
==== Front
Nat Commun
Nat Commun
Nature Communications
2041-1723
Nature Publishing Group UK London

51301
10.1038/s41467-024-51301-0
Article
N1-Methylpseudouridine and pseudouridine modifications modulate mRNA decoding during translation
Monroe Jeremy 1
http://orcid.org/0000-0002-6425-9770
Eyler Daniel E. 1
Mitchell Lili 2
http://orcid.org/0000-0002-2722-582X
Deb Indrajit 3
Bojanowski Abigail 1
http://orcid.org/0000-0001-7796-8827
Srinivas Pooja 4
http://orcid.org/0000-0002-8821-688X
Dunham Christine M. 4
http://orcid.org/0000-0003-1061-5482
Roy Bijoyita 2
Frank Aaron T. 135
http://orcid.org/0000-0002-7763-9262
Koutmou Kristin S. kkoutmou@umich.edu

1
1 https://ror.org/00jmfr291 grid.214458.e 0000 0004 1936 7347 Department of Chemistry, University of Michigan, Ann Arbor, MI USA
2 https://ror.org/04ywg3445 grid.273406.4 0000 0004 0376 1796 RNA and Genome Editing, New England Biolabs Inc., Ipswich, MA USA
3 https://ror.org/00jmfr291 grid.214458.e 0000 0004 1936 7347 Department of Biophysics, University of Michigan, Ann Arbor, MI USA
4 https://ror.org/03czfpz43 grid.189967.8 0000 0004 1936 7398 Department of Chemistry, Emory University, Atlanta, GA USA
5 https://ror.org/049d04r12 grid.508567.9 Present Address: Computational Chemistry, Arrakis Therapeutics, Waltham, MA USA
16 9 2024
16 9 2024
2024
15 81199 6 2022
2 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
The ribosome utilizes hydrogen bonding between mRNA codons and aminoacyl-tRNAs to ensure rapid and accurate protein production. Chemical modification of mRNA nucleobases can adjust the strength and pattern of this hydrogen bonding to alter protein synthesis. We investigate how the N1-methylpseudouridine (m1Ψ) modification, commonly incorporated into therapeutic and vaccine mRNA sequences, influences the speed and fidelity of translation. We find that m1Ψ does not substantially change the rate constants for amino acid addition by cognate tRNAs or termination by release factors. However, we also find that m1Ψ can subtly modulate the fidelity of amino acid incorporation in a codon-position and tRNA dependent manner in vitro and in human cells. Our computational modeling shows that altered energetics of mRNA:tRNA interactions largely account for the context dependence of the low levels of miscoding we observe on Ψ and m1Ψ containing codons. The outcome of translation on modified mRNA bases is thus governed by the sequence context in which they occur.

Chemical modification of mRNA nucleobases alters hydrogen bonding during translation. Here the authors show that the N1-methylpseudouridine (m1ψ), used in therapeutics, does not change translation rate but modestly modulates its fidelity in a codon-position and tRNA dependent manner.

Subject terms

RNA
Ribosome
tRNAs
https://doi.org/10.13039/100001309 Research Corporation for Science Advancement (Research Corporation) Cottrell Scholar Koutmou Kristin S. https://doi.org/10.13039/100000002 U.S. Department of Health & Human Services | National Institutes of Health (NIH) R35 GM128836 Koutmou Kristin S. https://doi.org/10.13039/100000001 National Science Foundation (NSF) CAREER 2045562 Koutmou Kristin S. https://doi.org/10.13039/100000057 U.S. Department of Health & Human Services | NIH | National Institute of General Medical Sciences (NIGMS) R01GM093278 Dunham Christine M. issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Chemically modified nucleosides are present in all organisms, often playing essential roles in key cellular processes including splicing and translation1–3. Defects in ribosomal RNA (rRNA) and transfer RNA (tRNA) modifying enzymes are linked to a host of deleterious human health outcomes, illustrating the importance of RNA modifications in protein synthesis4–7. There are over 150 unique modifications reported in RNAs that range in size and complexity from isomerized or saturated nucleosides (e.g. pseudouridine and dihydrouridine) to large, chemically diverse functional groups (e.g. NAD+, N6-threonylcarbamoyladenosine, glycan and farnesyl)8–11. RNA modifications have been widely studied for almost three quarters of a century and until recently were thought to be almost exclusively incorporated into non-coding RNA species (ncRNAs). However, the transcriptome wide mapping of 13 RNA modifications revealed that protein coding messenger RNAs (mRNAs) can also contain modifications at thousands of sites12,13. This discovery raised the possibility that mRNA modifications might play a previously underappreciated role in post-transcriptionally regulating gene expression.

The majority of enzymes that modify mRNAs also catalyze their incorporation into ncRNAs central to protein synthesis8. Like their protein post-translational counterparts, mRNA post-transcriptional modifications are generally present at sub-stoichiometric levels, with transcripts existing in a mixed population of modified and unmodified states14–17. Together these circumstances make ascertaining the impact of mRNA modifications on translation challenging. In cells, any changes to protein output observed when RNA modifying enzymes are removed cannot be directly attributed to alterations in a particular mRNA’s modification status. Therefore, studies using reconstituted translation systems, where it is possible to uniformly change the modification status of an mRNA without impacting that of ncRNA, have been particularly useful for assessing the consequences of mRNA modifications on translation elongation18. Although these reconstituted systems are typically bacterial in origin, the core mechanism of elongation phase of translation is fairly well conserved between bacteria and eukaryotes19–21. Initial studies reveal that modifications commonly slow the ribosome, though some only do so only in particular mRNA sequence contexts18. Additionally, a subset of mRNA modifications, including pseudouridine (Ψ) and inosine (I), also modulate codon decoding by the ribosome to varying degrees22–25. These findings suggest that there is a broad range of possible consequences when the ribosome encounters an mRNA modification. Developing a framework for understanding how individual modifications impact translation in differing sequence contexts will be crucial as researchers seek to uncover which of the thousands of chemically modified positions reported in mRNA codons are the most likely to have consequences for protein synthesis in cells.

In addition to being present in naturally occurring RNA molecules, modifications are also heavily incorporated in RNA-based therapeutics and mRNA vaccines26–29. Indeed, the mRNA transcripts that form the basis of many currently available COVID-19 mRNA vaccines substitute every uridine nucleoside with N1-methylpseudouridine (m1Ψ)30. The addition of m1Ψ limits the cellular innate immune response to dramatically stabilize the mRNA transcript, and ultimately increase the amount of protein synthesized31–34. Recent studies in a lysate-based translation system suggest that m1Ψ slows the ribosome in a manner that can be alleviated by the addition of membranes35. However, there is limited information available directly evaluating how m1Ψ can influence the rate and fidelity of amino acid addition, apart from studies establishing the translational accuracy of the carefully engineered COVID mRNA vaccine constructs36,37. This is an important question to ask because m1Ψ shares much of its structure with pseudouridine (Ψ) (Fig. 1A), a modification that has been shown to change translation speed and tRNA selection22,25,38–40. Furthermore, recent findings indicate that m1Ψ promote low levels of +1 ribosomal frameshifting on the COVID mRNA vaccine sequence, likely promoted by slowed-down translation32,36,37. Even subtle changes in translation rates or fidelity have the potential to impact protein folding or function41–44. Therefore, establishing if there are situations in which m1Ψ can alter translation will be critical for the continued design of mRNA-based therapeutics and vaccines in addition to understanding how different types of chemical moieties and contexts impact translation.Fig. 1 Cognate amino acid addition is modestly increased on UUm1Ѱ, but not m1Ѱ UU or Um1ѰU, codons.

A The chemical structures of the nucleobases we investigated. B The formation of fMet-Phe (MF) dipeptide as a function of time by E. coli ribosomes containing 35S-fMet-tRNAfMet bound to an AUG start codon in the P site, and unmodified (black circles – UUU, n = 23 reactions divided between 2 experiments) or modified (blue squares - m1ΨUU (n = 36 reactions conducted in 3 experiments), green diamonds - Um1ΨU (n = 45 reactions over 4 experiments), red triangles - UUm1Ψ (n = 44 reactions/3 experiments)) codons in the A site. C The K½ curve for RF1. Fitted kobs values (n = 12 independent measurements of kobs) for RF1-catalyzed 35S-fMet release on UAA (circles) or m1ΨAA (squares) are displayed as a function of [RF1]. D The K½ curve for RF2. Fitted kobs values (n = 11 independent measurements of kobs) for RF2-catalyzed 35S-fMet release on an UAA (black circles) or m1ΨAA (blue squares) are displayed as a function of [RF2]. Error bars in (C) and (D) indicate the standard error of the fitted value of kobs. Source data are provided as Source Data file.

To ascertain the molecular level consequences of m1Ψ codon modifications on ribosome decoding, we compared the translation of unmodified and m1Ψ- modified codons in both a fully reconstituted bacterial in vitro translation system and HEK293 cells. These studies reveal that, in contrast to Ψ, the presence of a single m1Ψ does not substantially reduce the rate constant for cognate amino acid addition. However, m1Ψ does influence the accuracy of amino acid addition. We demonstrate that Ψ and m1Ψ can both impede and enhance alternative tRNA selection depending on the surrounding sequence context and identity of the tRNA. Comparison of how Ψ and m1Ψ modifications affect translation reveal that uridine base isomerization and methylation each contribute to the ability of m1Ψ to perturb mRNA decoding. Computational modeling of tRNAIle,UAG bound to modified and unmodified Phe (UUU) codons in the context of the A site suggests that changes in the energies of mRNA:tRNA interactions likely account for the context dependent effects of Ψ and m1Ψ we observe. These findings demonstrate that Ψ and m1Ψ modulate ribosome decoding and have the potential to impact the speed and accuracy of protein production from both native and therapeutic mRNA sequences.

Results

m1Ψ modestly impacts the rate constant for Phe addition in some sequence contexts

We used a fully reconstituted E. coli in vitro translation system to evaluate the consequences of incorporating m1Ψ into mRNA codons on translation elongation and termination. In contrast to reporter-based studies in cells and lysates, the in vitro system we implemented is not influenced by extra-translational factors that can change observed protein levels (e.g. RNases and proteases) and allows us to directly and quantitatively examine individual steps along the translation pathway45. This E. coli translation system has long been used to study translation elongation because tRNA binding sites and ribosome peptidyl-transfer center are highly conserved between eukaryotic and bacterial ribosomes19–21.

