
==== Front
Mol Ther
Mol Ther
Molecular Therapy
1525-0016
1525-0024
American Society of Gene & Cell Therapy

S1525-0016(24)00424-6
10.1016/j.ymthe.2024.06.034
Original Article
NKG2A genetic deletion promotes human primary NK cell anti-tumor responses better than an anti-NKG2A monoclonal antibody
Gong Ying 123
Germeraad Wilfred T.V. 234
Zhang Xulin 5
Wu Nisha 6
Li Bo 1
Janssen Lynn 23
He Zongzhong 7
Gijbels Marion J.J. 389
Wu Bodeng 1
Gijsbers Birgit L.M.G. 23
Olieslagers Timo I. 310
Bos Gerard M.J. 234
Zheng Lei nfyyzhenglei@smu.edu.cn
1∗
Klein Wolterink Roel G.J. roel.kleinwolterink@mumc.nl
23∗∗
1 Department of Laboratory Medicine, Guangdong Engineering and Technology Research Center for Rapid Diagnostic Biosensors, Nanfang Hospital, Southern Medical University, Guangzhou 510515, P.R. China
2 Department of Internal Medicine, Division of Hematology, Maastricht University Medical Center+, 6227 HX Maastricht, the Netherlands
3 GROW – Research Institute for Oncology & Reproduction, Maastricht University, 6202 AZ Maastricht, the Netherlands
4 CiMaas BV, 6202 AZ Maastricht, the Netherlands
5 State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangdong Provincial Key Laboratory of Ophthalmology and Vision Science, Guangzhou 510000, China
6 Department of Breast and Thyroid Surgery, Southwest Hospital, Army Medical University, Chongqing 400038, P.R. China
7 Department of Transfusion Medicine of General Hospital of Southern Theatre Command, Guangzhou 510515, P.R. China
8 Department of Pathology, Maastricht University Medical Center+, Maastricht, the Netherlands
9 Department of Medical Biochemistry, Experimental Vascular Biology, Amsterdam Cardiovascular Sciences, Amsterdam Infection and Immunity, Amsterdam UMC, 1081 HV Amsterdam, the Netherlands
10 Department of Transplantation Immunology, Tissue Typing Laboratory, Maastricht University Medical Center+, 6202 AZ Maastricht, the Netherlands
∗ Corresponding author: Lei Zheng, MD PhD, Department of Laboratory Medicine, Guangdong Engineering and Technology Research Center for Rapid Diagnostic Biosensors, Nanfang Hospital, Southern Medical University, Guangzhou 510515, P.R. China. nfyyzhenglei@smu.edu.cn
∗∗ Corresponding author: Roel G.J. Klein Wolterink, MD PhD, Department of Internal Medicine, MUMC+, PO Box 5800, 6202 AZ Maastricht, the Netherlands. roel.kleinwolterink@mumc.nl
27 6 2024
07 8 2024
27 6 2024
32 8 27112727
6 10 2023
24 6 2024
© 2024 The Author(s)
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Natural killer (NK) cells eliminate infected or cancer cells via their cytotoxic capacity. NKG2A is an inhibitory receptor on NK cells and cancer cells often overexpress its ligand HLA-E to evade NK cell surveillance. Given the successes of immune checkpoint blockade in cancer therapy, NKG2A is an interesting novel target. However, anti-NKG2A antibodies have shown limited clinical response. In the pursuit of enhancing NK cell-mediated anti-tumor responses, we devised a Cas9-based strategy to delete KLRC1, encoding NKG2A, in human primary NK cells. Our approach involved electroporation of KLRC1-targeting Cas9 ribonucleoprotein resulting in effective ablation of NKG2A expression. Compared with anti-NKG2A antibody blockade, NKG2AKO NK cells exhibited enhanced activation, reduced suppressive signaling, and elevated expression of key transcription factors. NKG2AKO NK cells overcame inhibition from HLA-E, significantly boosting NK cell activity against solid and hematologic cancer cells. We validated this efficacy across multiple cell lines, a xenograft mouse model, and primary human leukemic cells. Combining NKG2A knockout with antibody coating of tumor cells further enhanced cytotoxicity through ADCC. Thus, we provide a comprehensive comparison of inhibition of the NKG2A pathway using genetic ablation and antibodies and provide novel insight in the observed differences in molecular mechanisms, which can be translated to enhance adoptive NK cell immunotherapy.

Graphical abstract

Gong and colleagues show that, compared with anti-NKG2A antibody blockade, NKG2AKO NK cells exhibited enhanced activation, reduced suppressive signaling, and elevated key transcription factors. NKG2AKO NK cells overcame inhibition from HLA-E, thereby boosting anti-cancer activity in a xenograft mouse model and against primary leukemic cells better than antibody blockade.

Keywords

checkpoint inhibitor immunotherapy
natural killer cells
NKG2A
CRISPR-Cas9
antibody-dependent cellular cytotoxicity
multiple immunofluorescence staining
HLA-E
tumor microenvironment
==== Body
pmcIntroduction

Immunotherapy has revolutionized cancer treatment, and immune checkpoint inhibitors and CAR-T cell therapy have shown remarkable clinical successes,1,2 but come with their limitations and side effects.3 Among the various immune cells involved in cancer immunotherapy, natural killer (NK) cells are innate lymphoid cells that play a vital role in recognizing and destroying cancerous and virus-infected cells.4 NK cells exhibit a potent anti-tumor activity against hematologic malignancies in clinical settings.5,6 Recently, CAR-transduced NK cells demonstrated promise in treating patients with B cell malignancies,7 with adoptive NK cells exhibiting persistence for over a year.8 However, solid tumors pose a significant challenge for cellular immunotherapy,9,10 as the tumor microenvironment produces suppressive factors such as hypoxia and low pH, among other factors, and induces high HLA class I E (HLA-E) expression levels on the cancer cells, resulting in suppressed NK cell activity.11,12,13 Therefore, developing further strategies to enhance NK cell function in the suppressive tumor microenvironment is necessary.

The immune response of NK cells is regulated by a delicate balance of activating and inhibitory receptors, which determines the outcome of effector functions toward target cells.11,14 NKG2A is a prominent inhibitory receptor on NK cells that binds to nonclassical HLA HLA-E and suppresses immune response via SHP-1.15 About 50% of naturally occurring NK cells express NKG2A. Notably, NKG2A expression levels are higher in cytotoxic lymphocytes isolated from tumor microenvironments,16 while ex-vivo-expanded NK cells may express even higher levels (unpublished data from our laboratory). HLA-E, the only known ligand for NKG2A, is overexpressed in many cancer cells, contributing to poor outcomes in multiple cancers, and evading circulating tumor cells from immune surveillance.15,17 Our group’s previous study using a mouse model demonstrated that myeloma cells express higher levels of HLA-E, resulting in further suppression of NK cell functions.18 While antibodies targeting CTLA-4 and the PD-1 axis have shown success, standalone NKG2A antibody blockade has demonstrated limited efficacy in a phase 2 trial for head and neck squamous cell carcinoma.19 Recent studies have emphasized the significance of targeting the NKG2A pathway in cancer treatment, with the recognition of NK cells as safe and competent effector cells for adoptive cell therapy.16,20 Therefore, it is crucial to effectively target this immunosuppressive molecule to improve anti-tumor responses. Here, we report an effective strategy to knock out NKG2A in human primary NK cells using Cas9, promoting enhanced cytotoxicity against HLA-Ehi tumor cell lines. Our approach surpasses the efficacy of anti-NKG2A antibodies in both in vitro and an in vivo mouse model by inducing tumor apoptosis and double-strand DNA breaks, leading to enhanced tumor eradication by NK cells. As Cas9-mediated deletion of NKG2A is easily adaptable to GMP-compliant conditions, this technique is an attractive way to improve NK cell-based anti-cancer therapy.

Results

NK cell phenotype, function, and KIR expression levels are not affected by NKG2A deletion

We used CRISPR-Cas9 to knock out the NKG2A-encoding gene KLRC1 by targeting its first coding exon (Figures 1A and S1). NKG2A deletion decreased the fraction of NKG2A+ expanded primary NK cells from 66.7% to 17.3% (average of n = 17 different donors; Figure 1B) without impacting phenotype, survival, and proliferation ability (Figure S1). To reveal changes to the NK cell transcriptome induced by NKG2A deletion, we performed RNA sequencing (RNA-seq) analysis on six paired samples without purification of negative fractions, comparing control and Cas9-treated NK cells. The most important variance between samples is explained by differences between donors, and the directionality of the variance shift between knockout and control cells was similar in all but one sample (Figure S2). We found only four genes (EGR2, TNF, RN7SK, and PGF) with significant differential expression between control and NKG2AKO NK cells (Figures 1C and 1D). qRT-PCR analysis of purified NKG2A− NK cells and unsorted NKG2AKO cultures was used to confirm their gene expression levels. Importantly, qRT-PCR analyses of purified NKG2AKO NK cells and unsorted cultures that still contained a small fraction of NKG2A-competent cells were highly similar, thus validating the RNA-seq analysis on non-purified NKG2AKO cultures (Figure S2E). NKG2A-deficient NK cells overexpressed the transcription factor EGR2, which is associated with NK cell differentiation, maturation, and activation.21,22 The function of RN7SK and PGF in human NK cells remains to be studied. Next, flow cytometric analysis revealed no changes in phenotypic or effector molecules (Figures 1E and 1F; statistical analysis of replicate donors and additional analyses in Figure S3). In contrast to the difference in TNF gene expression, we found no differences in TNF at the protein level. Importantly, we found neither compensatory upregulation of other checkpoint markers nor altered expression of killer cell immunoglobulin-like receptor in NKG2AKO cells (Figures 1G and 1H).23 Together, Cas9-mediated knockout of NKG2A does not have a major impact on resting NK cells at the transcriptional or protein level.Figure 1 Cas9-mediated deletion of NKG2A from human NK cells is efficient and induces minor changes to phenotypic and functional markers

