
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

72941
10.1038/s41598-024-72941-8
Article
Identification and validation of endoplasmic reticulum stress-related genes in patients with steroid-induced osteonecrosis of the femoral head
Wu Tingyu 1
Shi Weipeng 1
Zhou Yinxue 2
Guo Sijia 1
Tian Hua 3
Jiang Yaping 4
Li Weiyan 5
Wang Yingzhen 1
Li Tao qdult@qdu.edu.cn

1
1 https://ror.org/026e9yy16 grid.412521.1 0000 0004 1769 1119 Department of Joint Surgery, The Affiliated Hospital of Qingdao University, No. 59, Haier Road, Qingdao, 266003 China
2 https://ror.org/026e9yy16 grid.412521.1 0000 0004 1769 1119 Department of Respiratory and Critical Care Medicine, The Affiliated Hospital of Qingdao University, Qingdao, 266003 China
3 Department of Neurological Rehabilitation, Qingdao Special Servicemen Recuperation Center of PLA Navy, Qingdao, 266003 China
4 https://ror.org/026e9yy16 grid.412521.1 0000 0004 1769 1119 Department of Oral Implantology, The Affiliated Hospital of Qingdao University, Qingdao, 266003 China
5 Department of Emergency Surgery and Joint Surgery, Qingdao Third People’s Hospital, Qingdao, 266003 China
16 9 2024
16 9 2024
2024
14 216342 5 2024
11 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Steroid-induced osteonecrosis of the femoral head (SONFH) is a debilitating condition caused by long-term corticosteroid use, leading to impaired blood flow and bone cell death. The disruption of cellular processes and promotion of apoptosis by endoplasmic reticulum stress (ERS) is implicated in the pathogenesis of SONFH. We identified ERS-associated genes in SONFH and investigated their potential as therapeutic targets. We analysed the GSE123568 GEO dataset to identify differentially expressed genes (DEGs) related to ERS in SONFH. We conducted Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses, identified hub genes by protein-protein interaction (PPI) analyses, and evaluated their functions by gene set enrichment analysis (GSEA). We constructed mRNA–miRNA networks, identified potential therapeutics, and assessed immune cell infiltration. We performed cross-validation using the GEO dataset GSE74089, qRT-PCR on clinical samples from patients with SONFH and controls, and a receiver operating characteristic (ROC) curve analysis to assess the diagnostic performance of the hub genes. We identified 195 ERS-related genes in SONFH, which were primarily involved in oxidative stress, immune responses, and metabolic pathways. The PPI network suggested CXCL8, STAT3, IL1B, TLR4, PTGS2, TLR2, CASP1, CYBB, CAT, and HOMX1 to be key hub genes, which were shown by GSEA to be involved in biological pathways related to metabolism, immune modulation, and cellular integrity. We also identified 261 microRNAs (miRNAs) as well as drugs such as dibenziodolium and N-acetyl-L-cysteine that modulated inflammatory responses in SONFH. Twenty-two immune cell subtypes showed significant correlations, such as a positive correlation between activated mast cells and Tregs, and patients with SONFH had fewer dendritic cells than controls. The hub genes CYBB and TLR4 showed significant correlations with M1 macrophages and CD8 T cells, respectively. Cross-validation and qRT-PCR confirmed the upregulation of STAT3, IL1B, TLR2, and CASP1 in patients with SONFH, validating the bioinformatics findings. An ROC curve analysis confirmed the diagnostic potential of the hub genes. The top 10 hub genes show promise as ERS-related diagnostic biomarkers for SONFH. We discovered that 261 miRNAs, including hsa-miR-23, influence these genes and identified potential therapeutics such as dibenziodolium and simvastatin. Immune profiling indicated altered immune functions in SONFH, with significant correlations among immune cell types. Validation confirmed the upregulation of STAT3, IL1B, TLR2 and CASP1, which had diagnostic potential. The findings suggest potential diagnostic markers and therapeutic targets for SONFH.

Subject terms

Computational biology and bioinformatics
Biomarkers
Musculoskeletal system
Osteoimmunology
http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China 82272489 Li Tao TaiShan Scholars Project Special FundNO.tsqn202306396 Li Tao Qingdao Science and Technology Benefiting the People Demonstration Special Project24-1-8-smjk-3-nsh Li Tao issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Osteonecrosis of the femoral head (ONFH) is a debilitating condition characterised by ischaemia and cellular death in the femoral head, leading to structural and functional changes in the bone1–3. The aetiology of OFNH can be traumatic or non-traumatic4. Hormone use, chronic alcohol consumption, and a history of trauma are implicated as triggers of ONFH5. Steroid use is the most prevalent non-traumatic cause of ONFH6.

Steroid-induced ONFH (SONFH) occurs predominantly as a result of excessive use of corticosteroids in patients with immune-related diseases7,8. The effects of glucocorticoids (GCs) are important in SONFH. GCs can induce lipid metabolism disorders, leading to intraosseous hypertension, impairing the blood supply to the femoral head and initiating necrosis9. In addition, GCs can directly induce apoptosis of osteoblasts and osteocytes, which are responsible for bone formation and maintenance, thus accelerating bone loss and necrosis10. Moreover, GCs influence autophagy, which is essential for maintaining cellular homeostasis, by altering the balance between autophagy activation and inhibition11. This may contribute to the impairment of osteocyte function and increase susceptibility to ONFH. Furthermore, GCs reportedly regulate ferroptosis, a type of cell death driven by iron-dependent lipid peroxidation. Excess GC exposure promotes ferroptosis, which may aggravate bone loss and contribute to the progression of SONFH12. Critically, GCs activate endoplasmic reticulum stress (ERS), exacerbating the disruption of osteogenesis and angiogenesis, which are key factors in disease development13.

ERS occurs when the ER (the site of protein folding, lipid synthesis, and calcium storage) is overwhelmed by unfolded or misfolded proteins, triggering the unfolded protein response (UPR)13. The UPR is mediated by three key pathways: IRE1, which enhances the ability of the ER to manage misfolded proteins by splicing XBP1 mRNA; ATF6, which upon ER stress travels to the Golgi apparatus to be cleaved and induce the expression of UPR target genes; and PERK, which phosphorylates eIF2α to reduce protein synthesis and lessen the ER load, and activates stress response genes14,15. These pathways restore ER function by reducing protein misfolding, enhancing protein folding, and degrading misfolded proteins. If this balance is not restored, prolonged ERS can lead to apoptosis, exacerbating bone cell dysfunction and accelerating the progression of SONFH16.

In this study, we used bioinformatics methods to identify differentially expressed genes (DEGs) associated with ERS in SONFH. We analysed the roles of key hub genes, investigated their interactions with regulatory microRNAs (miRNAs), and identified therapeutics that could target these genes. In addition, we examined immune cell infiltration to understand the immunological landscape of SONFH. We validated the findings using external datasets and clinical samples. Our results will facilitate the development of targeted therapeutics for SONFH.

Materials and methods

Bioinformatics

Data collection

We downloaded the GSE123568 dataset from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/), and compared gene expression levels in 30 patients with SONFH and 10 non-affected controls post-steroid treatment17. Next, we extracted genes associated with ERS from the GeneCards database (https://www.genecards.org)18. Using a relevance threshold score of 10, we identified 2176 ERS-related genes (ERGs).

Analysis of differentially expressed genes

We used DESeq2 in R to identify genes in the GSE123568 dataset with significant changes in expression, defined as an absolute fold-change > 0.75 and an adjusted p < 0.0519; these were termed DEGs. The DEGs intersecting with 2176 ERGs were classified as differentially expressed ERS-related genes (DE-ERGs).

Functional enrichment analysis

We conducted Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses to evaluate the functions of the DE-ERGs20–22. GO analysis categorises DE-ERGs into Biological Processes (BP), Cellular Components (CC), and Molecular Functions (MF). KEGG analysis maps DE-ERGs to broader biological pathways. We used the clusterProfiler package to identify significant enrichments (adjusted p < 0.05 and Q < 0.2) and visualised the results with ggplot223.

