
==== Front
Mol Genet Genomic Med
Mol Genet Genomic Med
10.1002/(ISSN)2324-9269
MGG3
Molecular Genetics & Genomic Medicine
2324-9269
John Wiley and Sons Inc. Hoboken

10.1002/mgg3.70009
MGG370009
MGG3-2024-06-0677.R1
Original Article
Original Article
Clinical Characteristics, Genetic Analysis, and Literature Review of Cornelia de Lange Syndrome Type 4 Associated With a RAD21 Variant
Yue Xinyu https://orcid.org/0009-0005-3296-0473
13061480773@163.com

1
Chen Meiping https://orcid.org/0000-0003-1998-9915
1
Ke Xiaoan 1
Yang Hongbo 1
Gong Fengying 1
Wang Linjie 1
Duan Lian 1
Pan Hui 1
Zhu Huijuan https://orcid.org/0000-0001-5172-6870
1 shengxin2004@163.com

1 Key Laboratory of Endocrinology of National Health Commission, Department of Endocrinology, State Key Laboratory of Complex Severe and Rare Diseases Peking Union Medical College Hospital, Chinese Academy of Medical Science and Peking Union Medical College Beijing China
* Correspondence:
Huijuan Zhu (shengxin2004@163.com)

17 9 2024
9 2024
12 9 10.1002/mgg3.v12.9 e7000913 8 2024
03 6 2024
27 8 2024
© 2024 The Author(s). Molecular Genetics & Genomic Medicine published by Wiley Periodicals LLC.
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by-nc-nd/4.0/ License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made.

ABSTRACT

Background

Cornelia de Lange syndrome (CdLS) is an uncommon congenital developmental disorder distinguished by intellectual disorder and distinctive facial characteristics, with a minority of cases attributed to RAD21 variants.

Methods

A patient was admitted to the endocrinology department at Peking Union Medical College Hospital, where 2 mL of peripheral venous blood was collected from the patient and his parents. DNA was extracted for whole‐exome sequencing (WES) analysis, and the genetic variation of the parents was confirmed through Sanger sequencing.

Results

A 13.3‐year‐old male patient with a height of 136.5 cm (−3.5 SDS) and a weight of 28.4 kg (−3.1 SDS) was found to have typical craniofacial features. WES revealed a pathogenic variant c.1143G>A (p.Trp381*) in the RAD21 gene. He was diagnosed with CdLS type 4 (OMIM #614701). We reviewed 36 patients with CdLS related to RAD21 gene variants reported worldwide from May 2012 to March 2024. Patient's variant status, clinical characteristics, and rhGH treatment response were summarized. Frameshift variants constituted the predominant variant type, representing 36% (13/36) of cases. Clinical features included verbal developmental delay and intellectual disorder observed in 94% of patients.

Conclusion

This study reported the third case of CdLS type 4 in China caused by a RAD21 gene variant, enriching the genetic mutational spectrum.

Whole exome sequencing revealed a pathogenic variant c.1143G>A (p.Trp381*) in the RAD21 gene. We reviewed 36 patients with CdLS related to RAD21 gene variants reported worldwide. Frameshift variants constituted the predominant variant type, representing 36% (13/36) of cases.

Cornelia de Lange syndrome type 4
RAD21
short stature
whole‐exome sequencing
CAMS Innovation Fund for Medical SciencesCIFMS 2021‐I2M‐1‐003 source-schema-version-number2.0
cover-dateSeptember 2024
details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.4.8 mode:remove_FC converted:17.09.2024
Funding: This research was funded by the CAMS Innovation Fund for Medical Sciences (CIFMS 2021‐I2M‐1‐003). And the funding agency is Chinese Academy of Medical Science and Peking Union Medical College.
==== Body
pmc1 Introduction

Cornelia de Lange syndrome (CdLS; Online Mendelian Inheritance in Man #122470, 300590, 610759, 614701, 300882, 620568), also known as Brachmann‐de Lange syndrome, is a rare genetic disorder affecting multiple organs (Liu and Krantz 2008). This complex condition is distinguished by facial dysmorphism, including arched eyebrows with synophrys, a long philtrum, thin upper lips, and a hairy forehead. Moreover, individuals with CdLS experience prenatal and postnatal growth retardation, a range of cognitive impairments, digestive system abnormalities, heart defects, and limb malformations (Kline, Grados, et al. 2018). CdLS is a rare disease with a prevalence ranging from 1:30,000 to 1:10,000 live births with no variations seen among different ethnicities (Kline, Grados, et al. 2007).

CdLS originates from variants in seven specific genes: NIPBL, SMC1A, SMC3, RAD21, HDAC8, BRD4, and ANKRD11. Five of them encode products that possess either structural or regulatory functions within the cohesin complex (Ng et al. 2024). Notably, NIPBL, SMC3, RAD21, BRD4, and ANKRD11 exhibit autosomal dominant inheritance patterns, whereas SMC1A and HDAC8 follow an X‐linked inheritance pattern (Kline et al. 2018).

Through whole‐exome sequencing (WES), the investigation into additional factors contributing to CdLS has yielded the identification of variants in multiple genes. Within the CdLS spectrum, individuals may exhibit the classic CdLS phenotype, with or without the presence of a pathogenic variant in a cohesin functioning gene (in cases lacking molecular confirmation, clinical diagnosis remains feasible). Additionally, individuals with a non‐classic CdLS phenotype may possess a pathogenic variant in a gene relevant to cohesin function (Shangguan and Chen 2022).The identification of genetic variants in non‐cohesin genes has greatly broadened the range of genotypic and phenotypic characteristics observed in CdLS.

RAD21 gene is situated at 24.11 (8q24.11) on the long arm (q) of chromosome 8 (McKay et al. 1996), and its molecular position spread from 117858173 to 117887015, as documented by the National Center for Biotechnology Information (NCBI). This gene encompasses a total of 28,843 bases, comprising 13 exons responsible for protein coding and 12 introns. The transcription process spans a length of 3660 base pairs (bps), while the translation process results in the production of 631 amino acid (aa) residues.

The analysis of sequence similarity reveals that human RAD21 protein exhibits 96% and 25% similarity with mouse and yeast proteins, respectively (McKay et al. 1996). The N‐terminus (NT) and C‐terminus (CT) sections of RAD21 show the most conservation, as they interact with SMC3 and SMC1, respectively. Additionally, the STAG domain within the middle of RAD21 displays conservation when combined with STAG. Afterward, RAD21 interacts with V‐type SMC1 and SMC3 heterodimers to create a tripartite ring‐like structure, followed by the recruitment of STAG. These four subunit complexes collectively constitute the cohesin complex. The primary role of RAD21 entails the establishment and dissolution of cohesion between sister chromatids. Additionally, RAD21 is involved in various other processes such as DNA damage repair, transcriptional regulation, DNA replication, and centrosome biogenesis. When a variant in RAD21 hinders its proper functioning, it elevates the likelihood of disease manifestation (Cheng, Zhang, and Pati 2020).