(A) Schematic representation of the NKG2A-encoding KLRC1 gene on human chromosome 12 with non-coding regions (gray) and coding exons (white boxes), including the Cas9-targeted sequence with PAM sequence (red text) and the predicted cut site (scissors symbol). (B) Flow cytometric analysis of NKG2A expression in NK cells from multiple donors before (black line) and after NKG2A deletion (red line). The dots in the right panel represent individual donors, with lines indicating paired comparison (paired t test; ∗∗∗∗p < 0.001) of NKG2A-positive fraction before and after NKG2A deletion in each sample. (C) Volcano plot of differentially expressed genes in control versus NKG2AKO samples, analyzed using RNA-seq analysis (n = 6 paired NK cell samples), with significantly differentially expressed genes (corrected p value <0.05) shown in red (up in NKG2AKO) or blue (up in control). (D) The heatmap of gene expression of significantly different genes in six paired NK cell samples before and after NKG2A deletion analyzed using RNA-seq. (E–H) Flow cytometric analysis of WT control (black line) and NKG2AKO (red line) samples of one representative donor, showing phenotypic markers (E), effector molecules (F), checkpoint markers (G), and killer immunoglobulin-like receptors (KIR) (H).

NKG2A deletion enhanced NK cytotoxicity in vitro and can be combined with ADCC

To address the functionality of NKG2AKO NK cells, we tested cytotoxicity against HLA-E+ human tumor cell lines. While the mechanisms underpinning high HLA-E expression levels remain elusive, it is known that immune cell-induced anti-tumor responses, and IFN-γ in particular, promote HLA-E expression (Figure 2A).24,25 As expected, HLA-E expression levels varied both at baseline and after IFN-γ treatment, with K562 expressing the lowest HLA-E levels.26 This cell line also did not show an increase in HLA-E expression levels upon IFN-γ stimulation. Using wild-type NK cells, we confirmed reduced degranulation and reduced cytotoxicity against cell lines with strong induction of HLA-E expression, including the multiple myeloma cell lines RPMI-8226 and U266 and the breast cancer cell lines T-47D and SK-BR-3, but not in the HLA-Elow K562 cell line (Figures 2B and 2C). In all HLA-E+ cell lines, thus not in K562 cells, NKG2A-deficient NK cells overcame HLA-E inhibition and displayed enhanced cytotoxicity. Anti-NKG2A antibodies were also able to partially restore cytotoxicity against HLA-E+ cell lines, albeit at lower levels than NKG2AKO NK cells (Figures 2D and S4). These enhanced anti-tumor effects are at least partially explained by enhanced TNF-α and IFN-γ production (Figures S4B and S4C). Genetic deletion of HLA-E from tumor lines (Figures S5A–S5C) confirms that antibody-mediated blockade of the NKG2A pathway cannot completely block the effects mediated by the NKG2A/HLA-E axis (Figure S5D). In contrast, cytotoxicity following NKG2A deletion in NK cells was at similar levels as NK cell responses to HLA-E-deficient tumor cell lines (Figure S5E). Thus, NKG2A blockade unleashes a strong anti-tumor response in NK cells, especially after genetic deletion of NKG2A.Figure 2 NKG2A genetic deletion enhances NK cell cytotoxicity and outperforms anti-NKG2A antibodies

(A) HLA-E expression levels were analyzed in tumor cell lines by flow cytometry after incubation with IFN-γ (1,000 U/mL). IFN-γ was removed by washing two times with PBS before co-culture with NK cells. (B and C) Flow cytometry was used to determine the degranulation (B) and tumor cell killing (C) of NK cells incubated with HLA-Ehi or control tumor cell lines. A paired t test was used to determine statistical significance, with p values. (D) Primary human NK cells were incubated with tumor cell lines at an effector-target ratio of 2:1. Specific cytotoxicity (calculations in materials and methods) before and after IFN-γ treatment to upregulate HLA-E levels are shown. NK cells with CRISPR-Cas9-mediated NKG2AKO and co-cultured with blocking anti-NKG2A antibodies (1 μg/mL) were tested. Pooled data from eight donors (mean of three technical duplicates) were analyzed using one-way ANOVA with Tukey post-tests. (E and F) Antibody-dependent NK cell-mediated cytotoxicity against tumor cell lines treated with IFN-γ to upregulate HLA-E levels was measured at two effector-target (E:T) ratios using wild-type NK cells, anti-NKG2A antibodies, or NKG2AKO NK cells, along with the relevant anti-tumor antibodies (trastuzumab or daratumumab). Data are shown as mean ± SD, with dots representing individual donors (average of technical duplicates). Statistical differences between groups were determined using one-way ANOVA with Tukey post-tests. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; ns, not significant.

The cytotoxic response by NK cells against tumor cells can be enhanced by ADCC: activation through binding of tumor antigen-recognizing antibodies to the Fc gamma receptor III (CD16).27 For instance, trastuzumab is used to treat HER2+ breast and gastric cancer28 and daratumumab (anti-CD38) improves the outcome of multiple myeloma patients.29 Therefore, we tested whether NKG2A deletion improved ADCC, combining HLA-Ehi tumor cells lines with NK cells and the monoclonal antibodies recognizing tumor epitopes (Figures 2E and 2F). As expected, the addition of ADCC-inducing antibodies improved NK cytotoxicity. Blockade of the NKG2A axis further improved cytotoxicity in both cell lines. Thus, NKG2A knockout and ADCC independently enhance NK cytotoxicity, but can also be coupled to further enhance the killing capacity of NK cells.

Differential effects of NKG2A genetic deletion and antibody blockade on activating and inhibitory downstream signaling pathways

Given the difference in killing capacity between interference with the NKG2A pathway via antibodies and genetic deletion, we investigated the downstream targets of this receptor. Inhibitory NK cell receptors such as NKG2A signal via tyrosine-containing motifs. Phosphorylation of these inhibitory motifs enables the recruitment of the protein kinases SHP-1 and SHP-2, which de-phosphorylate signaling intermediates, thereby negatively regulating NK cell function.30 SHP-1 inhibits NK cell effector functions,31 while SHP-2 selectively inhibits cytokine production.32 We hypothesized that the observed increased killing capacity in NKG2AKO NK cells may be due to reduced expression of these negative regulators of NK cells. To test this hypothesis, we analyzed protein expression and phosphorylation of NK cells treated with anti-NKG2A antibodies and after NKG2A deletion. For this analysis, we purified NKG2AKO NK cells using flow cytometric sorting and compared these cells with NK cells treated with anti-NKG2A antibodies at saturating conditions (Figures S6A and S6B). We confirmed that increasing doses of anti-NKG2A antibodies did not impact NK cell survival (Figure S6C).

Since SHP-1 is the most important direct downstream target of the NKG2A receptor, we first investigated SHP-1 expression levels and phosphorylation at baseline. We did not observe differences in SHP-1 expression levels, but found that SHP-1 phosphorylation was diminished in NKG2A-deficient NK cells, but not in NK cells treated with different doses of anti-NKG2A antibodies (Figure 3A). Likewise, SHP-2 protein levels were unaltered, but NKG2A-deficient NK cells showed less SHP-2 phosphorylation. We also observed higher protein expression levels of the transcription factors EGR2, PLZF, GATA3, and EOMES. We confirmed higher TNF levels, but did not observe differences in expression of NCAM-1 (CD56). Granzyme B expression was higher in NK cells treated with anti-NKG2A antibodies, but not in knockout NK cells (Figures 3B and 3C).Figure 3 Decreased SHP-1 phosphorylation in NKG2A-deficient NK cells

(A) Purified NK (1 × 106) cells were lysed in RIPA buffer and (phosphorylated) protein expression levels were analyzed. Left panel is a representative sample of a western blot, right panel is the quantification of protein expression analysis of three donors. (B) Protein expression analysis of the indicated (phosphorylated) genes, with a representative sample (left panel) and quantification (bar graphs, right panel). (C) Bars show quantification of protein expression levels as shown in (B), compared with endogenous β-actin or total protein expression levels. Data are shown as mean ± SD, with dots representing individual donors (average of technical duplicates). Statistical differences between groups were determined using one-way ANOVA with Tukey post-tests. ∗p < 0.05, ∗∗p < 0.01; ns, not significant.