Screening of hub genes

We used the STRING database (https://string-db.org/) to analyse protein–protein interactions (PPIs) related to DE-ERGs24. The dataset was imported into Cytoscape, and we used the cytoHubba plugin to identify hub genes with crucial connections in the ERS PPI network25. We used the MCODE plugin in Cytoscape to identify significant clusters and refined the focus to the top 10 hub genes.

Single-gene gene set enrichment analysis

We conducted a gene set enrichment analysis (GSEA) to evaluate the associations between the hub genes with biological pathways or processes. Using the Molecular Signatures Database (MSigDB) (https://www.gseamsigdb.org/gsea/msigdb/index.jsp), we linked the hub genes to biological functions26. This approach is underpinned by stringent criteria (adjusted p < 0.05 and false discovery rate [FDR] < 0.25). We used the ggplot2 package in R to visualise the contributions of the hub genes to ERS and other stress-response mechanisms.

Construction of the mRNA–miRNA network

We identified miRNAs that may regulate the top 10 genes implicated in ERS using miRWalk (http://mirwalk.umm.uni-heidelberg.de/)27. By visualising these interactions in Cytoscape, we constructed an mRNA–miRNA regulatory network.

Targeted drug prediction

We used Enrichr (https://maayanlab.cloud/Enrichr) to identify drugs linked to key genes in ERS28,29. We input the top 10 hub genes into Enrichr, applied the Drug Signatures Database (DSigDB), and prioritised the results by p-values to identify the top 10 drugs associated with the hub genes.

Analysis of immune cell infiltration

We used the CIBERSORT algorithm (https://cibersortx.stanford.edu/) to analyse immune cell infiltration30. Using a permutation count of 100 and a p < 0.05, we evaluated the populations of immune cell types. We used the vioplot package to visualise the abundances of the immune cell types. The corrplot package was employed to generate correlation matrices to provide insight into the relationships between hub genes and immune cell types.

Cross-validation using an external dataset

To validate the findings from the GSE123568 dataset, we performed cross-validation31 of DE-ERG expression levels in the GSE74089 dataset. This dataset includes gene expression profiles of hip cartilage from patients with necrosis of the femoral head. By comparing the expression levels of the DE-ERGs in GSE74089 and GSE123568, we validated the identified hub genes. A value of p < 0.05 was considered indicative of statistical significance.

Validation of clinical samples

Clinical samples

This study complied with the Declaration of Helsinki and was approved by the Medical Ethics Committee of Qingdao University Affiliated Hospital. All of the participants provided informed consent. The inclusion criteria were adults 18–60 years of age diagnosed via radiographic evidence with femoral neck fractures or SONFH. The exclusion criteria were previous conditions that could influence immune response or gene expression, such as systemic infections or autoimmune diseases; immunosuppressive therapy within 6 months; or a history of metabolic bone diseases unrelated to our condition of interest, e.g., osteoporosis. We collected peripheral blood samples from three patients with SONFH and three healthy adults (following steroid administration).

Quantitative real-time polymerase chain reaction (qRT-PCR)

Peripheral blood was collected into EDTA-treated tubes and centrifuged to segregate the cellular fraction from plasma. White blood cells were lysed using TRIzol reagent, releasing RNA and denaturing proteins and DNA. RNA was isolated from the aqueous phase, precipitated using alcohol, and the pellet was washed with ethanol to remove impurities. After resuspension in RNase-free water, RNA purity and concentration were determined. We used the qPCR HiScript III RT SuperMix Kit to convert RNA into cDNA according to the manufacturer’s protocol. cDNA was used for qRT-PCR with the ChamQ Universal SYBR qPCR Master Mix Kit, with ACTB mRNA as the normalisation control. Each sample underwent qRT-PCR in triplicate, together with three biological replicates per group. The primer sequences are listed in Table 1.

Table 1 Primers used for real-time PCR.

Gene	Species	Direction	Sequence (5ʹ to 3ʹ)	
CXCL8	Human	Forward	ACTTTCAGAGACAGCAGAGCACAC	
Reverse	CACACAGTGAGATGGTTCCTTCCG	
STAT3	Human	Forward	GAGGCAGGAGAATCGCTTGAACC	
Reverse	TCTCAGACTGTCGCCCAGGATG	
IL1B	Human	Forward	GACCTGGACCTCTGCCCTCTG	
Reverse	GCCTGCCTGAAGCCCTTGC	
TLR4	Human	Forward	CATCATTGGTGTGTCGGTCCTCAG	
Reverse	AGCCAGCAAGAAGCATCAGGTG	
PTGS2	Human	Forward	ACAGCCAGACGCCCTCAGAC	
Reverse	ATGGGTGGGAACAGCAAGGATTTG	
TLR2	Human	Forward	GTGACCAAGTGAAGGCAGGAAGAC	
Reverse	AGCAGGCAGGAGGGGTGTTG	
CASP1	Human	Forward	CACACCGCCCAGAGCACAAG	
Reverse	TCCCACAAATGCCTTCCCGAATAC	
CYBB	Human	Forward	TTCCAGTGCGTGCTGCTCAAC	
Reverse	ACTCGGGCATTCACACACCATTC	
CAT	Human	Forward	CGGCAAGGGAGAAGGCAAATCTG	
Reverse	GATGAGCGGGTTACACGGATGAAC	
HMOX1	Human	Forward	TGCCAGTGCCACCAAGTTCAAG	
Reverse	TGTTGAGCAGGAACGCAGTCTTG	

Validation of hub genes by receiver operating characteristic analysis

Using the R package pROC, we conducted ROC curve analyses on the GSE123568 dataset to evaluate the diagnostic accuracy of hub genes for SONFH32. We assessed model performance by calculating areas under the curve (AUCs); AUCs > 0.6 indicated statistical significance.

Results

DE-ERGs in SONFH

We identified 1220 DEGs, including 754 upregulated and 466 downregulated genes, in the GSE123568 dataset (Fig. 1A). By intersecting these DEGs with ERS-related genes scoring > 10 in the GeneCards database, we identified 195 DE-ERGs (Fig. 1B). The expression levels of the top 100 intersecting genes of the SONFH and control groups are shown in Fig. 1C.

Fig. 1 Analysis and identification of differentially expressed endoplasmic reticulum stress-related genes (DE-ERGs) in SONFH and control samples. (A) Volcano map of the distribution of the 1220 DEGs in the GSE123568 dataset. Red, upregulated DEGs; blue, downregulated DEGs. (B) Venn diagram of 195 DE-ERGs. (C) Heatmap of changes in expression of the top 100 DE-ERGs. Blue, downregulation; red, upregulation.

GO and KEGG enrichment analyses of DE-ERGs

The GO and KEGG analyses identified 1987 GO terms and 117 KEGG pathways related to SONFH. The GO analysis yielded 1682 BPs, 137 CCs, and 158 MFs (Fig. 2), including BPs such as response to oxidative stress (OS), peptide-hormone signalling, and regulation of defence responses. CCs included structural features such as membrane microdomains and mitochondrial outer membranes. MFs were dominated by kinase activity and binding mechanisms. KEGG pathway analysis linked these DE-ERGs to the lipid and atherosclerosis, NOD-like receptor signalling, and FoxO signalling pathways.

Fig. 2 Enrichment analyses of DE-ERGs. (A,B) DE-ERGs related to Biological Process (BP), Cellular Component (CC), and Molecular Function (MF) according to GO analysis. (C,D) KEGG pathway enrichment analysis.

Construction of the PPI network and identification of hub genes

We constructed a PPI network for the 195 DE-ERGs using the STRING database with visualisation in Cytoscape (Fig. 3). The MCODE plugin revealed three critical gene clusters. Cluster 1 included genes involved in inflammation and immune response, Cluster 2 contained genes linked to OS and innate immunity, and Cluster 3 included lipid metabolism enzymes. The cytoHubba plugin identified CXCL8, STAT3, IL1B, TLR4, PTGS2, TLR2, CASP1, CYBB, CAT, and HMOX1 as hub genes. Nine genes were upregulated, and one gene (CAT) was downregulated.