This study presented a case of CdLS type 4 and provided a comprehensive summary of all reported cases with detailed clinical information caused by RAD21 variants. The aim is to summarize the genotypes and clinical phenotypes of CdLS type 4 patients, in order to facilitate further investigation into this rare disorder and to emphasize the importance of prognostic considerations.

2 Patient and Methods

2.1 Patient

A 13.3‐year‐old male patient was admitted to the endocrinology department of Peking Union Medical College Hospital presenting with the chief complaint of “short stature.” Following the standard assessment of thyroid function, growth hormone levels, sex hormone levels, pituitary MR imaging and bone age, the proband underwent WES. The findings indicated the existence of a disease‐causing variant in RAD21, resulting in the identification of CdLS. The patient's parents gave their consent for participation in the study, which was approved by the Ethics Committee of Peking Union Medical College Hospital (I‐22PJ1122) and followed the guidelines of the Helsinki Declaration.

2.2 WES After DNA Extraction

The experimental procedure for WES of the patient is detailed in the supplementary material. We employed online prediction programs, namely PolyPhen‐2, MutationTaster, and SIFT, to forecast the pathogenicity of variants. The pathogenicity of variants was determined in accordance with the guidelines established by the American College of Medical Genetics and Genomics (ACMG) (Richards et al. 2015).

The raw sequence data reported in this paper have been deposited in the Genome Sequence Archive in National Genomics Data Center (GSA‐Human: HRA008168) that are publicly accessible at https://ngdc.cncb.ac.cn/gsa‐human.

2.3 Confirming the RAD21 Pathogenic Variant Using Sanger Sequencing

The RAD21 reference sequence (NC_000008.10) was obtained from NCBI. A primer for a RAD21 variant in exon 9 was designed using the online tool Primer BLAST. The forward and reverse primers for the RAD21 (c.1143G>A) gene variant were designed as 5'‐TGAATGCCCGTTGTGTTCCA‐3′ and 5'‐AGAAAATGTGCCATACAGTTGC‐3′, respectively.

The polymerase chain reaction (PCR) system for amplification consisted of 10 μL of Taq SuperMix (2X buffer, Taq DNA polymerase, dNTPs), 3 μL of double distilled water, 5 μL of Genomic DNA, and 1 μL each of the forward and reverse primers at a concentration of 10 μmol/L. The cycling process began with an initial denaturation phase at 94°C lasting 4 min, then proceeded with 35 cycles of denaturation at 94°C for 30 s, annealing at the suitable temperature for 30 s, and extension at 72°C for 30 s. This was followed by a final extension step at 72°C for 4 min, and the samples were then stored at 4°C.

2.4 Literature Review and Statistical Analysis

From May 2012 to March 2024, the clinical presentation, genetic outcome, and treatment follow‐up data pertaining to CdLS type 4 were gathered from various databases such as PubMed, Web of Science, Google Scholar, and China National Knowledge Infrastructure (CNKI). The search was conducted using the terms “RAD21 gene variant” and “CdLS Type 4.” The criteria for inclusion and exclusion in the study were as follows: (a) All participants in the study possessed a verified genetic diagnosis; (b) individuals lacking accessible clinical data were omitted from the analysis, (c) participants with alternative genetic conditions were also excluded from the study, and (d) according to the clinical diagnostic criteria proposed by international consensus, patients with scores less than four were excluded. A thorough examination of the identified literature was conducted to ensure the inclusion of all pertinent information (Abarca‐Barriga, Punil Luciano, and Vásquez Sotomayor 2023; De Falco et al. 2023; Dorval et al. 2020; Goel and Parasivam 2020; Gudmundsson et al. 2019; Kaur et al. 2023; Krab et al. 2020; Li et al. 2020; Shangguan et al. 2024). The collected data were subsequently summarized and analyzed employing SPSS 27.0.

3 Results

3.1 Case Report

A 13.3‐year‐old boy was admitted to our hospital with a height below −2 SDS and a special facial appearance. The patient's birth weight measured 2.8 kg, equivalent to −1.9 standard deviation score (SDS), while his birth length measured 48 cm, corresponding to −1.7 SDS. This patient demonstrated delayed verbal development, commencing speech at the age of 2.1. Upon reaching the age of 5, the patient's vision was found to be impaired, with a binocular vision of 0.6/0.8, which could be corrected to 1.0. The patient received a diagnosis of amblyopia and astigmatism from an external hospital. The patient was diagnosed with enuresis in childhood. Currently, the frequency of enuresis episodes has reduced to approximately once a month. At the age of 7, the patient was diagnosed with short stature. He was diagnosed with growth hormone deficiency (GHD) after the levodopa (L‐dopa) and insulin hypoglycemic growth hormone stimulation test revealed GH peak values of 3.55 and 4.5 ng/mL, respectively. Additionally, his insulin‐like growth factor‐1 (IGF‐1) level was 188 ng/mL (reference range: 143–506).

At the age of 13.3, he was hospitalized in our hospital for treatment. The patient's hand bone age was approximately equivalent to 10 years old (Figure 1B). The physical examination results of the patient showed a height of 136.5 cm (−3.5 SDS), a weight of 28.4 kg (−3.1 SDS). And his head circumference was 48 cm (<−3 SDS). Figure 1A displays the patient's growth curve. He had a low hairline, hirsutism, thick eyebrows, arched eyebrows, synophrys, thick and black eyelashes, thin upper lip, short 5th fingers in both hands, upturned nasal tip, and a single palmar crease on his right hand. There were no obvious abnormalities of the spine and limbs, and there were no abnormalities in the physical examination of the heart, lungs, and abdomen. The patient had 3 mL testicles and 3 cm penis length. And the patient showed relevant signs of CdLS. His sexual hormone levels showed abnormalities and were detected as testosterone 0.64 ng/mL (reference range: 1.75–7.81), FSH 6.45 IU/L (reference range: 1.27–19.26), and LH 1.54 IU/L (reference range: 1.24–8.62). The results of the GnRH excitation experiment showed that the gonadal axis was activated. The initial dose of 3 U/day was given and recombinant human growth hormone (rhGH) was administered subcutaneously 30 min before bedtime. Following a 6‐month treatment period, the individual experienced 5.5 cm growth in height.

