
==== Front
Mol Ther
Mol Ther
Molecular Therapy
1525-0016
1525-0024
American Society of Gene & Cell Therapy

S1525-0016(24)00399-X
10.1016/j.ymthe.2024.06.017
Original Article
Building a novel TRUCK by harnessing the endogenous IFN-gamma promoter for cytokine expression
Ma Liya 12
Zhang Kaiwen 12
Xu Jian 12
Wang Jian 1
Jiang Ting 1
Du Xiaolong 1
Zhang Jiaxin 1
Huang Jing 1
Ren Fengyi 1
Liu Dong 1
Xue Weiwei 1
Kan Dongxu 1
Yao Mengjiao 1
Liang Yutian 1
Jason-Sun Hongxing hongxingsun@xkdbio.com
1∗
1 Shenzhen Celconta Life Science Co. Ltd., Shenzhen, Guangdong, China
∗ Corresponding author: Hongxing Jason-Sun, Shenzhen Celconta Life Science Co. Ltd., Shenzhen, Guangdong, China. hongxingsun@xkdbio.com
2 These authors contributed equally

15 6 2024
07 8 2024
15 6 2024
32 8 27282740
25 12 2023
14 6 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Despite the remarkable success of chimeric antigen receptor (CAR) T therapy in hematological malignancies, its efficacy in solid tumors remains limited. Cytokine-engineered CAR T cells offer a promising avenue, yet their clinical translation is hindered by the risks associated with constitutive cytokine expression. In this proof-of-concept study, we leverage the endogenous interferon (IFN)-γ promoter for transgenic interleukin (IL)-15 expression. We demonstrate that IFN-γ expression is tightly regulated by T cell receptor signaling. By introducing an internal ribosome entry site IL15 into the 3′ UTR of the IFN-γ gene via homology directed repair-mediated knock-in, we confirm that IL-15 expression can co-express with IFN-γ in an antigen stimulation-dependent manner. Importantly, the insertion of transgenes does not compromise endogenous IFN-γ expression. In vitro and in vivo data demonstrate that IL-15 driven by the IFN-γ promoter dramatically improves CAR T cells' antitumor activity, suggesting the effectiveness of IL-15 expression. Last, as a part of our efforts toward clinical translation, we have developed an innovative two-gene knock-in approach. This approach enables the simultaneous integration of CAR and IL-15 genes into TRAC and IFN-γ gene loci using a single AAV vector. CAR T cells engineered to express IL-15 using this approach demonstrate enhanced antitumor efficacy. Overall, our study underscores the feasibility of utilizing endogenous promoters for transgenic cytokines expression in CAR T cells.

Graphical abstract

Ma and colleagues investigated the overexpression of IL-15 in CAR T cells controlled by the endogenous IFN-γ promoter. Through an innovative dual transgene knock-in strategy, they demonstrated that IL-15 expression was antigen dependent and effectively enhanced CAR T cell antitumor activity.

Keywords

chimeric antigen receptor
CAR
interleukin-15
IL-15
endogenous promoter
interferon-γ
IFN-γ
antitumor activity
==== Body
pmcIntroduction

While chimeric antigen receptor (CAR) T cell therapy has demonstrated remarkable efficacy in hematological malignancies, its effectiveness in treating solid tumors remains unsatisfactory. The challenges include a lack of tumor-specific antigens and tumor heterogeneity, as well as tumor microenvironment. To improve therapeutic efficacy, CAR T cells have been genetically modified to express various cytokines, such as interleukin (IL)-7, IL-12, IL-18, IL-21, and IL-23.1,2,3,4,5 These cytokine-engineered CAR T cells are also referred to as T cells redirected toward universal cytokine-initiated killing (TRUCK).6 Nevertheless, considering that CAR T cells could potentially persist for years after infusion,7 the constitutive expression of these pro-inflammatory cytokines may lead to chronic inflammation and pose additional risks.8,9 As a result, a second-generation TRUCK was developed, in which the transgenic cytokines are driven by T cell receptor (TCR) responsive promoters, which potentially improved the safety of the TRUCK.10 The most extensively studied inducible promoter is the synthetic nuclear factor of activated T cells (NFAT) promoter.5,11 This promoter consists of two key elements: NFAT binding site repeats and the IL-2 minimal promoter. Following antigen stimulation, TCR signaling triggers NFAT phosphorylation, allowing its entry into the nucleus and promoting the transgenic gene expression. While synthetic promoters have demonstrated fidelity in vitro, their in vivo performance appears not as safe as researcher expected.9,12 Consequently, there is a growing demand for a more precise and reliable TCR signaling-inducible expression system.