In the upregulated gene network, coexpression interactions predominated at 66.92%, followed by colocalisation at 18.35%, and physical interactions at 15.43%. Predicted interactions were noted at 4.46%, with pathway involvement at 4.14%, genetic interactions at 0.46%, and shared protein domains at 0.23%. The network of the downregulated gene, CAT, was characterised by physical interactions, which constituted 77.64% of the connections. Coexpression accounted for 8.1%, with predicted interactions at 5.37%, colocalisation at 3.63%, genetic interactions at 2.87%, pathway involvement at 1.88%, and shared protein domains at 0.60%.

Fig. 3 Protein–protein interaction (PPI) network and top 10 hub genes. (A) PPI network of 195 DE-ERGs. (B) The MCODE plug-in identified three important clusters. (C) Identification of the top 10 hub genes using the CytoHubba plug-in. (D) Up- and downregulated genes among the top 10 hub genes.

Potential mechanisms of hub genes explored by GSEA

We performed GSEA for each of the hub genes (Fig. 4). CXCL8 showed enrichment in Thyroid Cancer and Galactose Metabolism, and negative enrichment in SNARE Interactions in Vesicular Transport and Proteasome. STAT3 showed negative enrichment in Epithelial Cell Signalling in Helicobacter pylori Infection and Prostate Cancer. IL1B showed positive enrichment in Insulin Signalling Pathway and NOD-like Receptor Signalling Pathway, and TLR4 exhibited negative enrichment in T Cell Receptor Signalling Pathway and ERBB Signalling Pathway. GSEA of PTGS2 indicated negative enrichment in, for instance, NOD-like Receptor Signalling Pathway and Apoptosis. TLR2 was negatively enriched in Vibrio cholerae Infection and Toll-like Receptor Signalling Pathway. CASP1 showed a mix of positive enrichment in pathways such as Pentose and Glucuronate Interconversions and negative enrichment in Lysosome and SNARE Interactions in Vesicular Transport. GSEA of CYBB revealed negative enrichment in Autoimmune Thyroid Disease and Lysosome. CAT was positively enriched in Valine, Leucine, and Isoleucine Degradation and Glyoxylate and Dicarboxylate Metabolism. HMOX1 exhibited negative enrichment in Selenoamino Acid Metabolism and Glycerolipid Metabolism.

Fig. 4 Gene set enrichment analysis (GSEA) of the top 10 hub genes. Colours above the image are labelled with the names of the enrichment entries corresponding to the colours in the image.

Hub gene-miRNA regulatory network and drugs

The mRNA–miRNA network showed that 261 miRNAs modulated the expression of the top 10 hub genes associated with ERS (Fig. 5). These included hsa-miR-23, which is reportedly correlated with osteogenic and adipogenic functions33–36. In addition, dibenziodolium and N-acetyl-L-cysteine, together with simvastatin and curcumin (which modulated inflammatory responses), potentially interacted with the hub genes.

Fig. 5 Hub gene-miRNA regulatory network and targeted drugs. (A) Interaction network between hub genes and targeted miRNAs. (B) Drugs identified in the analysis of the top 10 hub genes.

Immune infiltration and hub gene-immune cell interactions

Immune infiltration analysis using the GSE123568 dataset suggested the presence of diverse immune-cell subpopulations. The relative percentages of 22 immune-cell subtypes are shown in Fig. 6. The correlation analysis indicated significant interactions between immune-cell types. For instance, activated mast cells were strongly positively correlated with Tregs and resting dendritic cells and resting NK cells were negatively correlated with gamma-delta T cells.

Fig. 6 Immune infiltration and hub gene-immune cell interactions. (A) Relative percentages of 22 subpopulations of immune cells in 40 samples from the GSE123568 dataset. (B) Spearman correlation analysis among immune cells. Red, positive correlation; blue, negative correlation. (C) Boxplots of the expression of immune cells between the two groups. (D) Correlation map of hub genes and immune infiltration. Yellow, positive correlation; blue, negative correlation. The darker the colour the stronger the correlation (*p < 0.05).

Immune-landscape analysis showed that the proportion of dendritic cells was significantly smaller in the SONFH group compared to the control group, suggesting suppression or deficit in antigen presentation or immune priming in SONFH.

We analysed the correlation between the hub genes identified in the PPI network and immune cell infiltration. The gene CYBB showed a significant positive correlation with M1 macrophages and a negative correlation with activated NK cells, indicating an inverse relationship with adaptive immune responses. TLR4 showed a significant negative correlation with CD8 T cells.

Validation of hub genes in the GSE123568 dataset

The cross-validation results confirm that the expression levels of the 10 hub genes in the GSE74089 dataset align with those in the GSE123568 dataset. Relative to the control group, the SONFH group exhibited upregulation of CXCL8, STAT3, IL1B, TLR4, PTGS2, TLR2, CASP1, CYBB, and HMOX1, and downregulation of CAT (Fig. 7). qRT-PCR analysis of samples from three patients with SONFH and three healthy adults confirmed these findings at the mRNA level, reinforcing the reproducibility of the GSE123568 data. Compared to the control group, there was significant upregulation of STAT3 (p = 0.0002), IL1B (p = 0.0396), TLR2 (p = 0.0054), and CASP1 (p = 0.0264) in the SONFH group, which agrees with the bioinformatics analysis (Fig. 8). To validate the predictive significance of the 10 hub genes, we performed an ROC curve analysis on the GSE123568 dataset. All of the hub genes had statistically significant AUC values > 0.6 (Fig. 9). PTGS2 (AUC = 0.805) showed the greatest diagnostic efficacy, followed by STAT3 (AUC = 0.815).

Fig. 7 Violin plot of 10 hub genes in SONFH and control samples in the GSE74089 dataset.

Fig. 8 Validation by qRT-PCR of the top 10 hub genes in SONFH and control samples. Experiments were performed in triplicate; results are means ± SD (*p < 0.05).

Fig. 9 Diagnostic receiver operating characteristic (ROC) curves of 10 hub genes in SONFH samples and control samples.

Discussion

Our findings provide insight into the molecular framework of SONFH by identifying and characterising DE-ERGs. Analysis of the GSE123568 dataset revealed a large number of DE-ERGs, thereby enhancing our understanding of the cellular mechanisms triggered by steroid exposure. The study that originally generated the GSE123568 dataset focused on identifying dynamic biomarkers for different stages of non-traumatic ONFH (NONFH) using a transcriptional regulatory network17. Specifically, it highlighted the alterations in gene expression across various stages of the disease and identified key regulatory genes and pathways involved in NONFH progression. However, our study specifically investigates the role of ERS in SONFH, which was not addressed in the original study. Our research fills this gap by specifically investigating the intersection of ERS-related genes with the DEGs identified from the GSE123568 dataset. The identification of 1220 DEGs (754 upregulated and 466 downregulated) highlights the effects of steroids on gene expression in SONFH. Among these, the intersection with ERS-related genes resulting in 195 DE-ERGs suggests a significant subset of genes that may play crucial roles in the pathophysiology of SONFH through ERS mechanisms. This focused analysis provides a more detailed understanding of how ERS contributes to the cellular and molecular disruptions observed in SONFH, thereby offering new insights that were not explored in the original study.

GO and KEGG enrichment analyses provided insight into the BP and pathways enriched for these DE-ERGs. The significant enrichment in BP (e.g., response to OS, peptide hormone signalling, and regulation of defence responses) aligns with pathological features of SONFH, including OS and inflammatory responses. GC-induced OS promotes apoptosis of osteocytes, primarily by increasing NOX-mediated production of ROS37. Similarly, the exacerbation of inflammatory processes by BMP-2–mediated downregulation of IL-34, contributes to osteoclast differentiation and the progression of ONFH38. Moreover, the CC enrichment in membrane microdomains and mitochondrial outer membranes suggests changes in cellular architecture that could influence signal transduction and metabolic processes crucial for cell survival and function. KEGG pathway analysis mapped DE-ERGs to pathways implicated in SONFH, such as lipid metabolism and atherosclerosis. ERS is important in this context because it can be exacerbated by intracellular lipid imbalances39. Dysfunctions in lipid metabolism can lead to the accumulation of misfolded proteins in the ER, triggering stress responses and ultimately apoptosis and bone-tissue degradation40. Moreover, the atherosclerotic processes identified by the pathway analysis indicate that lipid accumulation affects cellular health not only directly but also indirectly by impairing blood flow, thereby exacerbating the hypoxia that leads to osteonecrosis. In addition, identification of the NOD-like receptor signalling and FoxO signalling pathways underscores the roles of DE-ERGs in modulating immune responses and apoptosis41. This emphasises their potential as therapeutic targets and highlights the complex interplay between metabolic dysfunction and immune-regulatory mechanisms in SONFH.

