
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00801-0
10.1016/j.psj.2024.104222
104222
IMMUNOLOGY, HEALTH AND DISEASE
Bacillus licheniformis suppresses Clostridium perfringens infection via modulating inflammatory response, antioxidant status, inflammasome activation and microbial homeostasis in broilers
Xiao Xiao *†‡§#1
Qin Songke *†1
Cui Tiantian *†
Liu Jinsong #
Wu Yanping *†‡§
Zhong Yifan *†‡§
Yang Caimei yangcaimei2012@163.com
*†‡§2
⁎ Key Laboratory of Applied Technology on Green-Eco-Healthy Animal Husbandry of Zhejiang Province, College of Animal Science and Technology, College of Veterinary Medicine, Zhejiang A&F University, Hangzhou 311300, China
† Zhejiang Provincial Engineering Laboratory for Animal Health and Internet Technology, College of Animal Science and Technology, College of Veterinary Medicine, Zhejiang A&F University, Hangzhou 311300, China
‡ Zhejiang International Science and Technology Cooperation Base for Veterinary Medicine and Health Management, College of Animal Science and Technology, College of Veterinary Medicine, Zhejiang A&F University, Hangzhou 311300, China
§ China-Australia Joint Laboratory for Animal Health Big Data Analytics, College of Animal Science and Technology, College of Veterinary Medicine, Zhejiang A&F University, Hangzhou 311300, China
# Zhejiang Vegamax Biotechnology Co., Ltd., Huzhou 313300, China
2 Corresponding author: yangcaimei2012@163.com
1 These authors contributed equally to this work.

21 8 2024
11 2024
21 8 2024
103 11 1042223 6 2024
11 8 2024
© 2024 Published by Elsevier Inc. on behalf of Poultry Science Association Inc.
2024

https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Pathogenic bacteria infection, especially Clostridium perfringens (C. perfringens), markedly threatened the health of animals, and further caused huge economic loss. In this study, Bacillus licheniformis HJ0135 (BL) was used. Oxford cup bacteriostatic test and inhibitory rate test were conducted to evaluate the antibacterial ability of BL. Results showed the strongest inhibitory role of BL on C. perfringens (P < 0.05). Afterwards, 540 one-day-old yellow-feather broilers (32.7 ± 0.2 g) were randomly allocated into 3 groups, including CON group (basal diet), CP group (basal diet + 1 × 109 CFU C. perfringens in gavage), and BL + CP group (basal diet containing 7.5 × 106 CFU/g BL + 1 × 109 CFU C. perfringens in gavage). At d 70, broilers in the CP and BL + CP groups were treated with C. perfringens by continuously oral administration for 5 d. The experiment lasted for 75 d. The serum, immune organs, jejunal mucosa, and cecal contents were collected for analysis. In vivo experiment showed that BL supplementation markedly improved (P < 0.05) BW, ADG, thymus index, serum immunoglobins and antioxidases, reduced feed conversion ratio (FCR) and serum pro-inflammatory cytokines of C. perfringens-infected broilers. Furthermore, the increased jejunal injury and levels of pro-inflammatory cytokines, decreased gene expressions of tight junction proteins in the jejunal mucosa were significantly alleviated (P < 0.05) by BL. More importantly, the activation of NOD-, LRR- and pyrin domain-containing protein 3 (NLRP3) inflammasome was inhibited (P < 0.05) by BL to further attenuate jejunal damage. Besides, BL supplementation markedly increased (P < 0.05) the cecal isobutyric acid and isovaleric acid. Microbial analysis showed that BL changed the composition and relative abundances of microbiota in the cecal contents (P < 0.05), especially the short chain fatty acids (SCFAs)-producing bacteria including Eubacterium_coprostanoligenes_group, Megamonas, Faecalibacterium, and Lactobacillus, which further protected against C. perfringens-induced jejunal inflammation in broilers. Our study laid a theoretical basis for the application of probiotics in lessening C. perfringens-related diseases in poultry farming.

Key words

Bacillus licheniformis
Clostridium perfringens
broiler
gut microbiota
inflammatory response
==== Body
pmcINTRODUCTION

Clostridium perfringens (C. perfringens), as a Gram-positive facultative anaerobic bacterium belonging to the family Clostridium, has the characteristics of spore-formation and wide distribution in natural environment, gastrointestinal tracts of humans and animals, as well as foods including raw meats and vegetables (Dolan et al., 2016; Feng et al., 2020; Mehdizadeh Gohari et al., 2021). Over the past centuries, C. perfringens has been reported to cause enteric diseases in animals. For example, C. perfringens infection led to necrotic enteritis (NE) and enterotoxaemia in pigs and poultry (Feng et al., 2020; Posthaus et al., 2020; Mehdizadeh Gohari et al., 2021). It is estimated that the intestinal damage caused by C. perfringens led to an annual increase in breeding costs and productivity losses of up to USD 600 million in the global poultry industry (Kiu and Hall, 2018). Besides, C. perfringens spores can survive in a dormant state when they are in a poor environment, such as hot and cold, and then return to be alive when the growth and nutritional conditions are suitable for survival (Talukdar et al., 2017). Thus, raw meats, milk and other foods can be easily polluted by C. perfringens bacteria or spores to further threaten human health. In the past years, antimicrobial drugs were large-scale used and the antimicrobial resistance of C. perfringens has been increased dramatically (Bendary et al., 2022). Thus, finding effective agents targeting C. perfringens was pivotal for treating related diseases in animals.

The pathogenicity of C. perfringens largely depends on the complement of extracellular toxins and hydrolytic enzymes (>20) they generate (Kiu and Hall, 2018; Feng et al., 2020). C. perfringens can produce various toxins, such as α-toxin, β-toxin, ε-toxin, enterotoxin (CPE) and B-type toxins (NetB), and was typed based on the production of specific toxins (Forti et al., 2020; Mehdizadeh Gohari et al., 2021). CPE was the major contributor of C. perfringens -related food poisoning and non-foodborne diseases in humans (Talukdar et al., 2017), and NetB was the predominant factor for necrotic enteritis in poultry (Keyburn et al., 2013). With the rapid advances of scientific technologies and focus of superb researchers, many chemical agents and antimicrobial reagents were found to inhibit C. perfringens proliferation and related diseases in different mechanisms. Different types of chemical agents, such as nitrate, nitrite, organic acids (sorbic acid, benzoic acid, lactic acid, and acetic acid), and phosphates, were constantly used in foods as preservatives, flavor and color enhancers to inactivate spore formation, inhibit germination and outgrowth, reduce cell viability of C. perfringens (Talukdar et al., 2017; Lin et al., 2022). Meanwhile, typical antimicrobial agents, including essential oils, nisin, antimicrobial peptides, and probiotics, were reported to inhibit C. perfringens, thus these potential drugs may be useful for treating C. perfringens-related diseases (Talukdar et al., 2017; Hussein et al., 2020; Khalique et al., 2020; Xu et al., 2023a). However, in consideration of their treating effect on C. perfringens-induced diseases, more attention should be paid to the specific drugs and the potential mechanism how these drugs function on C. perfringens-induced models still needs more investigation.

Among above agents, probiotics gradually attracted more interest due to its effectiveness and safety in the prevention of C. perfringens infection in animals. Previous studies have suggested that probiotic individually or the mixtures efficiently improved growth performance, meat quality, antioxidant and immune functions, attenuated intestinal damage and microbial dysbiosis in C. perfringens-infected broilers (Hussein et al., 2020; Zhao et al., 2020; Zhao et al., 2022). More importantly, our previous study indicated that Bacillus licheniformis HJDY01 inhibited intestinal inflammation and protected the intestinal morphology in C. perfringens-challenged broilers (Zhang et al., 2023), indicating the regulatory role of probiotics in C. perfringens-infected broilers.

Previously, our study found that Bacillus licheniformis HJ0135 (BL) supplementation at three dosages effectively improved the growth performance, immune and antioxidant functions, changed the intestinal microflora structure and metabolites of yellow-feathered broilers (Qin et al., 2024). In the current study, we firstly evaluated the antibacterial ability of BL (HJ0135) on three common pathogens, including Escherichia coli, Salmonella typhimurium and C. perfringens, in vitro and identified that C. perfringens was the most obvious bacteria inhibited by BL. Thus, we hypothesized that BL could protect the growth and intestinal health against C. perfringens infection in broilers. Based on the above hypothesis, the major objective of this research was to clarify the potential effect of BL on the growth performance, immune functions, inflammatory response, antioxidant capacity, intestinal damage, and microbial homeostasis in C. perfringens-induced broilers and elucidate the potential mechanism. In detail, BL was added in the basal diet and given to broilers for 75 d, which was infected with C. perfringens for consecutive 5 d. The results showed that BL supplementation increased the BW and ADG, serum immunoglobulins and antioxidases, and reduced feed conversion ratio (FCR) and serum pro-inflammatory cytokines. In addition, BL reduced the serum diamine oxidase (DAO), D-lactic acid (D-LA), and lactate dehydrogenase (LDH) induced by C. perfringens infection. The dropped jejunal injury score, the decreased contents and mRNA expressions of cytokines, the increased gene expressions of tight junction proteins further indicated the beneficial effect of BL on jejunal health in C. perfringens-induced broilers. More importantly, the gene expressions of NOD-, LRR- and pyrin domain-containing protein 3 (NLRP3) inflammasome showed that BL protected against C. perfringens infection by inhibiting the NLRP3 pathway. Furthermore, BL attenuated the decreased short chain fatty acids (SCFAs) in the cecal contents and changed the microbial structure and compositions of C. perfringens-induced broilers. Based on the experimental results, we can conclude that BL supplementation in broilers effectively increased the growth performance, immune functions, inflammatory response, antioxidant capacity, jejunal health, and microbial homeostasis, which was disturbed by C. perfringens infection, and the potential mechanism may be the involvement of the NLRP3 pathway.

MATERIALS AND METHODS

Animal Ethics Statement

All animal welfare and experimental procedures were approved by the Animal Care and Use Committee of Zhejiang Agricultural and Forestry University (Hangzhou, China, Approval no. ZAFUAC2023041) and all animal experiments complied with the ARRIVE guidelines.