The rate constants for amino acid addition were measured on unmodified (UUU) and m1Ψ modified (m1ΨUU, Um1ΨU, and UUm1Ψ) phenylalanine (Phe) codons (Fig. 1B). We chose to first evaluate amino acid incorporation rates on a UUU codon because the kinetics of Phe addition on UUU is well established, and UUU codons are present in the Pfizer/BioNTech mRNA COVID-19 vaccine sequence30. Our translation reactions were initiated by mixing E. coli 70 S ribosome initiation complexes (ICs; 35S-labeled formylmethionine-tRNAfMet [35S-fMet] bound to an AUG in the P site and Phe codon in the A site) with an excess of ternary complexes (TCs; Phe-tRNAPhe•EF-Tu•GTP). Reactions were quenched at select time points, and the unreacted 35S-fMet and 35S-fMet-Phe products visualized by electrophoretic TLC (eTLC) (Supplementary Fig. 2A). These studies reveal that cognate Phe incorporation on m1Ψ modified codons is largely unchanged, though we observe a  very slight (2 ± 0.3 -fold) increase in the rate constant for Phe addition when m1Ψ is in the third position in the codon (Fig. 1B, Supplementary Fig. 2B, Supplementary Table 1). Similarly, the inclusion of m1Ψ across all codon positions (m1Ψm1Ψm1Ψ) results in no observable defect in Phe addition.

All three stop codons begin with uridine (UAA, UAG, UGA) ensuring that modified stop codons will be present in synthetic mRNA-based vaccines and therapeutics. We evaluated the ability of bacterial class I release factors (RF1 and RF2) to hydrolyze peptidyl-tRNA bonds and terminate translation on m1Ψ modified stop codons. To accomplish this, we reacted termination complexes (E. coli 70 S ribosomes with 35S-fMet bound to an AUG in the P site, and a universal stop codon positioned in the A site (UAA, m1ΨAA)) with varying concentrations of RF1 and RF2 (0.05-10 μM). The reactions were quenched at a range of time points and 35S-fMet hydrolyzed by RFs was detected on an eTLC (Supplementary Figs. 3 and 4). The observed rate constants for peptide release (kobs,max) on UAA and m1ΨAA codons are equivalent (~0.1 s−1) and comparable previously published termination rates on an unmodified UAA codon (Supplementary Tables 2 and 3)46,47. Effects on K1/2 were minimal (Fig. 1C, D, Supplementary Tables 2, 3) and not statistically significant. In sum, we do not expect m1Ψ to impede translation termination in cells unless the concentration of release factors becomes severely limited, or, the termination codon is in a particularly poor sequence context48,49. This supposition is supported by numerous observations that reporter peptides and therapeutic RNA sequences generated from fully m1Ψ-substituted mRNAs yield protein products of the expected length31,36,50.

m1Ψ influences aminoacyl-tRNA selection by the ribosome in a context dependent manner

Chemical modifications to mRNA nucleobases can change the propensity of the ribosome to incorporate alternative amino acids into a growing polypeptide chain18. In comparison to uridine, m1Ψ possesses a repositioned, methylated nitrogen in its pyrimidine ring (Fig. 1A). These two changes provide m1Ψ the opportunity to alter the conformational fit of an mRNA in the ribosome, and potentially change the strength and pattern of mRNA:tRNA interactions. Consistent with this idea, Ψ, which shares a repositioned nitrogen with m1Ψ, was previously shown to enhance the reaction of some non-cognate tRNAs on UUU codons in vitro and in HEK293 cells22. To begin examining if m1Ψ similarly influences aminoacyl-tRNA (aa-tRNA) selection, we qualitatively evaluated the impact of m1Ψ on the propensity of Phe codons to react with tRNAs beyond tRNAPhe. In these assays, 70 S E. coli initiation complexes were generated with unmodified (UUU) and modified (m1ΨUU, Um1ΨU, and UUm1Ψ) codons in the A site, and reacted with EF-Tu containing ternary complexes formed using a mixture of total tRNA aminoacylated either by reacting all 20 amino acids with S100 (total aa-tRNAaa), or with a single amino acid and aminoacyl tRNA synthetase (Phe-tRNAPhe, Ser-tRNASer, Leu-tRNALeu, Ile-tRNAIle and Val-tRNAVal)45. Relative to UUU, we observed that m1ΨUU reacts more robustly with total aa-tRNAaa, and promotes the production of higher-levels of miscoded Met-Ile (MI) and Met-Val (MV) peptides (Fig. 2A). Um1ΨU and UUm1Ψ codons also exhibit different levels of reactivity with multiple tRNAs than an unmodified UUU (Supplementary Fig. 5).Fig. 2 m1Ψ impacts amino acid selectivity in vitro and in HEK293 cells.

A Representative eTLC displaying dipeptide products from translation reactions performed with 70 S initiation complexes (ICs) containing an unmodified UUU or m1ΨUU codon in the A site and total E. coli tRNA aminoacylated with a single amino acid (aa-TC). Relative to ICs containing a UUU codon in the A site, higher levels of miscoded MI and MV dipeptide products and lower levels of MS were generated from m1ΨUU containing ICs. B Summary of amino acid substitutions observed by mass spectrometry in a luciferase peptide incorporated on m1Ψ-containing mRNAs translated in 293H cells (Supplementary Table 8). Source data are provided as Source Data file.

Using the information obtained from our qualitative screens, we selected to further study three tRNAs that either appeared to react more (tRNAIle(GAU)), less (tRNALeu(CAG)), or to the same extent (tRNASer(UGA)) on unmodified and m1Ψ modified codons (Fig. 2A). We performed multiple-turnover tRNA selection assays to quantitatively characterize differences in tRNA selection for these three tRNAs and the three modified codons. In these assays, saturating concentrations of ternary complex were reacted with initiation complex. Energy regeneration mix and EF-Ts were included to catalyze re-formation of ternary complex after rejection and maintain a saturating concentration of ternary complex51. The rate constants we observed for dipeptide formation reflects not only the rate constant for the rate-limiting step in peptide bond formation, but also the many other steps involved in formation and breakdown of the post-accommodation elongating ribosome complex. As such, these measurements should not directly be compared to the single-turnover rate constants measured for phenylalanine incorporation in Fig. 1. Our approach contrasts with that of a recent study which uses neither saturating aa-tRNA nor energy regeneration to maintain saturation, resulting in second-order kinetics36.

We find that tRNA identity and the position of m1Ψ within a codon influence the rate constants for amino acid substitution (Fig. 3, Supplementary Table 4). For example, m1Ψ substitution at the first position in the Phe codon (m1ΨUU) does not change the kobs values for Leu or Ser incorporation but increases the rate constant for Ile addition by 2.2 ± 0.4-fold (Figs. 3D and 4A, Supplementary Table 4). This differs markedly from what we observed on Um1ΨU-modified codons, which have a much larger effect on tRNA selection. The kobs values are significantly reduced for Ile (10 ± 2-fold) and Leu (4 ± 1-fold) addition, while the rate constant for Ser mis-incorporation is conversely increased by 3.5 ± 0.4-fold (Fig. 3D, Supplementary Table 4). Substitution at the wobble position (UUm1Ψ) generally had modest impacts on the rate constants for amino acid incorporation; decreasing the kobs for Leu addition (2 ± 0.3-fold), while not impacting the kobs values for Ile and Ser addition (Fig. 3D, Supplementary Table 4). The findings of our kinetic studies are generally consistent with our initial qualitative assays (Figs. 2, 3 and Supplementary Fig. 5), and together indicate that m1Ψ codon modifications can both increase and decrease the ability of Phe UUU codons to react with a variety of tRNAs in the A site.Fig. 3 Ѱ and m1Ѱ impact the rates of the ribosome reacting with near-cognate tRNAs in a sequence context dependent manner.

Plots of dipeptide formation as a function of time (seconds). Miscoding reactions were performed with E. coli ICs containing 35S-fMet-tRNAfMet bound to an AUG start codon in the P site, and unmodified (black circles-UUU) or modified (blue squares-Ψ/m1ΨUU, green diamonds-UΨ/m1ΨU, red triangles-UUΨ/m1Ψ) codons in the A site. Purified ICs were reacted with TCs containing (A) Ile-tRNAIle(GAU), (B) Leu-tRNALeu(CAG)), or (C) Ser-tRNASer(UGA). At least 30 independent time points were collected for each IC in experiments conducted over three or more separate days. D The fitted rate constants (kobs) for isoleucine, leucine, and serine misincorporation on Ψ- and m1Ψ- modified codons relative to the fitted rate constants for isoleucine, leucine, and serine misincorporation on a UUU codon. Each ratio has an n of 1 (since each is computed by dividing kobs,modified/kobs,UUU) and error bars were calculated by propagating the 95% confidence intervals of each fitted rate constant. Source data are provided as Source Data file.

Fig. 4 Changes in the energetics of mRNA:tRNA interactions correlate with observed differences in Phe and Ile incorporation on Ψ− and m1Ψ− containing codons.

A Summary of data in Supplementary Tables 4 and 5 displaying how a Ψ and m1Ψ impact the rate constants for the reaction of near-cognate tRNAs. B, C Summary of MM data. Gray bars reflect the change in energy for interactions between a modified mRNA position (Ψ/m1Ψ) and the base paring (B) tRNAPhe(GAA) or (C) tRNAIle(GAU) residue (ΔEbp) relative to an unmodified mRNA U. Black bars reflect the total change in energy (ΔEΣΨ/m1Ψ:X-Y) for interactions between a modified mRNA position (Ψ/m1Ψ) and three (B) tRNAPhe(GAA) or (C) tRNAIle(GAU) residues (the base paired nucleotide, and nucleotides 5′ and 3′ the bp) relative to an unmodified mRNA U. D Molecular model of an unmodified sequence coding for a Phe UUU codon and a tRNAIle(GAU). The hypermodification t6A37 is also shown on the tRNA.

Uridine isomerization contributes to observed changes in amino acid substitution on m1Ψ containing codons

To determine how the C5-glycoside uridine isomerization and N1-methylation individually impact the ability of m1Ψ to modulate amino acid incorporation, we measured the rate constants for Leu, Ile and Ser mis-incorporation on Ψ modified Phe codons (ΨUU, UΨU and UUΨ). Ψ was selected for study because it contains the same isomerized uridine base as m1Ψ, but lacks the methylation at position N1 (Fig. 1A). The impact of Ψ on Ile and Leu insertion was similar to what we observed when m1Ψ is present in codons (Fig. 3, Supplementary Table 5). For example, the rate constant for Ile is significantly decreased (10 ± 2 -fold) when Ψ is incorporated at the second codon position (UΨU), while Leu is added more slowly when Ψ is at any position in the codon (Fig. 3, Supplementary Table 5). In contrast to m1Ψ, Ser incorporation occurs with a 4 ± 0.5-fold faster rate constants when Ψ is at the first and second positions in the codon and is not influenced by Ψ substitution at the wobble position (UUΨ). These observations indicate that uridine isomerization largely accounts for changes in how the ribosome decodes some tRNAs for m1Ψ−substituted mRNAs. However, comparing the reactivity profiles of Ψ and m1ΨUU reveals the N1 methyl group can suppress the effect of uridine isomerization on the rate constants for amino acid misincorporation by other tRNAs (e.g. ΨUU vs m1ΨUU reacting with tRNASer (UGA)) (Fig. 3D).