FIGURE 1 Detailed records of the patient's clinical materials and family diagram. (A) Growth curve chart of our patient. The arrow indicates that the patient has been receiving rhGH treatment since the age of 13.3. (B) Bone‐age radiograph showed a bone development equivalent to a 10‐year‐old, despite the patient's actual age being 13.3 years. (C) Family pedigree of our patient.

The parents or grandparents of the patient denied a blood relationship. The patient's mother, who measured 150 cm in height (−2 SDS), also showed short stature. Additionally, she perceived herself to possess thick eyebrows, increased hair, and abnormalities in genetic testing. The patient's mother has two sisters, one measuring 150 cm in height (−2 SDS) and the other measuring 158 cm (−0.5 SDS) (Figure 1C). And the shorter sister has two daughters who exhibited hirsutism and thick eyebrows, but both had normal height. The patient's maternal grandfather had a height of 167 cm (−1.0 SDS) and exhibited a low hairline, thick eyebrows, and hirsutism. The uncle of the patient's mother had a height of 168 cm (−0.8 SDS) and exhibited hirsutism. The patient's father was 172 cm tall (+1 SDS) and the genetic test did not reveal any abnormalities. The patient and his relatives had normal intellectual development.

3.2 Evaluation of Genetic Results

The proband's chromosome karyotype was determined to be normal (46, XY). Subsequent WES analysis revealed the presence of a pathogenic variant in exon 9 of the RAD21 gene: NM_006265.2:c.1143G>A (p.Trp381*) (Figure 2A). This is a heterozygous variant as well as a nonsense variant which causes CdLS type 4. Following the acquisition of the proband's genetic findings, the variant sites of his parents were subsequently analyzed. The findings from the Sanger sequencing of the RAD21 gene revealed that the paternal lineage did not exhibit the identified variant in RAD21 (Figure 2C), whereas the maternal lineage displayed the same pathogenic variant in exon 9 of the RAD21 gene (Figure 2B). This is a heterozygous variant as well as a nonsense variant. It is consistent with the autosomal dominant (AD) genetic pattern.

FIGURE 2 Sanger sequencing results for the proband and his parents. (A) The RAD21 of the proband exhibited a heterozygous variant at position c.1143G>A (p.Trp381*). (B) The RAD21 of the proband's mother displayed a heterozygous variant at position c.1143G>A (p.Trp381*). (C) The locus of the proband's father remained unaffected. Variant sites are indicated by arrows.

This variant was classified as pathogenic (P) based on ACMG. The evidence was as follows: PVS1_Strong: truncating variant; PM2: ExAC, gnomAD, 1000 person genome project, and ClinVar database were not found in the normal control population; PP1: This variant was detected in multiple patients in this family; PP3: Bioinformatics function predicted pathogenicity; PP4: The phenotype of the proband was highly consistent with a single genetic disease. In summary, the current rating was PVS1_Strong+PM2 + PP1 + PP3 + PP4 = P.

3.3 Literature Review

The OMIM website provides information indicating that CdLS is classified into six different types depending on specific pathogenic genes, which are NIPBL, SMC1A, SMC3, RAD21, HDAC8, and BRD4. Over 60% of people with this syndrome exhibit pathogenic variants in the NIPBL. According to Muto et al. (2014), the presence of NIPBL protein was essential for the attachment of cohesin to chromosomes. CdLS type 2 was caused by SMC1A variants, accounting for approximately 5% of CdLS (Huisman et al. 2017). As of May 2022, a search of the HGMD database identified 131 SMC1A variants and 81 SMC1A variants were found to be associated with CdLS type 2. From May 2012 to March 2024, a total of 36 cases of CdLS with confirmed RAD21 variants were reported (Table 2). These cases encompassed comprehensive clinical information, such as gender and age, with the exception of a 4‐year‐old patient whose gender remained unidentified (Lee et al. 2014).

3.4 Clinical Characteristics of Patients With CdLS Type 4

In accordance with the recent international consensus on diagnosing and treating Cornelia de Lange syndrome, individuals showing signs of CdLS should undergo assessment based on their clinical features. Patients with a clinical feature score less than 4 are not diagnosed with CdLS and do not meet the molecular detection criteria (Kline et al. 2018). Therefore, some patients with insufficient clinical data score less than 4 were not included in the scope of this study's statistics (Kruszka et al. 2019). None of the patients were born into a consanguineous family. In 35 cases with gender records, there were slightly more males than females with a ratio of 1.1 (18 males and 17 females). Among the 34 patients with definite age, their age at diagnosis was 6.0 (18.3–2.8) years (range, 1.0–61.0 years). The age distribution at the time of diagnosis was as follows: 19 of 34 were between 3 and 18 years old (55.9%), 8 of 34 were adults (23.5%), and 7 of 34 were infants (20.6%) with their ages ranging from 1 to 3 years old.

Intrauterine growth retardation (IUGR) is defined as a condition where the birth weight is below the 10th percentile of the same gestational age. IUGR was the most common fetal characteristic of CdLS. It is recommended to use the growth curve of CdLS children for physical evaluation (Kline et al. 2018). However, only 7 of 36 cases had complete records of birth height and birth weight, and 3 of them had characteristics of IUGR. Among the 29 cases without complete records of birth height or birth weight, 3 cases showed characteristics of IUGR. As defined in the WHO Growth Standards https://www.who.int/tools/child‐growth‐standards/standards/weight‐for‐age, the birth height and weight of the case in our center was around the 15th percentile. Among the 32 cases with height records at the time of diagnosis, 16 had a height of less than −2 SDS and could be diagnosed as “Short stature” (50%).

The frequency of clinical features for 36 patients is listed in Table 1. The clinical phenotypes listed in Table 1 were summarized from the international consensus on diagnosing and treating CdLS (Kline et al. 2018). Beyond the phenotypes identified in the international consensus, we have also recorded and characterized additional specific phenotypes observed in patients, which include genitourinary system abnormalities associated with enuresis observed in the patient from our center, and central nervous system abnormalities as reported by Goel and Parasivam (2020) and Kruszka et al. (2019). The frequency of craniofacial disabilities and intellectual disorders was highest among 36 patients. Specific clinical manifestations with higher frequencies included intellectual disorder to different degrees (94% [32/34]), long philtrum (90% [27/30]), thick eyebrows (85% [22/26]), long eyelashes (83% [25/30]), depressed nasal bridge (83% [24/29]), short fifth finger (83% [25/30]) and thin upper vermilion (81% [25/31]). There existed notable variations in the occurrence rate among verbal developmental delay, hearing loss, and visual impairment. A significant portion of patients showed verbal developmental delays (94% [30/32]) that required language proficiency training. One‐third of patients had hearing loss (33% [8/24]) that required hearing equipment. Only a small portion (4% [1/28]) had visual impairment. The patient in our center started speaking at 25 months and exhibited mild verbal developmental delay. His intelligence level was not compromised and his academic performance was above average. Currently, he occasionally has enuresis, which was considered to be caused by neurological dysfunction. Among the 36 cases, there was also a 22‐year‐old male patient who experienced enuresis from infancy to adolescence (Krab et al. 2020), while the other patients had no related symptoms.