We then determined how NKG2A pathway interference impacts downstream signaling in activated NK cells by stimulating control, antibody-treated and NKG2AKO NK cells with HLA-Ehi and HLA-Elow T-47D cells (Figure 4). We first confirmed that we could separate NK cells and T-47D cells following co-culture (Figure S7A). Following activation with tumor cells, NKG2A-deficient NK cell phosphorylation of SHP-1 continued to be markedly decreased compared with antibody-treated and control NK cells (Figures 4A and 4B). Phosphorylation of SYK and the STAT family is directly regulated by SHP-133,34 and partially by SHP-2,35 and was increased in NKG2AKO NK cells. ERK1/2 and VAV1 are further downstream of the SYK and STAT signaling pathways and their phosphorylation was also increased in knockout cells. We also confirmed increased TNF production, but found no changes in CD56 expression levels (Figures S7B and S7C). Enhanced activation of the aforementioned pathways is likely responsible for increased anti-tumor effects by NKG2AKO NK cells.33,36,37 In contrast, we did not observe these differences in NK cells with antibody-mediated blockade of the NKG2A pathway. While these limited analyses of the NKG2A pathway do not provide a full explanation for the observed superior cytotoxicity of NKG2AKO NK cells compared with antibody-treated NK cells, they may serve as the basis for future studies that further untangle the involvement of this pathway.Figure 4 Activation of NK cell intracellular signaling pathways in human primary NKG2AKO NK cells

(A) Representative sample of total and phosphorylated protein analysis of control, antibody-treated, and sorted NKG2A−/− NK cells stimulated for 30 min with T-47D cells (baseline HLA-E expression levels or HLA-Ehi after stimulation with IFN-γ). IFN-γ was removed by washing two times with PBS before co-culture with NK cells. (B) Bars show quantification of ratio of phosphorylated protein or total protein expression levels of samples prepared as in (A). Per condition, one representative image from three independent experiments is shown. Data are shown as mean ± SD, with dots representing individual donors (average of technical duplicates). Statistical differences between groups were determined using one-way ANOVA with Tukey post-tests. ∗p < 0.05, ∗∗p < 0.01; ns, not significant.

NKG2A-deleted NK cells show increased anti-tumor effects in vivo

Next, we tested our genetic NKG2A knockout approach against unmodified NK cells and antibody-mediated blockage of the NKG2A pathway in an in vivo model using tumor xenografts. To this end, we transplanted T-47D breast cancer and U266 multiple myeloma cells into conditioned BALB/c nude mice (Figure 5A).38,39 Seven days after tumor injection, mice received normal or NKG2AKO NK cells (Figure S8A) and were treated with anti-NKG2A antibodies or not. We observed that, in mice treated with NK cells, both the breast tumors and plasmacytomas were significantly smaller at the end of the experiment (Figures 5B, 5C, S8B, and S8C), which was consistent with the smaller tumor volume during the experiment (Figures 5D and 5E). Anti-NKG2A antibodies enhanced NK-mediated control of tumor growth, but NKG2AKO NK cells constrained tumor growth even better (Figures 5B–5E). While mice were injected with anti-NKG2A antibodies only once, we still observed unbound antibodies in the serum of the mice at the end of the experiment, albeit at low levels (Figure S8D). We then confirmed that repeated injection of anti-NKG2A antibodies results in increased serum concentrations at the end of the experiment, but does not further improve tumor control to the level of genetic deletion of NKG2A (Figure S9).Figure 5 NKG2AKO NK cells’ anti-tumor activity surpasses anti-NKG2A antibody treatment in a xenograft tumor mouse model

(A) Schematic diagram of adoptive NK cell therapy. BALB/c nude mice (n = 5 per group) were conditioned with cyclophosphamide to deplete remaining immune cells. T-47D cells (1 × 105) and U266 cells (2 × 105) suspended in 100 μL PBS were subcutaneously injected into the right flank of the mice. Seven days later, mice were treated with either PBS (PBS group), 1 × 107 expanded NK cells (NK only group), anti-NKG2A mAb (200 μg per mouse) plus 1 × 107 expanded NK cells (anti-NKG2A mAb group), or 1 × 107 NKG2AKO NK cells (NKG2AKO group) intravenously. All mice received i.p. injections of IL-2 every other day. (B and C) Tumor nodules were collected for morphological analysis on day 22 (T-47D cells, n = 6) and on day 31 (U266 cells, n = 5). The weight of tumor nodules was measured. (D and E) Tumor size was measured every 3 days. The data are presented as mean ± SD. Dots represent individual mice (average of technical duplicates). Differences between groups were determined with one-way ANOVA with Tukey post-tests. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; ns, not significant.

We hypothesized that NKG2A blockade also enhanced NK cell function in the tumor microenvironment, resulting in better tumor control. Therefore, we explored the phenotype and function of tumor-infiltrating NK cells at the end of the experiment. We found more NK cells in the tumor masses (Figure 6A), suggesting that the NKG2A axis plays a role in proliferation, tumor infiltration, or persistence of NK cells in this immunosuppressive environment. We observed no changes in NKG2A expression levels between antibody-treated and control mice (Figure 6B). Infiltrating NK cells that lack NKG2A showed more cytokine production, degranulation and granzyme B production (Figures 6C–6F). Interestingly, CD16 expression levels were increased in mice treated with knockout NK cells (Figure 6G). Future studies should indicate if this overexpression can be exploited to further enhance NK cell cytotoxicity via ADCC, such as is the case in our in vitro experiments (Figures 2E and 2F). The better tumor kill in the NKG2A-deficient group was also reflected by higher expression levels of the activating receptor NKG2D (Figure 6H). We observed no differences in the maturation markers CD57, CD27, CD45RA, PD-1, or CCR7 (Figure S10).Figure 6 NKG2A deletion enhances intratumoral NK cell numbers and activity

(A) The frequency of human NK effector cell infiltration (TIL NK) in tumor tissue was measured in different groups (n = 5 animals per group). Tumor lumps were dissociated to make single-cell suspensions that were stained with anti-human CD45, CD3, and CD56 antibodies. (B–H) TIL NK were analyzed for the expression of surface markers and effector molecules using flow cytometry. Bar graphs show statistical analysis of multiple animals, dot plots show one representative sample. Data are shown as mean ± SD, and dots represent individual animals (average of technical duplicates). Differences between groups were determined with one-way ANOVA with Tukey post-tests. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; ns, not significant.

We further characterized the tumor microenvironment using immunohistochemical analyses. In both cohorts of mice injected with T-47D tumor cells (Figure 7) and those with U-266 tumors (Figure S11), a notable reduction in proliferating cells marked by Ki-67 was observed upon treatment with NK cells featuring NKG2A blockade. Concurrently, there was a significant upsurge in markers indicative of heightened tumor cell death, as demonstrated by increased levels of γ-H2AX, signifying double-stranded DNA breaks, and augmented TUNEL staining, denoting the terminal phase of apoptosis, within these treated mice. Also, as in previous assays, the anti-cancer effects in the knockout group were more pronounced than in the antibody-treated group. There were no major differences in NK cell proliferation between groups (Figure S12). There was a minor infiltration of mouse NK cells in the tumor tissue as a result of the genetic immunodeficiency combined with cyclophosphamide conditioning (Figure S13). We did not see any gross disturbance of tissue architecture or clusters of infiltrating lymphocytes in other organs, indicating that there were no major off-target toxic effects resulting from administration of NK cells with a deficiency in a major inhibitory pathway (Figure S14). Together, these experiments show that NKG2A deletion is a powerful way to unleash the potential of human NK cells for anti-cancer therapy in a xenograft mouse model.Figure 7 NKG2AKO enhances NK cell-mediated tumor cell death in a T-47D tumor-bearing mouse model

(A) Immunohistochemical analysis of tumor tissue of T-47D tumor-bearing mice. One representative sample per group is shown. Shown are Ki-67 (proliferation), γ-H2AX (double-stranded DNA breaks), TUNEL (terminal apoptosis), and NKp46 (human NK cell infiltration). Representative image were showed in 200× magnification. Scale bars, 100 μm. (B) Quantification of cells expressing the various markers. Five samples were analyzed for each tumor group. Data are shown as mean ± SD, and dots represent individual animals. Differences between groups were determined with one-way ANOVA with Tukey post-tests. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; ns: not significant.

NKG2A deletion improves cytotoxicity against primary human leukemic cells

Finally, we tested the potency of NKG2A deletion to enhance cytotoxicity against primary human tumor cells. Therefore, we isolated primary leukemic cells from patients with acute lymphocytic leukemia (ALL) and acute myeloid leukemia (AML), respectively. At baseline, these tumor cells already displayed high HLA-E expression levels, which was further upregulated by IFN-γ (Figure 8A). Using primary expanded NK cells that were expanded from three healthy donors, we tested cytotoxicity against cells from four ALL and four AML patients, in the presence of anti-NKG2A antibodies and NKG2AKO NK cells (Figure 8B). As expected, there is considerable healthy donor-dependent variation in killing capacity of the various tumor cells (Figure S15). However, NKG2A deletion enhanced cytotoxicity in NK cells, and the effect was stronger than antibody-mediated blockade. This confirms that NKG2A deletion is also likely to improve NK cytotoxicity against tumor cells in patients.Figure 8 NKG2A genetic ablation enhances NK cell cytotoxicity against human primary leukemia cells

(A) Flow cytometry was used to analyze HLA-E expression levels in primary acute lymphocytic leukemia (ALL) and acute myeloid leukemia (AML) cells following incubation with IFN-γ (1,000 U/mL for 12 h). IFN-γ was removed by washing two times with PBS before co-culture with NK cells. (B) Four-hour cytotoxicity assays were performed against human primary ALL cells and AML cells from four patients who were exposed to IFN-γ. Expanded NK cells from three donors were used in four ALL and four AML experiments, with technical duplicates at a 2:1 effector-target (E:T) ratio. CRISPR-Cas9-mediated NKG2AKO was used for some NK cells, while others were co-cultured with blocking anti-NKG2A antibodies (Ab) (1 μg/mL). Dots represent the means of three technical duplicates. Differences between groups were determined with one-way ANOVA with Tukey post-tests. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001; ns, not significant.