Amino acid substitution in HEK293 cells increases on some m1Ψ containing codons

Our in vitro translation data reveal that m1Ψ and Ψ affect tRNA selection by E. coli ribosomes in different ways depending on their sequence context. We next asked if m1Ψ has similar effects on amino acid selection in eukaryotic cells. To approach this question, we transfected luciferase encoding mRNAs transcribed in vitro with either UTP or m1ΨTP into HEK293 cells where they were translated. The base composition of the unmodified and modified mRNAs was assessed by liquid chromatography-mass spectrometry (LC-MS) and is consistent between the unmodified and modified mRNA species we generated (Supplementary Fig. 7). We observed increased levels of luciferase protein expression in the m1Ψ-substituted mRNAs, consistent with previous reports (Supplementary Figs. 8 and 9)22. The luciferase proteins generated from both unsubstituted and m1Ψ-substituted mRNAs were purified and analyzed by mass spectrometry to identify amino acid substitutions.

Our mass spectrometry data analyses focused on a specific luciferase peptide with favorable ionization characteristics (Fig. 2B)22. ~1% of the amino acids in this peptide were substituted. This is a >20-fold increase over the level of amino acid substitution we previously observed for peptides generated from an unmodified version of the same luciferase reporter (<0.05% of their amino acids substituted)22. Nonetheless, the levels of misincorporation are still quite low. m1Ψ-mediated substitutions were observed on multiple codons (e.g. UUU, UAU), though we did not observe amino acid substitutions above background for every U-containing codon (e.g. UGG) (Supplementary Table 6). The highest levels of substitution were observed on the two Phe codons (UUU and UUC). Similar to our in vitro observations, serine and isoleucine/leucine amino acid substitutions were detected on both Phe codons with a >6-fold increased frequency of substitution over peptide from unmodified mRNA (Fig. 2B, Supplementary Tables 6–8)22. Isoleucine and leucine have the same mass and therefore cannot be distinguished in this assay. We also noted that the likelihood of substitutions occurring was not uniform across m1Ψ containing codons. The levels of miscoding that we detect are consistent with what we would predict from our in vitro studies, as is the heterogeneity of amino acid substitution on m1Ψ-modified codons (Figs. 2, 3). Furthermore, the lack of uniformity in amino acid substitution was also seen in our previous findings indicating that Ψ also increases the levels of amino acid misincorporation in the same luciferase reporter peptide22. Our results collectively suggest that the extent of misincorporation on any codon containing a C5-glyocside uridine isomer is low and strongly depends on both the codon and sequence context in which the modification is present.

Impact of m1Ψ and Ψ on duplex melting temperatures is context dependent

Ψ and m1Ψ are known to affect the melting temperature of RNA duplexes31,52,53. We sought to better understand the role of sequence context in our kinetic data by assaying the melting temperature of short (7–8 basepairs) duplexes containing U, Ψ and m1Ψ, modeling our approach after that used in a recent study36. The Tms we observed (~23 °C) were far below those reported previously (~78 °C) on similar sequences36, and several mismatch-containing duplexes were too unstable to allow a Tm determination. The Tm values that we measure are in line with Tms predicted by programs for estimating the physical properties of RNAs such as OligoCalc54. The unusually high Tm values (>70 °C) previously reported likely reflect hydrolysis of RNA in the presence of magnesium at elevated temperatures, which also results in increased absorbance. Ultimately, we successfully assayed U, Ψ, and m1Ψ in the context of a perfect duplex, a duplex containing a mismatch, and in a duplex adjacent to a wobble base pair (Supplementary Figs. 10–12). Pseudouridine increased the melting temperature of all duplexes, as expected, though the extent to which Ψ substitutions increased Tm values varied with the surrounding sequence context (ΔTm = 1.5–4 °C). The effects of m1Ψ varied even more dramatically depending on the sequence context, and sometimes differed from that of Ψ. For example, in the CXU context, pseudouridine stabilized the duplex, while m1Ψ did not. In the UXU context, with a 3′ U:G wobble pair, Ψ and m1Ψ provided equal stabilization.

Ψ-derived modifications change the energetics of mRNA:tRNA nucleoside interactions in the ribosome A site

We sought to understand why Ψ and m1Ψ modifications alter the interactions between mRNAs and tRNAs during translation in a position dependent manner (Figs. 1–4A). Although our melting temperature studies were generally consistent with our translation assays and suggest that modification-induced alterations base pairings fluctuate with sequence context, the changes in Tm measured between oligonucleotides outside of the ribosome structural context did not satisfactorily explain alterations in tRNA selection on Ψ and m1Ψ-containing codons that we observed. Therefore, we turned to molecular modeling (MM) and quantum mechanical calculations to examine unmodified and Ψ-, m1Ψ- and 3-methylpseudouridine (m3Ψ) modified UUU mRNA codons interacting with a tRNAPhe(AAG) and tRNAIle(UAG) in a portion of the ribosome A site (Figs. 1A, 4). Although we did not investigate the translation of m3Ψ-containing codons, we included m3Ψ in our computational studies as a positive control for a modification that should severely perturb mRNA:tRNA interactions. Methylation at the uridine N3 position removes the ability of uridine to donate a hydrogen bond and will limit tRNA binding. Our MM studies were conducted using models developed based on previously published crystal structure of the 70 S Thermus thermophilus ribosome with tRNAPhe bound on a ΨUU codon22. The MM investigations were designed to examine how the location of a modification impacts the pairwise tRNA:mRNA interaction energies. Each modification was modeled in either the first, second, or third codon position, and the energetics of tRNAPhe/Ile:mRNA interactions on modified codons were compared to those on an unmodified UUU codon (ΔE) (Fig. 4, Supplementary Data 1 and 2). Only ΔE values with magnitudes ≳1 kcal/mol are considered large enough to potentially influence mRNA:tRNA interactions.

We computed pairwise energy differences between a modified base and an unmodified base at the same position within a UUU codon. Both the change in base-pairing energy between the modified base and its partner in the tRNA were examined, as well as changes in energy derived from interactions between the modified base and neighboring tRNA bases. In general, the trends in modeled energy differences recapitulated trends in reaction free energy shown by changes in the observed rate constants for the reaction (Supplementary Fig. 13). In particular, the sum of changes in modeled energies between the modified base, its tRNA pair, and the upstream and downstream tRNA base (ΔEΣΨ/m1Ψ:tRNA-1,0,+1) were well correlated, while the individual pairwise interaction energies (Ebp) were less well correlated. The one exception was the summed energy change for m1Ψ in the second position, which predicted an increased kobs that was not borne out in the experimental data.

The in vitro translation, Tm, and modeling data all support the idea that pseudouridine-derived modifications affect the energetic landscape for codon interactions. As an additional check on our modeling, we calculated energy differences for codons containing m3Ψ, which should be strongly disruptive. Indeed, codon:anticodon pairings including this modification had significantly (+6 to +20 kcal/mol) increased interaction energies, strongly suggesting that m3Ψ-modified codons are not substrates for amino acid addition by tRNAPhe(GAA). In contrast to m3Ψ, Ψ and m1Ψ had changes in energy differences (ΔEΣΨ/m1Ψ:tRNA-1,0,+1) that ranged from significantly negative (−4.5 kcal/mol) to slightly positive (1.1 kcal/mol) depending on the modification, its position within the codon, and the anticodon. Pseudouridine substitution has small effects on both modeled energy differences (≲1 kcal/mol) and on changes in rate constant (≲2-fold) (Supplementary Fig. 13A) tRNAPhe(GAA). N1-methylpseudouridine substitution is predicted to increase codon:anticodon stability when in the second and third position (Supplementary Fig. 13A); this is observed experimentally in the third position but not in the second (Fig. 2, Supplementary Table S1).

Modeling studies were further performed with tRNAIle(GAU). The trends in calculated energy differences and changes in experimental rate constants correlated well for both Ψ and m1Ψ (Supplementary Fig. 13). This is likely attributable to differences in which steps in the kinetic mechanism the measured kobs values reflected, which were single-turnover with respect to amino acid addition (Fig. 1B) but multiple-turnover with respect to tRNA selection (Fig. 3). In the multiple turnover scenario, small energy differences in selection are effectively integrated over many cycles of tRNA selection, making the kobs in this experiment more sensitive to changes in tRNA selection than those in a true single-turnover experiment, such as those with tRNAPhe(GAA). Net energy differences (ΔEΣΨ/m1Ψ:tRNA-1,0,+1) were better correlated with kobs than individual mRNA:tRNA base pairs (ΔEbp). For m1Ψ in the first and third positions, this particularly reflects the contributions of compensatory interactions with tRNA bases adjacent to the modified base. The ΔEm1Ψ1:tRNAt6A37 interaction, for example, contributes −6.8 kcal/mol which is equal to the sum of contributions from all the other bases in the codon and anticodon. Our findings are consistent with previous studies which demonstrate that tRNA nucleotides adjacent to tRNA codon: anticodon base pairs are important determinants of mRNA decoding55. Our computational analyses generally support our experimental findings that Ψ-derived modifications differentially affect the interactions between codons and both tRNAs in context dependent manner to alter mRNA:tRNA interactions in the ribosome decoding center53,56–60 (Fig. 4, Supplementary Data 1, 2).

Discussion

During the selection of aminoacylated-tRNAs, the ribosome must compromise between the speed and accuracy of decoding. Chemical modifications of the RNAs involved in decoding (e.g. mRNA and tRNA) permit the fine tuning of this balancing act. m1Ψ modifications are heavily used in mRNA-based therapeutics and vaccines and we were interested in establishing how their inclusion in mRNA transcripts can impact translation elongation26,30. Our studies indicate that, depending on where it was located within a phenylalanine codon, a single m1Ψ substitution has little effect on the rate constant (kobs) for cognate amino acid incorporation (Fig. 1B). These findings are consistent with our melting temperature data (Supplementary Fig. 10), and the kobs values previously measured values for singly substituted Tyr codons (m1ΨAC), which were altered by <2-fold36. Similarly, the rate constants (khyd,max) for translation termination are not perturbed (Fig. 1C, D). The failure to detect defects in the rates of single amino acid incorporation on an exemplar codon does not preclude the possibility that overall translation elongation rate along an mRNA – which involves a variety of codons and ribosome translocation – is not perturbed by m1Ψ incorporation.

The small effect (if any) of m1Ψ on the ribosome reacting with cognate tRNAs depends largely on the position of the modification within a codon (Figs. 2, 3). Our computational studies reveal that the minor context-dependent effect of m1Ψ on Phe incorporation that we observe might be at least partially explained by changes in the energetics of base pairing interactions between m1Ψ-substituted UUU codons and their cognate tRNAPhe(GAA) (Fig. 4A, B), which vary depending on where m1Ψ is incorporated in the codon. Perturbations in base pairing energies can influence central steps in the translation elongation pathway including tRNA selection and accommodation51. Overall, our data support previous observations indicating that the increased protein yield observed from m1Ψ containing transcripts in cells (Supplementary Figs. 8 and 9) are largely due to m1Ψ-induced enhancements in mRNA stability and avoidance of the cell’s innate immune system33,34,50,61.