TABLE 1 Frequency of clinical features in all CdLS type 4 patients with detailed clinical data.

Clinical characteristics	N pos/N total	Frequency	
Sex (male/female)	18/17	51/49	
Short stature	16/32	50	
Microcephaly	23/33	70	
Brachycephaly	8/19	42	
Low anterior/posterior hairline	15/24	63	
Arched eyebrows	20/29	69	
Synophrys	21/30	70	
Thick eyebrows	22/26	85	
Long eyelashes	25/30	83	
Depressed nasal bridge	24/29	83	
Upturned nasal tip	20/28	71	
Long and/or smooth philtrum	27/30	90	
Thin upper vermilion	25/31	81	
Downturned corners of the mouth	16/27	59	
Widely spaced or absent teeth	3/21	14	
Highly arched palate	10/24	42	
Cleft palate	8/27	30	
Micrognathia	9/24	38	
Low‐set ears	14/26	54	
Small hands	7/29	24	
Short fifth finger	25/30	83	
5th finger clinodactyly	17/28	61	
Small feet	3/27	11	
Scoliosis	2/20	10	
Ptosis	11/26	42	
Seizures	2/22	9	
Visual impairment	1/28	4	
Hearing loss	8/24	33	
Verbal developmental delay	30/32	94	
Intellectual disorder (any degree)	32/34	94	
Hirsutism	12/28	43	
CNS malformations (MRI brain)	3/6	50	
Cardiac defects	10/24	42	
Diaphragmatic hernia	1/29	3	
Gastroesophageal reflux disease	13/25	52	
Genitourinary system abnormalities	10/25	40	
Abbreviations: N pos, the number of patients with a positive phenotype; N total, the total number of patients with a positive or negative phenotype.

Two cases reported that the loss of function (LOF) variants of the RAD21 gene are associated with the pathogenesis of holoprosencephaly (Goel and Parasivam 2020; Kruszka et al. 2019). The pathogenic variants in the genes encoding the four proteins of the cohesion complex (STAG2, SMC1A, SMC3, and RAD21), particularly LOF, are associated with the pathogenesis of holoprosencephaly and other midline brain defects.

3.5 Genetic Characteristics of Patients With CdLS Type 4

Among the 28 patients with known genetic patterns, it was observed that 12 patients exhibited germline variants, while the remaining 16 patients displayed de novo variants. The distribution of variant types can be visualized in Figure 3C. Among the total of 36 patients with recorded genetic alterations in Table 2, the most prevalent variant type was frameshift, accounting for 36% (13 out of 36) of cases. This was followed by missense variants, which constituted 19% (7 out of 36) of cases, and nonsense variants, which comprised 17% (6 out of 36) of cases. Additionally, one patient exhibited a splicing variant. Furthermore, Figure 3B provides information regarding the distribution of variants across different exons. Exon 14 exhibited the highest incidence of variants, accounting for 30.6% (11 out of 36), followed by variants in exon 7, exon 13, and exon 9. Figure 3A presents the various variants associated with distinct protein domains. Among the patients, 41.9% (13 out of 31) had variants situated in the RAD21‐SMC1A domain, while 6.5% (2 out of 31) and 6.5% (2 out of 31) had variants located in the RAD21‐SMC3 domain and RAD21‐STAG domain, respectively.

FIGURE 3 Summary of genetic abnormalities in CdLS patients carrying RAD21 variants. (A) Variants occurring in the RAD21 led to alterations in the protein's amino acid composition. The horizontal line and arrow indicate the location of the variant p. (Asp541_Gln568del). The number following the variant represents the number of people in whom this variant has occurred. (B) Among the various exons, exon 14 demonstrated the highest frequency of variants, accounting for 30.6% (11 out of 36) of the observed cases. (C) Among the total of 36 patients with documented genetic alterations, the most prevalent variant type observed was frameshift, which accounted for 36% (13 out of 36) of the cases. (D) The relationship between genotype and phenotype.

TABLE 2 Summaries of the genotypes and partial phenotypes of all CdLS type 4 patients with detailed clinical data.