Interferon-γ (IFN-γ) is a pleiotropic effector cytokine known for its broad ability to modulate the immune response and primarily produced by T cells and natural killer cells. T cell response is characterized by the stimulation of naive cells to undergo differentiation into effector cells. A hallmark of effector T cells is their ability to produce IFN-γ. Due to the central role of IFN-γ in immunity, its expression must be stringently regulated.13 IFN-γ expression in T cells can be divided into two phases: the differentiative stage and the differentiated stage. The IFN-γ gene is suppressed by DNA methylation in naive T cells. Upon antigen stimulation, the differentiation process will be initiated, concurrent with the erasure of DNA methylation.14,15 Once T cells differentiate into effector cells, the IFN-γ promoter becomes accessible for binding by transcription activators and repressors. Following antigen restimulation, transcription activators such as NFAT and activator protein-1 (AP-1) will bind to IFN-γ promoter regions and initiate IFN-γ expression.16 In addition, enhancer elements within the IFN-γ locus also play crucial roles in regulating IFN-γ expression. These elements, which include both proximal and distal enhancers, contribute to the tight control of IFN-γ transcription and are involved in orchestrating the dynamic regulation of IFN-γ expression in response to immune stimuli.17 Hence, antigen stimulation is indeed necessary for IFN-γ expression, as multiple repression mechanisms enable transcription to remain closed in its absence.

To harness an endogenous promoter for transgenic cytokine expression, the promoter should meet the following criteria. (1) It should be strictly antigen-stimulation responsive. (2) It should be preferentially expressed in effector T cells. (3) The transcription should demonstrate both sensitivity and robustness. Given these considerations, we decided to employ IFN-γ promoter for transgenic cytokines expression. To test our hypothesis, GFP and IL-15 were inserted into the 3′ UTR through homology directed repair (HDR)-mediated knock-in. We demonstrated that the editing did not affect IFN-γ production, and the transgenes were co-expressed with IFN-γ in an antigen stimulation-dependent manner. In vitro and in vivo data further confirmed that IL-15 driven by IFN-γ promoter improved CAR T cells antitumor activity significantly, suggesting the robustness of IFN-γ promoter. Last, to align with the current CAR T cell manufacturing process, we developed a novel double knock-in strategy, enabling the simultaneous knock-in of CAR and IL-15 genes.

Results

IFN-γ promoter is a sensitive TCR-responsive promoter

It is well known that IFN-γ is a gene responsive to TCR signaling and is primarily produced by effector T cells. To characterize its expression pattern, the kinetics of gene activation and deactivation were determined. For activation, T cells were stimulated with CD3/28 Dynabeads for durations of 0, 1, 2, 3, and 4 h, and the intracellular accumulation of IFN-γ was measured (Figure 1A). As data demonstrated the intracellular IFN-γ level increased over time, with protein accumulation commencing as early as 1 h (Figure 1B), indicating a rapid response to TCR signaling. To study the deactivation kinetics, cells were pre-treated overnight with CD3/CD28 Dynabeads. Then, the beads were removed, and protein transport inhibitors were added at intervals of 0, 1, 2, 3, and 4 h of incubation, and intracellular IFN-γ production was measured after an additional 4-h incubation (Figure 1C). We observed that the downregulation of IFN-γ protein began within 2 h upon the removal of stimuli (Figure 1D). Considering the degradation time of mRNA and protein, the closure of promoter should have initiated before the decrease in protein was detected. Given the crucial role of IFN-γ in the immune response, the engineering should avoid any interference with its expression. To achieve this, we chose to target the 3′ UTR rather than the protein coding regions. Four guide RNAs (gRNAs) were designed to generate double-strand DNA breaks, and their editing efficiencies were determined, subsequently. Three gRNAs achieved 70%–95% insertion/deletion efficiencies, while single gRNA2 (sgRNA2) exhibited about 50% editing efficiency (Figure 1E). Most important, none of the edits exhibited interference with IFN-γ expression (Figure 1F). Based on editing efficiency, sgRNA1/3/4 were selected for further studies.Figure 1 Determination of IFN-γ expression kinetics and evaluation of 3′ UTR targeting gRNAs

