum MALAT1 in HCC patients but also confirmed the association between serum MALAT1 and clinicopathological features, including tumor number, HCV infection, AST level, and AFP level, highlighting the clinical significance of MALAT1 as a biomarker. MALAT1 could enhance cellular proliferation and inhibit apoptosis via modulating PI3K/AKT and JAK/STAT signaling pathways, upregulating LTBP3 gene, and inhibiting caspase3/7 activity. 25 The putative mechanism for MALAT1 up-regulation could be the transcriptional activation of MALAT1 via the TF specificity protein Sp1/3 in HCC cells. Zhou et al reported that MALAT1 could promote HCC metastasis through the peripheral vascular infiltration by inhibiting the level of miRNA-613, which may be the reason for a significant association of MALAT1 with multi-tumor number and elevation in AFP reported by several studies.11,36 Hepatitis C virus infection not only causes liver cell damage and elevated transaminase levels, but also is related to the occurrence of HCC. Toraih et al reported serum MALAT1 profile was positively correlated with hepatic failure scores and confirmed MALAT1 oncogenic role in HCV-induced HCC in subsequent meta-analysis. 25 Assal et al. reported MALAT1 could target CD-155/TIGIT and PD-1/PD-L1 axes, facilitating HCV-related HCC development by evading immune surveillance. 38 Shao et al indicated that MALAT1 was most likely involved in regulating HCV-related HCC processes by acting as ceRNA regulation in the hsa-miR-193a-3p/BUB1 axis and confirmed in further in vitro experiment. 39 Furthermore, the overall survival analysis with the Kaplan-Meier method showed that patients with HCC in the high serum lncRNA MALAT1 expression group had significantly shorter OS. Although the high expression levels of MALAT1 in HCC tissues have been demonstrated to be associated with poor prognosis, to the best of our knowledge, the current study is the first to report the potential of serum MALAT1 for predicting the prognosis of patients with HCC.

HOTTIP (HOXA transcript at the distal tip), known as HOXA distal tip, is a long noncoding RNA located at the 5′ end of the HOXA gene. HOTTIP can directly control the expression of the HOXA gene by interacting with the WDR5/MLL complex and is associated with metastasis formation and poor patient survival in HCC. 40 Previous studies have shown that HOTTIP, an oncogene, is highly expressed in liver cancer tissues, 20 and several studies have shown that HOTTIP is abnormally expressed in the serum of patients with various tumors, including pancreatic, esophageal, gastric, and colorectal cancer.41-44 However, the serum expression of HOTTIP in HCC is rarely reported. In the present study, we identified that the serum expression of HOTTIP in HCC patients was significantly higher than that in healthy controls and had a better diagnostic efficacy than AFP. Clinicopathological feature analysis showed that abnormal expression of HOTTIP was positively associated with distant metastasis in HCC patients, which was consistent with previous studies.20,40 Tsang et al concluded that HOTTIP could be a novel oncogenic lncRNA, which negatively regulated by miR-125b and might cis-regulate the expression of its neighboring genes residing in the HOXA cluster in HCC and thereby contribute to hepatocarcinogenesis. In addition, knock-down of HOTTIP also inhibited migratory ability of HCC cells and significantly abrogated lung metastasis in orthotopic implantation model in nude mice. This may be a potential mechanism for the association between lncRNA HOTTIP expression and clinical variables. 20 The high expression level of HOTTIP in HCC tissues has been also reported as a candidate biomarker for predicting poor prognosis in HCC patients.40,45 However, we did not observe any associations between serum HOTTIP and biochemical parameters or overall survival. The possible reasons may be the lower expression level of HOTTIP in serum than that in HCC tissues and the short follow-up period in the present study.