The PPI network analysis provided insight into the molecular interactions and pathways linked to the pathophysiology of SONFH. The critical clusters in the PPI network, which were related to inflammation, immune response, OS, and lipid metabolism, indicates steroids affect the activities and interactions of these pathways in SONFH. The cytoHubba plugin identified CXCL8, STAT3, IL1B, TLR4, PTGS2, TLR2, CASP1, CYBB, CAT, and HMOX1 as hub genes. These genes regulate cytokine signalling, immune responses, and stress mechanisms, which are important for maintaining cellular homeostasis and responding to external stressors including steroids. Their central positions in the network implicate them in both normal cellular functions and in pathological conditions, potentially driving the processes that lead to bone degradation in SONFH. GSEA of hub genes highlighted their effects on metabolic regulation, immune modulation, and cellular integrity in SONFH. These genes are multifunctional: CXCL8 affects metabolic and stress management processes, STAT3 influences cellular growth and response to infection, and IL1B integrates metabolic and inflammatory pathways, which are key in the pathogenesis of SONFH. TLR4 and PTGS2 modulate immune responses and apoptosis, suggesting that they have potential as therapeutic targets to reduce osteocyte damage. The involvement of CASP1 in metabolic processing and cellular clean-up, together with the functions of CYBB and TLR2 in immune homeostasis, highlight the complex interplay of responses to steroid stress. The functions of CAT and HMOX1 in metabolic pathways suggest strategies to enhance cellular resilience against SONFH.

The regulation by miRNAs of the ERS-induced unfolded protein response suggests that their effects on pathways that govern cell survival or death influence cellular-stress outcomes42. Indeed, the fact that the mRNA-miRNA network centred on hub genes intersecting with ERS revealed the importance of miRNAs in SONFH. Among them, miR-23a modulates pathways critical for bone health. miR-23a inhibits osteogenesis by targeting LRP5, which is crucial for bone homeostasis, and icariin stimulates bone formation by modulating this pathway, suggesting therapeutic potential34,35. In addition, miR-23a modulates apoptosis and differentiation via LINC00473 in a PLGA hydrogel model, suggesting its importance for bone health36. Ganesan et al. found that downregulation of miR-23a led to upregulation of TLR2, enhancing the activity of autophagy-related pathways43. Lingam et al. reported that CXCL8 and miR-23a respond to inflammation and hypoxia44. Our predictions suggest that targeting miR-23a could improve SONFH outcomes by modulating TLR2 and CXCL8. These hub genes, which are significantly modulated by miRNAs, provide insight into the complex molecular mechanisms of SONFH and are potential targets for miRNA-based therapies.

Next, we identified potential therapeutic agents that could modulate these hub genes. Several drugs, including dibenziodolium and N-acetyl-L-cysteine, which have anti-inflammatory and antioxidant activity, respectively, potentially interacted with key hub genes. Dibenziodolium reduces inflammation-driven exacerbation, and N-acetyl-L-cysteine alleviates OS and inflammation, which are important in the pathogenesis of SONFH37. Similarly, simvastatin shows therapeutic promise for SONFH because of its anti-inflammatory activity and inhibition of the GC receptor45. Curcumin inhibits M1-type macrophage infiltration and osteocyte apoptosis in the femoral head, which are linked to the development of SONFH46. In combination, these drugs show greater therapeutic efficacy for SONFH, and may improve patient outcomes by modulating the expression of hub genes.

The significant correlations between immune cells and hub genes suggest immune modulation to be a pivotal component of therapeutic strategies. The positive correlation between activated mast cells, Tregs, and resting dendritic cells suggests that a protective regulatory mechanism is disrupted in SONFH. Therapeutic strategies that enhance Treg function or stabilise mast-cell activity could mitigate inflammatory processes in SONFH. Enhancing the function of Tregs to suppress inflammatory responses and pro-inflammatory cells (such as Th17) can restore the immune balance and reduce tissue damage, thereby promoting the repair and regeneration of bone tissue47. Conversely, the reduction in dendritic cells suggests impairment of immune priming, indicating that therapies boosting dendritic cell function could restore effective immune responses. He et al. showed that resting dendritic cells reduce osteonecrosis inflammation and promote bone repair by modulating antigen presentation and cytokine signalling, particularly by inhibiting the IL-17 pathway48.

Macrophage polarisation into the pro-inflammatory M1 or anti-inflammatory M2 phenotype in response to environmental cues is pivotal for bone homeostasis, and its dysregulation can lead to inflammatory responses that disrupt bone metabolism49. Furthermore, activated NK cells and CD8+ T cells are components of the cell-mediated cytotoxic immune response, and are important for clearing damaged cells. However, their overactivation may lead to detrimental effects on bone tissue, indicating the need for a balanced immune response to maintain skeletal integrity and prevent exacerbation of osteonecrosis50,51. The positive correlations of TLR4, CYBB, and CASP1 with M1 macrophages suggest a pro-inflammatory phenotype that could exacerbate bone loss and turnover. Targeting these genes to modulate M1 macrophage activity may attenuate this pro-inflammatory state and induce a shift towards bone preservation and repair. Conversely, the negative correlations of TLR4, TLR2, IL1B, HMOX1, CYBB, and CASP1 with activated NK cells suggest a protective mechanism against the cytotoxicity typically induced by these immune cells. Similarly, the negative correlations of these hub genes, together with STAT3 and PTGS2, with CD8 T cells suggest a dampening of cytotoxic T-cell activity, which could reduce bone tissue damage in SONFH. Therefore, adjusting hub gene activity could correct the immune imbalance in SONFH, reducing pro-inflammatory effects and fortifying defences against overactive immune responses, a promising direction for targeted therapy development.

Finally, we validated the expression levels of 10 hub genes using the GSE74089 dataset, confirming the accuracy of our findings from GSE123568. To further substantiate these findings and directly link them to our study’s focus on ERS-related genes in SONFH, we conducted qRT-PCR analysis on peripheral blood samples collected from three patients with SONFH and three healthy adults following steroid administration. This experimental design aimed to measure the expression levels of these hub genes in a clinical context, providing a more accurate reflection of their roles in SONFH and their association with ERS.

The qRT-PCR process involved several critical steps: isolating total RNA from the blood samples, converting it into cDNA using reverse transcription, and then amplifying specific gene targets using quantitative PCR to measure their expression levels. This rigorous approach ensured that our results were both reliable and relevant to the pathophysiological conditions of SONFH, particularly concerning ERS. The qRT-PCR analysis yielded consistent results for four hub genes: STAT3, IL1B, TLR2, and CASP1. These genes were identified as significantly altered in SONFH patients compared to healthy controls, underscoring their potential as biomarkers and therapeutic targets. Researches have reported that, STAT3 exacerbates SONFH by promoting osteoclast differentiation52, IL1B polymorphisms affect genetic susceptibility53, TLR2 enhances BMSC-mediated angiogenesis and osteogenesis54, and CASP1 affects osteogenic functions via the ROS/NLRP3 pathway55. In an ROC curve analysis, the 10 genes had AUC values > 0.6, underscoring their diagnostic potential. This indicates that the other hub genes might still be involved in the pathophysiology of SONFH, even though their qRT-PCR results were not consistent.

This validation step, by bridging bioinformatics predictions with clinical sample analysis, strengthens our findings and confirms the relevance of these hub genes in the pathophysiology of SONFH, specifically in the context of ERS. Thus, our qRT-PCR results not only support the bioinformatic data but also provide a tangible link to clinical outcomes and the role of ERS in SONFH, making them crucial for developing targeted therapies for this condition.