Pathogenic Bacteria and Probiotic Culture

Escherichia coli (EC) ATCC25922 strain, Salmonella typhimurium (ST) ATCC14028 strain, and C. perfringens (CP) ATCC13124 strain were purchased from China General Microbiological Culture Collection Center. EC and ST were cultured on Luria-Bertani (LB) agar (Biosharp, China) overnight at 37°C, and a single colony was selected and inoculated in LB liquid broth with constant shaking at 37°C for 10 h. CP was anaerobically cultured in thioglycolate broth (Merck, Germany) for 18 h at 37°C. Finally, the number of all viable bacteria corresponding to OD600 = 0.5 was determined by the plate counting method. The above three pathogenic strains were used to determine the antibacterial ability of the probiotics.

Bacillus licheniformis HJ0135 (BL) were isolated by our lab and cultured in LB agar overnight at 37°C, and a single colony was selected and inoculated in LB liquid broth with constant shaking at 37°C for 10 to 12 h. Finally, the number of all viable bacteria corresponding to OD600 = 0.5 was determined by the plate counting method.

Antibacterial Ability of BL

Oxford cup bacteriostatic test: EC and ST were evenly spread on the LB agar plate, and C. perfringens were spread on the Tryptose Sulfite Cycloserine Agar Base (TSC) plate (Hopebio, China), with 1 × 106 CFU per plate. About 200 μL of probiotic culture medium was added to each Oxford cup (7.8 mm × 6 mm, C0172, Shandong Tuopu Biol-engineering Co., LTD, China) placed at 37°C and incubated for 12 h, and the size of the inhibition zone was measured.

Inhibitory rate test: The BL was cultured as described above, and the number of all viable bacteria was adjusted to OD600 = 0.5. Then, the whole medium was centrifuged at 3,000 × g for 5 min at room temperature, and the probiotic BL supernatant was acquired and stored at 4°C until use. To determine if the probiotic BL supernatant could inhibit the growth of C. perfringens, C. perfringens was co-cultured with probiotic supernatant at a ratio of 4:1 or alone. At 1 h, 2 h, 3 h, 4 h and 5 h, the OD600 value was measured, and the inhibition rate was calculated [inhibition rate % = (OD value of pathogenic bacteria culture solution - OD value of co-culture solution) / OD value of pathogenic bacteria culture solution * 100].

Transmission Electron Microscopy

The BL supernatant was co-cultured with EC, ST, and CP for 3 h, 1 h, and 3 h, respectively. The samples were fixed in 2.5% glutaric acid solution overnight, and then in 1% osmic acid solution for 1 to 2 h at room temperature. The samples were dehydrated with gradient concentrations of ethanol solution (30, 50, 70, and 80%) for 15 min, and then dehydrated with gradient concentrations of acetone solution (90% and 95%) for 15 min. Finally, the samples were treated with 100% acetone twice. Then, the samples were embedded and observed in a Hitachi 7,650 device at 80 kV (Hitachi, Japan).

Experimental Design and Animal Management

A total of 540 one-day-old yellow-feather broilers (initial body weight: 32.7 ± 0.2 g) were used in our study. The broilers were allocated into 3 groups according to the body weight and the average initial weight among 3 groups showed no difference. There were 10 replicates per group and 18 chickens per replicate. The experimental groups were basal diet (CON group), basal diet + C. perfringens in gavage (1 mL, 1 × 109 CFU/mL, CP group), and basal diet containing 7.5 × 106 CFU/g BL + C. perfringens in gavage (1 mL, 1 × 109 CFU/mL, BL + CP group). At d 70, broilers in the CP and BL + CP groups were treated with C. perfringens by continuously oral administration for 5 d. The experiment lasted for 75 d. The basic diet was formulated to meet the nutritional requirements with reference to the recommendation of the “Nutritional Requirements of Chinese Yellow Feather Broilers” (NY/T 3645-2020) and “Feeding Standard of chicken” (NY/T 33-2004). The broilers were free access to food and water. The temperature was set at 33°C at the age of 1 to 7 d and then reduced by 3°C per week to a final temperature of around 24°C. The humidity was set 60 to 65% at the age of 1 to 7 d and then 50 to 60%. The broilers were exposed to 24 h light. In addition, all birds were vaccinated against Newcastle disease virus and infectious bronchitis virus vaccines on d 7, and against bursa disease virus via drinking water on d 12 and 26 according to the routine immunization program. The BL HJ0135 (viable bacteria count: 1 × 1010 CFU/g) were obtained by unique confidential drying technology from Zhejiang Vegamax Biotechnology Co., Ltd (Huzhou, China). The BL addition was 750 mg/kg as our previously study (Qin et al., 2024).

Chemical Analysis of Feed Chemical Compositions

The composition and nutrient levels of the basal diet were shown in Table 1. The Crude protein contents in diet were determined by the automatic Kjeldahl analyzer (K9840, Shanghai Lijin Scientific Instrument Co., Ltd, China) according to the methods of National Standards of the People's Republic of China GB/T 6432-2018. The amino acid was analyzed using an amino acid analyzer (L8900, Hitachi, Tokyo, Japan). Values of digestible energy were calculated from data provided by Feed Database in China (2020).Table 1 The composition and nutritional level of basal diet (air-dried basis).

Table 1Ingredient, %	Starter (1–35d)	Finisher (35–75 d)	
Ingredients			
 Corn	53.20	61.20	
 Corn protein meal	2.00	3.50	
 Soybean meal	25.10	14.10	
 Extruded soybean	5.00	5.00	
 DDGS	5.00	8.00	
 Fermented soybean meal	2.50	0.00	
 Wheat middlings	0.00	2.00	
 Soybean oil	2.30	2.00	
 Limestone	1.20	1.30	
 CaHPO4	1.70	0.90	
 Premix1	2.00	2.00	
 Total	100.00	100.00	
Nutrient levels2			
 Digestible energy (MJ/kg)	12.43	12.63	
 Crude protein	21.03	17.53	
 Lys	1.26	0.95	
 Met	0.55	0.44	
 Met + Cys	0.90	0.76	
 Thr	0.82	0.65	
 Trp	0.22	0.16	
1 Supplied per kilogram of diet: vitamin A (retinyl acetate), 1,500 IU; cholecalciferol, 200 IU; vitamin E (DL-α-tocopheryl acetate), 10 IU; riboflavin, 3.5 mg; pantothenic acid, 10 mg; niacin, 30 mg; cobalamin, 10 µg; choline chloride, 1,000 mg; biotin, 0.15 mg; folic acid, 0.5 mg; thiamine, 1.5 mg; pyridoxine, 3.0 mg; Fe, 80 mg; Zn, 40 mg; Mn, 60 mg; I, 0.18 mg; Cu, 8 mg; Se, 0.15 mg; Lys, 3000 mg; Met, 2000 mg; Thr, 1000 mg.

2 Values of digestible energy were calculated from data provided by Feed Database in China (2020). Crude protein and amino acids were measured values.

Sample Collection

At the end of the experiment (d 75), one broiler per replicate was selected at random and weighed for sample collection. Blood was taken from the carotid artery and centrifugated at 4,000 × g, 4°C for 15 min, and the serum samples were collected and stored at -80°C for measuring biomarkers, immunoglobulins (Ig), cytokines and antioxidases. The liver, spleen, bursa and left thymus were weighed individually for calculating immune organ indexes. Part of jejunum was used for injury scoring, and the remaining jejunal mucosa were stored at -80°C for measuring the levels of cytokines and mRNA expression of related genes. The cecum contents were collected, snap-frozen in liquid nitrogen and transferred to -80°C for microbiota and SCFAs analysis.

Growth Performance and Immune Organ Index

The initial body weight (IBW) at d 1, the final body weight (FBW) at d 75, and the feed intake during the whole experiment were recorded. The ADG, ADFI and FCR were calculated. The immune organ (liver, spleen, bursa, and left thymus) of broilers at d 75 were weighed. The immune organ index was calculated as follows: Immune organ index=immune organ weight (g) /broiler body weight (kg).

Immunoglobulin and Inflammatory Cytokines Levels

The concentrations of IgA (CAS: ANG-E32004C; 10-600 ng/mL; Intra- and interassay CV lower than 9% and 15%), IgM (CAS: ANG-E32005C; 0.1875-11.25 μg/mL; Intra- and interassay CV lower than 9% and 15%), and IgY (CAS: ANG-E32209C; 0.0625-3.75 ng/mL; Intra- and interassay CV lower than 9% and 15%) in serum, the levels of interleukin-10 (IL-10; CAS: ANG-E32011C; 1–60 ng/L; Intra- and interassay CV lower than 9% and 15%), IL-1β (CAS: ANG-E32218C; 1.875–112.5 ng/L; Intra- and interassay CV lower than 9% and 15%), IL-2 (CAS: ANG-E32014C; 10–600 pg/mL; Intra- and interassay CV lower than 9% and 15%), IL-18 (CAS: ANG-E32035C; 1.875-112.5 ng/L; Intra- and interassay CV lower than 9% and 15%), IL-6 (CAS: ANG-E32013C; 18.75–1125 pg/mL; Intra- and interassay CV lower than 9% and 15%), and tumor necrosis factor-α (TNF-α;CAS: ANG-E32030C; 1.25–75 ng/L; Intra- and interassay CV lower than 9% and 15%) in serum and jejunal mucosa were quantified by ELISA kits according to the manufacturer's instructions (Nanjing Angle Gene Bioengineering Co., Ltd, Nanjing, China). The serum samples were diluted 5 to 10 times, and then measured by ELISA kits. The jejunal mucosa samples were cut into pieces and grounded into powder by grinding-hardening with liquid nitrogen. Then, the powder was weighted, dissolved in PBS (0.1 g samples + 1 mL PBS), and homogenized. Afterwards, the medium was centrifuged at 12,000 × g, 4°C for 20 min, and the supernatant was collected. Finally, the protein levels were measured using the BCA kit (Takara, Japan) and the cytokines levels were measured by ELISA kits.