There are several limitations to the current study. First, the experiment contains a relatively limited sample size and is a single-center study. The sample size of this study is composed of consecutively collected cases, rather than sample size calculation. However, we conducted a sample size justification in the validation set, using the results of the training set. On the other hand, HCC is a heterogeneous disease, and the expression level of the same gene may be variable in different populations. Thus, large-scale and multicenter studies are recommended to evaluate the diagnostic and prognostic potential of lncRNAs in further investigations. Second, apart from AFP, PIVKA-II is also a common clinical biomarker for HCC. The comparison of the diagnostic value of lncRNAs with PIVKA-II warrants further research. Third, no HCC tissue or adjacent noncancerous liver tissue samples were obtained. A comprehensive transcriptome analysis of tissue and serum from HCC patients showed a correlation in ncRNAs between serum and tissue samples, suggesting that noncoding RNA export from tumors. 46 Although the majority of studies have reported that MALAT111,34,47-49 and HOTTIP20,40,45,50,51 are highly expressed in HCC tissues and validated by public databases, the expression levels of the target genes in tissues were not verified in the present study. In addition, since the GAPDH expression level is usually not affected under experimental or physiological conditions, 52 GAPDH is widely used as an internal control in numerous similar studies. 53 However, it is worth noting that there is no “one-size-fits-all” gene that can be used for the normalization of gene expression data. Therefore, some scholars proposed that gene expression analysis should be related to several housekeepers in parallel. 54 Finally, we paid more attention to lncRNAs acting as novel biomarkers of HCC in this study, and in vivo and in vitro experiments are recommended to explore the functional role of MALAT1 and HOTTIP in HCC development in the future.

Conclusion

In summary, we identified that the serum lncRNAs MALAT1 and HOTTIP were significantly highly expressed in patients with HCC and exhibited a better diagnostic value for HCC than the traditional biomarker AFP. High levels of lncRNA expression were associated with clinical features and poor prognosis of HCC patients, showing potential as noninvasive biomarkers for the diagnosis and prognosis of HCC. Additionally, the combination of MALAT1, HOTTIP and AFP could provide a better diagnostic accuracy, and MALAT1 and HOTTIP play a major role in the diagnostic panel.

Acknowledgments

We thank openbiox community and Hiplot team (https://hiplot.org) for providing technical assistance and valuable tools for data analysis and visualization. We also thank AJE for English editing.

Ethical Statement

Ethical Approval

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Ethics Committee of The First Hospital of China Medical University (protocol code 2018-215-2).

Consent to Participate

Informed consent was obtained from all subjects involved in the study.

ORCID iD

Han Bao https://orcid.org/0000-0002-1972-2148

Data Availability Statement

The datasets generated and/or analyzed during this current study are not publicly available due to privacy or ethical restrictions but are available from the corresponding author upon reasonable request.*

Authors’ Contributions: HB performed the experiments and drafted the manuscript. YTJ and NW analyzed and interpreted the data. HYS conceived and designed the project. XJH revised the manuscript. All authors have read and approved the final manuscript.

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding: The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the Special Funds for Science and Technology Innovation of Shenyang (Grant no. F15-199-1-43), and the National Natural Science Foundation of China (Grant no. 81901846).
==== Refs
References