Strengths and limitations

This study provides valuable insights into the molecular framework of SONFH by identifying and characterizing DE-ERGs. Our comprehensive analysis of the GSE123568 dataset revealed significant gene expression changes associated with steroid exposure, offering a robust foundation for understanding the cellular mechanisms involved in SONFH. The use of GO and KEGG enrichment analyses, PPI network analysis, and validation with the GSE74089 dataset further strengthens the reliability of our findings.

However, the study has limitations. Firstly, the lack of randomization may introduce selection bias and affect the internal validity of our findings. Future studies should include randomized controlled trials to minimize bias and enhance the robustness of the results. Additionally, the generalizability of our findings is constrained by the specific characteristics of our study population, which was drawn from a single institution. This may not fully represent the broader population of patients with SONFH. Future studies should include more diverse and larger sample sizes from multiple centers to improve the applicability of the findings. The small sample size for qRT-PCR analysis may also limit the generalizability of the results. Future research should include in vitro validation of the predicted miRNA regulatory mechanisms and the therapeutic potential of the identified drugs to gain deeper insights into their clinical implications.

Conclusion

Using the GSE123568 dataset, we identified 195 DE-ERGs in SONFH, which were related to oxidative stress, immune responses, and metabolic pathways. GO and KEGG analyses, and the PPI network, identified CXCL8, STAT3, IL1B, TLR4, PTGS2, TLR2, CASP1, CYBB, CAT, and HMOX1 as key hub genes, which regulate metabolic, immune, and cellular integrity processes. The identification of 261 miRNAs, particularly hsa-miR-23, emphasised the complexity of the regulation of genes that modulate bone metabolism. Moreover, we found that dibenziodolium, N-acetyl-L-cysteine, simvastatin, and curcumin target inflammatory pathways important in the pathophysiology of SONFH. Twenty-two immune cell subtypes showed significant interactions, notably activated mast cells and Tregs, and there was a reduction in the population of dendritic cells, indicating altered immune function in SONFH. In addition, the positive and negative correlations of hub genes with immune cell types underscore their potential as therapeutic targets. Validation by cross-dataset comparison, qRT-PCR and ROC analysis confirmed the upregulation of STAT3, IL1B, TLR2, and CASP1. Further validation by ROC curve analysis confirmed that these hub genes are reliable diagnostic markers. The findings provide molecular insight into SONFH and will facilitate the development of targeted interventions.

Acknowledgements

We would like to acknowledge the GEO (GSE123568 and GSE74089) network for providing data. We gratefully acknowledge Textcheck for their English language editing services. The English in this document has been checked by two native-speaking professional editors. For a certificate, please see: http://www.textcheck.com/certificate/2K7SOE.

Author contributions

TW, WS and YZ contributed to the bioinformatics analysis and wrote the original manuscript. SG and HT collected the literature and participated in the qRT-PCR test. YJ and WL performed the statistical analysis. YW and TL designed the study and revised the manuscript. All authors read and approved the final paper.

Funding

This work was supported by grants from National Natural Science Foundation of China; Grant number: 82272489, 82203588; TaiShan Scholars Project Special Fund; Grant number: NO.tsqn202306396; Qingdao Science and Technology Benefiting the People Demonstration Special Project; Grant number: 24-1-8-smjk-3-nsh. The funding body played no role in the design of the study and collection, analysis, and interpretation of data and in writing the manuscript.

Data availability

Publicly available datasets were analyzed in this study. The data can be found here: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi? acc=GSE123568;https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi? acc=GSE74089. All data are available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.

Ethical approval and consent to participate

This study was supported and approved by the Institutional Review Board (IRB) of The Affiliated Hospital of Qingdao University (QYFY WZLL 28701). All clinical samples patients were informed of the purpose of the study and signed the consent form.

Consent for publication

The manuscript was read and approved for publication by all authors.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Tingyu Wu, Weipeng Shi and Yinxue Zhou contributed equally to this work.
==== Refs
References