Antioxidant Capacity

The levels of the total antioxidant capacity (T-AOC; A015-2-1) and malondialdehyde (MDA; A003-1-2; 0.5-113.0 nmol/mL; Intra- and interassay CV were 3.5% and 4.11%), the activities of glutathione peroxidase (GPx; A005-1-2; 20-330 U/mL; Intra- and interassay CV were 3.56% and 6.8%), superoxide dismutase (SOD; A001-3-2; 0.5–122.1 U/mL; Intra- and interassay CV were 5.50% and 3.32%), catalase (CAT; A007-1-1; 0.2-24.8 U/mL; Intra- and interassay CV were 1.9% and 4.94%), and total nitric oxide synthase (T-NOS; A005-1-2; 0.2–81.9 U/mL; Intra- and interassay CV were 1.9% and 5.95%) in serum were measured following the instructions of corresponding kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The serum samples were diluted according to pre-experiments for each kit.

Intestinal Permeability Biomarkers

The contents of DAO (A088-1-1; 0-100 U/L; Interassay CV lower than 10%) in serum was detected according to the manufacturer's instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The levels of D-LA (CAS: ANG-E32105C; 8.75–262.5 μg/L; Intra- and interassay CV lower than 9% and 15%) and LDH (CAS: DX3380) were measured according to the manufacturer's instructions (Nanjing Angle Gene Bioengineering Co., Ltd, Nanjing, China). The serum samples were diluted 5 to 10 times, and then used for measurement.

Jejunal Injury Score

The jejunal injury was observed and scored according to the severity of intestinal injury based on reported study (Dahiya et al., 2005). A total of 0 to 4 points scoring system was used: 0, no obvious lesions; 0.5, severe congestion of mesentery and small intestinal wall; 1) thinning and crisping of intestinal wall, more than 5 bleeding points; 2) gas in the intestinal cavity, a large number of bleeding points in intestinal wall with a small amount of necrosis or ulceration; 3) regional necrosis and ulcer in the intestinal wall; 4) a large number of gas in intestinal cavity with diffuse necrosis.

Real-Time Quantitative PCR

Total RNA from jejunal mucosa samples were isolated with Trizol reagent (Takara Bio, Japan). The concentration and quality of RNA were determined using a Nano2000 microspectrophotometer (Thermo Scientific, Waltham, MA). Briefly, 2 μg of RNA were reverse transcribed into cDNA using the PrimeScript RT-PCR Kit (RR047, Takara Bio, Japan) according to their instructions. qPCR was conducted with FastStart Universal SYBR Green master mix (Roche, Mannheim, Germany) via StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, CA). The primer sequences were displayed in Table 2 and synthesized by TSINGKE Biological Technology (Beijing, China). Each sample was run in triplicate, and the relative mRNA expressions of the target genes were calculated using the 2−△△Ct method. Gapdh was used as the endogenous control.Table 2 Primer sequences for qPCR.

Table 2Gene	Primer sequence (5’-3’)	GenBank No.	
Gapdh	F: AGTCAACGGATTTGGCCGTA
R: ACAGTGCCCTTGAAGTGTCC	NM_204305.2	
Nlrp3	F: AAGTCTTGGGATCAGCACGG
R: TGGCCATCTTTGCTGGGTTC	NM_001348947.2	
Caspase1	F: CTTTCCCCACCCCTGAAGTGA
R: ATTTTGGGTGGTGCTGCGAG	XM_015295935.4	
Il1b	F: GCCTGCAGAAGAAGCCTCG
R: GGAAGGTGACGGGCTCAAAA	NM_204524.2	
Il18	F: AGATGATGAGCTGGAATGCGAT
R: TCTACCTGGACGCTGAATGC	NM_204608.3	
Tnf-α	F: CCGTAGTGCTGTTCTATGACCG
R: GTTCCACATCTTTCAGAGCATCAA	NM204267.1	
Claudin1	F: CACACCCGTTAACACCAGATTT
R: GAGGGGGCATTTTTGGGGTA	NM_001013611.2	
Occludin	F: AGCCCTCAATACCAGGATGTG
R: CGCTTGATGTGGAAGAGCTTG	NM_205128.1	
Zo1	F: CAGATGGCCATAGGGGTGAC
R: TGGAGTTACCCACAGCTTCC	XM_040706827.2	

SCFAs Measurement and Analysis

According to our previous study (Xiao et al., 2024), the concentration of SCFAs in cecal content was estimated by gas chromatography using a 7890B Network GC System (DB-FFAP column parameter: 30 m × 0.25 mm × 0.25 μm; Cat#122-3232; Agilent Technologies, Santa Clara, CA) and 7693 Automatic Liquid Sampler with G4513A injector (Agilent Technologies, Santa Clara, CA) and aflame ionization detector. In brief, 0.5 g of cecal samples was weighted and dissolved in 1.0 mL pure water. After shock mixing and high-speed centrifugation (12,000 × g for 10 min at 4°C), the supernatant was extracted and mixed with 25% phosphoric acid (m/v, 1:5). Then, the mixture was placed at 4°C overnight and filtered into the special injection bottles for machine detection. The detection time lasted for 20 min at 220°C.

Gut Microbiota Analysis

The total genomic DNA of each sample was extracted according to the instructions of QIAamp DNA Stool Mini Kit (Qiagen, Hildern, Germany), the concentration and quality of the extracted genomic DNA was detected by 1% agarose gel electrophoresis (Thermo Scientific Corporation, Waltham, MA). The primers were 338F: 5′-ACTCCTACGGGAGGCAGCAG-3′ and 806R: 5′-GGACTACHVGGGTWTCTAAT-3′ carrying the Barcode sequence to complete the 16S rRNA gene V3-V4 variable PCR amplification. Then, the PCR products were retrieved using 2% agarose gel and purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA). Subsequently, library quantification, normalization, and pooling were performed and the samples were loaded for MiSeq sequencing on the Miseq PE300/NovaSeq PE250 platform of Illumina (Shanghai Meiji Biomedical Technology Co., Ltd.). Finally, the amplification primers were removed with cutadapt 2.4 and the trimmed reads were filtered for amplicon sequence variant (ASV) inference based on DADA2 1.12.1 algorithm. The alpha diversity index and beta diversity of samples were performed based on ASV table. Bacterial abundances and differential species at different taxonomy were further analyzed and Linear discriminant analysis with effect size (LEfSe) was used to identify microbes that were significantly changed. Related analysis was performed using the free online platform of Majorbio Cloud Platform (www.majorbio.com).

Statistical Analysis

Data were presented as the mean ± SEM. One-way ANOVA followed by Tukey's multiple range tests were performed to access statistical significance. Statistical analysis was conducted using the SPSS 22 software (IBM company, New York, NY) and GraphPad Prism 9.0 software (GraphPad software company, Boston, MA). P < 0.05 was considered statistically significant and P < 0.01 was considered extremely significant. Different letters (a, b, c) indicated statistically significant.

RESULTS

Antibacterial Ability of BL on Pathogenic Bacteria in Vitro

As shown in Figure 1A, results of the Oxford Cup experiment showed that BL supernatant significantly inhibited the growth of 3 pathogenic EC, ST, and C. perfringens (P < 0.05), in which the growth of C. perfringens was extremely suppressed by BL supernatant (29.03 mm). For further validation, the morphological structure of pathogenic bacteria co-cultured with BL supernatant was observed by TEM. The results in Figure 1B indicated that the pathogenic bacteria alone showed intact cell wall and clear boundary, whereas severe disrupted cell wall, cell debris, cytoplasmic shrinkage and vacuolization were observed in the pathogenic bacteria co-cultured with BL supernatant. These data suggested a significant inhibitory growth of BL supernatant on pathogenic bacteria, especially C. perfringens. Due to the strongest effect of BL on C. perfringens, we further measured the inhibitory rate in a time manner. Results in Figure 1C showed that the inhibition rates of BL and C. perfringens at each time point within 1 to 5 h were 51.53, 50.07, 63.27, 46.11, and 38.01%, respectively, indicating that co-cultured for 3 h expressed the best inhibition.Figure 1 The inhibitory effect of BL on pathogenic bacteria in vitro. (A) The inhibitory zone; (B) Representative images of BL co-cultured with pathogenic bacteria; (C) The inhibitory rate of BL co-cultured with pathogenic C. perfringens. a, b Different letters indicated statistically significant (P < 0.05). BL, Bacillus licheniformis HJ0135; EC, Escherichia coli ATCC25922; ST, Salmonella typhimurium ATCC14028; CP, C. perfringens ATCC13124.

Figure 1

The Effect of BL on the Growth Performance and Immune Organ Indexes of C. perfringens-Induced Broilers

As shown in Table 3, C. perfringens infection significantly dropped (P < 0.05) the FBW, ADG, liver index and thymus index compared with the CON group. However, BL supplementation significantly reversed (P < 0.05) the decreased body weight, ADG and thymus index induced by C. perfringens infection, with no impact on reduced liver index (P > 0.05). In addition, the increased FCR induced by C. perfringens infection was reversed (P < 0.05) by BL supplementation, whereas no change (P > 0.05) of ADFI, bursa and spleen indexes were observed among the 3 groups.Table 3 Effects of BL on the growth performance and immune organ indexes of C. perfringens-induced broilers.1

Table 3Items2	Groups3	SEM4	P-value	
CON	CP	BL + CP	
IBW, g	32.248	32.704	33.197	0.231	0.253	
FBW, kg	1.760a	1.478b	1.729a	0.089	< 0.001	
ADG, g	23.031a	19.268b	22.613a	0.445	< 0.001	
ADFI, g	63.421	60.729	62.983	0.940	0.471	
FCR	2.769b	3.189a	2.800b	0.076	0.038	
Liver index, g/kg	18.905a	17.431b	17.793ab	0.261	0.049	
Thymus index, g/kg	3.506a	1.975c	2.780b	0.159	< 0.001	
Bursa index, g/kg	0.962	1.002	0.719	0.074	0.242	
Spleen index, g/kg	2.170	2.133	2.263	0.076	0.784	
1 Data were expressed as means and SEM. n = 10.