1 Omata M Cheng AL Kokudo N , et al. Asia-Pacific clinical practice guidelines on the management of hepatocellular carcinoma: a 2017 update. Hepatol Int. 2017;11 (4 ):317-370. doi:10.1007/s12072-017-9799-9 28620797
2 Kulik L El-Serag HB . Epidemiology and management of hepatocellular carcinoma. Gastroenterology. 2019;156 (2 ):477-491. doi:10.1053/j.gastro.2018.08.065 30367835
3 Luo P Yin P Hua R , et al. A Large-scale, multicenter serum metabolite biomarker identification study for the early detection of hepatocellular carcinoma. Hepatology. 2018;67 (2 ):662-675. doi:10.1002/hep.29561 28960374
4 Perne MG Sitar-Taut AV Alexescu TG , et al. Diagnostic performance of extrahepatic protein induced by vitamin K absence in the hepatocellular carcinoma: a systematic review and meta-analysis. Diagnostics. 2023;13 (5 ):816. doi:10.3390/diagnostics13050816 36899960
5 Fu Y Wei X Han Q , et al. Identification and characterization of a 25-lncRNA prognostic signature for early recurrence in hepatocellular carcinoma. BMC Cancer. 2021;21 (1 ):1165. doi:10.1186/s12885-021-08827-z 34717566
6 Chen Y Huang F Deng L , et al. Long non-coding RNA TGLC15 advances hepatocellular carcinoma by stabilizing Sox4. J Clin Lab Anal. 2020;34 (1 ):e23009. doi:10.1002/jcla.23009 31495979
7 Qian X Li S Yang Z Zhang J . The long non-coding RNA HLNC1 potentiates hepatocellular carcinoma progression via interaction with USP49. J Clin Lab Anal. 2020;34 (11 ):e23462. doi:10.1002/jcla.23462 32691951
8 Tian X Wu Y Yang Y , et al. Long noncoding RNA LINC00662 promotes M2 macrophage polarization and hepatocellular carcinoma progression via activating Wnt/β-catenin signaling. Mol Oncol. 2020;14 (2 ):462-483. doi:10.1002/1878-0261.12606 31785055
9 Yang Z Zhou L Wu LM , et al. Overexpression of long non-coding RNA HOTAIR predicts tumor recurrence in hepatocellular carcinoma patients following liver transplantation. Ann Surg Oncol. 2011;18 (5 ):1243-1250. doi:10.1245/s10434-011-1581-y 21327457
10 Ding C Yang Z Lv Z , et al. Long non-coding RNA PVT1 is associated with tumor progression and predicts recurrence in hepatocellular carcinoma patients. Oncol Lett. 2015;9 (2 ):955-963. doi:10.3892/ol.2014.2730 25624916
11 Lai MC Yang Z Zhou L , et al. Long non-coding RNA MALAT-1 overexpression predicts tumor recurrence of hepatocellular carcinoma after liver transplantation. Med Oncol. 2012;29 (3 ):1810-1816. doi:10.1007/s12032-011-0004-z 21678027
12 Liu J Wang J Song Y , et al. A panel consisting of three novel circulating lncRNAs, is it a predictive tool for gastric cancer? J Cell Mol Med. 2018;22 (7 ):3605-3613. doi:10.1111/jcmm.13640 29700972
13 McShane LM Altman DG Sauerbrei W , et al. REporting recommendations for tumour MARKer prognostic studies (REMARK). Br J Cancer. 2005;93 (4 ):387-391. doi:10.1038/sj.bjc.6602678 16106245
14 Konishi H Ichikawa D Yamamoto Y , et al. Plasma level of metastasis-associated lung adenocarcinoma transcript 1 is associated with liver damage and predicts development of hepatocellular carcinoma. Cancer Sci. 2016;107 (2 ):149-154. doi:10.1111/cas.12854 26614531
15 Yang L Zhang X Li H Liu J . The long noncoding RNA HOTAIR activates autophagy by upregulating ATG3 and ATG7 in hepatocellular carcinoma. Mol Biosyst. 2016;12 (8 ):2605-2612. doi:10.1039/c6mb00114a 27301338
16 Shi Y Song Q Yu S Hu D Zhuang X . Microvascular invasion in hepatocellular carcinoma overexpression promotes cell proliferation and inhibits cell apoptosis of hepatocellular carcinoma via inhibiting miR-199a expression. OncoTargets Ther. 2015;8 :2303-2310. doi:10.2147/OTT.S86807
17 Wang F Ying HQ He BS , et al. Upregulated lncRNA-UCA1 contributes to progression of hepatocellular carcinoma through inhibition of miR-216b and activation of FGFR1/ERK signaling pathway. Oncotarget. 2015;6 (10 ):7899-7917.25760077
18 Xu WH Zhang JB Dang Z , et al. Long non-coding RNA URHC regulates cell proliferation and apoptosis via ZAK through the ERK/MAPK signaling pathway in hepatocellular carcinoma. Int J Biol Sci. 2014;10 (7 ):664-676. doi:10.7150/ijbs.8232 25013376