Reference	Number	Age	Gender	Severity	Birth weight	Birth length	Weight	Height	Variant site	Types of variant	Exons/Intron	Predicted amino acid change	Inheritance	
Martinez et al.	P1	5 years	M	Mild	/	/	<−2 SD	<−2 SD	c.68G > A	Nonsense	Exon 2	p.(Trp23*)	De novo	
Clinvar	P2	11 years	M	Mild	/	/	/	/	c.194G>A	Missense	Exon 2	p.(Arg65Gln)	/	
Ansari et al.(P1)	P3	3 years 3 months	F	/	/	/	(−1.83 SD)	(−0.97 SD)	c.274 + 1G > A	Splice site	Intron 3		Familial (paternal)	
Minor et al.(P2)	P4	12 years	M	Moderate	(−3 SD)		(−1.06 SD)	(−0.95 SD)	c.592_593dupAG	Frameshift	Exon 6	p.(Ser198Argfs*6)	/	
Krab et al.	P5	1 year	F	/					c.617_620del	Frameshift	Exon 6	p.(Ile206Thrfs*3)	De novo	
Boyle et al.(IV.16)	P6	26 years	F	Moderate	/	/	/	<−2 SD	c.704delG	Frameshift	Exon 7	p.(Ser235Ilefs*19)	Familial (maternal)	
Boyle et al.(III.1)	P7	61 years	F	Mild	/	/	/	/	c.704delG	Frameshift	Exon 7	p.(Ser235Ilefs*19)	Familial	
Boyle et al.(III.2)	P8	60 years	F	Mild	/	/	/	/	c.704delG	Frameshift	Exon 7	p.(Ser235Ilefs*19)	Familial	
Boyle et al.(III.5)	P9	50 years	F	Mild	/	/	/	/	c.704delG	Frameshift	Exon 7	p.(Ser235Ilefs*19)	Familial	
Krab et al.	P10	44 years	F	/					c.704delG	Frameshift	Exon 7	p.(Ser235Ilefs*19)	Familial	
Dorval et al.	P11	5 years	M	Mild	(+0.4 SD)	(0 SD)	(−0.81 SD)	(−0.07 SD)	c.943_946del	Frameshift	Exon 9	p.(Glu315Glnfs*9)	De novo	
Deardorff et al.(P5)	P12	6 years	M	Moderate	/	/	<−2 SD	<−2 SD	c.1127C > G	Missense	Exon 9	p.(Pro376Arg)	De novo	
The current case	P13	13 years 4 months	M	Mild	(−1.9 SD)	(−1.7 SD)	(−3.14 SD)	(−3.36 SD)	c.1143G > A	Nonsense	Exon 9	p.(Trp381*)	Familial (maternal)	
Kruszka et al.(P14)	P14	2 years	M	Moderate	/	/	/	/	c.1217_1224del	Frameshift	Exon 10	p.(Lys406Argfs*4)	De novo	
Krab et al.	P15	4 years	F	Moderate					c.1382C > T	Missense	Exon 11	p.(Thr461Ile)	Familial (paternal)	
Qun Li et al.	P16	5 years	M	Mild		/	(−0.42 SD)	(−3.77 SD)	c.1553_1554delAG	Frameshift	Exon 12	p.(Glu518Valfs*18)	De novo	
Minor et al.(P1)	P17	3 years	M	Moderate	(−1.5 SD)	(+0.5 SD)	19th centile	31st centile	c.1621‐388_1704 + 193del	Inframe deletion	Exon 13	p.(Asp541_ Gln568del)	Familial (maternal)	
Minor et al.(mother P1)	P18	42 years	F	Mild	/	/	/	/	c.1621‐388_1704 + 193del	Inframe deletion	Exon 13	p.(Asp541_ Gln568del)	/	
Krab et al.	P19	9 years	F	Moderate	(<−2 SD)			<−2 SD	c.1635del	Frameshift	Exon 13	p.(Gly547Alafs*65)	De novo	
Shangguan et al.	P20	2 years 1 month	M	/	/	/	/	− 2.52 SDS	c.1635delA	Frameshift	Exon 13	p.(Gly547Alafs*65)	De novo	
De Falco et al.	P21	2 years	F	Moderate	(<−3 SD)	(<−3 SD)	<−2 SD	<−2 SD	c.1722_1723del	Frameshift	Exon 14	p.(Gly575SerfsTer2)	De novo	
Deardorff et al.(P6)	P22	Child’	F	/	/	/	/	/	c.1753T > C	Missense	Exon 14	p.(Cys585Arg)	De novo	
Krab et al.	P23	5 years 11 months	F	Mild					c.1753T > C	Missense	Exon 14	p.(Cys585Arg)	Familial	
Krab et al.	P24	0 year	F	/	<−2 SD				c.1753T > C	Missense	Exon 14	p.(Cys585Arg)	Familial	
Krab et al.	P25	13 years	M	/				<−2 SD	c.1756C > T	Nonsense	Exon 14	p.(Arg586*)	/	
Krab et al.	P26	17 years	M	Moderate				<−2 SD	c.1756C > T	Nonsense	Exon 14	p.(Arg586*)	Familial (paternal)	
Krab et al.(P25's Father)	P27	46 years	M	/				<−2 SD	c.1756C > T	Nonsense	Exon 14	p.(Arg586*)	/	
Gudmunsson et al.	P28	2 years	M	Mild	(−0.8 SD)	/	<−2 SD	/	c.1774_1776del	Inframe deletion	Exon 14	p.(Gln592del)	De novo	
Krab et al.	P29	6 years 5 months	M	Mild					c.1800_1802del	Inframe deletion	Exon 14	p.(Phe600del)	/	
Lee et al. (P76)	P30	4 years	/	Mild	/	/	/	/	c.1808T > C	Missense	Exon 14	p.(Leu603Pro)	De novo	
Goel et al.	P31	0 year	F	Severe	/	/	/	/	c.1843G>T	Nonsense	Exon 14	p.(Glu615*)	De novo	
Deardorff et al.(P4)	P32	Child’	M	/				<−2 SD	arr [hg19] 8q23.3q24.11 (116880827–118875305) x1	2 Mb deletion	Whole gene		/	
Krab et al.	P33	2 years 1 month	F	Mild	<−2 SD	<−2 SD	<−2 SD	<−2 SD	arr [hg19] 8q23.3q24.11 (116915114–119171074) x1	2.3 Mb deletion	Whole gene		De novo	
Deardorff et al.(P2)	P34	5 years	M	Moderate	<−2 SD	<−2 SD		<−2 SD	arr [hg19] 8q23.3q24.12 (117571728–119260904) x1	1.7 Mb deletion	Whole gene		De novo	
Krab et al.	P35	22 years	M	Moderate				<−2 SD	arr [hg19] 8q24.11 (117866471–117893495)x1	27 kb deletion	Exons 1–9		/	
Hugo H et al.	P36	13 years	F	/	(−0.1 SD)	(+1.5 SD)	/	<−2 SD	arr [hg19] 8q24.11 (116845458_116854956) x1	9.5 kb deletion	Exons 9–14		De novo	
The bold indicates that this particular case and variant are from our center.

3.6 Phenotypic and Genotypic Analyses of Patients With CdLS Type 4

Furthermore, in order to assess the severity of patients, according to the CdLS scoring system proposed by Kline, Krantz, et al. (2007), it was found that among the 26 patients meeting the criteria, only 1 was classified as severe, 11 reached moderate levels, and 14 were considered mild. As depicted in Figure 3D, out of the four patients with nonsense variants, two were classified as mild (50% [2/4]), one exhibited a moderate level (25% [1/4]), and one displayed a severe level (25% [1/4]). Among the five patients with missense variants, three were categorized as mild (60% [3/5]), and two reached moderate levels (40% [2/5]). Out of the 10 patients who had frameshift variants, 5 were classified as mild levels (50% [5/10]), while the remaining 5 reached moderate levels (50% [5/10]). Similarly, among the four patients with inframe deletion variants, three were categorized as mild levels (75% [3/4]), and only one patient reached a moderate level (25% [1/4]). Lastly, among the three patients with microdeletion variants, one patient reached a mild level (33% [1/3]), while the other two were classified as moderate levels (67% [2/3]).