2 IBW: initial body weight; FBW: final body weight; ADG: average daily gain; ADFI: average daily feed intake; FCR, feed conversion ratio.

3 CON, basal diet; CP, basal diet + 1 × 109 CFU C. perfringens in gavage; BL + CP, basal diet containing 7.5 × 106 CFU/g Bacillus licheniformis + 1×109 CFU C. perfringens in gavage.

4 SEM: standard error of the mean.

a-c Within a row, means without a common superscript differ significantly (P < 0.05).

The Effect of BL on the Immune and Anti-Inflammatory Capacity of C. perfringens-Induced Broilers

The levels of immunoglobulin and inflammatory cytokines in serum of broilers were shown in Table 4. Compared with the CON group, C. perfringens infection significantly reduced (P < 0.05) the levels of immunoglobulins (IgA, IgM, and IgY) and anti-inflammatory IL-10, increased (P < 0.05) the levels of pro-inflammatory cytokines, such as IL-1β, IL-2, IL-18, and TNF-α, and showed no significant impact (P > 0.05) on IL-6. These results indicated that C. perfringens challenge induced severe inflammation and disturbance of immune functions in broilers. Nevertheless, BL supplementation pronouncedly restored (P < 0.05) the levels of immunoglobulins and IL-10, which were approximate to that in the CON group. Moreover, the levels of IL-1β, IL-2, IL-6, IL-18, and TNF-α were markedly decreased (P < 0.05) in the BL + CP group compared with the CP group. Furthermore, no change (P > 0.05) of IL-6 in serum was exhibited between the CON and CP, CON and BL + CP groups.Table 4 Effects of BL on the serum immunoglobulins and cytokines of C. perfringens-induced broilers.1

Table 4Items2	Groups3	SEM4	P-value	
CON	CP	BL + CP	
IgA, ng/mL	47.916a	41.082b	48.732a	0.997	< 0.001	
IgM, μg/mL	0.735a	0.650b	0.756a	0.012	< 0.001	
IgY, ng/mL	0.203a	0.165b	0.212a	0.005	< 0.001	
IL-1β, ng/L	4.136b	5.426a	3.297c	0.217	< 0.001	
IL-2, ng/L	24.687b	33.038a	19.869c	1.426	< 0.001	
IL-6, ng/L	56.312ab	60.160a	55.216b	0.874	0.041	
IL-18, ng/L	5.974b	8.552a	6.086b	0.433	0.012	
TNF-α, ng/L	4.462b	6.095a	4.215b	0.209	< 0.001	
IL-10, ng/L	7.715b	6.581c	8.058a	0.157	< 0.001	
1 Data were expressed as means and SEM. n = 6.

2 Ig, immunoglobulin; IL, interleukin; TNF, tumor necrosis factor.

3 CON, basal diet; CP, basal diet + 1 × 109 CFU C. perfringens in gavage; BL + CP, basal diet containing 7.5 × 106 CFU/g Bacillus licheniformis + 1×109 CFU C. perfringens in gavage.

4 SEM, standard error of the mean.

a-c Within a row, means without a common superscript differ significantly (P < 0.05).

The Effect of BL on the Antioxidant Status of C. perfringens-Induced Broilers

The activities and levels of antioxidant enzymes in serum were shown in Table 5. Compared with the CON group, the levels of T-AOC, the activities of GPx, SOD and CAT were significantly decreased (P < 0.05), while the level of MDA and the activity of T-NOS were markedly enhanced (P < 0.05) in the CP group. Not surprisingly, the reduced antioxidases and increased peroxidation products were absolutely reversed (P < 0.05) in the BL + CP group compared to the CP group. Interestingly, the level of MDA and the activity of T-NOS were even lower (P < 0.05), the activities of GPx and SOD were much higher (P < 0.05) in the BL + CP group compared to the CON group.Table 5 Effects of BL on the serum antioxidant parameters of C. perfringens-induced broilers.1

Table 5Items2	Groups3	SEM4	P-value	
CON	CP	BL + CP	
T-AOC, mmol/L	0.264a	0.170b	0.288a	0.013	< 0.001	
GPx, U/L	23.079b	19.036c	24.611a	0.610	< 0.001	
SOD, U	1.080b	0.964c	1.226a	0.030	< 0.001	
CAT, U/mL	13.655a	10.042b	14.559a	0.531	< 0.001	
MDA, μmol/L	7.199b	10.673a	5.602c	0.528	< 0.001	
T-NOS, U/mL	32.821b	38.225a	30.108c	0.860	< 0.001	
1 Data were expressed as means and SEM. n = 6.

2 T-AOC, total antioxidant capacity; GPx, glutathione peroxidase; SOD, superoxide dismutase; CAT, catalase; MDA, malondialdehyde; T-NOS, total nitric oxide synthase.

3 CON, basal diet; CP, basal diet + 1 × 109 CFU C. perfringens in gavage; BL + CP, basal diet containing 7.5 × 106 CFU/g Bacillus licheniformis + 1×109 CFU C. perfringens in gavage.

4 SEM, standard error of the mean.

a-c within a row, means without a common superscript differ significantly (P < 0.05).

The Effect of BL on the Jejunal Injury and Inflammation of C. perfringens-Induced Broilers

Parameters related to jejunal injury and inflammation were shown in Table 6. Results of DAO, D-LA, and LDH in serum, the intestinal permeability biomarkers, showed that C. perfringens challenge markedly increased (P < 0.05) the activity of DAO, and the levels of D-LA and LDH compared with the CON group, suggesting the disruption of intestinal integrity. Additionally, broilers receiving BL + CP had decreased (P < 0.05) DAO, D-LA and LDH levels compared to the ones receiving CP. For further investigation, the jejunum was pictured and the injury score was evaluated. Obvious bleeding and lesion, accessed by injury score, were observed (P < 0.05) in the CP group, which was markedly attenuated (P < 0.05) in the BL + CP group. Besides, results of jejunal mucosa samples also verified that robust release of pro-inflammatory IL-1β, IL-18, and IL-6 induced by C. perfringens infection were reversed (P < 0.05) to a large extent, except for IL-6 (P > 0.05), whereas the level of TNF-α was much lower in the BL + CP group compared to the CP group (P < 0.05).Table 6 Effects of BL on the jejunal injury and inflammation of C. perfringens-induced broilers.1

Table 6Items2	Groups3	SEM4	P-value	
CON	CP	BL + CP	
DAO, U/L	38.238b	44.057a	38.064b	1.054	0.019	
D-LA, μg/L	16.297b	18.035a	15.013b	0.385	0.001	
LDH, μmol/L	0.307b	0.346a	0.269c	0.008	< 0.001	
Jejunal injury score	0.375b	2.250a	0.750b	0.250	0.002	
IL-1β, pg/g protein	1.661b	2.722a	1.737b	0.169	0.007	
IL-18, pg/g protein	3.766b	6.512a	4.471ab	0.440	0.018	
IL-6, pg/g protein	21.388b	37.282a	30.566a	1.867	< 0.001	
TNF-α, ng/g protein	1.476ab	1.939a	1.218b	0.101	0.004	
1 Data were expressed as means and SEM. n = 6–8.

2 DAO: diamine oxidase; D-LA: D-lactic acid; LDH: lactate dehydrogenase; IL: interleukin; TNF: tumor necrosis factor.

3 CON, basal diet; CP, basal diet + 1 × 109 CFU C. perfringens in gavage; BL + CP, basal diet containing 7.5 × 106 CFU/g Bacillus licheniformis + 1×109 CFU C. perfringens in gavage.

4 SEM: standard error of the mean.

a-c Within a row, means without a common superscript differ significantly (P < 0.05).

The Effect of BL on the Jejunal Barrier Function and Inflammation-Related Pathway of C. perfringens-Induced Broilers

For further investigate the potential mechanism of BL on C. perfringens-induced jejunal inflammation, we measured the gene expressions of biomarkers related to barrier function and NLRP3 inflammasome. Tight junction proteins including Claudin1, Occludin, and Zo1 were essential for maintaining the barrier functions. Results in Figures 2A–2C showed that the mRNA expressions of Claudin1, Occludin, and Zo1 were significantly reduced (P < 0.05) after C. perfringens challenge compared with the CON group, while the levels of Claudin1 and Occludin were restored (P < 0.05) and no change of Zo-1 (P > 0.05) was showed in the BL + CP group compared with the CP group. In addition, the over-release of cytokines and the activation of NLRP3 inflammasome also contributed to the inflammatory response. In our study, the mRNA expressions of Tnf-α, Il1b and Il18, Nlrp3 and Caspase1 were significantly improved (P < 0.05) in the CP group compared with the CON group (Figures 2D–2H). More importantly, the expressions of Il1b, Nlrp3 and Caspase1 were reversed (P < 0.05) (Figures 2E, 2G–2H), whereas the expressions of Tnf-α and Il18 showed no difference (P < 0.05) (Figure 2, Figure 2) in the BL + CP group as comparing to the CP group.Figure 2 The effect of BL on the jejunal barrier function and inflammation-related pathway of C. perfringens-induced broilers. The mRNA expression of Claudin1 (A), Occludin (B), Zo1 (C), Tnf-α (D), Il1b (E), Il18 (F), Nlrp3 (G), and Caspase1 (H). a, b Different letters indicated statistically significant (P < 0.05). CON, basal diet; CP, basal diet + 1 × 109 CFU C. perfringens in gavage; BL + CP, basal diet containing 7.5 × 106 CFU/g Bacillus licheniformis + 1 × 109 CFU C. perfringens in gavage.