19 Lv J Ma L Chen XL Huang XH Wang Q . Downregulation of LncRNAH19 and MiR-675 promotes migration and invasion of human hepatocellular carcinoma cells through AKT/GSK-3β/Cdc25A signaling pathway. J Huazhong Univ Sci Technolog Med Sci. 2014;34 (3 ):363-369. doi:10.1007/s11596-014-1284-2 24939300
20 Tsang FH Au SL Wei L , et al. Long non-coding RNA HOTTIP is frequently up-regulated in hepatocellular carcinoma and is targeted by tumour suppressive miR-125b. Liver Int. 2015;35 (5 ):1597-1606. doi:10.1111/liv.12746 25424744
21 Yang F Zhang L Huo XS , et al. Long noncoding RNA high expression in hepatocellular carcinoma facilitates tumor growth through enhancer of zeste homolog 2 in humans. Hepatology. 2011;54 (5 ):1679-1689. doi:10.1002/hep.24563 21769904
22 Torre LA Bray F Siegel RL Ferlay J Lortet-Tieulent J Jemal A . Global cancer statistics, 2012. Ca - Cancer J Clin. 2015;65 (2 ):87-108. doi:10.3322/caac.21262 25651787
23 Bao H Su H . Long noncoding RNAs act as novel biomarkers for hepatocellular carcinoma: progress and prospects. BioMed Res Int. 2017;2017 :6049480. doi:10.1155/2017/6049480 28835896
24 Huang J Zheng Y Xiao X , et al. A circulating long noncoding RNA panel serves as a diagnostic marker for hepatocellular carcinoma. Dis Markers. 2020;2020 :5417598. doi:10.1155/2020/5417598 32733618
25 Toraih EA Ellawindy A Fala SY , et al. Oncogenic long noncoding RNA MALAT1 and HCV-related hepatocellular carcinoma. Biomed Pharmacother. 2018;102 :653-669. doi:10.1016/j.biopha.2018.03.105 29604585
26 Kamel MM Matboli M Sallam M Montasser IF Saad AS El-Tawdi AHF . Investigation of long noncoding RNAs expression profile as potential serum biomarkers in patients with hepatocellular carcinoma. Transl Res. 2016;168 :134-145. doi:10.1016/j.trsl.2015.10.002 26551349
27 Rojas A Gil-Gomez A de la Cruz-Ojeda P , et al. Long non-coding RNA H19 as a biomarker for hepatocellular carcinoma. Liver Int. 2022;42 (6 ):1410-1422. doi:10.1111/liv.15230 35243752
28 Li J Wang X Tang J , et al. HULC and Linc00152 act as novel biomarkers in predicting diagnosis of hepatocellular carcinoma. Cell Physiol Biochem. 2015;37 (2 ):687-696. doi:10.1159/000430387 26356260
29 Luo P Liang C Zhang X , et al. Identification of long non-coding RNA ZFAS1 as a novel biomarker for diagnosis of HCC. Biosci Rep. 2018;38 (4 ):BSR2017135. doi:10.1042/BSR20171359
30 Zhou J Yu L Gao X , et al. Plasma microRNA panel to diagnose hepatitis B virus-related hepatocellular carcinoma. J Clin Oncol. 2011;29 (36 ):4781-4788. doi:10.1200/JCO.2011.38.2697 22105822
31 Park SJ Jang JY Jeong SW , et al. Usefulness of AFP, AFP-L3, and PIVKA-II, and their combinations in diagnosing hepatocellular carcinoma. Medicine (Baltim). 2017;96 (11 ):e5811. doi:10.1097/MD.0000000000005811
32 Pang BY Leng Y Wang X Wang YQ Jiang LH . A meta-analysis and of clinical values of 11 blood biomarkers, such as AFP, DCP, and GP73 for diagnosis of hepatocellular carcinoma. Ann Med. 2023;55 (1 ):42-61. doi:10.1080/07853890.2022.2153163 36476015
33 Lei L Chen J Huang J , et al. Functions and regulatory mechanisms of metastasis-associated lung adenocarcinoma transcript 1. J Cell Physiol. 2018;234 (1 ):134-151. doi:10.1002/jcp.26759 30132842
34 Tripathi V Ellis JD Shen Z , et al. The nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation. Mol Cell. 2010;39 (6 ):925-938. doi:10.1016/j.molcel.2010.08.011 20797886
35 Sun Y Ma L . New insights into long non-coding RNA MALAT1 in cancer and metastasis. Cancers. 2019;11 (2 ):216. doi:10.3390/cancers11020216 30781877
36 Li JJ Yang H Cai XY Huang YB Luo DZ . Clinical value and function of lncRNA MALAT1 in hepatocellular carcinoma: a comprehensive study with original detection, meta-analysis and in vitro verification. Int J Clin Exp Pathol. 2016;9 (8 ):7982-7994.