1. Mont MA Hungerford DS Non-traumatic avascular necrosis of the femoral head J. Bone Jt. Surg. Am. Vol. 1995 77 3 459 474 10.2106/00004623-199503000-00018
Mont, M. A. & Hungerford, D. S. Non-traumatic avascular necrosis of the femoral head. J. Bone Jt. Surg. Am. Vol. 77 (3), 459–474. 10.2106/00004623-199503000-00018 (1995).10.2106/00004623-199503000-00018
2. Moya-Angeler J Gianakos AL Villa JC Ni A Lane JM Current concepts on osteonecrosis of the femoral head World J. Orthop. 2015 6 8 590 601 10.5312/wjo.v6.i8.590 26396935
Moya-Angeler, J., Gianakos, A. L., Villa, J. C., Ni, A. & Lane, J. M. Current concepts on osteonecrosis of the femoral head. World J. Orthop. 6 (8), 590–601. 10.5312/wjo.v6.i8.590 (2015).26396935 10.5312/wjo.v6.i8.590
3. Assouline-Dayan Y Chang C Greenspan A Shoenfeld Y Gershwin ME Pathogenesis and natural history of osteonecrosis Semin. Arthritis Rheum. 2002 32 2 94 124 10.1053/sarh.2002.33724b 12430099
Assouline-Dayan, Y., Chang, C., Greenspan, A., Shoenfeld, Y. & Gershwin, M. E. Pathogenesis and natural history of osteonecrosis. Semin. Arthritis Rheum. 32 (2), 94–124 (2002).12430099 10.1053/sarh.2002.33724b
4. Zhao D Guidelines for clinical diagnosis and treatment of osteonecrosis of the femoral head in adults (2019 version) J. Orthop. Transl. 2020 21 100 110 10.1016/j.jot.2019.12.004
Zhao, D. et al. Guidelines for clinical diagnosis and treatment of osteonecrosis of the femoral head in adults (2019 version). J. Orthop. Transl. 21, 100–110. 10.1016/j.jot.2019.12.004 (2020).10.1016/j.jot.2019.12.004
5. Hines JT Osteonecrosis of the femoral head: an updated review of ARCO on pathogenesis, staging and treatment J. Korean Med. Sci. 2021 36 24 e177 10.3346/jkms.2021.36.e177 34155839
Hines, J. T. et al. Osteonecrosis of the femoral head: an updated review of ARCO on pathogenesis, staging and treatment. J. Korean Med. Sci. 36 (24), e177. 10.3346/jkms.2021.36.e177 (2021).34155839 10.3346/jkms.2021.36.e177
6. Kerachian MA Séguin C Harvey EJ Glucocorticoids in osteonecrosis of the femoral head: a new understanding of the mechanisms of action J. Steroid Biochem. Mol. Biol. 2009 114 3–5 121 128 10.1016/j.jsbmb.2009.02.007 19429441
Kerachian, M. A., Séguin, C. & Harvey, E. J. Glucocorticoids in osteonecrosis of the femoral head: a new understanding of the mechanisms of action. J. Steroid Biochem. Mol. Biol. 114 (3–5), 121–128. 10.1016/j.jsbmb.2009.02.007 (2009).19429441 10.1016/j.jsbmb.2009.02.007
7. Wang A Ren M Wang J The pathogenesis of steroid-induced osteonecrosis of the femoral head: a systematic review of the literature Gene 2018 671 103 109 10.1016/j.gene.2018.05.091 29859289
Wang, A., Ren, M. & Wang, J. The pathogenesis of steroid-induced osteonecrosis of the femoral head: a systematic review of the literature. Gene 671, 103–109. 10.1016/j.gene.2018.05.091 (2018).29859289 10.1016/j.gene.2018.05.091
8. Li Y Zhang J Zhao Y Tian R Yang P A novel animal model of osteonecrosis of the femoral head based on 3D printing technology J. Orthop. Surg. Res. 2023 18 1 564 10.1186/s13018-023-04050-7 37537614
Li, Y., Zhang, J., Zhao, Y., Tian, R. & Yang, P. A novel animal model of osteonecrosis of the femoral head based on 3D printing technology. J. Orthop. Surg. Res. 18 (1), 564. 10.1186/s13018-023-04050-7 (2023).37537614 10.1186/s13018-023-04050-7
9. Martel D 3T chemical shift-encoded MRI: detection of altered proximal femur marrow adipose tissue composition in glucocorticoid users and validation with magnetic resonance spectroscopy J. Magn. Reson. Imaging 2019 50 2 490 496 10.1002/jmri.26586 30548522
Martel, D. et al. 3T chemical shift-encoded MRI: detection of altered proximal femur marrow adipose tissue composition in glucocorticoid users and validation with magnetic resonance spectroscopy. J. Magn. Reson. Imaging 50 (2), 490–496. 10.1002/jmri.26586 (2019).30548522 10.1002/jmri.26586
10. Chotiyarnwong P McCloskey EV Pathogenesis of glucocorticoid-induced osteoporosis and options for treatment Nat. Rev. Endocrinol. 2020 16 8 437 447 10.1038/s41574-020-0341-0 32286516
Chotiyarnwong, P. & McCloskey, E. V. Pathogenesis of glucocorticoid-induced osteoporosis and options for treatment. Nat. Rev. Endocrinol. 16 (8), 437–447. 10.1038/s41574-020-0341-0 (2020).32286516 10.1038/s41574-020-0341-0
11. Zhu L Parathyroid hormone (PTH) induces autophagy to protect osteocyte cell survival from dexamethasone damage Med. Sci. Monit. 2017 23 4034 4040 10.12659/msm.903432 28824162
Zhu, L. et al. Parathyroid hormone (PTH) induces autophagy to protect osteocyte cell survival from dexamethasone damage. Med. Sci. Monit. 23, 4034–4040. 10.12659/msm.903432 (2017).28824162 10.12659/msm.903432
12. Sun F Zhou JL Liu ZL Jiang ZW Peng H Dexamethasone induces ferroptosis via P53/SLC7A11/GPX4 pathway in glucocorticoid-induced osteonecrosis of the femoral head Biochem. Biophys. Res. Commun. 2022 602 149 155 10.1016/j.bbrc.2022.02.112 35276555
Sun, F., Zhou, J. L., Liu, Z. L., Jiang, Z. W. & Peng, H. Dexamethasone induces ferroptosis via P53/SLC7A11/GPX4 pathway in glucocorticoid-induced osteonecrosis of the femoral head. Biochem. Biophys. Res. Commun. 602, 149–155. 10.1016/j.bbrc.2022.02.112 (2022).35276555 10.1016/j.bbrc.2022.02.112
13. Wu T Jiang Y Shi W Wang Y Li T Endoplasmic reticulum stress: a novel targeted approach to repair bone defects by regulating osteogenesis and angiogenesis J. Transl. Med. 2023 21 1 480 10.1186/s12967-023-04328-8 37464413
Wu, T., Jiang, Y., Shi, W., Wang, Y. & Li, T. Endoplasmic reticulum stress: a novel targeted approach to repair bone defects by regulating osteogenesis and angiogenesis. J. Transl. Med. 21 (1), 480. 10.1186/s12967-023-04328-8 (2023).37464413 10.1186/s12967-023-04328-8
14. Wiseman RL Mesgarzadeh JS Hendershot LM Reshaping endoplasmic reticulum quality control through the unfolded protein response Mol. Cell 2022 82 8 1477 1491 10.1016/j.molcel.2022.03.025 35452616
Wiseman, R. L., Mesgarzadeh, J. S. & Hendershot, L. M. Reshaping endoplasmic reticulum quality control through the unfolded protein response. Mol. Cell 82 (8), 1477–1491. 10.1016/j.molcel.2022.03.025 (2022).35452616 10.1016/j.molcel.2022.03.025
15. Yoshida H Matsui T Yamamoto A Okada T Mori K XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor Cell 2001 107 7 881 891 10.1016/s0092-8674(01)00611-0 11779464
Yoshida, H., Matsui, T., Yamamoto, A., Okada, T. & Mori, K. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107 (7), 881–891. 10.1016/s0092-8674(01)00611-0 (2001).11779464 10.1016/s0092-8674(01)00611-0
16. Tao SC Exosomes derived from human platelet-rich plasma prevent apoptosis induced by glucocorticoid-associated endoplasmic reticulum stress in rat osteonecrosis of the femoral head via the Akt/Bad/Bcl-2 signal pathway Theranostics 2017 7 3 733 750 10.7150/thno.17450 28255363
Tao, S. C. et al. Exosomes derived from human platelet-rich plasma prevent apoptosis induced by glucocorticoid-associated endoplasmic reticulum stress in rat osteonecrosis of the femoral head via the Akt/Bad/Bcl-2 signal pathway. Theranostics 7 (3), 733–750. 10.7150/thno.17450 (2017).28255363 10.7150/thno.17450
17. Jia Y Identification and assessment of novel dynamic biomarkers for monitoring non-traumatic osteonecrosis of the femoral head staging Clin. Transl. Med. 2023 13 6 e1295 10.1002/ctm2.1295 37313692
Jia, Y. et al. Identification and assessment of novel dynamic biomarkers for monitoring non-traumatic osteonecrosis of the femoral head staging. Clin. Transl. Med. 13 (6), e1295. 10.1002/ctm2.1295 (2023).37313692 10.1002/ctm2.1295
18. Rebhan M Chalifa-Caspi V Prilusky J Lancet D GeneCards: integrating information about genes, proteins and diseases Trends Genet. 1997 13 4 163 10.1016/s0168-9525(97)01103-7 9097728