In our studies, we found that m1Ψ modestly alters tRNA interactions with the ribosome. Our kinetic investigations reveal that both m1Ψ and Ψ modifications can both enhance or limit amino acid substitution depending on aa-tRNA identity and the position of the modification within the codon (Figs. 3 and 4A). These in vitro observations are supported by cellular reporter studies indicating that m1Ψ can promote miscoding events when included in full-length transcripts expressed in human cells (Fig. 2B, Supplementary Tables 6, 8). The mass spectrometry assay does not have sufficient sensitivity to detect if there are any modified codons that exhibited lowered levels of amino acid substitution, as we might expect on Leu codons based on our kinetics. Our findings are consistent with the increase in miscoding we previously observed on Ψ-containing mRNAs in the same experimental system22. Comparison of miscoding rates on m1Ψ and Ψ-containing codons suggests that the addition of a methyl group and altered ring electronics resulting from the exchange of the nitrogen, play distinct positional and codon specific roles in the modulation of miscoding (Fig. 3). This is further supported by our MM calculations revealing that methylations (m1Ψ and m3Ψ) have larger impact on the energetics of tRNA:mRNA interactions than isomerization at the C5-position alone (Ψ) (Fig. 4).

Two studies published while this manuscript was under revision have also investigated the effects of m1Ψ in mRNA on translational fidelity in cells. Kim et al.36 expressed the SARS-CoV2 spike protein from mRNA constitutively substituted with Ψ or m1Ψ in HEK293 cells and utilized mass spectrometry to search for miscoded peptides. They achieved 39% coverage of the spike protein sequence and identified six peptide fragments with single amino acid substitutions detected in at least one sample. On average, any individual miscoded peptide was observed in 4 out of 9 samples (3 each of U, Ψ, and m1Ψ); the most-abundant/best-detected individual miscoded peptide was found in 7 out of 9 samples, though the two samples lacking the peptide were both m1Ψ samples, making reliable quantitation difficult. More recently, Mulroney et al.37 utilized multiple methods to determine that translation of m1Ψ-containing SARS-CoV2 spike protein mRNA yields +1 frameshifting products in cell culture and in mice, indicating a role for m1Ψ in frame maintenance. Although Mulroney et al.37 do not directly discuss amino acid substitutions, they observe that production of full-length spike protein from m1Ψ mRNA is increased when cells are treated with paromomycin, suggesting that m1Ψ does affect decoding by the ribosome. Although we are unable to say definitively why the results of Kim et al. differ from ours and those of Mulroney et al., we note that the constitutively-modified Pfizer mRNA vaccine sequence used in the Kim et al. study was likely experimentally optimized to minimize amino acid substitutions in human cells, which might make it a poor reporter of m1Ψ’s effects on translational fidelity.

Our data reveal that the impact of m1Ψ and Ψ on mRNA decoding depends strongly on the sequence context of the modification (Figs. 3 and 4). These findings are in line with previous work demonstrating that naturally occurring mRNA modifications can differentially affect translation depending on their location within a codon or mRNA sequence22,23,62. In this work, we go beyond observing these differences to try and identify how pseudouridine-derived modifications change the fundamental interactions between mRNAs and tRNAs in a context dependent manner. Comparison of the rate constants for amino acid misincorporation on m1Ψ and Ψ containing codons, coupled with Tm measurements and MM calculations provide evidence that fundamental changes in the energetics of mRNA:tRNA base pairing contribute to the context dependent outcomes we observe. Indeed, we find that the strongest predicted interactions between the tRNAIle anticodon and Ψ and m1Ψ modified UUU Phe codons occurs when these modifications are in the first and third position of the codon (Fig. 4D, E). This is consistent with our tRNA selection assay indicating that Ile-tRNAIle reacts more rapidly with codons containing Ψ and m1Ψ in the first and third position of a codon than in the second position (Figs. 3, 4A).

tRNA anticodon step loop (ASL) modifications have long been known to influence ribosome decoding. Our data suggest that these modifications might also contribute to the context dependence decoding on modified Ψ and m1Ψ codons. We observe that the rate constants for non-cognate tRNAs possessing hyper-modifications (t6A37 in tRNAIle(GAU), ms2i6A37 and cmo5U34 in tRNASer(UGA)) were more sensitive to the position of mRNA modifications within a codon than the tRNALeu(CAG) that contains only a methylation at position 37 (m1G37) (Fig. 4A). Additionally, our MM calculations indicate that the hypermodifications adjacent to tRNAPhe(GAA) and tRNAIle(GAU) anticodons also influence the energetics of codon:anticodon interactions with Ψ and m1Ψ, and can make tRNA interactions with a non-cognate codon up to 7.6 kcal/mol more energetically favorable. This correlates with our kinetic studies demonstrating that tRNAIle(GAU) reacts more rapidly on m1ΨUU, and is further supported by previous studies demonstrating that modified tRNA A37 nucleosides (t6A, ms2t6A,ct6A) can improve the stability of the codon:anticodon duplex through enhanced base stacking30,41,56,57,63–65. Together, our biochemical amino acid misincorporation and modeling data suggest that tRNA ASL modifications may help to mediate tRNA discrimination on and modified codons during the decoding process (Fig. 4D, E and Supplementary Fig. 5).

The ability of m1Ψ and Ψ to modestly impact ribosome speed and decoding has several implications. Given the emerging evidence that Ψ is commonly included into mRNA at increased levels under cellular stress conditions, these findings support the possibility that Ψ−derived modifications can provide the cells with a way to transiently reshape the proteome under stress to increase fitness16,22,66,67. Furthermore, this could potentially be advantageous for mRNA vaccines relative to traditional vaccine platforms; greater antigen diversity might provide broader protection against circulating virus populations than single-strain vaccine formulations, similar to the increased efficacy of multivalent vaccines. Indeed, a recent report demonstrates that +1 ribosomal frameshift products generated from the translation of m1Ψ-substituted transcripts trigger an immune response37. While potentially beneficial in the context of mRNA vaccines, even small changes translational fidelity may need to be more carefully considered in the context of other classes of mRNA therapeutics. The complex rules which govern the translational outcome of mRNA modifications such as m1Ψ are only beginning to be elucidated, and may in some cases prove to be critical to designing effective mRNA therapeutics.

Methods

In vitro ribosome amino acid addition assays

E. coli MRE600 tight coupled 70 S ribosome were prepared by sedimentation and rate zonal ultracentrifugation45. Unmodified mRNAs were generated by run-off T7 transcription of DNA oligonucleotides. mRNAs containing modified nucleotides were synthesized and HPLC purified by Dharmacon. mRNA sequences were generally of the form GGUGUCUUGCGAGGAAUAAGUGCAUU AUG UUU UAA GCCCUUCUGUAGCCA; the coding sequence is underlined. Modified mRNA had either the first, second, third position of the Phe (UUU) codon modified with m1Ψ (Supplementary Data 3). Dharmacon verified quality control via ESI-MS data (Supplementary Fig. 14). E. coli translation factor and tRNA constructs were gifted from the laboratories of Dr. Rachel Green and Dr. Yury Polikanov unless otherwise noted. Recombinant translation factors and release factors were purified via sequential affinity, ion exchange, and gel filtration chromatography steps22,45. Natively modified tRNAPhe was expressed and purified from HB101 E. coli and Ser-, Ile-, and Leu- tRNAs were expressed and purified from BL21(DE3) E. coli utilizing ion exchange and reversed-phase chromatography45. The acceptor activity of the tRNA was validated via triplicate aminoacylation assays with both the appropriate synthetase and S100 lysate.

E. coli initiation complexes (ICs) were prepared in 1 × 219 – Tris Buffer (50 mM Tris pH 7.5, 70 mM NH4Cl, 30 mM KCl, 7 mM MgCl2, 5 mM β-ME) with 1 mM GTP22,45. Ternary complexes (TCs) were formed in the same buffer but with 10 mM GTP22. Amino acid addition reactions were conducted at final concentrations of 1 μM aminoacylated tRNA, 20 μM EF-Tu, 70 nM pre-formed ICs in buffer 1 × 219 at 37 °C. Reactions were quenched with 500 mM KOH (final) on a KinTek RF-3 quench-flow apparatus. eTLCs were visualized by phosophorimaging and then quantified with ImageQuant software (Cytiva). Data was fit to the following Eq. 1, where A is the amplitude of the signal.1 FractionProduct=A⋅1−ekobs⋅t

In vitro translation termination assays

Pre-termination complexes (pre-TCs) were prepared by forming ICs on a mRNA containing the coding sequence AUG-UAA or AUG-m1ΨAA. Release assays were performed by mixing 70 nM pre-TCs with release factors (RF1 or RF2; 50 nM to 10 μM) at room temperature (~20 °C). Reaction time points were quenched in 5% formic acid. The fraction of released of f-[35S]-Met was fit to Equation 1 and K1/2 values were obtained by fitting to Eq. 2.2 khyd=kmax⋅RFK1/2+RF

In vitro translation amino acid misincorporation

Assays performed with total aa-tRNAaa were conducted by reacting ICs (70 nM final) with TCs (1 μM total tRNA aminoacylated with either S100 enzymes or specific synthetases, 40 μM EF-Tu and 10 mM GTP) at 37 °C for 15 min. Reactions were quenched with 500 mM KOH (final). The reactants and products were separated by eTLC and visualized using ImageQuant software (Supplementary Figs. 5 and 6). For assays with high kinetic resolution (e.g. Fig. 3), ICs were reacted with Ternary complexes (40 μM EF-Tu:10 μM EF-Ts: 10 μM of aminoacylated tRNA (either Ile, Leu, Ser)). These reactions were prepared and conducted as previously published45.

Luciferase mRNA transfection and expression analyses

The template for in vitro synthesis of luciferase mRNA consists of: the T7 RNA polymerase promoter, followed by an N-terminal 3× Hemagglutinin (HA) tag fused in-frame with the firefly luciferase gene, in-frame C-terminal StrepII and FLAG tags. The open reading frame spans from the 3xHA tag to the FLAG tag enabling the purification of full-length luciferase protein and not translation truncated products. The luciferase mRNA was transcribed using T7 RNA polymerase (New England Biolabs) as previously published22.

Synthesized, purified mRNAs were transfected into 293H cells using TransIT-mRNA transfection kit as recommended by the manufacturer (Mirus). Tandem purification of the luciferase translation products was performed using the FLAG tag followed by selection for the N-terminal HA tag as described previously22,68,69 Three independent transfections were performed for uridine/ N1-methylpseudouridine -containing mRNAs. The tandem-affinity purified products were analyzed on 8% SDS-PAGE, gels were then silver stained (ProteoSilver, Sigma) and processed for mass spectrometry. For western blot analyses of the luciferase protein, proteins were separated by SDS- PAGE and blotted as previously described22.