Discussion

Multiple clinical studies have demonstrated the potent anti-tumor capacity of NK cells.40,41 Various methods have been developed to enhance their function and persistence in immunotherapy.13,14,42 In this preclinical study, we utilized CRISPR-Cas9 knockout technology to delete inhibitory signaling in human primary NK cells by targeting NKG2A, an inhibitory receptor crucial for NK cell education and licensing.43,44,45 At baseline, NKG2A knockout using Cas9 in our human primary NK cell expansion system did not affect NK cell expansion ability, phenotype, cytotoxicity, killer immunoglobulin-like receptor (KIR) expression or degranulation capacities, nor did it induce major changes to the transcriptome. However, we show important changes in the molecular pathway downstream of the NKG2A receptor upon NKG2A deletion, but not after antibody-mediated blockade. Despite our limited analysis of the pathway, we conclude that these changes are likely responsible for the increased killing capacity of NKG2AKO NK cells against HLA-Ehi tumor cells in vitro and in vivo in xenograft models. Furthermore, we confirmed this enhanced cytotoxicity against primary human leukemia cells, making NKG2A deletion interesting for clinical applications using donor NK cells.

A recent study shows that circulating tumor cells that are thought to function as the basis for metastasis of solid tumors, also express high levels of HLA-E to evade NK cell surveillance.46,47 Here, an anti-NKG2A antibody was used to block HLA-E:NKG2A interaction, preventing metastasis of pancreatic cancer cells. In addition, HLA-E knockdown in tumor cells also enhanced NK cell cytotoxicity. We also confirmed that HLA-E knockout in tumor cells, thereby completely blocking the HLA-E/NKG2A axis, outperforms antibody-mediated blockade. In contrast, the kill capacity of NKG2AKO NK cells was at similar levels as in HLA-E-deleted conditions. This further supports our conclusion that NKG2A deletion in NK cells works better to promote anti-cancer responses than antibody-mediated blockade.

This study provides some new insights in how the NKG2A pathway operates at the molecular level. Deletion of NKG2A leads to decreased phosphorylation of the immediate downstream mediators SHP-1 and SHP-2. After activation, NKG2A−/− NK cells had a more activated state, indicated by enhanced phosphorylation of VAV1 and ERK1/2 that are linked to NK cell cytotoxicity via degranulation.36,37 Importantly, other inhibitory receptors such as KIRs and Ly49s also contain ITIM sites that can recruit SHP-1 and SHP-2.30,48 This balance is especially important to keep self-tolerance and thus to avoid off-target cytotoxicity. Future studies, such as assays in which partners of NKG2A are knocked out or overexpressed, are required to provide a more comprehensive molecular analysis of the NKG2A pathway in NK cells. This may pave the way for further strategies to enhance anti-cancer effects of NK cells.

Our study has demonstrated that NKG2A genetic knockout may be a more effective method of attenuating NK cell exhaustion in a tumor-suppressive microenvironment than anti-NKG2A antibody blockade. Although monalizumab, a humanized monoclonal anti-NKG2A antibody, has shown safety in clinical trials and is currently in phase II and III testing, initial results show limited anti-tumor efficacy.19,49,50 Furthermore, a recent phase I/II trial using monalizumab in combination with durvalumab (anti-programmed death ligand-1) in various solid malignancies showed a partial response in only 10% of patients or less, depending on the tumor type.51 Another trial in head and neck cancer was recently stopped due to lack of efficacy (NCT04590963).52 In this study, we used the commercially available NKG2A-blocking antibody Z199. In a recent study, Z199 and monalizumab were shown to bind to the same NKG2A region with similar binding properties.49 Importantly, the binding site of these antibodies differs by only two amino acids from the activating NK cell receptor NKG2C, potentially hampering the further development of these blocking antibodies for clinical use. In addition, the EC50 values for monalizumab were highly dependent on the HLA-E-peptide complexes, and in various instances were shown to be considerably higher for these of clinically used immune checkpoint inhibitors such as PD-1 and PD-L1.49,53 Therefore, genetic ablation of NKG2A in NK cells might be a more effective and safer approach to abolish this suppressive pathway. Although the initial preclinical results of NKG2AKO NK cells in xenograft models have shown no off-target toxicity, further patient studies with longer follow-up after infusion will be needed to fully assess the safety and efficacy of this approach.

This study shows that NKG2A deletion enhances the cytotoxic capacity of NK cells, but also leads to higher number of NK cells in the tumor microenvironment. Our analyses do not provide a full explanation for this phenomenon. Our in vitro experiments did not indicate that NKG2A deletion affects proliferation or survival of NK cells. In the xenograft model, we found no increased NK cell proliferation, but this analysis was limited to a single time point. In a complex tumor microenvironment, many factors will influence NK cell infiltration, proliferation, and survival.6,54 In this perspective, it is also important to acknowledge the limitations of using immunodeficient nude mice as hosts in our xenograft model. In a translational setting of adoptive NK cell transfer, anti-NKG2A antibodies may also boost the endogenous NK cells, while genetic deletion will only enhance the function of the transferred NK cells. Further studies, such as using long-term in vivo imaging to track NK cells, are necessary to differentiate between improved persistence, proliferation, and penetration of the tumor microenvironment.

Several studies have explored methods to decrease NKG2A expression on NK cells.43,55 Kamiya et al. used a retroviral approach to intracellular retain NKG2A and found it more efficient than using antibodies in vitro.56 Bexte et al. reported that Cas9-mediated NKG2AKO NK cells had better tumoricidal abilities than wild-type NK cells but did not compare them with antibody blockade.57 Figueiredo et al. reduced NKG2A expression in human NK cells and T cells by 95% via a lentiviral shRNA.58 In addition, transient NKG2A blockade by siRNA has been reported to enhance NK cytotoxicity against HLA-Ehi tumor cells.59,60 Similar data were published during the preparation of this article, confirming our basic finding of NKG2A knockdown.61 In our study, we address some of the limitations of previous research, compare Cas9-mediated deletion with blocking antibodies, and provide some insights in the molecular mechanisms behind the superior performance of NKG2AKO NK cells.

In summary, our study illustrates that Cas9-mediated NKG2A deletion from human NK cells is a potent enhancer of NK cell function. To our knowledge, this is the first analysis that combines the analysis of changes to the phenotype, transcriptome, signaling pathways, and function of primary NK cells upon NKG2A deletion. Using flow cytometry and transcriptome analysis, we show that NKG2AKO cells do not change their phenotype or licensing state at baseline. NKG2A deletion, but not antibody blockade, suppressed the activation of the negative regulators of NK cell function, SHP-1 and SHP-2. We confirmed that NKG2A deletion outperforms blockade using anti-NKG2A antibodies using xenograft mouse models. Likewise, NKG2AKO NK cells from various healthy donors showed enhanced cytotoxic capacity against primary human leukemia cells. Collectively, our study shows the promise of Cas9-mediated NKG2A deletion in human NK cells. As NK cells are increasingly explored as donor cell therapy for cancer treatment in humans, we demonstrated how genetic NKG2A blockade may further enhance anti-cancer effects in NK cells.

Materials and methods

Cell culture

K562 cells (CCL-243, ATCC, Manassas, VA) were cultured in IMDM (Gibco, Grand Island, NE) supplemented with 10% FCS (Greiner-Bio-one, Kremsmünster, Austria) and 1% penicillin-streptomycin (Gibco). Jurkat cells (ACC 282, DSMZ, Braunschweig, Germany), RPMI 8226 cells (ACC 402, DSMZ), and U266 cells (ACC 9, DSMZ) were cultured in RPMI 1640 medium (Gibco) with 10% FCS and 1% penicillin-streptomycin. T-47D cells (HTB-133, ATCC) were cultured in RPMI 1640 (30-2001, ATCC) supplemented with 10% FCS (Greiner-Bio-One), 1% penicillin-streptomycin and 0.2 U/mL insulin (Sigma-Aldrich Chemie, Zwijndrecht, the Netherlands). All cell culture experiments were performed in a humidified cell incubator set at 37°C with 5% CO2.

NK cell isolation and expansion

Primary human NK cells were isolated from anonymous healthy donor buffy coats (Sanquin, Maastricht, the Netherlands, and Nanfang Hospital, Guangzhou, China) using a MACS-based negative selection isolation kit (130-092-657, Miltenyi Biotec, Bergisch Gladbach, Germany) as described previously.62 The use of buffy coats, being a byproduct of a required Medical Ethical Review Committee (METC) procedure, does not need ethical approval in the Netherlands under the Dutch Code for Proper Secondary Use of Human Tissue. The buffy coat from Nanfang Hospital is approved under METC Ethical registration number: NFEC-2022-295. NK cells were cultured in RPMI 1640 medium (Gibco) supplemented with 10% fetal calf serum (Greiner Bio-One) and 100 U/mL penicillin-streptomycin (Gibco) supplemented with IL-2 (1,000 IU/mL; Proleukin, Clinigen, Yardley, PA). NK cells were expanded using K562/mIL-21/4-1BBL feeder cells (prepared in-house, manuscript in preparation).