4 Discussion

If clinical manifestations such as growth and developmental delay, microcephaly, and distinct craniofacial features are present, the potential diagnosis of CdLS should be contemplated. Furthermore, a definitive diagnosis should rely on the evaluation of clinical feature scores and the results obtained from gene sequencing. In the identification of known CdLS pathogenic genes, the implementation of exome sequencing (ES) or Trio‐ES, or panel sequencing targeting currently known CdLS genes (NIPBL, SMC1A, SMC3, RAD21, BRD4, HDAC8, and ANKRD11), should be considered (Hauer et al. 2018). In the case of non‐classic CdLS, the determination of which genes to prioritize for sequencing should be made by experienced specialists (Kline et al. 2018). However, if no pathogenic variants are identified in the sequencing, it is advisable to consider the potential presence of gene mosaicism. Further research could involve selecting uncultured fibroblasts, buccal mucosal cells, and bladder epithelial cells. The utilization of multiple ligation probe amplification techniques can facilitate the subsequent identification of NIPBL deletions or duplications Kline, Grados, et al. (2007).

This study reported a juvenile male patient with CdLS type 4. In this case, we were attracted by the typical craniofacial features and growth retardation characteristics such as short stature. Among the three adult patients for whom age records were available, the mean age was 31.3 ± 12.9 years (p = 0.298), and their average height was below −2 SDS. The patient's mother possessed a variant at the identical genetic locus and demonstrated a phenotype similar to that of the patient, characterized by a height of 150 cm (−2 SDS). She also exhibited symptoms of thick eyebrows and hirsutism.

An ophthalmic evaluation of the patient revealed amblyopia and binocular ametropia, but there were no signs of ptosis. Based on the patient's past history, an impairment in vision was observed at the age of 5. According to international consensus (Kline et al. 2018), children with CdLS must undergo eye assessment, including visual assessment (such as astigmatism, strabismus, amblyopia) as well as assessment of ptosis, blepharitis, and related nasolacrimal duct obstruction. Children with refractive errors and amblyopia secondary to ptosis required surgical correction. Among the 36 cases with detailed clinical manifestations that we summarized, De Falco et al. (2023) reported a 2‐year‐old girl was observed to have a significantly pale optic disc during an ophthalmic evaluation while in the hospital, indicating visual impairment associated with CdLS. In addition, in this case the child experienced symptoms of difficulty falling asleep. According to consensus (Kline et al. 2018), children with CdLS often have sleep disorders, and their sleep disorders can gradually improve with age. If necessary, behavioral interventions and melatonin therapy can be performed. Assessing an individual's cognitive strengths and weaknesses, as well as providing language and cognitive training within their living environment, can yield advantageous outcomes. Moreover, addressing repetitive behavior and social anxiety in daily life can effectively enhance their cognitive and learning abilities (Reid et al. 2017).

Five patients in our research had different‐sized microdeletions, specifically 9.5 kb, 27 kb, 1.7 Mb, 2.3 Mb, and 2 Mb, and they were unrelated to each other. Three of five patients had detailed information: two patients were rated as moderate levels and one was rated as mild. There was no significant linear relationship between phenotype severity and gene deletion size involving the RAD21 gene in three patients. However, a study on microdeletions in the NIPBL gene found a relatively clear linear relationship (Pehlivan et al. 2012).NIPBL microdeletions could be observed in a wide range of clinical severity, manifested as cognitive, growth, and structural involvement. The severity of the features was directly correlated with the extent of the deletion and the number of exons affected, with a greater number of exons resulting in more severe characteristics.

The examination of the mutational spectrum offers a partial understanding of the relationship between genotypes and phenotypes in individuals with CdLS. Specifically, the identification of nonsense, splicing site, and frameshift pathogenic variants within the NIPBL gene results in the synthesis of truncated and potentially non‐functional NIPBL protein, leading to severe phenotypic manifestations. Conversely, patients with CdLS harboring pathogenic variants in the SMC1A, SMC3, and RAD21 genes exhibit clinical characteristics that are more consistent and characterized by mild to moderate phenotypes, resembling those observed in NIPBL variant probands with missense alterations. Finally, patients who possess pathogenic variants of the HDAC8 gene demonstrate clinical characteristics that partially coincide with typical manifestations of CdLS, including distinctive facial abnormalities and profound cognitive impairment (Mannini et al. 2013).

In contrast to individuals with SMC1A and NIPBL variants, patients with RAD21 variants generally exhibit a lower prevalence of characteristics and a lesser degree of severity. The occurrence of hirsutism in RAD21 patients is comparatively infrequent, and significant limb malformations have not been documented. However, minor abnormalities in the hands and feet, including fetal pads, a single palmar crease, and clinodactyly, continue to be commonly observed (Krab et al. 2020). Patients harboring RAD21 variants generally exhibit a diminished extent of growth and developmental impairment during the neonatal period, accompanied by a lesser incidence of short stature and microcephaly postnatally. The prevalence and severity of congenital heart anomalies in these patients are comparable to those observed in individuals with NIPBL and SMC1A variants (Kline et al. 2018).

Overall, patients with missense variants and inframe deletions of RAD21 tend to display milder symptoms, indicating a correlation between the type of variants and the severity of the patients' phenotype. Patients with microdeletion and nonsense variants are more likely to exhibit moderate to severe symptoms.

Previous literature documented three cases of initiating growth hormone treatment in patients with CdLS. Out of these cases, two were caused by pathogenic variants in the NIPBL gene, one was associated with a pathogenic variant in the SMC3 gene, and there were no reported cases of RAD21 gene variants being treated with growth hormone. Our center assessed a 13.3‐year‐old boy with a clear diagnosis of short stature linked to CdLS, and the results of the growth hormone stimulation test verified growth hormone deficiency. Before initiating rhGH treatment, our patient's spinal X‐ray examination showed no abnormalities. An initial dosage of 3 U/day of rhGH was administered to the patient via subcutaneous injection. Following a 6‐month treatment period, his height increased from −3.5 SDS to −3.1 SDS.