In-gel digestion and LC-MS/MS analysis

In-gel digestion and LC-MS/MS analysis were performed as previously published22. Three independent transfections were performed for each RNA (modified and unmodified) and each sample was harvested and processed independently. UPLC was performed on a Waters NanoAcquity instrument using water +0.1% formic acid as mobile phase A and acetonitrile + 0.1% formic acid as mobile phase B. Peptides were loaded at 5% mobile phase B and separated using a 5–35% B gradient over 45 min at a flow rate of 4 uL/min. Positive mode electrospray ionization with a liquid junction potential of 1.4 kV was used to introduce ions into a Thermo Scientific Q Exactive hybrid mass spectrometer. An m/z range of 300–1750 at 70,000 resolution and an AGC target of 1e6 were used. Data-dependent acquisition selected the ten most abundant precursor ions for HCD fragmentation using an isolation width of 1.6 Da, fill time of 110 ms, and an AGC target of 1e5. Peptides were fragmented using a normalized collision energy of 27, and fragment spectra were acquired with a resolution of 17,500 at m/z = 200.

Raw data files were peak-picked by Proteome Discoverer (version 2.1), and preliminary searches were performed using the MASCOT search engine (version 2.4) against the SwissProt Human FASTA file (downloaded 05/2018) modified to include the luciferase protein sequence. Search parameters included Trypsin/P specificity, up to 2 missed cleavages, a fixed modification of carbamidomethyl cysteine, and variable modifications of oxidized methionine, pyroglutamic acid for Q, and N-terminal acetylation. The processed peak list was then re-searched in MASCOT against luciferase only as described previously22, using an error-tolerant search allowing for all possible substitutions. Substitutions with a greater than 90% probability in Scaffold (v4.8.8) were added back to the original search in Proteome Discoverer and re-run using MASCOT with these included as variable modifications22. This final search was loaded into Skyline-daily (University of Washington, v4.1), extracted ion chromatograms were generated for each peptide of interest, and peaks were manually inspected for proper peak picking, isotope dot product >0.8, good fragment ion coverage, and elution times consistent with the time of MS/MS detection. The sum of the top 3 isotopes were then exported for each modification for further analysis.

Molecular modeling

Fragment molecular orbital (FMO) calculations were used to quantify the pairwise Phe UUU codon anti-codon interaction energies70–72. First, the initial coordinates of the Phe UUU codon:phe tRNA complex were taken from the X-ray crystal of the Thermus thermophilus 70 S ribosome in complex with mRNA (PDB ID: 6UO1). Starting from these coordinates, we generated six additional codon:tRNA complexes with the UUU codon changed to m1ΨUU, Um1Ψ U, Uum1Ψ, ΨUU, UΨ U, and UUΨ, respectively. The codon:tRNA complexes were then processed through CHARMM-GUI webserver add hydrogens, patch the terminal 5′ and 3′ residues, and prepare the input files for energy minimization73,74. Each complex was energy minimized with 50 steps of steepest descent (SD) and 200 steps of adopted basis Newton-Raphson (ABNR) method with a gradient tolerance of 0.001. During energy minimization, the non-bonded list was generated at a cutoff of 15.0 Å and updated heuristically; and the Lennard-Jones and electrostatic interactions were treated with the switching function. Energy minimization was carried out using the CHARMM36 nucleic force field for the RNAs and solvation effects were models using the Generalized Born using Molecular Volume (GBMV) implicit solvent75–77. The energy minimized coordinates of the complexes were used as the starting geometries for FMO calculations.

All calculations were carried out at the Møller-Plesset perturbation theory (MP2)/6-31 G* level of theory78–81. Solvation effects were modeled using the polarizable continuum model (PCM) interfaced with the FMO method82. For the FMO-MP2/6-31 G*/PCM calculations, each RNA residue was treated as a single fragment. Input files for FMO calculations we generated from the energy minimized coordinates of the codon:tRNA complexes using an in-house fragment script (https://github.com/atfrank/RNAFMO). Briefly, fragmentation was performed at the C5′-O5′ bond of the RNA residues following the approach used in the computational chemistry software Facio (version 22.1.1.32)83,84. All FMO calculations were carried out using the ab initio quantum chemistry package, general atomic and molecular electronic structure system (GAMESS) (September 2018, R3)85. The Pair interaction energy decomposition analysis (PIEDA) facility in GAMESS was used to compute and decompose the pairwise interaction energies between individual fragments (nucleotides) in the mRNA:tRNA complexes86.

Melting temperature determination

Annealing and melting were performed in a Beckman-Coulter DU-6000 equipped with the 6-position Tm cell changer and Peltier temperature control. RNA oligos were obtained from Horizon Discovery and from IDT. Stoichiometric quantities of RNA oligos were mixed in a cuvette in 20 mM sodium cacodylate, pH 7, and 100 mM NaCl at a sufficient concentration to give an A254 reading of approximately 0.5 at 8 °C. RNA oligos were annealed by heating from 10 °C to 65 °C at 5 °C/min, holding at 65 °C for 5 min, and then cooling to 8 °C at 5 °C/min. Annealing was validated by observation of the A254 trace during the annealing procedure. Following annealing, cuvettes were removed from the instrument, kept on ice, and ice-cold MgCl2 was added to each cuvette to a final concentration of 10 mM. Cuvettes were returned to the instrument and the melting experiment was performed according to the following protocol. Cuvettes were held at 8 °C for 10 min, then heated at 0.1 °C per minute to 45 °C with readings every 0.1 °C. Subsequently, samples were heated to 65 °C with readings every 5 °C. Each experiment contained one blank cuvette containing only buffer, and one cuvette for each duplex containing U, Ψ, or m1Ψ. Three independent experiments were performed on different days for each set of duplexes.

Absorbance data at 254 nm from independent experiments were normalized using Eq. 3:3 ΔAtnormalized=AtAmax−Amin

Normalized absorbance data were overlaid on the same plot and fitted using Eq. 4:4 A=mx+b1+Δbekx−Tmekx−Tm+1

This equation assumes a two-state model for melting and allows us to explicitly fit Tm as a parameter without performing material-intensive determination of heat capacities. It further assumes that the duplex and single-stranded RNAs display the same dependence of absorbance on temperature; however, due to the limited amount of data in the fully-annealed region below 10 °C, we cannot prove or disprove this assumption. The key feature of this equation is that the maximum value of its first derivative occurs at Tm, which is a characteristic it shares with the theoretically complete treatment (Turner Methods Enzymology 2009). GraphPad Prism was used for curve fitting. Reported Tms are the values determined by fitting curves to absorbance data collected in three separate experiments (~500 data points per RNA duplex) and the reported error values are the 95% confidence intervals of the fitted parameter calculated by Prism.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Supplementary information

Supplementary Information

Description of Additional Supplementary Files

Supplementary Data 1–3

Reporting Summary

Source data

Source Data

Supplementary information

The online version contains supplementary material available at 10.1038/s41467-024-51301-0.

Acknowledgements

We would like to acknowledge Dr. Tyler Smith for his thoughtful discussions and careful reading of the manuscript. We thank the following funding sources for their support: National Institutes of Health (NIGMS R35 GM128836 (K.S.K.); NIGMS R01GM093278 (C.M.D.); T32-GM008602 (P.S.)), National Science Foundation (NSF CAREER 2045562 to K.S.K.), Research Corporation for Science Advancement (Cottrell Scholar Award to K.S.K.) and New England Biolabs (NEB) Inc. (L.M. and B.R. were New England Biolabs, Inc. employees).

Author contributions

J.M., D.E., L.M., B.R., and A.B. performed key experiments. P.S. and C.M.D. prepared and provided critical reagents. J.M., D.E., L.M., and K.S.K. analyzed data. J.M., I.D., and A.T.F. performed computational work. J.M., D.E., A.T.F. and K.S.K. wrote the manuscript.

Peer review

Peer review information

Nature Communications thanks Hashim Al-Hashimi and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.

Data availability

The raw mass spectrometry data have been deposited to the ProteomeXchange Consortion (http://proteomecentral.proteomexchange.org) via the PRIDE partner repository (https://www.ebi.ac.uk/pride/) with the dataset identifiers PXD053919. Structural data from 6UO1 was used for molecular modeling. Source data are provided with this paper.

Code availability

The in-house script used in the molecular modeling is available on the GitHub repository at https://github.com/atfrank/RNAFMO.

Competing interests

The authors declare no competing interests.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Jeremy Monroe, Daniel E. Eyler.
==== Refs
References