CRISPR-Cas9 gRNA design and Cas9 RNP preparation

The gRNA was designed and analyzed by CRISPOR.63 The most promising three gRNA candidates (43fw: ACTGCAGAGATGGATAACCA AGG; 9rev: CTCTGCAGTGTGTGATGTCA GGG; 33fw: GACATCACACACTGCAGAGA TGG) targeting the first coding exon of the KLRC1 gene were selected based on the highest predicted MIT specificity score. gRNAs comprised Alt-R CRISPR-Cas9 tracRNA and Alt-R CRISPR-Cas9 crRNA (IDT [Integrated DNA Technologies], Leuven, Belgium). One microliter of 100 μM tracrRNA and 1 μL of 100 μM crRNA were added to 98 μL nuclease free duplex buffer (IDT) in a PCR tube. The tube was placed in a heat block for 5 min at 95°C, and allowed to cool to room temperature (15°C–25°C). Alt-R S.p. HiFi Cas9 Nuclease V3 (IDT; 62 μM stock) was prediluted into 1 μM in Opti-MEM medium (Gibco). Finally, the 40 μL tracrRNA-crRNA mix was mixed with 10 μL Cas9 protein solution (molar ratio 4:1) at room temperate for 20 min before use in the electroporation.

NK cells (15 × 106) were harvested and washed twice with PBS. The cell pellet was resuspended in 150 μL Opti-MEM medium. One microliter of 100 μM of Alt-R Cas9 Electroporation Enhancer (IDT) was added to the electroporation buffers and mixed with 50 μL gRNA-Cas9 protein. NK cells were electroporated in a 2 mm cuvette with the settings 250 V, 75 μF using the exponential program of the Gene Pulser Xcell system (Bio-Rad, Hercules, CA) or P3 Primary Cell 4D-NucleofectorTM solution electroporated using Lonza 4D-Nucleofector system with pulse EN-138 program. Wild-type NK cells were electroporated with Cas9 protein only. After electroporation, the NK cells were maintained for 7 days in RPMI 1640 medium supplemented with 500 IU/mL of IL-2 (Proleukin) before assessing the efficiency of CRISPR modification using flow cytometry.

Bulk RNA-seq

Six paired (wild-type and Cas9-mediated NKG2AKO) human NK cell samples of 106 cells were collected 7 days after electroporation (Figure S1) and lysed in 600 μL TRIzol Reagent (Invitrogen, Thermo Fisher). RNA isolation and quality control using an RNA 6000 Nano kit on an Agilent 2100 Bioanalyzer (Agilent Biotechnologies, Santa Clara, CA) were conducted at BGI (BGI Genomics Company, Hong Kong, P.R. China). RIN were ≥7.8 in all samples. Then, samples were reverse-transcribed and cDNA libraries were generated with oligo(dT) primers. Transcriptome libraries were pooled and sequenced using the DNBseq platform, obtaining thirty million 100 bp reads per sample. Samples were analyzed using the Galaxy Platform.64 Quality control was performed using FastQC and MultiQC, showing that all samples were suitable for downstream analyses. Then, trimming of the first 13 base pairs was performed using Trimmomatic, followed by mapping to the hu38 genome with HISAT2, resulting in an error rate of <0.4% in all samples, mapping >94% reads for every sample with >89% proper pairs. Count matrices were generated using FeatureCount and differentially expressed genes were analyzed using limma-voom (filtering out lowly expressed genes with CPM<10.0 in at least 2 samples, FDR of 0.05, and p value adjustment using Benjamini and Hochberg, normalized using TMM).

NKG2AKO cell sorting and qPCR

Six paired (wild-type and Cas9-mediated NKG2AKO) human expanded NK cell donor samples of 106 cells were collected 7 days after electroporation (Figure S1) and NKG2A-positive and -negative cell populations were further purified in a BD FACSAria Fusion Flow Cytometer (BD Biosciences). NKG2A-positive and -negative NK cells (1 × 106) from each donor were harvested and lysed in 600 μL TRIzol Reagent (Invitrogen, Thermo Fisher). qPCR primers are listed in Table S2. qPCR kits were bought from Roche and assays were run on the CFX96 Real-Time PCR Detection System (Bio-Rad).

Flow cytometry for NK cell immunophenotyping

NK cells were stained with fluorescently labeled antibodies (Table S3) at proper dilutions for 30 min at 4°C in the dark. NK cells were washed in 2 mL PBS (Gibco, Thermo Fisher) and centrifuged at 300 × g for 5 min. Cells were suspended in 200 μL PBS. Cells were acquired on a FACS Canto II flow cytometer (BD Biosciences).

CD107a assay

NK cell degranulation was analyzed as CD107a expression using flow cytometry, as described before.65 In brief, 7 days after electroporation, NK cells were harvested and 105 cells were incubated with 105 tumor cells in 200 μL RPMI 1640 medium with 0.5 μL anti-CD107a-Horizon VioBlue (H4A3, Miltenyi Biotech). In the NKG2A antibody blockade group, 1 μg/mL anti-NKG2A antibody (Z199, Beckman Coulter, Woerden, the Netherlands) was added. After 1 h of co-culture, 10 μg/mL monensin (BD Biosciences) was added. After another 3 h, the plate was placed on ice to stop the reaction and cells were stained with anti-CD56 and anti-NKG2A antibodies.

HLA-E induction on tumor cells

IFN-γ (1,000 U/mL; R&D systems, MN) was added to tumor cells the day before analysis. HLA-E levels were measured using an anti-HLA-E antibody (clone: 3D12HLA-E, eBioscience). IFN-γ was removed by washing two times with PBS before co-culture with NK cells for cytotoxicity assays.

Flow cytometric analysis of cytokine production

To measure cytokine production, NK cells were stimulated with PMA (20 ng/mL) and ionomycin (1 μg/mL) in the presence of 10 μg/mL BFA in complete culture medium for 4 h. Then cells were harvested, washed, and stained with fluorochrome-conjugated anti-CD3 and anti-CD56 surface monoclonal antibodies for 30 min at 4°C. Intracellular staining was performed using an Intracellular Fixation & Permeabilization Buffer Set (Thermo Fisher Scientific) according to the manufacturer’s protocol, followed by staining with fluorochrome-conjugated anti-IFN-γ, anti-perforin, anti-TNF-α and anti-granzyme B.

Cytotoxicity assay and ADCC assay

NK cell cytotoxicity against tumor cells was determined in a 4 h flow cytometry-based assay. Tumor cells were labeled using Cell TrackerCM-DiI Dye (Molecular Probes, Thermo Fisher, MA) and were incubated overnight. NK cells were co-cultured with labeled tumor cells at different effector-target ratios (0.25:1; 0.5:1, 1:1, and 2:1) in duplicates. After 4 h co-incubation, cell viability was determined using a Live/Dead Fixable V500-Aqua Dead cell stain kit (Thermo Fisher) and measured using a Canto II flow cytometer (BD Biosciences, NJ) and FlowJo software v.10 (Tree Star, Ashland, OR). Specific cytotoxicity was determined using the following equation: (% dead tumor cells − % spontaneous tumor cell death)/(100% − % spontaneous tumor cell death) × 100.

Western blot assay

NK cells were harvested from the co-culture with tumor cells by carefully obtaining only the non-adherent cell population. Cells were then lysed in RIPA lysis buffer with fresh protease inhibitor cocktail (Roche) on ice for 20 min and sonicated for 2 s on ice. Sample protein was measured by a standard bicinchoninic acid assay, size fractioned by SDS-polyacrylamide gel electrophoresis, and transferred to PVDF membrane. Nonspecific binding was blocked by incubating in TBST 5% skim milk plus 1% Triton X-100 solution for 1 h, followed by incubation with the primary antibodies listed in Table S3 overnight at 4°C. Species-specific HRP-conjugated secondary antibodies (1:10,000 were applied to membranes for 1 h at room temperature. lmmunoreactive products were visualized using the Bio-Rad Imaging Systems. Bands were quantified using ImageJ software from three independent plots. All loading samples were normalized by staining of β-actin or total protein.

In vivo xenograft models

Six-week-old BALB/c-nu mice were purchased from the Laboratory Animal Sciences of Southern Medical University (Guangzhou, P.R. China). All animal experiments were approved by the Institutional Animal Care and Use Committee of Southern Medical University in accordance with the NIH Guide for the Care and Use of Laboratory Animals (National Academies Press 2011) and the Animal Welfare Act (SMU-L2022080). Cyclophosphamide (200 mg/kg; Sigma-Aldrich, Germany) was injected into the intraperitoneal (i.p.) cavity of the mice 72 h before tumor cell injection. T-47D and U266 cells were injected subcutaneously (s.c.) at 2 × 105 cells per mouse. Mice were distributed over groups to achieve an even representation of tumor engraftment based on the tumor volume (>100 mm3) recorded before NK cell administration. NK cells were expanded with F012 feeder cells. Seven days after tumor cell injection, NKG2AKO and 1 × 107 control NK cells with or without anti-NKG2A mAb (clone Z199, 200 μg per mouse) were intravenously administered. All mice received i.p. injections of 20,000 IU IL-2 every other day. Mice were euthanized when the sum of tumor volume [(length × width2)/2] reached 1,500 mm3.