37 Liao X Chen J Luo D Luo B Huang W Xie W . Prognostic value of long non-coding RNA MALAT1 in hepatocellular carcinoma: a study based on multi-omics analysis and RT-PCR validation. Pathol Oncol Res. 2022;28 :1610808. doi:10.3389/pore.2022.1610808 36685103
38 Assal RA Elemam NM Mekky RY , et al. A novel epigenetic strategy to concurrently block immune checkpoints PD-1/PD-L1 and CD155/TIGIT in hepatocellular carcinoma. Transl Oncol. 2024;45 :101961. doi:10.1016/j.tranon.2024.101961 38631259
39 Shao L Liang L Fang Q Wang J . Construction of novel lncRNA-miRNA-mRNA ceRNA networks associated with prognosis of hepatitis C virus related hepatocellular carcinoma. Heliyon. 2022;8 (10 ):e10832. doi:10.1016/j.heliyon.2022.e10832 36217480
40 Quagliata L Matter MS Piscuoglio S , et al. Long noncoding RNA HOTTIP/HOXA13 expression is associated with disease progression and predicts outcome in hepatocellular carcinoma patients. Hepatology. 2014;59 (3 ):911-923. doi:10.1002/hep.26740 24114970
41 Wang Y Li Z Zheng S , et al. Expression profile of long non-coding RNAs in pancreatic cancer and their clinical significance as biomarkers. Oncotarget. 2015;6 (34 ):35684-35698.26447755
42 Li Y Liu Y Chen G , et al. HOTTIP is upregulated in esophageal cancer and triggers the drug resistance. J BUON. 2021;26 (3 ):1056-1061.34268972
43 Zhao R Zhang Y Zhang X , et al. Exosomal long noncoding RNA HOTTIP as potential novel diagnostic and prognostic biomarker test for gastric cancer. Mol Cancer. 2018;17 (1 ):68. doi:10.1186/s12943-018-0817-x 29486794
44 Ali Akbar-Esfahani S Karimipoor M Bahreini F Soltania AR Aletaha N Mahdavinezhad A . Diagnostic value of plasma long non-coding RNA HOTTIP as a non-invasive biomarker for colorectal cancer (A case- control study). Int J Mol cell med. 2019;8 (4 ):240-247.32587834
45 Wu L Yang Z Zhang J Xie H Zhou L Zheng S . Long noncoding RNA HOTTIP expression predicts tumor recurrence in hepatocellular carcinoma patients following liver transplantation. Hepatobiliary Surg Nutr. 2018;7 (6 ):429-439.30652087
46 Mjelle R Dima SO Bacalbasa N , et al. Comprehensive transcriptomic analyses of tissue, serum, and serum exosomes from hepatocellular carcinoma patients. BMC Cancer. 2019;19 (1 ):1007. doi:10.1186/s12885-019-6249-1 31660891
47 Luo F Sun B Li H , et al. A MALAT1/HIF-2α feedback loop contributes to arsenite carcinogenesis. Oncotarget. 2016;7 (5 ):5769-5787.26735578
48 Zhao Y Zhou L Li H , et al. Nuclear-encoded lncRNA MALAT1 epigenetically controls metabolic reprogramming in HCC cells through the mitophagy pathway. Mol Ther Nucleic Acids. 2021;23 :264-276. doi:10.1016/j.omtn.2020.09.040 33425485
49 Malakar P Shilo A Mogilevsky A , et al. Long noncoding RNA MALAT1 promotes hepatocellular carcinoma development by SRSF1 upregulation and mTOR activation. Cancer Res. 2017;77 (5 ):1155-1167. doi:10.1158/0008-5472.CAN-16-1508 27993818
50 Ge Y Yan X Jin Y , et al. MiRNA-192 [corrected] and miRNA-204 directly suppress lncRNA HOTTIP and interrupt GLS1-mediated glutaminolysis in hepatocellular carcinoma. PLoS Genet. 2015;11 (12 ):e1005726. doi:10.1371/journal.pgen.1005726 26710269
51 Wei H Xu Z Chen L , et al. Long non-coding RNA PAARH promotes hepatocellular carcinoma progression and angiogenesis via upregulating HOTTIP and activating HIF-1α/VEGF signaling. Cell Death Dis. 2022;13 (2 ):102. doi:10.1038/s41419-022-04505-5 35110549
52 Wang J Yu X Cao X , et al. GAPDH: a common housekeeping gene with an oncogenic role in pan-cancer. Comput Struct Biotechnol J. 2023;21 :4056-4069. doi:10.1016/j.csbj.2023.07.034 37664172
53 Lumkul L Jantaree P Jaisamak K , et al. Combinatorial gene expression profiling of serum HULC, HOTAIR, and UCA1 lncRNAs to differentiate hepatocellular carcinoma from liver diseases: a systematic review and meta-analysis. Int J Mol Sci. 2024;25 (2 ):1258. doi:10.3390/ijms25021258 38279264
54 Barber RD Harmer DW Coleman RA Clark BJ . GAPDH as a housekeeping gene: analysis of GAPDH mRNA expression in a panel of 72 human tissues. Physiol Genom. 2005;21 (3 ):389-395. doi:10.1152/physiolgenomics.00025.2005