Figure 2

The Effect of BL on the Cecal SCFAs of C. perfringens-Induced Broilers

Microbial homeostasis and derived metabolites played essential roles in regulating intestinal health, among which SCFAs have been paid widely attentions in recent years. As shown in Table 7, C. perfringens infection markedly reduced (P < 0.05) the contents of cecal acetic acid, butyric acid, valeric acid, isobutyric acid, and isovaleric acid, with no impact (P > 0.05) on propionic acid. After the supplementation with BL, the levels of isobutyric acid and isovaleric acid were pronouncedly increased (P < 0.05) compared with the CP group, but still markedly reduced (P < 0.05) compared with the CON group. However, the decreased acetic acid, butyric acid, and valeric acid were not restored (P > 0.05) by BL. Besides, there were no difference (P > 0.05) of propionic acid among the 3 groups.Table 7 Effects of BL on cecal SCFAs of C. perfringens-induced broilers.1

Table 7Items	Groups2	SEM3	P-value	
CON	CP	BL + CP	
Acetic acid, ng/μL	790.828a	650.670b	758.462ab	21.287	0.011	
Propionic acid, ng/μL	369.113	286.813	304.594	22.339	0.300	
Butyric acid, ng/μL	331.229a	224.870b	253.784b	13.083	< 0.001	
Valeric acid, ng/μL	76.875a	63.706b	67.966ab	2.077	0.021	
Isobutyric acid, ng/μL	37.415a	26.428c	31.531b	1.280	< 0.001	
Isovaleric acid, ng/μL	38.094a	26.745c	32.295b	1.276	< 0.001	
1 Data were expressed as means and SEM. n = 7.

2 CON, basal diet; CP, basal diet + 1 × 109 CFU C. perfringens in gavage; BL + CP, basal diet containing 7.5 × 106 CFU/g Bacillus licheniformis + 1×109 CFU C. perfringens in gavage.

3 SEM, standard error of the mean.

a-c Within a row, means without a common superscript differ significantly (P < 0.05).

The Effect of BL on Microbial Diversity of C. perfringens-Induced Broilers

To investigate whether the alleviating effect of BL on C. perfringens-induced intestinal inflammation relied on the participation of gut microbiota, we profiled the cecal microbiota by sequencing. Shannon, Simpson, Ace, and Chao are pivotal indicators for evaluating microbial α-diversity. Our results showed that no significance (P > 0.05) of Shannon and Simpson indexes was observed among the 3 groups (Figures 3A and 3B), indicating that C. perfringens infection and BL supplementation had no impact on bacterial community diversity. In addition, the Ace and Chao indexes were markedly reduced (P < 0.05) in the BL + CP group compared with the CON and CP groups (Figures 3C and 3D), which inferred decreased bacterial richness induced by BL supplementation and C. perfringens infection. Furthermore, β-diversity was evaluated by PCA and PCoA analysis. The result of PCA plot (PC1: 8.15% and PC2: 6.93%) exhibited significant separations among 3 groups (Figure 3E), which was also verified by PCoA plot (PC1: 23.66% and PC2: 15.64%) (Figure 3F).Figure 3 The effect of BL on microbial diversity of C. perfringens-induced broilers. (A) Shannon index; (B) Simpson index; (C) Ace index; (D) Chao index; (E) PCA plot based on ASV level; (F) PCoA plot based on ASV level. a, b Different letters indicated statistically significant (P < 0.05). CON, basal diet; CP, basal diet + 1×109 CFU C. perfringens in gavage; BL + CP, basal diet containing 7.5 × 106 CFU/g Bacillus licheniformis + 1×109 CFU C. perfringens in gavage.

Figure 3

The Effect of BL on Microbial Structure and Composition of C. perfringens-Induced Broilers

Based on above results, we further analyzed the relative abundance of bacteria in different taxonomy levels. As shown in Figure 4A, Firmicutes and Bacteroidota were the predominant bacteria, followed by Desulfobacterota, at the phylum level. In addition, Bacteroidaceae, Lachnospiraceae, Prevotellaceae, Ruminococcaceae, Rikenellaceae, Oscillospiraceae, unclassified_o_Bacteroidales, Acidaminococcaceae, norank_o_Clostria_UCG-014, and Erysipelatoclostridiaceae were the TOP10 bacteria at the family level (Figure 4B). Among which, the relative abundance of Bacteroidaceae, Lachnospiraceae and Prevotellaceae accounted for approximately half of all bacteria (Figure 4B). The results of differential analysis at the family level showed that Lachnospiraceae, Ruminococcaceae, Rikenellaceae, Lactobacillaceae, Eubacterium_coprostanoligenes_group, Bacillaceae, Selenomonadaceae, unclassified_c_Bacilli, Streptococcaceae, and norank_o_Oscillosporales were the TOP10 differential bacteria (P < 0.05) induced by BL and C. perfringens (Figure 4C). In detail, the relative abundances of Lachnospiraceae and unclassified_c_Bacilli were markedly increased in the CP group, which was reversed in the BL + CP group (Figure 4C). Moreover, the relative abundances of Ruminococcaceae and Eubacterium_coprostanoligenes_group were downregulated, whereas Rikenellaceae, Lactobacillaceae, Bacillaceae, Streptococcaceae, and norank_o_Oscillosporales were upregulated in the CP and BL + CP groups compared with the CON group (Figure 4C). Interestingly, only the relative abundance of Selenomonadaceae was decreased in the CP group, but increased in the BL + CP group (Figure 4C). Furthermore, the relative abundance of bacteria and differential species at the genus level were also evaluated. Our data showed that Bacteroides, Prevotellaceae_UCG-001, f_Lachnospiraceae, Rikenellaceae_RC9_gut_group, Faecalibacterium, o_Bacteroidales, Phascolarctobacterium, Clostridia_UCG-014, Alistipes, and Ruminococcus_torques_group were the TOP10 bacteria (Figure 4D). Among which, Bacteroides was the major species accounting for 20% proportion, followed by Prevotellaceae_UCG-001 and f_ Lachnospiraceae (Figure 4D). Specifically, the TOP10 differential bacteria at the genus level was listed in Figure 4E. The relative abundance of f_Lachnospiraceae were markedly increased in the CP group, which was reversed in the BL + CP group (Figure 4E). In turn, the relative abundance of Megamonas was significantly reduced in the CP group, which was abolished in the BL + CP group (Figure 4E). Besides, Rikenellaceae_RC9_gut_group, Lactobacillus, and Bacillus were increased, whereas Faecalibacterium and Eubacterium_coprostanoligenes_group were decreased in the CP and BL + CP groups compared with the CON group (Figure 4E). Only Lachnoclostridium was reduced in the BL + CP group compared with the CON and BL groups (Figure 4E). LEfSe analysis further validated that f_Ruminococcaceae, Faecalibacterium, Eubacterium_coprostanoligenes_group, and Merdibacter were dominant in the CON group, and Lachnoclostridium was the advantageous bacteria in the CP group, while Rikenellaceae_RC9_gut_group, Lactobacillus, Megamonas, and Bacillus were the superior species in the BL + CP group (Figure 4F).Figure 4 The effect of BL on microbial structure and composition of C. perfringens-induced broilers. (A) The relative abundance of TOP10 phyla; (B) The relative abundance of TOP10 family; (C) The relative abundance of differential TOP10 family; (D) The relative abundance of TOP10 genus; (E) The relative abundance of differential TOP10 genus; (F) LEfSe linear discriminant analysis (LDA) score based on genus level. LDA score higher than 4 was exhibited. *0.01 < P < 0.05 and **P < 0.01. CON, basal diet; CP, basal diet + 1 × 109 CFU C. perfringens in gavage; BL + CP, basal diet containing 7.5 × 106 CFU/g Bacillus licheniformis + 1 × 109 CFU C. perfringens in gavage.

Figure 4

DISCUSSION

Typical pathogens including E. coli, Salmonella, and Clostridium severely threated the health of animals, and further caused death and economic loss. Among which, C. perfringens-induced enterocolitis in animals has become a pivotal public health problem (Mehdizadeh Gohari et al., 2021). Due to the overuse of antibiotics and the increased antimicrobial resistance, seeking effective agents targeting C. perfringens was essential for treating associated diseases in the future. Thus, our study firstly evaluated the antibacterial ability of probiotic BL on 3 typical pathogens, and found that C. perfringens was the strongest bacteria suppressed by BL in vitro, which inferred that BL may be the potential agents for treating C. perfringens infection. Then, C. perfringens-infected broilers was established, and our results showed that dietary supplemented with BL markedly improved the growth performance, immune functions, anti-inflammatory capacity, and antioxidant status, alleviated jejunal inflammation and barrier dysfunction through inhibiting the NLRP3 inflammasome. More importantly, BL markedly increased the levels of cecal SCFAs and restored the microbial balance to protect against C. perfringens-induced necrotic enteritis in broilers.

Oxford Cup experiment was usually used to evaluate the antibacterial anticity of different materials against pathogens. Our study showed that BL supernatant inhibited the growth of EC and ST to some extent, but strongly suppressed C. perfringens as indicated by 29 mm of inhibitory zone. Previous studies have inferred that different Lactobacillus plantarum (L. plantarum) supernatants and L. coryniformis supernatant strongly inhibited EC, Staphylococcus aureus (SA), Salmonella and ST (Lei et al., 2020; Xu et al., 2023b). However, another study reported that the probiotics mixture (B. subtilis and L. acidophilus) showed lower sensitive to EC as indicated by 9.81 mm of antibacterial circle (Liang et al., 2021), which was similar to our results. In addition, our research firstly showed that BL supernatant strongly inhibited C. perfringens, other study also exhibited B. subtilis supernatant directly inhibited C. perfringens growth (Wang et al., 2023). Co-culture experiment in this study indicated that BL supernatant disrupted cell walls and induced cytoplasmic shrinkage and vacuolization to further kill pathogens. In addition, we found that the inhibitory rates of BL supernatant on C. perfringens were higher as 63.27%. Other study also showed that EC and SA were almost all dead at 24 h when co-cultured with L. coryniformis supernatant, while ST was undetectable after 48 h (Xu et al., 2023b). Together, these results suggested that BL markedly inhibited the growth of C. perfringens.