Flow cytometry analysis of tumor-infiltrating mouse lymphocytes

Tumors were removed from euthanized mice and dissected into small pieces and digested with collagenase (1 mg/mL), hyaluronidase (0.1 mg/mL), and DNase 20,000 units (20 mg/mL) in HBSS buffer (Sigma Aldrich) during incubation at 37°C for 45 min. Digested tumors were then filtered through 70 μm pore size filters (BD) and washed with RPMI 1640 medium. Red blood cells were lysed after 5 min of incubation on ice with ammonium chloride solution and washed with RPMI 1640 medium. Cells were stained with: anti-human CD45, CD3, and CD56 following the FACS protocol as described. Tumor-infiltrating mouse lymphocyte (TIL) NK cells were stimulated with PMA (20 ng/mL) and ionomycin (1 μg/mL) in the presence of BFA (10 μg/mL) in complete culture medium for 4 h. Finally, cells were fixed by incubation in BD Cytofix Fixation Buffer (BD Biosciences) at 4°C for 30 min.

Histology, immunohistochemistry, and immunofluorescence staining

Tumor tissues were harvested and fixed for 48–72 h in 4% paraformaldehyde (Servicbio, Guangzhou, P.R. China). Paraffin-embedded tumor sections (4 μm) were sliced and stained with H&E dyes or were deparaffinized following heat-mediated antigen retrieval for 30 min in IHC-Tek epitope retrieval solution (Servicbio). The H&E staining is for the investigation of the safety of adoptive human NK cells therapy on immunodeficient mice. After antigen restoration, tumor sections were permeabilized with 100% methanol. For TUNEL staining, sections were blocked for 30 min with Tris-NaCl blocking buffer (Servicbio) and then incubated with primary antibodies (TUNEL; Servicbio) diluted 1:500 in TNB blocking buffer overnight in a humidified chamber at 4°C. After incubation, tumor sections were washed and incubated with Alexa Fluor 488-conjugated goat anti-rabbit secondary antibody (Abcam) for 1 h at room temperature. Nuclei were counterstained with DAPI (Invitrogen, Thermo Fisher). For other antibodies, deparaffinized tumor sections (4 μm) were stained with mouse anti-human EpCAM (Abcam) and rabbit anti-human Ki-67, γ-H2AX, and CD45 (Abcam). For NKp46 and pan-CK staining, sections were blocked for 30 min with Tris-NaCl blocking buffer (Servicbio) and then incubated with primary antibodies (anti-human NKp46 from Servicbio, anti-human pan-CK from Cell Signaling Technology) diluted 1:500 in TNB blocking buffer overnight in a humidified chamber at 4°C. After incubation, tumor sections were washed and incubated with Alexa Fluor 532 (yellow)- and Alexa Fluor 594 (red)-conjugated secondary antibodies (Abcam) for 1 h at room temperature. Nuclei were counterstained with DAPI (Invitrogen, Thermo Fisher) and the sections were cover slipped using anti-fade mounting medium (Thermo Fisher). Images were obtained using Nikon ECLIPSE Ti2-U microscopy (Nikon, Japan). Multilayer IF or the IHC images were imported to inForm v.2.4.8 (Akoya Biosciences) for image quantitative analysis.66 The quantities of cell populations were expressed as the number of stained cells per square millimeter in each representative image from individual tumor lumps and further as the percentage of positively stained cells. For each marker, automated stitching of six scanned slides, followed by quality control under PBS group, cell segmentation using DAPI and cell identification and quantification using TIL NK cell markers.

Patients and samples

Fresh leukemia cells were acquired from patients diagnosed with ALL and AML at Nanfang Hospital, Guangzhou, P.R. China (METC Ethical registration number: NFEC-2022-295). Patient characteristics are summarized in Table S1. All subjects (or the legal parents, for the 17-year-old patient) signed an informed consent in accordance with the Declaration of Helsinki.

Statistical analysis

All statistical tests used in this study, except for those for RNA-seq analysis, were completed with GraphPad Prism 9 (Graphpad Software, San Diego, CA). The specific statistical tests used for each comparison are specifically annotated in the respective figure legends.

Data and code availability

For the RNA-seq experiments, the original data and count matrices are available online in the GEO database under accession number GSE178566. Other reagents and analyses are available through the corresponding authors upon reasonable request.

Supplemental information

Document S1. Figures S1–S15 and Tables S1 and S2

Table S3. Reagents list

Document S2. Article plus supplemental information

Acknowledgments

We would like to express our gratitude to Dr. Lotte Wieten (Department of Transplantation Immunology, MUMC+) for valuable discussions during the conceptualization and preparation of the manuscript, and to Dr. Arjan Groot (MAASTRO laboratory, Department of Radiology, Maastricht University) for providing advice on CRISPR-Cas9 technology. We also thank Fausto Palusci for performing Sanger sequencing and Eric-Jan Ververs for technical assistance in the initial NK cell expansion experiments. We thank Prof. Zhili Rong, Dr. Lixin Huang, and Dr. Xin Zhang provide assistance on Lonza Cas9 RNP electroporation. We thank the medical doctors in our department in the Nanfang Hospital and Maastricht University Medical Center+ who were involved in this study.

This study was supported by various organizations, including the Subproject of National Key R&D Project of Ministry of Science and Technology (2021YFA1300604 ), the 10.13039/501100014219 National Science Fund for Distinguished Young Scholars (82025024 ), the Key Project of the National Natural Science Foundation of China (82230080 ), the 10.13039/501100001809 National Natural Science Foundation of China (81871735 , 82172371 , and 82202978 ), the Natural Science Foundation from Guangdong Science and Technology Department of China (2019A1515011077 , 2022A1515011276 ), the Science and Technology Program of Guangzhou (202102020595 ), the Guangzhou Basic and Applied Basic Research Foundation (2023A04J2359 ), and the Major State Basic Research Development Program of Natural Science Foundation of Shandong Province in China (ZR2020ZD11 ).

Y.G. thanks the 10.13039/501100004543 China Scholarship Council (CSC) (no. 201707720056 ) for fellowship support. R.G.J.K.W. was supported by various fellowships, including a Kootstra Talent Fellowship (Maastricht University), a Marie Skłodowska-Curie Individual fellowship (799810-TOPNIN ; European Union), a Cancer Research Institute/Irvington Postdoctoral Fellowship, and a Postdoctoral Junior Leader fellowship from the “10.13039/100010434 'la Caixa' ” Foundation (ID: 100010434 ; LCF/BQ/PR20/11770004 ). In addition, this research study is supported by the Cancer Research Foundation Limburg (KOFL: 2012-03 , to G.M.J.B). The graphic figure was created with Biorender.com.

Author contributions

Y.G., X.L.Z., N.S.W., L.J., Z.Z.H., B.D.W., B.L.M.G.G., and T.I.O. performed the experiments. Y.G., B.L., X.L.Z., and R.G.J.K.W. analyzed the data. M.G. performed histological analysis of tumor samples. Y.G., W.T.V.G., X.L.Z., B.L., G.M.J.B., L.Z., and R.G.J.K.W. wrote the paper. Y.G., W.T.V.G., G.M.J.B., L.Z., and R.G.J.K.W. conceptualized the study.

Declaration of interests

G.M.J.B. and W.T.V.G. are the founders of CiMaas BV, an NK cell therapy company.

Supplemental information can be found online at https://doi.org/10.1016/j.ymthe.2024.06.034.
==== Refs
References