de Graaf et al. (2017) reported that a woman diagnosed with CdLS identified a pathogenic variant in the NIPBL gene through WES. Following a GH stimulation test with clonidine and arginine, peak serum GH levels were measured at 4.4 and 12.1 μg/L, respectively. Subsequently, at the age of 4.3 years with a height of 91.7 cm (−3.5 SDS), the patient commenced a daily dose of 0.86 mg/m2 of rhGH. By the age of 12.3 years with a height of 142.6 cm (−1.8 SDS), the patient demonstrated a height increase of 1.6 SDS Li et al. (2021). documented the case of an 11.7‐year‐old male patient presenting with the primary concern of short stature. WES analysis identified a pathogenic variant in the SMC3 gene. At 5.5 years of age, the patient underwent a growth hormone stimulation test, resulting in a diagnosis of partial growth deficiency. Following this diagnosis, the patient received rhGH treatment, with the specific dosage not disclosed. The therapeutic intervention lasted for 3 months, during which the patient exhibited a height increase of 3 cm. The female patient, as reported by Lu et al. (2023), was diagnosed with small for gestational age (SGA) at birth. Subsequent growth hormone stimulation testing revealed a GH peak value of 9.32 ng/mL. At the age of 2.5, the patient's height was measured at 79.8 cm (−3.5 SDS). After a two‐year course of growth hormone treatment, the patient's height at the age of 4.5 increased to 97.0 cm (−2.4 SDS), representing a height increase of 1.1 SDS compared to the pre‐treatment period. Simultaneously, it was noted that the overall developmental quotient of the children showed a significant improvement following the implementation of growth hormone therapy, indicating a potential beneficial effect of growth hormone use on the physical and neurological growth of children with CdLS.

Management and treatment of patients with CdLS remain challenging because of the multiple developmental defects associated with CdLS. The average lifespan of patients with CdLS is 10–20 years shorter than the general population. The primary cause of death is respiratory diseases caused by aspiration or gastroesophageal reflux, followed by gastrointestinal diseases (including intestinal obstruction/torsion), congenital diaphragmatic hernia, and congenital heart defects (Boyle et al. 2015; Schrier et al. 2011). The multidisciplinary treatment (MDT) model of interdisciplinary team collaboration is necessary for the diagnosis, treatment, and prognosis evaluation of multi‐system diseases, and cooperation with families and schools should be emphasized. Children with CdLS who receive effective care (especially before the age of 1 year) can survive until adulthood (Kline et al. 2018). The MDT mode enables a collective analysis of the patient's condition by multiple subject experts, thereby ensuring the comprehensive consideration of all treatment plans and the subsequent specification of the most rational course of action.

5 Conclusion

This study presents a case of CdLS which carries a RAD21 variant, c.1143G>A (p.Trp381*) nonsense variant located in exon 9. Notably, this is the first reported occurrence of a nonsense variant in this exon. Our study reports the third case of CdLS type 4 patient in China, enriching the genetic mutational spectrum. The case in our center is the fourth case using rhGH to improve short stature in patients with CdLS. While existing research indicates the potential efficacy of rhGH in ameliorating CdLS‐associated short stature and promoting physical and neurological development, further clinical evidence is necessary to substantiate these findings.

Author Contributions

X.Y. and H.Z. designed the study. M.C. and X.Y. carried out the experiments and gathered the data. X.K. handled the data analysis. F.G. provided guidance throughout the experimental phase. X.Y. and M.C. prepared the initial draft of the manuscript. H.Y., L.W., L.D., and H.P. interpreted the data and contributed to the manuscript revision. All authors have reviewed and approved the final version of the manuscript.

Ethics Statement

The patient's parents gave their consent for participation in the study, which was approved by the Ethics Committee of Peking Union Medical College Hospital (I‐22PJ1122) and followed the guidelines of the Helsinki Declaration.

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Data S1.

Acknowledgements

We extend our gratitude to the participating families for their cooperation and to all the study participants for their invaluable contributions. This research was funded by the CAMS Innovation Fund for Medical Sciences (CIFMS 2021‐I2M‐1‐003).

Data Availability Statement

The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher. The raw sequence data reported in this paper have been deposited in the Genome Sequence Archive in the National Genomics Data Center (GSA‐Human: HRA008168) that are publicly accessible at https://ngdc.cncb.ac.cn/gsa‐human.
==== Refs
References