Numerous reports have demonstrated that C. perfringens infection reduced growth performance, impaired immune functions and induced oxidative stress in broilers (Hussein et al., 2020; Zhao et al., 2020; Sandvang et al., 2021; Sun et al., 2023; Wang et al., 2023; Zhang et al., 2023). More importantly, C. perfringens-induced intestinal inflammation was the major cause for pathological damage and various diseases (Khalique et al., 2020; Zhao et al., 2022; Bendary et al., 2022). Although the CP ATCC13124 strain, used in this study, may result in mild infection due to the absence of netB or tpeL genes involved in virulence/pathogenicity. Our lab previously showed the CP infection at 1 × 109 CFU for 5 d can successfully induced NE challenge model in broiler chickens (Yang et al., 2023a; Zhang et al., 2023). Immune organs, the origin of different immune cells, are parts of host immune system responsible for defensing stimulus and maintaining homeostasis. Immune organs, such as liver, thymus, spleen, and bursa, are often used to evaluate the immune function of broilers (Qin et al., 2024). Our study showed that BL supplementation reversed the decreased body weight and thymus index, restored the FCR disturbed by C. perfringens. Similar to our results, Zhao et al. also indicated that probiotic B. licheniformis H2 markedly alleviated the decrease of BW and the increase of food intake induced by C. perfringens in broilers (Zhao et al., 2020). Moreover, compound probiotics (L. johnsonii BS15 and B. licheniformis H2) or alone also enhanced the growth performance compared with the CP group in broilers (Sun et al., 2023). Li et al. found that C. perfringens challenge decreased the ADG, and increased FCR, which was reversed by dietary supplementation with L. acidophilus (Li et al., 2018b). In controversial to our results partially, B. subtilis supplementation showed no impact on liver, bursa, spleen, and thymus percentages compared with C. perfringens-infected broilers, but markedly improved the FBW, feed efficiency, and survival rate (Hussein et al., 2020). Another study showed that dietary with L. plantarum 16 (Lac16) significantly ameliorated C. perfringens-induced side effects of growth performance (BW and FCR) and attenuated C. perfringens-induced enlarged bursa of fabricius (Wang et al., 2021). Furthermore, immunoglobulins, as the first line of the immune system, mediated multiple immune responses by interacting with specific receptors and immune mediators (Xiao et al., 2024). IgA, IgM, and IgY are typical immunoglobulins for broilers and play important regulatory roles in immune functions. Our study showed that C. perfringens infection reduced the levels of IgA, IgM, and IgY in serum, which was totally reversed by BL supplementation. Previous study also indicated that B. licheniformis HJDY01 supplementation attenuated the decreased levels of serum and jejunum mucosa immunoglobulins in C. perfringens-infected broilers (Zhang et al., 2023). Another study showed that C. perfringens challenge had no influence on serum immunoglobulin content (Yang et al., 2023a), whereas B. subtilis supplementation markedly increased the concentrations of serum IgG, IgA, and IgM in broiler chickens (Qiu et al., 2021). Although some differences existed between our results and other studies, the majority of literatures supported the idea of the protective effect of probiotics on enhancing the immune functions in C. perfringens-infected broilers.

C. perfringens-induced enterocolitis was usually accomplished by the robust release of typical cytokines (Wang et al., 2023; Zhang et al., 2023), including IL-1β, IL-6, TNF-α, IL-10, and IL-2. Above cytokines played important roles in inflammation occurrence, immune response, cell differentiation, tissue repair, and host homeostasis (Neurath, 2014). Moreover, the imbalance between pro-inflammatory and anti-inflammatory cytokines can lead to disease perpetuation and tissue destruction (Neurath, 2014). Previous studies have inferred that Bacillus strains can reduce pro-inflammatory IL-1β and IL-6, and improve anti-inflammatory IL-10 in pigs and broilers in the context of normal or injury conditions (Li et al., 2018a; Xu et al., 2021). Furthermore, B. subtilis DSM29784 reduced serum IFN-γ and TNF-α in C. perfringens-infected broilers, while C. perfringens and B. subtilis DSM29784 showed no impact on IL-1β and IL-6 (Wang et al., 2023). In line with reported studies, our research also showed that C. perfringens infection reduced anti-inflammatory IL-10, increased pro-inflammatory IL-1β, IL-2, IL-18, and TNF-α in serum, which was reversed by BL supplementation. Similarly, our results found that both C. perfringens infection and BL supplementation showed no impact on IL-6 compared with the CON group. Thus, our finding showed consistent results with others in consideration of the regulatory effect of Bacillus on C. perfringens-induced inflammation.

Growing evidences have suggested that overwhelming production of free radical, such as ROS, can trigger oxidative stress, which further led to inflammatory response. In cells and host, there is a balanced system namely antioxidant systems which plays a pivotal role in oxidative stress. The antioxidant system is consisted of antioxidant enzymes including GPx, SOD, and CAT, which form the first line of defense against free radicals in organisms (Xiao et al., 2024). In addition, excess of free radicals resulted in lipid peroxidation, and contributed to the production of MDA (Xiao et al., 2019). Previous studies have showed that probiotic bacteria exhibited pretty antioxidative properties as improving the antioxidant system or decreasing radical generation (Wang et al., 2017; Xu et al., 2023b). In consistent with others’ research (Zhao et al., 2020; Tang et al., 2022), we also found that C. perfringens infection reduced serum T-AOC, GPx, SOD, and CAT, increased MDA and T-NOS, indicating the oxidative stress of broilers. Conversely, BL supplementation enhanced the antioxidant capacity of broilers by increasing antioxidant enzymes and decreasing MDA and T-NOS in our research. In line with our data, another study also exhibited that dietary probiotic B. licheniformis H2 significantly reduced the MDA, increased SOD, CAT and T-AOC in serum, ileum, and liver to protect against C. perfringens-induced oxidative injury of broilers (Zhao et al., 2020). Together, these results proved that BL attenuated oxidative stress to potentially protect against C. perfringens-infected broilers.

The intestine was the most susceptible organ to pathogenic bacteria infection, which resulted in a series of diseases, such as necrotic enteritis in broilers induced by C. perfringens (Keyburn et al., 2013; Feng et al., 2020). The gut homeostasis was regulated by immune cells and derived cytokines, tight junctions, microbiota and derived metabolites (Arenas-Gómez et al., 2023). DAO, D-LA, and LDH, the intestinal permeability biomarkers, were markedly increased by C. perfringens infection in our study, which was abolished by BL supplementation. Moreover, robust release of cytokines, including IL-1β, IL-6, IL-18, and TNF-α, and decreased mRNA expression of tight junction proteins, Claudin1, Occludin, and Zo1, were observed in the C. perfringens-infected broilers, whereas BL supplementation markedly inhibited inflammatory cytokines and barrier function disturbance. The jejunal injury score further validated the protective effect of BL on C. perfringens-infected broilers. Similar to our results, previous studies also indicated that probiotics supplementation reduced the intestinal lesions score compared with C. perfringens-infected broiler (Hussein et al., 2020; Wang et al., 2023). Consistently, Gong et al. indicated that the damaged intestinal structure and shorter villus were observed in C. perfringens-infected birds, which were recovered by probiotic Lac16 treatment (Gong et al., 2020). However, C. perfringens infection significantly increased the expression of intestinal barrier-related genes, such as Claudin1, Zo-1, and Muc2 (Gong et al, 2020), which was contrary to our study and others (Tang et al., 2022). In line with our results, C. perfringens infection increased the mRNA expression of pro-inflammatory cytokines IL-6 and IL-1β, while Lac16 treatment significantly decreased the expression levels of IL-6 (Gong et al., 2020). Another study also found that dietary supplementation of B. licheniformis-fermented products effectively relieved the C. perfringens-induced jejunal lesions of broilers (Cheng et al., 2021). Furthermore, C. perfringens infection disturbed jejunal mucosal structure and villi, reduced the mRNA expressions of Claudin1, Occludin, Muc2 and Zo1, whereas B. subtilis DSM29784 and L. acidophilus played beneficial effects on intestinal integrity and barrier function (Li et al., 2018b; Wang et al., 2023). However, partially in controversial to our results, C. perfringens infection showed no impact on jejunal IFN-γ, IL-1β, and IL-6, as well as B. subtilis DSM29784 supplementation, whereas jejunal TNF-α were increased in the C. perfringens-infected group and attenuated by B. subtilis DSM29784 supplementation in broilers (Wang et al., 2023). We speculated that the beneficial effect of probiotics on intestinal health may be due to the strains difference and addition duration, animal ages and breeds. Numerous findings have showed that the expression of IL-1β and IL-18 was regulated by inflammasomes, especially typical NLRP3 (Zong et al., 2021; Cheng et al., 2024). Moreover, previous studies have showed that C. perfringens triggered inflammatory response through the mediation of NLRP3 (Yamamura et al., 2019; Liu et al., 2023). Zhang et al. reported that B. licheniformis HJDY01 inhibited the expression levels of genes involved in the NLRP3 inflammasome pathway in C. perfringens-challenged broilers (Zhang et al., 2023). Similarly, we also observed C. perfringens infection increased the mRNA expressions of Nlrp3 and Caspase1 to further induce the release of IL-11β and IL-18, which was suppressed by BL supplementation, indicating the inactivation of Nlrp3 inflammasome. Together, BL protected intestinal health and barrier functions against C. perfringens infection though the inactivation of NLRP3 inflammasome.