1 Demaria O. Gauthier L. Debroas G. Vivier E. Natural killer cell engagers in cancer immunotherapy: Next generation of immuno-oncology treatments Eur. J. Immunol. 51 2021 1934 1942 10.1002/eji.202048953 34145579
2 Laskowski T.J. Biederstädt A. Rezvani K. Natural killer cells in antitumour adoptive cell immunotherapy Nat. Rev. Cancer 22 2022 557 575 10.1038/s41568-022-00491-0 35879429
3 Lee D.A. Cellular therapy: Adoptive immunotherapy with expanded natural killer cells Immunol. Rev. 290 2019 85 99 10.1111/imr.12793 31355489
4 Vivier E. Rebuffet L. Narni-Mancinelli E. Cornen S. Igarashi R.Y. Fantin V.R. Natural killer cell therapies Nature 626 2024 727 736 10.1038/s41586-023-06945-1 38383621
5 Ruggeri L. Capanni M. Urbani E. Perruccio K. Shlomchik W.D. Tosti A. Posati S. Rogaia D. Frassoni F. Aversa F. Effectiveness of donor natural killer cell alloreactivity in mismatched hematopoietic transplants Science 295 2002 2097 2100 10.1126/science.1068440 11896281
6 Wolf N.K. Kissiov D.U. Raulet D.H. Roles of natural killer cells in immunity to cancer, and applications to immunotherapy Nat. Rev. Immunol. 23 2023 90 105 10.1038/s41577-022-00732-1 35637393
7 Gong Y. Klein Wolterink R.G.J. Wang J. Bos G.M.J. Germeraad W.T.V. Chimeric antigen receptor natural killer (CAR-NK) cell design and engineering for cancer therapy J. Hematol. Oncol. 14 2021 73 10.1186/s13045-021-01083-5 33933160
8 Liu E. Marin D. Banerjee P. Macapinlac H.A. Thompson P. Basar R. Nassif Kerbauy L. Overman B. Thall P. Kaplan M. Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors N. Engl. J. Med. 382 2020 545 553 10.1056/NEJMoa1910607 32023374
9 Zhou Y. Cheng L. Liu L. Li X. NK cells are never alone: crosstalk and communication in tumour microenvironments Mol. Cancer 22 2023 34 10.1186/s12943-023-01737-7 36797782
10 van der Schans J.J. van de Donk N. Mutis T. Dual Targeting to Overcome Current Challenges in Multiple Myeloma CAR T-Cell Treatment Front. Oncol. 10 2020 1362 10.3389/fonc.2020.01362 32850436
11 Myers J.A. Miller J.S. Exploring the NK cell platform for cancer immunotherapy Nat. Rev. Clin. Oncol. 18 2021 85 100 10.1038/s41571-020-0426-7 32934330
12 Terrén I. Orrantia A. Vitallé J. Zenarruzabeitia O. Borrego F. NK Cell Metabolism and Tumor Microenvironment Front. Immunol. 10 2019 2278 10.3389/fimmu.2019.02278 31616440
13 Xiao K. Lai Y. Yuan W. Li S. Liu X. Xiao Z. Xiao H. mRNA-based chimeric antigen receptor T cell therapy: Basic principles, recent advances and future directions Interdiscip. Med. 2 2023 e20230036 10.1002/INMD.20230036
14 Maskalenko N.A. Zhigarev D. Campbell K.S. Harnessing natural killer cells for cancer immunotherapy: dispatching the first responders Nat. Rev. Drug Discov. 21 2022 559 577 10.1038/s41573-022-00413-7 35314852
15 Borst L. van der Burg S.H. van Hall T. The NKG2A-HLA-E Axis as a Novel Checkpoint in the Tumor Microenvironment Clin. Cancer Res. 26 2020 5549 5556 10.1158/1078-0432.Ccr-19-2095 32409305
16 Khan M. Arooj S. Wang H. NK Cell-Based Immune Checkpoint Inhibition Front. Immunol. 11 2020 167 10.3389/fimmu.2020.00167 32117298
17 Salomé B. Sfakianos J.P. Ranti D. Daza J. Bieber C. Charap A. Hammer C. Banchereau R. Farkas A.M. Ruan D.F. NKG2A and HLA-E define an alternative immune checkpoint axis in bladder cancer Cancer Cell 40 2022 1027 1043.e9 10.1016/j.ccell.2022.08.005 36099881
18 Sarkar S. van Gelder M. Noort W. Xu Y. Rouschop K.M. Groen R. Schouten H.C. Tilanus M.G. Germeraad W.T. Martens A.C. Optimal selection of natural killer cells to kill myeloma: the role of HLA-E and NKG2A Cancer Immunol. Immunother. 64 2015 951 963 10.1007/s00262-015-1694-4 25920521
19 André P. Denis C. Soulas C. Bourbon-Caillet C. Lopez J. Arnoux T. Bléry M. Bonnafous C. Gauthier L. Morel A. Anti-NKG2A mAb Is a Checkpoint Inhibitor that Promotes Anti-tumor Immunity by Unleashing Both T and NK Cells Cell 175 2018 1731 1743.e13 10.1016/j.cell.2018.10.014 30503213
20 Zaghi E. Calvi M. Marcenaro E. Mavilio D. Di Vito C. Targeting NKG2A to elucidate natural killer cell ontogenesis and to develop novel immune-therapeutic strategies in cancer therapy J. Leukoc. Biol. 105 2019 1243 1251 10.1002/jlb.Mr0718-300r 30645023
21 Li K. Wu Y. Li Y. Yu Q. Tian Z. Wei H. Qu K. Landscape and Dynamics of the Transcriptional Regulatory Network During Natural Killer Cell Differentiation Dev. Reprod. Biol. 18 2020 501 515 10.1016/j.gpb.2020.12.003
22 Costanzo M.C. Kim D. Creegan M. Lal K.G. Ake J.A. Currier J.R. Streeck H. Robb M.L. Michael N.L. Bolton D.L. Transcriptomic signatures of NK cells suggest impaired responsiveness in HIV-1 infection and increased activity post-vaccination Nat. Commun. 9 2018 1212 10.1038/s41467-018-03618-w 29572470
23 Fauriat C. Ivarsson M.A. Ljunggren H.G. Malmberg K.J. Michaëlsson J. Education of human natural killer cells by activating killer cell immunoglobulin-like receptors Blood 115 2010 1166 1174 10.1182/blood-2009-09-245746 19903900
24 Malmberg K.J. Levitsky V. Norell H. de Matos C.T. Carlsten M. Schedvins K. Rabbani H. Moretta A. Söderström K. Levitskaya J. Kiessling R. IFN-gamma protects short-term ovarian carcinoma cell lines from CTL lysis via a CD94/NKG2A-dependent mechanism J. Clin. Invest. 110 2002 1515 1523 10.1172/jci15564 12438449
25 Gustafson K.S. Ginder G.D. Interferon-gamma induction of the human leukocyte antigen-E gene is mediated through binding of a complex containing STAT1alpha to a distinct interferon-gamma-responsive element J. Biol. Chem. 271 1996 20035 20046 10.1074/jbc.271.33.20035 8702722
26 Lo Monaco E. Tremante E. Cerboni C. Melucci E. Sibilio L. Zingoni A. Nicotra M.R. Natali P.G. Giacomini P. Human leukocyte antigen E contributes to protect tumor cells from lysis by natural killer cells Neoplasia 13 2011 822 830 10.1593/neo.101684 21969815
27 Ochoa M.C. Minute L. Rodriguez I. Garasa S. Perez-Ruiz E. Inogés S. Melero I. Berraondo P. Antibody-dependent cell cytotoxicity: immunotherapy strategies enhancing effector NK cells Immunol. Cell Biol. 95 2017 347 355 10.1038/icb.2017.6 28138156
28 Yip H.Y.K. Papa A. Signaling Pathways in Cancer: Therapeutic Targets, Combinatorial Treatments, and New Developments Cells 10 2021 659 10.3390/cells10030659 33809714
29 de Weers M. Tai Y.T. van der Veer M.S. Bakker J.M. Vink T. Jacobs D.C. Oomen L.A. Peipp M. Valerius T. Slootstra J.W. Daratumumab, a novel therapeutic human CD38 monoclonal antibody, induces killing of multiple myeloma and other hematological tumors J. Immunol. 186 2011 1840 1848 10.4049/jimmunol.1003032 21187443
30 Meza Guzman L.G. Keating N. Nicholson S.E. Natural Killer Cells: Tumor Surveillance and Signaling Cancers (Basel) 12 2020 952 10.3390/cancers12040952 32290478
31 Lowin-Kropf B. Kunz B. Beermann F. Held W. Impaired natural killing of MHC class I-deficient targets by NK cells expressing a catalytically inactive form of SHP-1 J. Immunol. 165 2000 1314 1321 10.4049/jimmunol.165.3.1314 10903732
32 Viant C. Fenis A. Chicanne G. Payrastre B. Ugolini S. Vivier E. SHP-1-mediated inhibitory signals promote responsiveness and anti-tumour functions of natural killer cells Nat. Commun. 5 2014 5108 10.1038/ncomms6108 25355530
33 Stebbins C.C. Watzl C. Billadeau D.D. Leibson P.J. Burshtyn D.N. Long E.O. Vav1 dephosphorylation by the tyrosine phosphatase SHP-1 as a mechanism for inhibition of cellular cytotoxicity Mol. Cell. Biol. 23 2003 6291 6299 10.1128/mcb.23.17.6291-6299.2003 12917349
34 Matalon O. Fried S. Ben-Shmuel A. Pauker M.H. Joseph N. Keizer D. Piterburg M. Barda-Saad M. Dephosphorylation of the adaptor LAT and phospholipase C-γ by SHP-1 inhibits natural killer cell cytotoxicity Sci. Signal. 9 2016 ra54 10.1126/scisignal.aad6182
35 Lehmann U. Schmitz J. Weissenbach M. Sobota R.M. Hortner M. Friederichs K. Behrmann I. Tsiaris W. Sasaki A. Schneider-Mergener J. SHP2 and SOCS3 contribute to Tyr-759-dependent attenuation of interleukin-6 signaling through gp130 J. Biol. Chem. 278 2003 661 671 10.1074/jbc.M210552200 12403768