1. Frye M Jaffrey SR Pan T Rechavi G Suzuki T RNA modifications: what have we learned and where are we headed? Nat. Rev. Genet. 2016 17 365 372 10.1038/nrg.2016.47 27140282
Frye, M., Jaffrey, S. R., Pan, T., Rechavi, G. & Suzuki, T. RNA modifications: what have we learned and where are we headed? Nat. Rev. Genet. 17, 365–372 (2016).27140282 10.1038/nrg.2016.47
2. Nachtergaele S He C Chemical modifications in the life of an mRNA transcript Annu Rev. Genet. 2018 52 349 372 10.1146/annurev-genet-120417-031522 30230927
Nachtergaele, S. & He, C. Chemical modifications in the life of an mRNA transcript. Annu Rev. Genet. 52, 349–372 (2018).30230927 10.1146/annurev-genet-120417-031522
3. Jackman JE Alfonzo JD Transfer RNA modifications: nature’s combinatorial chemistry playground: transfer RNA modifications WIREs RNA 2013 4 35 48 10.1002/wrna.1144 23139145
Jackman, J. E. & Alfonzo, J. D. Transfer RNA modifications: nature’s combinatorial chemistry playground: transfer RNA modifications. WIREs RNA 4, 35–48 (2013).23139145 10.1002/wrna.1144
4. Jonkhout N The RNA modification landscape in human disease RNA 2017 23 1754 1769 10.1261/rna.063503.117 28855326
Jonkhout, N. et al. The RNA modification landscape in human disease. RNA 23, 1754–1769 (2017).28855326 10.1261/rna.063503.117
5. Sloan KE Tuning the ribosome: the influence of rRNA modification on eukaryotic ribosome biogenesis and function RNA Biol. 2017 14 1138 1152 10.1080/15476286.2016.1259781 27911188
Sloan, K. E. et al. Tuning the ribosome: the influence of rRNA modification on eukaryotic ribosome biogenesis and function. RNA Biol. 14, 1138–1152 (2017).27911188 10.1080/15476286.2016.1259781
6. Pan T Modifications and functional genomics of human transfer RNA Cell Res. 2018 28 395 404 10.1038/s41422-018-0013-y 29463900
Pan, T. Modifications and functional genomics of human transfer RNA. Cell Res. 28, 395–404 (2018).29463900 10.1038/s41422-018-0013-y
7. Haruehanroengra P Zheng YY Zhou Y Huang Y Sheng J RNA modifications and cancer RNA Biol. 2020 17 1560 1575 10.1080/15476286.2020.1722449 31994439
Haruehanroengra, P., Zheng, Y. Y., Zhou, Y., Huang, Y. & Sheng, J. RNA modifications and cancer. RNA Biol. 17, 1560–1575 (2020).31994439 10.1080/15476286.2020.1722449
8. Boccaletto P MODOMICS: a database of RNA modification pathways. 2017 update Nucleic Acids Res. 2018 46 D303 D307 10.1093/nar/gkx1030 29106616
Boccaletto, P. et al. MODOMICS: a database of RNA modification pathways. 2017 update. Nucleic Acids Res. 46, D303–D307 (2018).29106616 10.1093/nar/gkx1030
9. Dumelin CE Chen Y Leconte AM Chen YG Liu DR Discovery and biological characterization of geranylated RNA in bacteria Nat. Chem. Biol. 2012 8 913 919 10.1038/nchembio.1070 22983156
Dumelin, C. E., Chen, Y., Leconte, A. M., Chen, Y. G. & Liu, D. R. Discovery and biological characterization of geranylated RNA in bacteria. Nat. Chem. Biol. 8, 913–919 (2012).22983156 10.1038/nchembio.1070
10. Chen YG Kowtoniuk WE Agarwal I Shen Y Liu DR LC/MS analysis of cellular RNA reveals NAD-linked RNA Nat. Chem. Biol. 2009 5 879 881 10.1038/nchembio.235 19820715
Chen, Y. G., Kowtoniuk, W. E., Agarwal, I., Shen, Y. & Liu, D. R. LC/MS analysis of cellular RNA reveals NAD-linked RNA. Nat. Chem. Biol. 5, 879–881 (2009).19820715 10.1038/nchembio.235
11. Flynn RA Small RNAs are modified with N-glycans and displayed on the surface of living cells Cell 2021 184 3109 3124.e22 10.1016/j.cell.2021.04.023 34004145
Flynn, R. A. et al. Small RNAs are modified with N-glycans and displayed on the surface of living cells. Cell 184, 3109–3124.e22 (2021).34004145 10.1016/j.cell.2021.04.023
12. Jones, J. D., Monroe, J., & Koutmou, K. S. A molecular‐level perspective on the frequency, distribution, and consequences of messenger RNA modifications. WIREs RNA10.1002/wrna.1586 (2020).
13. Moshitch-Moshkovitz S Dominissini D Rechavi G The epitranscriptome toolbox Cell 2022 185 764 776 10.1016/j.cell.2022.02.007 35245480
Moshitch-Moshkovitz, S., Dominissini, D. & Rechavi, G. The epitranscriptome toolbox. Cell 185, 764–776 (2022).35245480 10.1016/j.cell.2022.02.007
14. Li X Xiong X Yi C Epitranscriptome sequencing technologies: decoding RNA modifications Nat. Methods 2017 14 23 31 10.1038/nmeth.4110
Li, X., Xiong, X. & Yi, C. Epitranscriptome sequencing technologies: decoding RNA modifications. Nat. Methods 14, 23–31 (2017).10.1038/nmeth.4110
15. Arango D Acetylation of cytidine in mRNA promotes translation efficiency Cell 2018 175 1872 1886.e24 10.1016/j.cell.2018.10.030 30449621
Arango, D. et al. Acetylation of cytidine in mRNA promotes translation efficiency. Cell 175, 1872–1886.e24 (2018).30449621 10.1016/j.cell.2018.10.030
16. Schwartz S Transcriptome-wide mapping reveals widespread dynamic-regulated pseudouridylation of ncRNA and mRNA Cell 2014 159 148 162 10.1016/j.cell.2014.08.028 25219674
Schwartz, S. et al. Transcriptome-wide mapping reveals widespread dynamic-regulated pseudouridylation of ncRNA and mRNA. Cell 159, 148–162 (2014).25219674 10.1016/j.cell.2014.08.028
17. Xu L Three distinct 3-methylcytidine (m3C) methyltransferases modify tRNA and mRNA in mice and humans J. Biol. Chem. 2017 292 14695 14703 10.1074/jbc.M117.798298 28655767
Xu, L. et al. Three distinct 3-methylcytidine (m3C) methyltransferases modify tRNA and mRNA in mice and humans. J. Biol. Chem. 292, 14695–14703 (2017).28655767 10.1074/jbc.M117.798298
18. Franco MK Koutmou KS Chemical modifications to mRNA nucleobases impact translation elongation and termination Biophys. Chem. 2022 285 106780 10.1016/j.bpc.2022.106780 35313212
Franco, M. K. & Koutmou, K. S. Chemical modifications to mRNA nucleobases impact translation elongation and termination. Biophys. Chem. 285, 106780 (2022).35313212 10.1016/j.bpc.2022.106780
19. Melnikov S One core, two shells: bacterial and eukaryotic ribosomes Nat. Struct. Mol. Biol. 2012 19 560 567 10.1038/nsmb.2313 22664983
Melnikov, S. et al. One core, two shells: bacterial and eukaryotic ribosomes. Nat. Struct. Mol. Biol. 19, 560–567 (2012).22664983 10.1038/nsmb.2313
20. Ramakrishnan V Ribosome structure and the mechanism of translation Cell 2002 108 557 572 10.1016/S0092-8674(02)00619-0 11909526
Ramakrishnan, V. Ribosome structure and the mechanism of translation. Cell 108, 557–572 (2002).11909526 10.1016/S0092-8674(02)00619-0
21. Jobe A Liu Z Gutierrez-Vargas C Frank J New insights into ribosome structure and function Cold Spring Harb. Perspect. Biol. 2019 11 a032615 10.1101/cshperspect.a032615 29903714
Jobe, A., Liu, Z., Gutierrez-Vargas, C. & Frank, J. New insights into ribosome structure and function. Cold Spring Harb. Perspect. Biol. 11, a032615 (2019).29903714 10.1101/cshperspect.a032615
22. Eyler DE Pseudouridinylation of mRNA coding sequences alters translation PNAS 2019 116 23068 23074 10.1073/pnas.1821754116 31672910
Eyler, D. E. et al. Pseudouridinylation of mRNA coding sequences alters translation. PNAS 116, 23068–23074 (2019).31672910 10.1073/pnas.1821754116
23. Licht K Inosine induces context-dependent recoding and translational stalling Nucleic Acids Res. 2019 47 3 14 10.1093/nar/gky1163 30462291
Licht, K. et al. Inosine induces context-dependent recoding and translational stalling. Nucleic Acids Res. 47, 3–14 (2019).30462291 10.1093/nar/gky1163
24. You C Dai X Wang Y Position-dependent effects of regioisomeric methylated adenine and guanine ribonucleosides on translation Nucleic Acids Res. 2017 45 9059 9067 10.1093/nar/gkx515 28591780
You, C., Dai, X. & Wang, Y. Position-dependent effects of regioisomeric methylated adenine and guanine ribonucleosides on translation. Nucleic Acids Res. 45, 9059–9067 (2017).28591780 10.1093/nar/gkx515
25. Dai Q Quantitative sequencing using BID-seq uncovers abundant pseudouridines in mammalian mRNA at base resolution Nat. Biotechnol. 2023 41 344 354 10.1038/s41587-022-01505-w 36302989
Dai, Q. et al. Quantitative sequencing using BID-seq uncovers abundant pseudouridines in mammalian mRNA at base resolution. Nat. Biotechnol. 41, 344–354 (2023).36302989 10.1038/s41587-022-01505-w
26. Agrawal S RNA therapeutics are stepping out of the maze Trends Mol. Med. 2020 26 1061 1064 10.1016/j.molmed.2020.08.007 32988738
Agrawal, S. RNA therapeutics are stepping out of the maze. Trends Mol. Med. 26, 1061–1064 (2020).32988738 10.1016/j.molmed.2020.08.007
27. Zhou L-Y Qin Z Zhu Y-H He Z-Y Xu T Current RNA-based therapeutics in clinical trials Curr. Gene Ther. 2019 19 172 196 10.2174/1566523219666190719100526 31566126
Zhou, L.-Y., Qin, Z., Zhu, Y.-H., He, Z.-Y. & Xu, T. Current RNA-based therapeutics in clinical trials. Curr. Gene Ther. 19, 172–196 (2019).31566126 10.2174/1566523219666190719100526
28. Sergeeva OV Koteliansky VE Zatsepin TS mRNA-based therapeutics–advances and perspectives Biochem. Mosc. 2016 81 709 722 10.1134/S0006297916070075
Sergeeva, O. V., Koteliansky, V. E. & Zatsepin, T. S. mRNA-based therapeutics–advances and perspectives. Biochem. Mosc. 81, 709–722 (2016).10.1134/S0006297916070075
29. Gao M Zhang Q Feng X-H Liu J Synthetic modified messenger RNA for therapeutic applications Acta Biomater. 2021 131 1 15 10.1016/j.actbio.2021.06.020 34133982
Gao, M., Zhang, Q., Feng, X.-H. & Liu, J. Synthetic modified messenger RNA for therapeutic applications. Acta Biomater. 131, 1–15 (2021).34133982 10.1016/j.actbio.2021.06.020
30. Nance, K. D. & Meier, J. L. Modifications in an emergency: the role of N1-methylpseudouridine in COVID-19 vaccines. ACS Cent. Sci. 10.1021/acscentsci.1c00197 (2021).
31. Parr CJC N 1-Methylpseudouridine substitution enhances the performance of synthetic mRNA switches in cells Nucleic Acids Res. 2020 48 e35 e35 10.1093/nar/gkaa070 32090264
Parr, C. J. C. et al. N 1-Methylpseudouridine substitution enhances the performance of synthetic mRNA switches in cells. Nucleic Acids Res. 48, e35–e35 (2020).32090264 10.1093/nar/gkaa070
32. Svitkin YV N1-methyl-pseudouridine in mRNA enhances translation through eIF2α-dependent and independent mechanisms by increasing ribosome density Nucleic Acids Res. 2017 45 6023 6036 10.1093/nar/gkx135 28334758