In recent years, the importance of gut microbiota and derived metabolites in intestinal health has been highlighted (Arenas-Gómez et al., 2023). Among the metabolites, SCFAs, which originate from dietary fibers, are the linkage between host nutrition and intestinal homeostasis (Martin-Gallausiaux et al., 2021). Other study showed that the levels of total SCFAs, acetate, and butyrate of the C. perfringens-infected broilers were significantly decreased compared with the uninfected broilers, which was significantly reversed by Lac16 supplementation (Wang et al., 2021). In our study, C. perfringens infection markedly reduced the contents of acetic acid, butyric acid, valeric acid, isobutyric acid, and isovaleric acid, while the levels of isobutyric acid and isovaleric acid were pronouncedly increased in the BL + CP group. In addition, oxidative stress and inflammatory response have been associated with an altered gut microbiota. Our study showed that C. perfringens infection showed no impact on microbial α-diversity, but significantly changed β-diversity, which was similar to the results of others (Sun et al., 2023). However, BL supplementation reduced microbial richness as accessed by lower Ace and Chao indexes, and markedly altered β-diversity as indicated by PCA and PCoA plots, which was in line with other studies (Zhao et al., 2022; Wang et al., 2023; Zhang et al., 2023). Previous study revealed that dietary BL supplementation maintained the ileum microbiota homeostasis disturbed C. perfringens infection in chickens (Xu et al., 2018). Our study also indicated that BL supplementation changed the microbial composition and diversity to support the idea of restoring the fecal microbiota disorder caused by C. perfringens infection in broilers. Moreover, Firmicutes and Bacteroidota were the predominant phyla in broilers no matter with or without C. perfringens infection and BL supplementation. Additionally, SCFAs-producing bacteria including Eubacterium_coprostanoligenes_group, Lachnospiraceae, Megamonas, Faecalibacterium, and Lactobacillus was changed in our study. Eubacterium was reported to regulate lipid metabolism and widely regarded as lactic acid- and SCFA-producing bacteria (Wei et al., 2021; Tang et al., 2022). Faecalibacterium, whose level was positive related with body weight (Lundberg et al., 2021), was reduced in the CP group, which was in line with lower body weight by C. perfringens infection in the present study. The majority members of Lachnospiraceae were reported as the main producers of SCFAs, and also associated with different diseases occurrence (Vacca et al., 2020). Our study found that the proportion of Lachnospiraceae was increased in the CP group, but decreased in the BL + CP group, indicating the detrimental effect on intestinal health. Previous studies have inferred that Megamonas can utilize carbohydrate polymers to produce acetic acid, propionic acid and lactic acid, and the relative abundance of Megamonas was closely with intestinal inflammation and metabolic dysfunction (Yang et al., 2023b). The proportion of Megamonas was decreased in the CP group, but increased in the BL + CP group, which can partially explain the change of acetic acid level and inflammatory response. Moreover, Lactobacillus was generally considered as beneficial microbes and responsible for lactic acid production (Huang et al., 2022). However, the effect of Lactobacillus on disease onset or prevention was inconsistent and needed further investigation. Our study showed that the relative abundance of Lactobacillus was increased in the CP and BL + CP groups compared with the CON group, which was in line with the study (Zhao et al., 2022). In consistent with our results, another study also reported that the relative abundance of Lactobacillus was also found to increase in cecal microbiota populations, possibly due to a feedback mechanism against CP infection by the broilers (Lu et al., 2020). Together, our data and others indicated that C. perfringens challenge triggered the microbiota dysbiosis in broilers (Tang et al., 2022; Zhao et al., 2022; Sun et al., 2023; Zhang et al., 2023). More importantly, BL supplementation reshaped the microbial composition and structure to increase the SCFAs and maintain the intestinal health in broilers.

Therefore, our experiment showed that BL supernatant exhibited strong antibacterial activity against 3 pathogenic bacteria in vitro, especially C. perfringens. In vivo results showed BL supplementation significantly increased the growth performance, immune functions, and antioxidant capacity, alleviated the inflammatory response, jejunal damage, and microbial dysbiosis of C. perfringens-infected broilers, among which NLRP3 inflammasome pathway was involved. However, the concrete mechanism of NLRP3 inflammasome activation in the progression of intestinal inflammation and how BL regulated the pathway still remain unclear. In addition, the role of microbiota should be verified by further experiments, such as fecal microbiota transplantation. Finally, the mechanism of specific probiotics-BL in our study on different animals or stage period needs more investigation.

CONCLUSIONS

In summary, our study demonstrated that BL supernatant exhibited strong antibacterial activity against 3 pathogenic bacteria in vitro, especially C. perfringens. Moreover, BL supplementation in diet effectively improved growth performance, immune functions, anti-inflammatory capacity, and antioxidant status of C. perfringens-infected broilers. Furthermore, C. perfringens-induced intestinal injury, inflammation, barrier dysfunction was alleviated by BL, which may due to the involvement of NLRP3 inflammasome. In addition, supplemented with BL markedly increased the levels of cecal SCFAs, such as isobutyric acid and isovaleric acid. Mechanistically, BL changed microbial diversity and composition, especially the SCFAs-producing bacteria including Eubacterium_coprostanoligenes_group, Lachnospiraceae, Megamonas, Faecalibacterium, and Lactobacillus, to protect against C. perfringens-induced necrotic enteritis in broilers.

DISCLOSURES

The authors declare no conflicts of interest.

ACKNOWLEDGMENTS

This research was funded by the Postdoctoral Science Foundation of China (2023M733150 ), the National Natural Science Foundation of China (32202687 ), and Research and Development Project of Zhejiang Agricultural and Forestry University (2023LFR016 ).

Data Availability Statement: The data in this article are available on request from the Corresponding author. The 16S high-throughput sequencing data produced in this study was deposited in the NCBI Sequence Read Archive (SRA) database (accession number: PRJNA1144664).

Author Contributions: Conceptualization, Xiao Xiao and Songke Qin; Data curation, Xiao Xiao and Songke Qin; Formal analysis, Xiao Xiao and Tiantian Cui; Funding acquisition, Xiao Xiao and Caimei Yang; Investigation, Tiantian Cui, Jinsong Liu, Yanping Wu and Yifan Zhong; Methodology, Tiantian Cui, Yanping Wu and Yifan Zhong; Project administration, Caimei Yang; Resources, Jinsong Liu; Software, Caimei Yang; Supervision, Xiao Xiao and Caimei Yang; Validation, Yanping Wu; Visualization, Yifan Zhong; Writing – original draft, Xiao Xiao; Writing – review & editing, Xiao Xiao, Songke Qin and Caimei Yang. All authors have read and agreed to the published version of the manuscript.
==== Refs
REFERENCES