36 Wei S. Gamero A.M. Liu J.H. Daulton A.A. Valkov N.I. Trapani J.A. Larner A.C. Weber M.J. Djeu J.Y. Control of lytic function by mitogen-activated protein kinase/extracellular regulatory kinase 2 (ERK2) in a human natural killer cell line: identification of perforin and granzyme B mobilization by functional ERK2 J. Exp. Med. 187 1998 1753 1765 10.1084/jem.187.11.1753 9607917
37 Colucci F. Rosmaraki E. Bregenholt S. Samson S.I. Di Bartolo V. Turner M. Vanes L. Tybulewicz V. Di Santo J.P. Functional dichotomy in natural killer cell signaling: Vav1-dependent and -independent mechanisms J. Exp. Med. 193 2001 1413 1424 10.1084/jem.193.12.1413 11413196
38 Turner J.G. Cui Y. Bauer A.A. Dawson J.L. Gomez J.A. Kim J. Cubitt C.L. Nishihori T. Dalton W.S. Sullivan D.M. Melphalan and Exportin 1 Inhibitors Exert Synergistic Antitumor Effects in Preclinical Models of Human Multiple Myeloma Cancer Res. 80 2020 5344 5354 10.1158/0008-5472.Can-19-0677 33023948
39 Ayan D. Maltais R. Roy J. Poirier D. A new nonestrogenic steroidal inhibitor of 17β-hydroxysteroid dehydrogenase type I blocks the estrogen-dependent breast cancer tumor growth induced by estrone Mol. Cancer Ther. 11 2012 2096 2104 10.1158/1535-7163.Mct-12-0299 22914440
40 Wang K. Wang L. Wang Y. Xiao L. Wei J. Hu Y. Wang D. Huang H. Reprogramming natural killer cells for cancer therapy Mol. Ther. 32 2024 10.1016/j.ymthe.2024.01.027
41 Siegler E.L. Kim Y.J. Chen X. Siriwon N. Mac J. Rohrs J.A. Bryson P.D. Wang P. Combination Cancer Therapy Using Chimeric Antigen Receptor-Engineered Natural Killer Cells as Drug Carriers Mol. Ther. 25 2017 2607 2619 10.1016/j.ymthe.2017.08.010 28919377
42 Tang W.T. Liu J.B. Ding B.Q. Nucleic acid nanostructure for delivery of CRISPR/Cas9-based gene editing system Interdiscip. Med. 1 2023 e20220014 10.1002/INMD.20220014
43 Fisher J.G. Doyle A.D.P. Graham L.V. Khakoo S.I. Blunt M.D. Disruption of the NKG2A:HLA-E Immune Checkpoint Axis to Enhance NK Cell Activation against Cancer Vaccines (Basel) 10 2022 1993 10.3390/vaccines10121993 36560403
44 Buckle I. Guillerey C. Inhibitory Receptors and Immune Checkpoints Regulating Natural Killer Cell Responses to Cancer Cancers (Basel) 13 2021 4263 10.3390/cancers13174263 34503073
45 Zhang X. Feng J. Chen S. Yang H. Dong Z. Synergized regulation of NK cell education by NKG2A and specific Ly49 family members Nat. Commun. 10 2019 5010 10.1038/s41467-019-13032-5 31676749
46 Liu X. Song J. Zhang H. Liu X. Zuo F. Zhao Y. Zhao Y. Yin X. Guo X. Wu X. Immune checkpoint HLA-E:CD94-NKG2A mediates evasion of circulating tumor cells from NK cell surveillance Cancer Cell 41 2023 272 287.e9 10.1016/j.ccell.2023.01.001 36706761
47 Blunt M.D. Khakoo S.I. Harnessing natural killer cell effector function against cancer Immunother. Adv. 4 2024 ltad031 10.1093/immadv/ltad031
48 Ljutic B. Carlyle J.R. Filipp D. Nakagawa R. Julius M. Zúñiga-Pflücker J.C. Functional requirements for signaling through the stimulatory and inhibitory mouse NKR-P1 (CD161) NK cell receptors J. Immunol. 174 2005 4789 4796 10.4049/jimmunol.174.8.4789 15814704
49 Battin C. Kaufmann G. Leitner J. Tobias J. Wiedermann U. Rölle A. Meyer M. Momburg F. Steinberger P. NKG2A-checkpoint inhibition and its blockade critically depends on peptides presented by its ligand HLA-E Immunology 166 2022 507 521 10.1111/imm.13515 35596615
50 van Montfoort N. Borst L. Korrer M.J. Sluijter M. Marijt K.A. Santegoets S.J. van Ham V.J. Ehsan I. Charoentong P. André P. NKG2A Blockade Potentiates CD8 T Cell Immunity Induced by Cancer Vaccines Cell 175 2018 1744 1755.e15 10.1016/j.cell.2018.10.028 30503208
51 Patel S.P. Alonso-Gordoa T. Banerjee S. Wang D. Naidoo J. Standifer N.E. Palmer D.C. Cheng L.Y. Kourtesis P. Ascierto M.L. Phase 1/2 study of monalizumab plus durvalumab in patients with advanced solid tumors J. Immunother. Cancer 12 2024 e007340 10.1136/jitc-2023-007340
52 Fayette J. Licitra L.F.L. Harrington K.J. Haddad R. Siu L.L. Liu Y.C. Tahara M. Machiels J.P. Rischin D. Seiwert T. 854O INTERLINK-1: Phase III study of cetuximab (CTX) ± monalizumab (M) in participants (pts) with recurrent/metastatic head and neck squamous cell carcinoma (R/M HNSCC) with disease progression on/after platinum chemotherapy (CT) and previously treated with an immune checkpoint inhibitor (ICI) Ann. Oncol. 34 2023 S554 S555 10.1016/j.annonc.2023.09.2000
53 De Sousa Linhares A. Battin C. Jutz S. Leitner J. Hafner C. Tobias J. Wiedermann U. Kundi M. Zlabinger G.J. Grabmeier-Pfistershammer K. Steinberger P. Therapeutic PD-L1 antibodies are more effective than PD-1 antibodies in blocking PD-1/PD-L1 signaling Sci. Rep. 9 2019 11472 10.1038/s41598-019-47910-1
54 Schönfeld K. Sahm C. Zhang C. Naundorf S. Brendel C. Odendahl M. Nowakowska P. Bönig H. Köhl U. Kloess S. Selective inhibition of tumor growth by clonal NK cells expressing an ErbB2/HER2-specific chimeric antigen receptor Mol. Ther. 23 2015 330 338 10.1038/mt.2014.219 25373520
55 Rezvani K. Rouce R. Liu E. Shpall E. Engineering Natural Killer Cells for Cancer Immunotherapy Mol. Ther. 25 2017 1769 1781 10.1016/j.ymthe.2017.06.012 28668320
56 Kamiya T. Seow S.V. Wong D. Robinson M. Campana D. Blocking expression of inhibitory receptor NKG2A overcomes tumor resistance to NK cells J. Clin. Invest. 129 2019 2094 2106 10.1172/jci123955 30860984
57 Bexte T. Alzubi J. Reindl L.M. Wendel P. Schubert R. Salzmann-Manrique E. von Metzler I. Cathomen T. Ullrich E. CRISPR-Cas9 based gene editing of the immune checkpoint NKG2A enhances NK cell mediated cytotoxicity against multiple myeloma Oncoimmunology 11 2022 2081415 10.1080/2162402x.2022.2081415
58 Figueiredo C. Seltsam A. Blasczyk R. Permanent silencing of NKG2A expression for cell-based therapeutics J. Mol. Med. 87 2009 199 210 10.1007/s00109-008-0417-0 19002424
59 Palacios D. Momayyezi P. Huhn O. Ask E.H. Dunst J. Malmberg K.J. Hammer Q. An optimized platform for efficient siRNA delivery into human NK cells Eur. J. Immunol. 52 2022 1190 1193 10.1002/eji.202149710 35416292
60 Furutani E. Su S. Smith A. Berg M. Childs R. siRNA Inactivation of the Inhibitory Receptor NKG2A Augments the Anti-Tumor Effects of Adoptively Transferred NK Cells In Tumor-Bearing Hosts Blood 116 2010 1015 10.1182/blood.V116.21.1015.1015
61 Mac Donald A. Guipouy D. Lemieux W. Harvey M. Bordeleau L.J. Guay D. Roméro H. Li Y. Dion R. Béland K. Haddad E. KLRC1 knockout overcomes HLA-E-mediated inhibition and improves NK cell antitumor activity against solid tumors Front. Immunol. 14 2023 1231916 10.3389/fimmu.2023.1231916
62 Gong Y. Klein Wolterink R.G.J. Gulaia V. Cloosen S. Ehlers F.A.I. Wieten L. Graus Y.F. Bos G.M.J. Germeraad W.T.V. Defucosylation of Tumor-Specific Humanized Anti-MUC1 Monoclonal Antibody Enhances NK Cell-Mediated Anti-Tumor Cell Cytotoxicity Cancers (Basel) 13 2021 2579 10.3390/cancers13112579 34070311
63 Concordet J.P. Haeussler M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens Nucleic Acids Res. 46 2018 10.1093/nar/gky354 W242-w245
64 Afgan E. Baker D. Batut B. van den Beek M. Bouvier D. Cech M. Chilton J. Clements D. Coraor N. Grüning B.A. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2018 update Nucleic Acids Res. 46 2018 10.1093/nar/gky379 W537-w544
65 Gong Y. Klein Wolterink R.G.J. Janssen I. Groot A.J. Bos G.M.J. Germeraad W.T.V. Rosuvastatin Enhances VSV-G Lentiviral Transduction of NK Cells via Upregulation of the Low-Density Lipoprotein Receptor Mol. Ther. Methods Clin. Dev. 17 2020 634 646 10.1016/j.omtm.2020.03.017 32300610
66 Li J. Wu C. Hu H. Qin G. Wu X. Bai F. Zhang J. Cai Y. Huang Y. Wang C. Remodeling of the immune and stromal cell compartment by PD-1 blockade in mismatch repair-deficient colorectal cancer Cancer Cell 41 2023 1152 1169.e7 10.1016/j.ccell.2023.04.011 37172580