Rebhan, M., Chalifa-Caspi, V., Prilusky, J. & Lancet, D. GeneCards: integrating information about genes, proteins and diseases. Trends Genet. 13 (4), 163. 10.1016/s0168-9525(97)01103-7 (1997).9097728 10.1016/s0168-9525(97)01103-7
19. Love MI Huber W Anders S Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 Genome Biol. 2014 15 12 550 10.1186/s13059-014-0550-8 25516281
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15 (12), 550. 10.1186/s13059-014-0550-8 (2014).25516281 10.1186/s13059-014-0550-8
20. Kanehisa M Toward understanding the origin and evolution of cellular organisms Protein Sci. 2019 28 11 1947 1951 10.1002/pro.3715 31441146
Kanehisa, M. Toward understanding the origin and evolution of cellular organisms. Protein Sci. 28 (11), 1947–1951. 10.1002/pro.3715 (2019).31441146 10.1002/pro.3715
21. Kanehisa M Furumichi M Sato Y Kawashima M Ishiguro-Watanabe M KEGG for taxonomy-based analysis of pathways and genomes Nucleic Acids Res. 2023 51 D1 D587 D592 10.1093/nar/gkac963 36300620
Kanehisa, M., Furumichi, M., Sato, Y., Kawashima, M. & Ishiguro-Watanabe, M. KEGG for taxonomy-based analysis of pathways and genomes. Nucleic Acids Res. 51 (D1), D587–D592. 10.1093/nar/gkac963 (2023).36300620 10.1093/nar/gkac963
22. Kanehisa M Goto S KEGG: kyoto encyclopedia of genes and genomes Nucleic Acids Res. 2000 28 1 27 30 10.1093/nar/28.1.27 10592173
Kanehisa, M. & Goto, S. KEGG: kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28 (1), 27–30. 10.1093/nar/28.1.27 (2000).10592173 10.1093/nar/28.1.27
23. Yu G Wang LG Han Y He QY clusterProfiler: an R package for comparing biological themes among gene clusters Omics 2012 16 5 284 287 10.1089/omi.2011.0118 22455463
Yu, G., Wang, L. G., Han, Y. & He, Q. Y. clusterProfiler: an R package for comparing biological themes among gene clusters. Omics 16 (5), 284–287. 10.1089/omi.2011.0118 (2012).22455463 10.1089/omi.2011.0118
24. Franceschini A STRING v9.1: protein-protein interaction networks, with increased coverage and integration Nucleic Acids Res. 2013 41 D808 D815 10.1093/nar/gks1094 23203871
Franceschini, A. et al. STRING v9.1: protein-protein interaction networks, with increased coverage and integration. Nucleic Acids Res. 41, D808–D815. 10.1093/nar/gks1094 (2013).23203871 10.1093/nar/gks1094
25. Shannon P Cytoscape: a software environment for integrated models of biomolecular interaction networks Genome Res. 2003 13 11 2498 2504 10.1101/gr.1239303 14597658
Shannon, P. et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 13 (11), 2498–2504. 10.1101/gr.1239303 (2003).14597658 10.1101/gr.1239303
26. Liberzon, A. et al. Molecular signatures database (MSigDB) 3.0. Bioinformatics (Oxford, England) 27 (12), 1739–1740. 10.1093/bioinformatics/btr260 (2011).
27. Dweep H Sticht C Pandey P Gretz N miRWalk–database: prediction of possible miRNA binding sites by walking the genes of three genomes J. Biomed. Inform. 2011 44 5 839 847 10.1016/j.jbi.2011.05.002 21605702
Dweep, H., Sticht, C., Pandey, P. & Gretz, N. miRWalk–database: prediction of possible miRNA binding sites by walking the genes of three genomes. J. Biomed. Inform. 44 (5), 839–847. 10.1016/j.jbi.2011.05.002 (2011).21605702 10.1016/j.jbi.2011.05.002
28. Chen EY Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool BMC Bioinform. 2013 14 128 10.1186/1471-2105-14-128
Chen, E. Y. et al. Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinform. 14, 128. 10.1186/1471-2105-14-128 (2013).10.1186/1471-2105-14-128
29. Kuleshov MV Enrichr: a comprehensive gene set enrichment analysis web server 2016 update Nucleic Acids Res. 2016 44 W1 W90 W97 10.1093/nar/gkw377 27141961
Kuleshov, M. V. et al. Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res. 44 (W1), W90–W97. 10.1093/nar/gkw377 (2016).27141961 10.1093/nar/gkw377
30. Newman AM Robust enumeration of cell subsets from tissue expression profiles Nat. Methods 2015 12 5 453 457 10.1038/nmeth.3337 25822800
Newman, A. M. et al. Robust enumeration of cell subsets from tissue expression profiles. Nat. Methods 12 (5), 453–457. 10.1038/nmeth.3337 (2015).25822800 10.1038/nmeth.3337
31. Liang XZ Identification of potential autophagy-related genes in steroid-induced osteonecrosis of the femoral head via bioinformatics analysis and experimental verification J. Orthop. Surg, Res. 2022 17 1 86 10.1186/s13018-022-02977-x 35151359
Liang, X. Z. et al. Identification of potential autophagy-related genes in steroid-induced osteonecrosis of the femoral head via bioinformatics analysis and experimental verification. J. Orthop. Surg, Res. 17 (1), 86. 10.1186/s13018-022-02977-x (2022).35151359 10.1186/s13018-022-02977-x
32. Robin X pROC: an open-source package for R and S + to analyze and compare ROC curves BMC Bioinform. 2011 12 77 10.1186/1471-2105-12-77
Robin, X. et al. pROC: an open-source package for R and S + to analyze and compare ROC curves. BMC Bioinform. 12, 77. 10.1186/1471-2105-12-77 (2011).10.1186/1471-2105-12-77
33. Li T MicroRNA expression profile of dexamethasone-induced human bone marrow-derived mesenchymal stem cells during osteogenic differentiation J. Cell. Biochem. 2014 115 10 1683 1691 10.1002/jcb.24831 24802236
Li, T. et al. MicroRNA expression profile of dexamethasone-induced human bone marrow-derived mesenchymal stem cells during osteogenic differentiation. J. Cell. Biochem. 115 (10), 1683–1691. 10.1002/jcb.24831 (2014).24802236 10.1002/jcb.24831
34. Li T microRNA-23a inhibits osteogenic differentiation of human bone marrow-derived mesenchymal stem cells by targeting LRP5 Int. J. Biochem. Cell Biol. 2016 72 55 62 10.1016/j.biocel.2016.01.004 26774446
Li, T. et al. microRNA-23a inhibits osteogenic differentiation of human bone marrow-derived mesenchymal stem cells by targeting LRP5. Int. J. Biochem. Cell Biol. 72, 55–62. 10.1016/j.biocel.2016.01.004 (2016).26774446 10.1016/j.biocel.2016.01.004
35. Xu Y Jiang Y Jia B Wang Y Li T Icariin stimulates osteogenesis and suppresses adipogenesis of human bone mesenchymal stem cells via miR-23a-mediated activation of the Wnt/β-catenin signaling pathway Phytomed. Int. J. Phytother. Phytopharmacol. 2021 85 153485 10.1016/j.phymed.2021.153485
Xu, Y., Jiang, Y., Jia, B., Wang, Y. & Li, T. Icariin stimulates osteogenesis and suppresses adipogenesis of human bone mesenchymal stem cells via miR-23a-mediated activation of the Wnt/β-catenin signaling pathway. Phytomed. Int. J. Phytother. Phytopharmacol. 85, 153485. 10.1016/j.phymed.2021.153485 (2021).10.1016/j.phymed.2021.153485
36. Xu Y LINC00473-modified bone marrow mesenchymal stem cells incorporated thermosensitive PLGA hydrogel transplantation for steroid-induced osteonecrosis of femoral head: a detailed mechanistic study and validity evaluation Bioeng. Transl. Med. 2022 7 2 e10275 10.1002/btm2.10275 35600648
Xu, Y. et al. LINC00473-modified bone marrow mesenchymal stem cells incorporated thermosensitive PLGA hydrogel transplantation for steroid-induced osteonecrosis of femoral head: a detailed mechanistic study and validity evaluation. Bioeng. Transl. Med. 7 (2), e10275. 10.1002/btm2.10275 (2022).35600648 10.1002/btm2.10275
37. Zhang X Dexamethasone induced osteocyte apoptosis in steroid-induced femoral head osteonecrosis through ROS-mediated oxidative stress Orthop. Surg. 2024 16 3 733 744 10.1111/os.14010 38384174
Zhang, X. et al. Dexamethasone induced osteocyte apoptosis in steroid-induced femoral head osteonecrosis through ROS-mediated oxidative stress. Orthop. Surg. 16 (3), 733–744. 10.1111/os.14010 (2024).38384174 10.1111/os.14010
38. Wang M Bone morphogenetic protein 2 controls steroid-induced osteonecrosis of the femoral head via directly inhibiting interleukin-34 expression J. Mol. Endocrinol. 2021 68 1 1 9 10.1530/jme-21-0163 34582356