Svitkin, Y. V. et al. N1-methyl-pseudouridine in mRNA enhances translation through eIF2α-dependent and independent mechanisms by increasing ribosome density. Nucleic Acids Res. 45, 6023–6036 (2017).28334758 10.1093/nar/gkx135
33. Karikó K Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability Mol. Ther. 2008 16 1833 1840 10.1038/mt.2008.200 18797453
Karikó, K. et al. Incorporation of pseudouridine into mRNA yields superior nonimmunogenic vector with increased translational capacity and biological stability. Mol. Ther. 16, 1833–1840 (2008).18797453 10.1038/mt.2008.200
34. Karikó K Buckstein M Ni H Weissman D Suppression of RNA recognition by toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA Immunity 2005 23 165 175 10.1016/j.immuni.2005.06.008 16111635
Karikó, K., Buckstein, M., Ni, H. & Weissman, D. Suppression of RNA recognition by toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA. Immunity 23, 165–175 (2005).16111635 10.1016/j.immuni.2005.06.008
35. Svitkin, Y. V., Gingras, A.-C., & Sonenberg, N. Membrane-dependent relief of translation elongation arrest on pseudouridine- and N1-methyl-pseudouridine-modified mRNAs. Nucleic Acids Res. 10.1093/nar/gkab1241 (2021).
36. Kim KQ N1-methylpseudouridine found within COVID-19 mRNA vaccines produces faithful protein products Cell Rep. 2022 40 111300 10.1016/j.celrep.2022.111300 35988540
Kim, K. Q. et al. N1-methylpseudouridine found within COVID-19 mRNA vaccines produces faithful protein products. Cell Rep. 40, 111300 (2022).35988540 10.1016/j.celrep.2022.111300
37. Mulroney, T. E., et al. N1-methylpseudouridylation of mRNA causes +1 ribosomal frameshifting. Nature10.1038/s41586-023-06800-3 (2023).
38. Hoernes TP Nucleotide modifications within bacterial messenger RNAs regulate their translation and are able to rewire the genetic code Nucleic Acids Res. 2016 44 852 862 10.1093/nar/gkv1182 26578598
Hoernes, T. P. et al. Nucleotide modifications within bacterial messenger RNAs regulate their translation and are able to rewire the genetic code. Nucleic Acids Res. 44, 852–862 (2016).26578598 10.1093/nar/gkv1182
39. Levi, O. & Arava, Y. S. Pseudouridine-mediated translation control of mRNA by methionine aminoacyl tRNA synthetase. Nucleic Acids Res. 10.1093/nar/gkaa1178 (2020).
40. Adachi H Targeted pseudouridylation: an approach for suppressing nonsense mutations in disease genes Mol. Cell 2023 83 637 651.e9 10.1016/j.molcel.2023.01.009 36764303
Adachi, H. et al. Targeted pseudouridylation: an approach for suppressing nonsense mutations in disease genes. Mol. Cell 83, 637–651.e9 (2023).36764303 10.1016/j.molcel.2023.01.009
41. Kurland CG Translational accuracy and the fitness of bacteria Annu. Rev. Genet. 1992 26 29 50 10.1146/annurev.ge.26.120192.000333 1482115
Kurland, C. G. Translational accuracy and the fitness of bacteria. Annu. Rev. Genet. 26, 29–50 (1992).1482115 10.1146/annurev.ge.26.120192.000333
42. Sitron CS Brandman O Detection and degradation of stalled nascent chains via ribosome-associated quality control Annu. Rev. Biochem 2020 89 417 442 10.1146/annurev-biochem-013118-110729 32569528
Sitron, C. S. & Brandman, O. Detection and degradation of stalled nascent chains via ribosome-associated quality control. Annu. Rev. Biochem 89, 417–442 (2020).32569528 10.1146/annurev-biochem-013118-110729
43. Kim SJ Translational tuning optimizes nascent protein folding in cells Science 2015 348 444 448 10.1126/science.aaa3974 25908822
Kim, S. J. et al. Translational tuning optimizes nascent protein folding in cells. Science 348, 444–448 (2015).25908822 10.1126/science.aaa3974
44. Yu C-H Codon usage influences the local rate of translation elongation to regulate co-translational protein folding Mol. Cell 2015 59 744 754 10.1016/j.molcel.2015.07.018 26321254
Yu, C.-H. et al. Codon usage influences the local rate of translation elongation to regulate co-translational protein folding. Mol. Cell 59, 744–754 (2015).26321254 10.1016/j.molcel.2015.07.018
45. Monroe, J. G., Smith, T. J., & Koutmou, K. S. Investigating the consequences of mRNA modifications on protein synthesis using in vitro translation assays. in Methods in Enzymology (Academic Press, 2021). 10.1016/bs.mie.2021.06.011.
46. Zaher HS Green R Quality control by the ribosome following peptide bond formation Nature 2009 457 161 166 10.1038/nature07582 19092806
Zaher, H. S. & Green, R. Quality control by the ribosome following peptide bond formation. Nature 457, 161–166 (2009).19092806 10.1038/nature07582
47. Hetrick B Lee K Joseph S Kinetics of stop codon recognition by release factor 1 Biochemistry 2009 48 11178 11184 10.1021/bi901577d 19874047
Hetrick, B., Lee, K. & Joseph, S. Kinetics of stop codon recognition by release factor 1. Biochemistry 48, 11178–11184 (2009).19874047 10.1021/bi901577d
48. Dabrowski M Bukowy-Bieryllo Z Zietkiewicz E Translational readthrough potential of natural termination codons in eucaryotes – The impact of RNA sequence RNA Biol. 2015 12 950 958 10.1080/15476286.2015.1068497 26176195
Dabrowski, M., Bukowy-Bieryllo, Z. & Zietkiewicz, E. Translational readthrough potential of natural termination codons in eucaryotes – The impact of RNA sequence. RNA Biol. 12, 950–958 (2015).26176195 10.1080/15476286.2015.1068497
49. Wangen JR Green R Stop codon context influences genome-wide stimulation of termination codon readthrough by aminoglycosides eLife 2020 9 e52611 10.7554/eLife.52611 31971508
Wangen, J. R. & Green, R. Stop codon context influences genome-wide stimulation of termination codon readthrough by aminoglycosides. eLife 9, e52611 (2020).31971508 10.7554/eLife.52611
50. Pardi N Expression kinetics of nucleoside-modified mRNA delivered in lipid nanoparticles to mice by various routes J. Control Release 2015 217 345 351 10.1016/j.jconrel.2015.08.007 26264835
Pardi, N. et al. Expression kinetics of nucleoside-modified mRNA delivered in lipid nanoparticles to mice by various routes. J. Control Release 217, 345–351 (2015).26264835 10.1016/j.jconrel.2015.08.007
51. Rodnina MV Wintermeyer W Fidelity of Aminoacyl-tRNA selection on the ribosome: kinetic and structural mechanisms Annu. Rev. Biochem. 2001 70 415 435 10.1146/annurev.biochem.70.1.415 11395413
Rodnina, M. V. & Wintermeyer, W. Fidelity of Aminoacyl-tRNA selection on the ribosome: kinetic and structural mechanisms. Annu. Rev. Biochem. 70, 415–435 (2001).11395413 10.1146/annurev.biochem.70.1.415
52. Meroueh M Unique structural and stabilizing roles for the individual pseudouridine residues in the 1920 region of Escherichia coli 23S rRNA Nucleic Acids Res. 2000 28 2075 2083 10.1093/nar/28.10.2075 10773075
Meroueh, M. Unique structural and stabilizing roles for the individual pseudouridine residues in the 1920 region of Escherichia coli 23S rRNA. Nucleic Acids Res. 28, 2075–2083 (2000).10773075 10.1093/nar/28.10.2075
53. Kierzek E The contribution of pseudouridine to stabilities and structure of RNAs Nucleic Acids Res. 2014 42 3492 3501 10.1093/nar/gkt1330 24369424
Kierzek, E. et al. The contribution of pseudouridine to stabilities and structure of RNAs. Nucleic Acids Res. 42, 3492–3501 (2014).24369424 10.1093/nar/gkt1330
54. Kibbe WA OligoCalc: an online oligonucleotide properties calculator Nucleic Acids Res. 2007 35 W43 W46 10.1093/nar/gkm234 17452344
Kibbe, W. A. OligoCalc: an online oligonucleotide properties calculator. Nucleic Acids Res. 35, W43–W46 (2007).17452344 10.1093/nar/gkm234
55. Zhang W Foo M Eren AM Pan T tRNA modification dynamics from individual organisms to metaepitranscriptomics of microbiomes Mol. Cell 2022 82 891 906 10.1016/j.molcel.2021.12.007 35032425
Zhang, W., Foo, M., Eren, A. M. & Pan, T. tRNA modification dynamics from individual organisms to metaepitranscriptomics of microbiomes. Mol. Cell 82, 891–906 (2022).35032425 10.1016/j.molcel.2021.12.007
56. Charette M Gray MW Pseudouridine in RNA: what, where, how, and why IUBMB Life 2000 49 341 351 10.1080/152165400410182 10902565
Charette, M. & Gray, M. W. Pseudouridine in RNA: what, where, how, and why. IUBMB Life 49, 341–351 (2000).10902565 10.1080/152165400410182
57. Davis DR Veltri CA Nielsen L An RNA model system for investigation of pseudouridine stabilization of the codon-anticodon interaction in tRNALys, tRNAHis and tRNATyr J. Biomol. Struct. Dyn. 1998 15 1121 1132 10.1080/07391102.1998.10509006 9669557
Davis, D. R., Veltri, C. A. & Nielsen, L. An RNA model system for investigation of pseudouridine stabilization of the codon-anticodon interaction in tRNALys, tRNAHis and tRNATyr. J. Biomol. Struct. Dyn. 15, 1121–1132 (1998).9669557 10.1080/07391102.1998.10509006
58. Davis DR Stabilization of RNA stacking by pseudouridine Nucleic Acids Res. 1995 23 5020 5026 10.1093/nar/23.24.5020 8559660
Davis, D. R. Stabilization of RNA stacking by pseudouridine. Nucleic Acids Res. 23, 5020–5026 (1995).8559660 10.1093/nar/23.24.5020
59. Lucas X Bauzá A Frontera A Quiñonero D A thorough anion–π interaction study in biomolecules: on the importance of cooperativity effects Chem. Sci. 2016 7 1038 1050 10.1039/C5SC01386K 29899893
Lucas, X., Bauzá, A., Frontera, A. & Quiñonero, D. A thorough anion–π interaction study in biomolecules: on the importance of cooperativity effects. Chem. Sci. 7, 1038–1050 (2016).29899893 10.1039/C5SC01386K
60. Westhof E Pseudouridines or how to draw on weak energy differences Biochem. Biophys. Res. Commun. 2019 520 702 704 10.1016/j.bbrc.2019.10.009 31761086
Westhof, E. Pseudouridines or how to draw on weak energy differences. Biochem. Biophys. Res. Commun. 520, 702–704 (2019).31761086 10.1016/j.bbrc.2019.10.009
61. Andries O N1-methylpseudouridine-incorporated mRNA outperforms pseudouridine-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice J. Controlled Release 2015 217 337 344 10.1016/j.jconrel.2015.08.051
Andries, O. et al. N1-methylpseudouridine-incorporated mRNA outperforms pseudouridine-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice. J. Controlled Release 217, 337–344 (2015).10.1016/j.jconrel.2015.08.051