Abarca‐Barriga, H. H. , R. Punil Luciano , and F. Vásquez Sotomayor . 2023. “Cornelia de Lange Syndrome Caused by an Intragenic Heterozygous Deletion in RAD21 Detected Through Very‐High‐Resolution Chromosomal Microarray Analysis.” Genes 14 , no. 12 : 2212. 10.3390/genes14122212.38137034
Boyle, M. I. , C. Jespersgaard , K. Brøndum‐Nielsen , A.‐M. Bisgaard , and Z. Tümer . 2015. “Cornelia de Lange Syndrome.” Clinical Genetics 88 , no. 1 : 1–12. 10.1111/cge.12499.25209348
Cheng, H. , N. Zhang , and D. Pati . 2020. “Cohesin Subunit RAD21: From Biology to Disease.” Gene 758 : 144966. 10.1016/j.gene.2020.144966.32687945
De Falco, A. , D. De Brasi , M. Della Monica , et al. 2023. “A Novel Variant in RAD21 in Cornelia De Lange Syndrome Type 4: Case Report and Bioinformatic Analysis.” Genes 14 , no. 1 : 119. 10.3390/genes14010119.36672860
de Graaf, M. , S. G. Kant , J. M. Wit , et al. 2017. “Successful Growth Hormone Therapy in Cornelia de Lange Syndrome.” Journal of Clinical Research in Pediatric Endocrinology 9 , no. 4 : 366–370. 10.4274/jcrpe.4349.28588001
Dorval, S. , M. Masciadri , M. Mathot , S. Russo , N. Revencu , and L. Larizza . 2020. “A Novel RAD21 Mutation in a boy With Mild Cornelia de Lange Presentation: Further Delineation of the Phenotype.” European Journal of Medical Genetics 63 , no. 1 : 103620. 10.1016/j.ejmg.2019.01.010.30716475
Goel, H. , and G. Parasivam . 2020. “Another Case of Holoprosencephaly Associated With RAD21 Loss‐Of‐Function Variant.” Brain 143 , no. 8 : e64. 10.1093/brain/awaa173.32696056
Gudmundsson, S. , G. Annerén , Í. Marcos‐Alcalde , et al. 2019. “A Novel RAD21 p.(Gln592del) Variant Expands the Clinical Description of Cornelia de Lange Syndrome Type 4—Review of the Literature.” European Journal of Medical Genetics 62 , no. 6 : 103526. 10.1016/j.ejmg.2018.08.007.30125677
Hauer, N. N. , B. Popp , E. Schoeller , et al. 2018. “Clinical Relevance of Systematic Phenotyping and Exome Sequencing in Patients With Short Stature.” Genetics in Medicine 20 , no. 6 : 630–638. 10.1038/gim.2017.159.29758562
Huisman, S. , P. A. Mulder , E. Redeker , et al. 2017. “Phenotypes and Genotypes in Individuals With SMC1A Variants.” American Journal of Medical Genetics Part A 173 , no. 8 : 2108–2125. 10.1002/ajmg.a.38279.28548707
Kaur, M. , J. Blair , B. Devkota , et al. 2023. “Genomic Analyses in Cornelia de Lange Syndrome and Related Diagnoses: Novel Candidate Genes, Genotype‐Phenotype Correlations and Common Mechanisms.” American Journal of Medical Genetics Part A 191 , no. 8 : 2113–2131. 10.1002/ajmg.a.63247.37377026
Kline, A. D. , M. Grados , P. Sponseller , et al. 2007. “Natural History of Aging in Cornelia de Lange Syndrome.” American Journal of Medical Genetics Part C: Seminars in Medical Genetics 145C , no. 3 : 248–260. 10.1002/ajmg.c.30137.17640042
Kline, A. D. , I. D. Krantz , A. Sommer , et al. 2007. “Cornelia de Lange Syndrome: Clinical Review, Diagnostic and Scoring Systems, and Anticipatory Guidance.” American Journal of Medical Genetics Part A 143A , no. 12 : 1287–1296. 10.1002/ajmg.a.31757.17508425
Kline, A. D. , J. F. Moss , A. Selicorni , et al. 2018. “Diagnosis and Management of Cornelia de Lange Syndrome: First International Consensus Statement.” Nature Reviews Genetics 19 , no. 10 : 649–666. 10.1038/s41576-018-0031-0.
Krab, L. C. , I. Marcos‐Alcalde , M. Assaf , et al. 2020. “Delineation of Phenotypes and Genotypes Related to Cohesin Structural Protein RAD21.” Human Genetics 139 , no. 5 : 575–592. 10.1007/s00439-020-02138-2.32193685
Kruszka, P. , S. I. Berger , V. Casa , et al. 2019. “Cohesin Complex‐Associated Holoprosencephaly.” Brain 142 , no. 9 : 2631–2643. 10.1093/brain/awz210.31334757
Lee, H. , J. L. Deignan , N. Dorrani , et al. 2014. “Clinical Exome Sequencing for Genetic Identification of Rare Mendelian Disorders.” JAMA 312 , no. 18 : 1880–1887. 10.1001/jama.2014.14604.25326637
Li, Q. , G. Chang , L. Yin , et al. 2020. “Clinical and Molecular Analysis in a Cohort of Chinese Children With Cornelia de Lange Syndrome.” Scientific Reports 10 , no. 1 : 21224. 10.1038/s41598-020-78205-5.33277604
Li, R. , B. Tian , H. Liang , et al. 2021. “A Chinese Case of Cornelia de Lange Syndrome Caused by a Pathogenic Variant in SMC3 and a Literature Review.” Frontiers in Endocrinology 12 : 604500. 10.3389/fendo.2021.604500.34659104
Liu, J. , and I. D. Krantz . 2008. “Cohesin and Human Disease.” Annual Review of Genomics and Human Genetics 9 , no. 1 : 303–320. 10.1146/annurev.genom.9.081307.164211.
Lu, T. , X. Lu , W. Lian , and H. Zheng . 2023. “Clinical Analysis of a Case of Cornelia de Lange Syndrome Treated With Growth Hormone (In Chinese).” Chinese Journal of Birth Health & Heredity 31 , no. 2 : 345–349. 10.13404/j.cnki.cjbhh.2023.02.028.
Mannini, L. , F. Cucco , V. Quarantotti , I. D. Krantz , and A. Musio . 2013. “Mutation Spectrum and Genotype‐Phenotype Correlation in Cornelia de Lange Syndrome.” Human Mutation 34 , no. 12 : 1589–1596. 10.1002/humu.22430.24038889
McKay, M. J. , C. Troelstra , P. Van Der , et al. 1996. “Sequence Conservation of the RAD21 Schizosaccharomyces pombe DNA Double‐Strand Break Repair Gene in Human and Mouse.” Genomics 36 , no. 2 : 305–315. 10.1006/geno.1996.0466.8812457
Muto, A. , S. Ikeda , M. E. Lopez‐Burks , et al. 2014. “Nipbl and Mediator Cooperatively Regulate Gene Expression to Control Limb Development.” PLoS Genetics 10 , no. 9 : e1004671. 10.1371/journal.pgen.1004671.25255084
Ng, R. , J. O'Connor , D. Summa , and A. D. Kline . 2024. “Neurobehavioral and Developmental Profiles: Genotype‐Phenotype Correlations in Individuals With Cornelia de Lange Syndrome.” Orphanet Journal of Rare Diseases 19 , no. 1 : 111. 10.1186/s13023-024-03104-1.38462617
Pehlivan, D. , M. Hullings , C. M. B. Carvalho , et al. 2012. “NIPBL Rearrangements in Cornelia de Lange Syndrome: Evidence for Replicative Mechanism and Genotype‐Phenotype Correlation.” Genetics in Medicine 14 , no. 3 : 313–322. 10.1038/gim.2011.13.22241092
Reid, D. , J. Moss , L. Nelson , L. Groves , and C. Oliver . 2017. “Executive Functioning in Cornelia de Lange Syndrome: Domain Asynchrony and Age‐Related Performance.” Journal of Neurodevelopmental Disorders 9 , no. 1 : 29. 10.1186/s11689-017-9208-7.28806899
Richards, S. , N. Aziz , S. Bale , et al. 2015. “Standards and Guidelines for the Interpretation of Sequence Variants: A Joint Consensus Recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology.” Genetics in Medicine 17 , no. 5 : 405–424. 10.1038/gim.2015.30.25741868
Schrier, S. A. , I. Sherer , M. A. Deardorff , et al. 2011. “Causes of Death and Autopsy Findings in a Large Study Cohort of Individuals With Cornelia de Lange Syndrome and Review of the Literature.” American Journal of Medical Genetics Part A 155 , no. 12 : 3007–3024. 10.1002/ajmg.a.34329.
Shangguan, H. , and R. Chen . 2022. “Phenotypes of Cornelia de Lange Syndrome Caused by Non‐Cohesion Genes: Novel Variants and Literature Review.” Frontiers in Pediatrics 10 : 940294. 10.3389/fped.2022.940294.35935361
Shangguan, H. , J. Wang , J. Lin , X. Huang , Y. Zeng , and R. Chen . 2024. “A Study on Genotypes and Phenotypes of Short Stature Caused by Epigenetic Modification Gene Variants.” European Journal of Pediatrics 183 : 1403–1414. 10.1007/s00431-023-05385-3.38170291