Wang, M. et al. Bone morphogenetic protein 2 controls steroid-induced osteonecrosis of the femoral head via directly inhibiting interleukin-34 expression. J. Mol. Endocrinol. 68 (1), 1–9. 10.1530/jme-21-0163 (2021).34582356 10.1530/jme-21-0163
39. Morishita Y Cell death-associated lipid droplet protein CIDE-A is a noncanonical marker of endoplasmic reticulum stress JCI Insight 2021 6 7 980 10.1172/jci.insight.143980
Morishita, Y. et al. Cell death-associated lipid droplet protein CIDE-A is a noncanonical marker of endoplasmic reticulum stress. JCI Insight 6 (7), 980. 10.1172/jci.insight.143980 (2021).10.1172/jci.insight.143980
40. Yi J Lipid metabolism disorder promotes the development of intervertebral disc degeneration Biomed. Pharmacother. 2023 166 115401 10.1016/j.biopha.2023.115401 37651799
Yi, J. et al. Lipid metabolism disorder promotes the development of intervertebral disc degeneration. Biomed. Pharmacother. 166, 115401. 10.1016/j.biopha.2023.115401 (2023).37651799 10.1016/j.biopha.2023.115401
41. Sun F Zhou JL Wei SX Jiang ZW Peng H Glucocorticoids induce osteonecrosis of the femoral head in rats via PI3K/AKT/FOXO1 signaling pathway PeerJ 2022 10 e13319 10.7717/peerj.13319 35529482
Sun, F., Zhou, J. L., Wei, S. X., Jiang, Z. W. & Peng, H. Glucocorticoids induce osteonecrosis of the femoral head in rats via PI3K/AKT/FOXO1 signaling pathway. PeerJ 10, e13319. 10.7717/peerj.13319 (2022).35529482 10.7717/peerj.13319
42. Maurel M Chevet E Endoplasmic reticulum stress signaling: the microRNA connection Am. J. Physiol. Cell. Physiol. 2013 304 12 C1117 C1126 10.1152/ajpcell.00061.2013 23515532
Maurel, M. & Chevet, E. Endoplasmic reticulum stress signaling: the microRNA connection. Am. J. Physiol. Cell. Physiol. 304 (12), C1117–C1126. 10.1152/ajpcell.00061.2013 (2013).23515532 10.1152/ajpcell.00061.2013
43. Ganesan S Stromal cells downregulate miR-23a-5p to activate protective autophagy in acute myeloid leukemia Cell Death Dis. 2019 10 10 736 10.1038/s41419-019-1964-8 31570693
Ganesan, S. et al. Stromal cells downregulate miR-23a-5p to activate protective autophagy in acute myeloid leukemia. Cell Death Dis. 10 (10), 736. 10.1038/s41419-019-1964-8 (2019).31570693 10.1038/s41419-019-1964-8
44. Lingam I Serial blood cytokine and chemokine mRNA and microRNA over 48 h are insult specific in a piglet model of inflammation-sensitized hypoxia-ischaemia Pediatr. Res. 2021 89 3 464 475 10.1038/s41390-020-0986-3 32521540
Lingam, I. et al. Serial blood cytokine and chemokine mRNA and microRNA over 48 h are insult specific in a piglet model of inflammation-sensitized hypoxia-ischaemia. Pediatr. Res. 89 (3), 464–475. 10.1038/s41390-020-0986-3 (2021).32521540 10.1038/s41390-020-0986-3
45. Yu Y Lin L Liu K Jiang Y Zhou Z Effects of simvastatin on cartilage homeostasis in steroid-induced osteonecrosis of femoral head by inhibiting glucocorticoid receptor Cells 2022 11 24 945 10.3390/cells11243945 35326395
Yu, Y., Lin, L., Liu, K., Jiang, Y. & Zhou, Z. Effects of simvastatin on cartilage homeostasis in steroid-induced osteonecrosis of femoral head by inhibiting glucocorticoid receptor. Cells 11 (24), 945. 10.3390/cells11243945 (2022).35326395 10.3390/cells11243945
46. Jin S Curcumin prevents osteocyte apoptosis by inhibiting M1-type macrophage polarization in mice model of glucocorticoid-associated osteonecrosis of the femoral head J. Orthop. Res. 2020 38 9 2020 2030 10.1002/jor.24619 32009245
Jin, S. et al. Curcumin prevents osteocyte apoptosis by inhibiting M1-type macrophage polarization in mice model of glucocorticoid-associated osteonecrosis of the femoral head. J. Orthop. Res. 38 (9), 2020–2030. 10.1002/jor.24619 (2020).32009245 10.1002/jor.24619
47. Kikuiri T Cell-based immunotherapy with mesenchymal stem cells cures bisphosphonate-related osteonecrosis of the jaw-like disease in mice J. Bone Miner. Res. 2010 25 7 1668 1679 10.1002/jbmr.37 20200952
Kikuiri, T. et al. Cell-based immunotherapy with mesenchymal stem cells cures bisphosphonate-related osteonecrosis of the jaw-like disease in mice. J. Bone Miner. Res. 25 (7), 1668–1679. 10.1002/jbmr.37 (2010).20200952 10.1002/jbmr.37
48. He J Zhou Q Jia X Zhou P Chen L Immune-related expression profiles of bisphosphonates-related osteonecrosis of the jaw in multiple myeloma Die Pharmazie 2021 76 4 159 164 10.1691/ph.2021.01013 33849701
He, J., Zhou, Q., Jia, X., Zhou, P. & Chen, L. Immune-related expression profiles of bisphosphonates-related osteonecrosis of the jaw in multiple myeloma. Die Pharmazie 76 (4), 159–164. 10.1691/ph.2021.01013 (2021).33849701 10.1691/ph.2021.01013
49. Hu K Shang Z Yang X Zhang Y Cao L Macrophage polarization and the regulation of bone immunity in bone homeostasis J. Inflamm. Res. 2023 16 3563 3580 10.2147/jir.S423819 37636272
Hu, K., Shang, Z., Yang, X., Zhang, Y. & Cao, L. Macrophage polarization and the regulation of bone immunity in bone homeostasis. J. Inflamm. Res. 16, 3563–3580. 10.2147/jir.S423819 (2023).37636272 10.2147/jir.S423819
50. Weitzmann MN Vikulina T Roser-Page S Yamaguchi M Ofotokun I Homeostatic expansion of CD4 + T cells promotes cortical and trabecular bone loss, whereas CD8 + T cells induce trabecular bone loss only J. Infect. Dis. 2017 216 9 1070 1079 10.1093/infdis/jix444 28968828
Weitzmann, M. N., Vikulina, T., Roser-Page, S., Yamaguchi, M. & Ofotokun, I. Homeostatic expansion of CD4 + T cells promotes cortical and trabecular bone loss, whereas CD8 + T cells induce trabecular bone loss only. J. Infect. Dis. 216 (9), 1070–1079. 10.1093/infdis/jix444 (2017).28968828 10.1093/infdis/jix444
51. Wu L Natural killer cells infiltration in the joints exacerbates collagen-induced arthritis Front. Immunol. 2022 13 860761 10.3389/fimmu.2022.860761 35432322
Wu, L. et al. Natural killer cells infiltration in the joints exacerbates collagen-induced arthritis. Front. Immunol. 13, 860761. 10.3389/fimmu.2022.860761 (2022).35432322 10.3389/fimmu.2022.860761
52. Wang F IL-34 aggravates steroid-induced osteonecrosis of the femoral head via promoting osteoclast differentiation Immune Netw. 2022 22 3 e25 10.4110/in.2022.22.e25 35799706
Wang, F. et al. IL-34 aggravates steroid-induced osteonecrosis of the femoral head via promoting osteoclast differentiation. Immune Netw. 22 (3), e25. 10.4110/in.2022.22.e25 (2022).35799706 10.4110/in.2022.22.e25
53. Yu Y Genetic polymorphisms in IL1B predict susceptibility to steroid-induced osteonecrosis of the femoral head in Chinese Han population Osteoporos. Int. 2019 30 4 871 877 10.1007/s00198-019-04835-9 30852631
Yu, Y. et al. Genetic polymorphisms in IL1B predict susceptibility to steroid-induced osteonecrosis of the femoral head in Chinese Han population. Osteoporos. Int. 30 (4), 871–877. 10.1007/s00198-019-04835-9 (2019).30852631 10.1007/s00198-019-04835-9
54. Zhou Q The use of TLR2 modified BMSCs for enhanced bone regeneration in the inflammatory micro-environment Artif. Cells Nanomed. Biotechnol. 2019 47 1 3329 3337 10.1080/21691401.2019.1626867 31387403
Zhou, Q. et al. The use of TLR2 modified BMSCs for enhanced bone regeneration in the inflammatory micro-environment. Artif. Cells Nanomed. Biotechnol. 47 (1), 3329–3337. 10.1080/21691401.2019.1626867 (2019).31387403 10.1080/21691401.2019.1626867
55. Luo J CGRP-loaded porous microspheres protect BMSCs for alveolar bone regeneration in the periodontitis microenvironment Adv. Healthc. Mater. 2023 12 28 e2301366 10.1002/adhm.202301366 37515813
Luo, J. et al. CGRP-loaded porous microspheres protect BMSCs for alveolar bone regeneration in the periodontitis microenvironment. Adv. Healthc. Mater. 12 (28), e2301366. 10.1002/adhm.202301366 (2023).37515813 10.1002/adhm.202301366