62. Choi J N6-methyladenosine in mRNA disrupts tRNA selection and translation elongation dynamics Nat. Struct. Mol. Biol. 2016 23 110 115 10.1038/nsmb.3148 26751643
Choi, J. et al. N6-methyladenosine in mRNA disrupts tRNA selection and translation elongation dynamics. Nat. Struct. Mol. Biol. 23, 110–115 (2016).26751643 10.1038/nsmb.3148
63. Durant PC Bajji AC Sundaram M Kumar RK Davis DR Structural effects of hypermodified nucleosides in the Escherichia coli and human tRNALys anticodon loop: the effect of nucleosides s2U, mcm5U, mcm5s2U, mnm5s2U, t6A, and ms2t6A Biochemistry 2005 44 8078 8089 10.1021/bi050343f 15924427
Durant, P. C., Bajji, A. C., Sundaram, M., Kumar, R. K. & Davis, D. R. Structural effects of hypermodified nucleosides in the Escherichia coli and human tRNALys anticodon loop: the effect of nucleosides s2U, mcm5U, mcm5s2U, mnm5s2U, t6A, and ms2t6A. Biochemistry 44, 8078–8089 (2005).15924427 10.1021/bi050343f
64. Murphy FV Ramakrishnan V Malkiewicz A Agris PF The role of modifications in codon discrimination by tRNA(Lys)UUU Nat. Struct. Mol. Biol. 2004 11 1186 1191 10.1038/nsmb861 15558052
Murphy, F. V., Ramakrishnan, V., Malkiewicz, A. & Agris, P. F. The role of modifications in codon discrimination by tRNA(Lys)UUU. Nat. Struct. Mol. Biol. 11, 1186–1191 (2004).15558052 10.1038/nsmb861
65. Satpati P Bauer P Åqvist J Energetic tuning by tRNA modifications ensures correct decoding of isoleucine and methionine on the ribosome Chem. Eur. J. 2014 20 10271 10275 10.1002/chem.201404016 25043149
Satpati, P., Bauer, P. & Åqvist, J. Energetic tuning by tRNA modifications ensures correct decoding of isoleucine and methionine on the ribosome. Chem. Eur. J. 20, 10271–10275 (2014).25043149 10.1002/chem.201404016
66. Garcia DM A prion accelerates proliferation at the expense of lifespan Elife 2021 10 e60917 10.7554/eLife.60917 34545808
Garcia, D. M. et al. A prion accelerates proliferation at the expense of lifespan. Elife 10, e60917 (2021).34545808 10.7554/eLife.60917
67. Purchal MK Pseudouridine synthase 7 is an opportunistic enzyme that binds and modifies substrates with diverse sequences and structures Proc. Natl. Acad. Sci. USA 2022 119 e2109708119 10.1073/pnas.2109708119 35058356
Purchal, M. K. et al. Pseudouridine synthase 7 is an opportunistic enzyme that binds and modifies substrates with diverse sequences and structures. Proc. Natl. Acad. Sci. USA 119, e2109708119 (2022).35058356 10.1073/pnas.2109708119
68. Roy B Leszyk JD Mangus DA Jacobson A Nonsense suppression by near-cognate tRNAs employs alternative base pairing at codon positions 1 and 3 Proc. Natl. Acad. Sci. USA 2015 112 3038 3043 10.1073/pnas.1424127112 25733896
Roy, B., Leszyk, J. D., Mangus, D. A. & Jacobson, A. Nonsense suppression by near-cognate tRNAs employs alternative base pairing at codon positions 1 and 3. Proc. Natl. Acad. Sci. USA 112, 3038–3043 (2015).25733896 10.1073/pnas.1424127112
69. Roy B Ataluren stimulates ribosomal selection of near-cognate tRNAs to promote nonsense suppression Proc. Natl. Acad. Sci. USA 2016 113 12508 12513 10.1073/pnas.1605336113 27702906
Roy, B. et al. Ataluren stimulates ribosomal selection of near-cognate tRNAs to promote nonsense suppression. Proc. Natl. Acad. Sci. USA 113, 12508–12513 (2016).27702906 10.1073/pnas.1605336113
70. Kitaura K Ikeo E Asada T Nakano T Uebayasi M Fragment molecular orbital method: an approximate computational method for large molecules Chem. Phys. Lett. 1999 313 701 706 10.1016/S0009-2614(99)00874-X
Kitaura, K., Ikeo, E., Asada, T., Nakano, T. & Uebayasi, M. Fragment molecular orbital method: an approximate computational method for large molecules. Chem. Phys. Lett. 313, 701–706 (1999).10.1016/S0009-2614(99)00874-X
71. Nakano T Fragment molecular orbital method: application to polypeptides Chem. Phys. Lett. 2000 318 614 618 10.1016/S0009-2614(00)00070-1
Nakano, T. et al. Fragment molecular orbital method: application to polypeptides. Chem. Phys. Lett. 318, 614–618 (2000).10.1016/S0009-2614(00)00070-1
72. Nakano T Fragment molecular orbital method: use of approximate electrostatic potential Chem. Phys. Lett. 2002 351 475 480 10.1016/S0009-2614(01)01416-6
Nakano, T. et al. Fragment molecular orbital method: use of approximate electrostatic potential. Chem. Phys. Lett. 351, 475–480 (2002).10.1016/S0009-2614(01)01416-6
73. Jo S Kim T Iyer VG Im W CHARMM-GUI: a web-based graphical user interface for CHARMM J. Comput Chem. 2008 29 1859 1865 10.1002/jcc.20945 18351591
Jo, S., Kim, T., Iyer, V. G. & Im, W. CHARMM-GUI: a web-based graphical user interface for CHARMM. J. Comput Chem. 29, 1859–1865 (2008).18351591 10.1002/jcc.20945
74. Lee J CHARMM-GUI input generator for NAMD, GROMACS, AMBER, OpenMM, and CHARMM/OpenMM simulations using the CHARMM36 additive force field J. Chem. Theory Comput. 2016 12 405 413 10.1021/acs.jctc.5b00935 26631602
Lee, J. et al. CHARMM-GUI input generator for NAMD, GROMACS, AMBER, OpenMM, and CHARMM/OpenMM simulations using the CHARMM36 additive force field. J. Chem. Theory Comput. 12, 405–413 (2016).26631602 10.1021/acs.jctc.5b00935
75. Foloppe N MacKerell AD Jr. All-atom empirical force field for nucleic acids: I. Parameter optimization based on small molecule and condensed phase macromolecular target data J. Comput. Chem. 2000 21 86 104 10.1002/(SICI)1096-987X(20000130)21:2<86::AID-JCC2>3.0.CO;2-G
Foloppe, N. & MacKerell, A. D. Jr. All-atom empirical force field for nucleic acids: I. Parameter optimization based on small molecule and condensed phase macromolecular target data. J. Comput. Chem. 21, 86–104 (2000).10.1002/(SICI)1096-987X(20000130)21:2<86::AID-JCC2>3.0.CO;2-G
76. Denning EJ Priyakumar UD Nilsson L MacKerell AD Impact of 2′-hydroxyl sampling on the conformational properties of RNA: Update of the CHARMM all-atom additive force field for RNA J. Comput Chem. 2011 32 1929 1943 10.1002/jcc.21777 21469161
Denning, E. J., Priyakumar, U. D., Nilsson, L. & MacKerell, A. D. Impact of 2′-hydroxyl sampling on the conformational properties of RNA: Update of the CHARMM all-atom additive force field for RNA. J. Comput Chem. 32, 1929–1943 (2011).21469161 10.1002/jcc.21777
77. Lee MS Feig M Salsbury FR Brooks CL New analytic approximation to the standard molecular volume definition and its application to generalized Born calculations J. Comput Chem. 2003 24 1348 1356 10.1002/jcc.10272 12827676
Lee, M. S., Feig, M., Salsbury, F. R. & Brooks, C. L. New analytic approximation to the standard molecular volume definition and its application to generalized Born calculations. J. Comput Chem. 24, 1348–1356 (2003).12827676 10.1002/jcc.10272
78. Takematsu K Possibility of mutation prediction of influenza hemagglutinin by combination of hemadsorption experiment and quantum chemical calculation for antibody binding J. Phys. Chem. B. 2009 113 4991 4994 10.1021/jp810997c 19323468
Takematsu, K. et al. Possibility of mutation prediction of influenza hemagglutinin by combination of hemadsorption experiment and quantum chemical calculation for antibody binding. J. Phys. Chem. B. 113, 4991–4994 (2009).19323468 10.1021/jp810997c
79. Kurisaki I Fragment molecular orbital (FMO) study on stabilization mechanism of neuro-oncological ventral antigen (NOVA)–RNA complex system J. Mol. Structure THEOCHEM 2010 962 45 55 10.1016/j.theochem.2010.09.013
Kurisaki, I. et al. Fragment molecular orbital (FMO) study on stabilization mechanism of neuro-oncological ventral antigen (NOVA)–RNA complex system. J. Mol. Structure THEOCHEM 962, 45–55 (2010).10.1016/j.theochem.2010.09.013
80. Mazanetz MP Ichihara O Law RJ Whittaker M Prediction of cyclin-dependent kinase 2 inhibitor potency using the fragment molecular orbital method J. Cheminform 2011 3 2 10.1186/1758-2946-3-2 21219630
Mazanetz, M. P., Ichihara, O., Law, R. J. & Whittaker, M. Prediction of cyclin-dependent kinase 2 inhibitor potency using the fragment molecular orbital method. J. Cheminform 3, 2 (2011).21219630 10.1186/1758-2946-3-2
81. Okimoto N Otsuka T Hirano Y Taiji M Use of the multilayer fragment molecular orbital method to predict the rank order of protein–ligand binding affinities: a case study using tankyrase 2 inhibitors ACS Omega 2018 3 4475 4485 10.1021/acsomega.8b00175 31458673
Okimoto, N., Otsuka, T., Hirano, Y. & Taiji, M. Use of the multilayer fragment molecular orbital method to predict the rank order of protein–ligand binding affinities: a case study using tankyrase 2 inhibitors. ACS Omega 3, 4475–4485 (2018).31458673 10.1021/acsomega.8b00175
82. Fedorov DG Kitaura K Li H Jensen JH Gordon MS The polarizable continuum model (PCM) interfaced with the fragment molecular orbital method (FMO) J. Comput. Chem. 2006 27 976 985 10.1002/jcc.20406 16604514
Fedorov, D. G., Kitaura, K., Li, H., Jensen, J. H. & Gordon, M. S. The polarizable continuum model (PCM) interfaced with the fragment molecular orbital method (FMO). J. Comput. Chem. 27, 976–985 (2006).16604514 10.1002/jcc.20406
83. Suenaga M Facio: new computational chemistry environment for PC GAMESS J. Comput. Chem. Jpn. 2005 4 25 32 10.2477/jccj.4.25
Suenaga, M. Facio: new computational chemistry environment for PC GAMESS. J. Comput. Chem. Jpn. 4, 25–32 (2005).10.2477/jccj.4.25
84. Suenaga M Development of GUI for GAMESS / FMO calculation J. Comput. Chem., Jpn. 2008 7 33 54 10.2477/jccj.H1920
Suenaga, M. Development of GUI for GAMESS / FMO calculation. J. Comput. Chem., Jpn. 7, 33–54 (2008).10.2477/jccj.H1920
85. Barca GMJ Recent developments in the general atomic and molecular electronic structure system J. Chem. Phys. 2020 152 154102 10.1063/5.0005188 32321259
Barca, G. M. J. et al. Recent developments in the general atomic and molecular electronic structure system. J. Chem. Phys. 152, 154102 (2020).32321259 10.1063/5.0005188
86. Fedorov DG Kitaura K Pair interaction energy decomposition analysis J. Comput Chem. 2007 28 222 237 10.1002/jcc.20496 17109433
Fedorov, D. G. & Kitaura, K. Pair interaction energy decomposition analysis. J. Comput Chem. 28, 222–237 (2007).17109433 10.1002/jcc.20496