Arenas-Gómez C.M. Garcia-Gutierrez E. Escobar J.S. Cotter P.D. Human gut homeostasis and regeneration: the role of the gut microbiota and its metabolites Crit Rev Microbiol 49 2023 764 785 36369718
Bendary M.M. Abd El-Hamid M.I. El-Tarabili R.M. Hefny A.A. Algendy R.M. Elzohairy N.A. Ghoneim M.M. Al-Sanea M.M. Nahari M.H. Moustafa W.H. Clostridium perfringens associated with foodborne infections of animal origins: insights into prevalence, antimicrobial resistance, toxin genes profiles, and toxinotypes Biology (Basel) 11 2022 551
Cheng Y. Xiao X. Fu J. Zong X. Lu Z. Wang Y. Escherichia coli K88 activates NLRP3 inflammasome-mediated pyroptosis in vitro and in vivo Biochem. Biophy. Rep. 38 2024 101665
Cheng Y.H. Horng Y.B. Dybus A. Yu Y.H. Bacillus licheniformis-fermented products improve growth performance and intestinal gut morphology in broilers under Clostridium perfringens challenge J Poult Sci 58 2021 30 39 33519284
Dahiya J.P. Hoehler D. Wilkie D.C. Van Kessel A.G. Drew M.D. Dietary glycine concentration affects intestinal Clostridium perfringens and lactobacilli populations in broiler chickens Poult. Sci. 84 2005 1875 1885 16479944
Dolan G.P. Foster K. Lawler J. Amar C. Swift C. Aird H. Gorton R. An epidemiological review of gastrointestinal outbreaks associated with Clostridium perfringens, North East of England, 2012-2014 Epidemiol. Infect. 144 2016 1386 1393 26567801
Feng Y. Fan X. Zhu L. Yang X. Liu Y. Gao S. Jin X. Liu D. Ding J. Guo Y. Hu Y. Phylogenetic and genomic analysis reveals high genomic openness and genetic diversity of Clostridium perfringens Microbial. Genomics 6 2020 mgen000441
Forti K. Cagiola M. Pellegrini M. Anzalone L. Di Paolo A. Corneli S. Severi G. De Giuseppe A. Generation of recombinant baculovirus expressing atoxic C-terminal CPA toxin of Clostridium perfringens and production of specific antibodies BMC Biotechnol. 20 2020 7 31992276
Gong L. Wang B. Zhou Y. Tang L. Zeng Z. Zhang H. Li W. Protective effects of Lactobacillus plantarum 16 and Paenibacillus polymyxa 10 against Clostridium perfringens infection in broilers Front Immunol 11 2020 628374
Huang R. Wu F. Zhou Q. Wei W. Yue J. Xiao B. Luo Z. Lactobacillus and intestinal diseases: mechanisms of action and clinical applications Microbiol. Res. 260 2022 127019
Hussein E.O.S. Ahmed S.H. Abudabos A.M. Suliman G.M. Abd El-Hack M.E. Swelum A.A. N. A. A. Ameliorative effects of antibiotic-, probiotic- and phytobiotic-supplemented diets on the performance, intestinal health, carcass traits, and meat quality of Clostridium perfringens-infected broilers Animals (Basel) 10 2020 669
Keyburn A.L. Portela R.W. Sproat K. Ford M.E. Bannam T.L. Yan X. Rood J.I. Moore R.J. Vaccination with recombinant NetB toxin partially protects broiler chickens from necrotic enteritis Vet Res 44 2013 54 23865568
Khalique A. Zeng D. Shoaib M. Wang H. Qing X. Rajput D.S. Pan K. Ni X. Probiotics mitigating subclinical necrotic enteritis (SNE) as potential alternatives to antibiotics in poultry AMB Express 10 2020 50 32172398
Kiu R. Hall L.J. An update on the human and animal enteric pathogen Clostridium perfringens Emerg. Microbes. Infect. 7 2018 141 30082713
Lei S. Zhao R. Sun J. Ran J. Ruan X. Zhu Y. Partial purification and characterization of a broad-spectrum bacteriocin produced by a Lactobacillus plantarum zrx03 isolated from infant's feces Food Sci. Nutr. 8 2020 2214 2222 32405378
Li Y. Zhang H. Su W. Ying Z. Chen Y. Zhang L. Lu Z. Wang T. Effects of dietary Bacillus amyloliquefaciens supplementation on growth performance, intestinal morphology, inflammatory response, and microbiota of intra-uterine growth retarded weanling piglets J. Anim. Sci. Biotechnol. 9 2018 22 29564121
Li Z. Wang W. Liu D. Guo Y. Effects of Lactobacillus acidophilus on the growth performance and intestinal health of broilers challenged with Clostridium perfringens J. Anim. Sci. Biotechnol. 9 2018 25 29599973
Liang W. Li H. Zhou H. Wang M. Zhao X. Sun X. Li C. Zhang X. Effects of Taraxacum and Astragalus extracts combined with probiotic Bacillus subtilis and Lactobacillus on Escherichia coli-infected broiler chickens Poult. Sci. 100 2021 101007
Lin T. Bian H. Sun Z. Wang X. Liu F. Wang D. Inactivation of Clostridium perfringens C1 spores by the combination of mild heat and lactic acid Foods 11 2022 3771
Liu Y. Lei Y.X. Li J.W. Ma Y.Z. Wang X.Y. Meng F.H. Wu Y.J. Wang N. Liang J. Zhao C.Q. Yang Y. Chen G.X. Yu S.X. G protein-coupled receptor 120 mediates host defense against Clostridium perfringens infection through regulating NOD-like receptor family pyrin domain-containing 3 inflammasome activation J. Agric. Food Chem. 71 2023 7119 7130 37115810
Lu M. Li R.W. Zhao H. Yan X. Lillehoj H.S. Sun Z. Oh S. Wang Y. Li C. Effects of Eimeria maxima and Clostridium perfringens infections on cecal microbial composition and the possible correlation with body weight gain in broiler chickens Res. Vet. Sci. 132 2020 142 149 32575030
Lundberg R. Scharch C. Sandvang D. The link between broiler flock heterogeneity and cecal microbiome composition Anim. Microbiome 3 2021 54 34332648
Martin-Gallausiaux C. Marinelli L. Blottière H.M. Larraufie P. Lapaque N. SCFA: mechanisms and functional importance in the gut Proc. Nutr. Soc. 80 2021 37 49 32238208
Mehdizadeh Gohari I. A. N. MLi J. Shrestha A. Uzal F. A. M. B Pathogenicity and virulence of Clostridium perfringens Virulence 12 2021 723 753 33843463
Neurath M.F. Cytokines in inflammatory bowel disease Nat Rev Immunol 14 2014 329 342 24751956
Posthaus H. Kittl S. Tarek B. Bruggisser J. Clostridium perfringens type C necrotic enteritis in pigs: diagnosis, pathogenesis, and prevention J Vet Diagn Invest 32 2020 203 212 31955664
Qin S. Xiao X. Dai Z. Zhao G. Cui Z. Wu Y. Yang C. Effects of Bacillus licheniformis on growth performance, immune and antioxidant functions, and intestinal microbiota of broilers Poult Sci 103 2024 103210
Qiu K. Li C.L. Wang J. Qi G.H. Gao J. Zhang H.J. Wu S.G. Effects of dietary supplementation with bacillus subtilis, as an alternative to antibiotics, on growth performance, serum immunity, and intestinal health in broiler chickens Front. Nutr. 8 2021 786878
Sandvang D. Skjoet-Rasmussen L. Cantor M.D. Mathis G.F. Lumpkins B.S. Blanch A. Effects of feed supplementation with 3 different probiotic Bacillus strains and their combination on the performance of broiler chickens challenged with Clostridium perfringens Poult. Sci. 100 2021 100982
Sun N. Xue Y. Wei S. Wu B. Wang H. Zeng D. Zhao Y. Khalique A. Pan K. Zeng Y. Shu G. Jing B. Ni X. Compound probiotics improve body growth performance by enhancing intestinal development of broilers with subclinical necrotic enteritis Probiotics Antimicrob Proteins 15 2023 558 572 34735679
Talukdar P.K. Udompijitkul P. Hossain A. Sarker M.R. Inactivation strategies for Clostridium perfringens spores and vegetative cells Appl. Environ. Microbiol. 83 2017 e02731-16
Tang Y. Zhang X. Wang Y. Guo Y. Zhu P. Li G. Zhang J. Ma Q. Zhao L. Dietary ellagic acid ameliorated Clostridium perfringens-induced subclinical necrotic enteritis in broilers via regulating inflammation and cecal microbiota J. Anim. Sci. Biotechnol. 13 2022 47 35436978
Vacca M. Celano G. Calabrese F.M. Portincasa P. Gobbetti M. De Angelis M. The controversial role of human gut lachnospiraceae Microorganisms. 8 2020 573 32326636
Wang B. Zhou Y. Mao Y. Gong L. Li X. Xu S. Wang F. Guo Q. Zhang H. Li W. Dietary supplementation with lactobacillus plantarum ameliorates compromise of growth performance by modulating short-chain fatty acids and intestinal dysbiosis in broilers under Clostridium perfringens challenge Front Nutr 8 2021 706148
Wang Y. Wu Y. Wang Y. Xu H. Mei X. Yu D. Wang Y. Li W. Antioxidant properties of probiotic bacteria Nutrients 9 2017 521
Wang Y. Xu Y. Cao G. Zhou X. Wang Q. Fu A. Zhan X. Bacillus subtilis DSM29784 attenuates Clostridium perfringens-induced intestinal damage of broilers by modulating intestinal microbiota and the metabolome Front. Microbiol. 14 2023 1138903
Wei W. Jiang W. Tian Z. Wu H. Ning H. Yan G. Zhang Z. Li Z. Dong F. Sun Y. Li Y. Han T. Wang M. Sun C. Fecal g. Streptococcus and g. Eubacterium_coprostanoligenes_group combined with sphingosine to modulate the serum dyslipidemia in high-fat diet mice Clin. Nutr. 40 2021 4234 4245 33608131
Xiao X. Cheng Y. Song D. Li X. Hu Y. Lu Z. Wang F. Wang Y. Selenium-enriched Bacillus paralicheniformis SR14 attenuates H(2)O(2)-induced oxidative damage in porcine jejunum epithelial cells via the MAPK pathway Appl. Microbiol. Biotechnol. 103 2019 6231 6243 31147754
Xiao X. Guo K. Liu J. Liu Y. Yang C. Xu Y. Deng B. The effect of sodium alginate-coated nano-zinc oxide on the growth performance, serum indexes and fecal microbial structure of weaned piglets Animals 14 2024 146
Xu B. Shaoyong W. Wang L. Yang C. Chen T. Jiang X. Yan R. Jiang Z. Zhang P. Jin M. Wang Y. Gut-targeted nanoparticles deliver specifically targeted antimicrobial peptides against Clostridium perfringens infections Sci. Adv. 9 2023 eadf8782 37774026
Xu S. Lin Y. Zeng D. Zhou M. Zeng Y. Wang H. Zhou Y. Zhu H. Pan K. Jing B. Ni X. Bacillus licheniformis normalize the ileum microbiota of chickens infected with necrotic enteritis Sci. Rep. 8 2018 1744 29379124
Xu X. Qiao Y. Peng Q. Shi B. Probiotic Properties of Loigolactobacillus coryniformis NA-3 and in vitro comparative evaluation of live and heat-killed cells for antioxidant, anticancer and immunoregulatory activities Foods 12 2023 1118 36900635
Xu Y. Yu Y. Shen Y. Li Q. Lan J. Wu Y. Zhang R. Cao G. Yang C. Effects of Bacillus subtilis and Bacillus licheniformis on growth performance, immunity, short chain fatty acid production, antioxidant capacity, and cecal microflora in broilers Poult. Sci. 100 2021 101358
Yamamura K. Ashida H. Okano T. Kinoshita-Daitoku R. Suzuki S. Ohtani K. Hamagaki M. Ikeda T. Suzuki T. Inflammasome activation induced by Perfringolysin O of Clostridium perfringens and its involvement in the progression of gas gangrene Front. Microbiol. 10 2019 2406 31708887
Yang T. Sun Y. Dai Z. Liu J. Xiao S. Liu Y. Wang X. Yang S. Zhang R. Yang C. Dai B. Microencapsulated sodium butyrate alleviates immune injury and intestinal problems caused by Clostridium perfringens through gut microbiota Animals (Basel) 13 2023 3784 38136821
Yang X. Zhang M. Liu Y. Wei F. Li X. Feng Y. Jin X. Liu D. Guo Y. Hu Y. Inulin-enriched Megamonas funiformis ameliorates metabolic dysfunction-associated fatty liver disease by producing propionic acid NPJ Biofilms Microbiomes 9 2023 84 37925493
Zhang R. Qin S. Yang C. Niu Y. Feng J. The protective effects of Bacillus licheniformis against inflammatory responses and intestinal barrier damage in broilers with necrotic enteritis induced by Clostridium perfringens J. Sci. Food Agric. 103 2023 6958 6965 37309567
Zhao Y. Zeng D. Wang H. Qing X. Sun N. Xin J. Luo M. Khalique A. Pan K. Shu G. Jing B. Ni X. Dietary probiotic Bacillus licheniformis H2 enhanced growth performance, morphology of small intestine and liver, and antioxidant capacity of broiler chickens against Clostridium perfringens-induced subclinical necrotic enteritis Probiotics Antimicrob Proteins 12 2020 883 895 31713770
Zhao Y. Zeng Y. Zeng D. Wang H. Sun N. Xin J. Zhou M. Yang H. Lei L. Ling H. Khalique A. Rajput D.S. Gan B. Wan Z. Yao Z. Fang J. Pan K. Shu G. Jing B. Zhang D. Ni X. Dietary probiotic supplementation suppresses subclinical necrotic enteritis in broiler chickens in a microbiota-dependent manner Front. Immunol. 13 2022 855426
Zong X. Xiao X. Jie F. Cheng Y. Jin M. Yin Y. Wang Y. YTHDF1 promotes NLRP3 translation to induce intestinal epithelial cell inflammatory injury during endotoxic shock Sci. China Life Sci. 64 2021 1988 1991 33825148