(A) Schematic of the experiment designed to investigate the kinetics of IFN-γ expression upon antigen stimulation. (B) Representative result of IFN-γ intracellular staining (left) and graph based on three independent experiments (right). (C) Schematic of the experiment designed to investigate the shutting down kinetics of IFN-γ expression upon antigen removal. (D) Representative result of IFN-γ intracellular staining (left) and graph based on three independent experiments (right). (E) Four gRNAs were designed targeting IFN-γ 3′ UTR (up) and insertion/deletion (indel) efficiency were determined with online sequence trace decomposition tool (TIDE). (F) Investigate the impact of 3′ UTR indel on IFN-γ expression. T cells were edited with four gRNAs separately, and 48 h later, the IFN-γ production capacity was measured with intracellular staining (N = 3). FC, flow cytometry; MFI, mean fluorescence intensity; NS, not significant.

Hijack the IFN-γ promoter for transgene expression by integrating the target gene into its 3′ UTR

HDR-mediated knock-in can precisely integrate large DNA fragment into the genome of primary T cells. Based on identified gRNAs, we designed three DNA cassettes as HDR templates. Since translation is terminated before 3′ UTR, we introduced an internal ribosome entry site (IRES) sequence upstream of the GFP to reinitiate translation (Figure 2A). Using PCR amplicons as donor templates, we assessed the knock-in efficiencies at three different loci. The knock-in efficiency varied from 2% to 10%, and sgRNA4 demonstrated the highest knock-in efficiency (Figure 2B). Therefore, sgRNA4 was chosen for further investigation. To improve knock-in efficiency, the sgRNA4 donor template was delivered using adeno-associated virus (AAV). In line with previous studies, AAV significantly improved the knock-in efficiency, reaching approximately 30%. Considering that only a portion of ex vivo cultured T cells can produce IFN-γ, the actual knock-in efficiency could exceed 50%. Consistent with IFN-γ expression, GFP expression was readily detectable upon antigen stimulation (Figure 2C). Since the length of the insertion fragment could impact the 3′ UTR function of IFN-γ, IFN-γ expression was determined. As expected, the GFP-positive cells also produced a high level of IFN-γ, suggesting that the insertion of GFP did not affect IFN-γ expression (Figure 2D). Using ELISA, we further confirmed that the levels of IFN-γ in the supernatant were comparable between wild-type and GFP knock-in T cells (Figure 2E). To better understand transgene expression, we examined the kinetics of transgene expression upon antigen stimulation. Remarkably, GFP expression almost reached a plateau after 1 h of stimulation, consistent with the kinetics of IFN-γ expression we observed (Figure 2F). Therefore, our data demonstrate that transgenic gene expression, driven by IRES, is aligned with IFN-γ expression.Figure 2 Hijacking of IFN-γ promoter for GFP expression through the integration of GFP into IFN-γ 3′ UTR

(A) Schematic illustration of the GFP knock-in strategy targeting the IFN-γ 3′ UTR via HDR. (B) Knock-in experiment was conducted using PCR amplicon as the donor template. 3 days later, cells were restimulated with CD3/28 beads, and GFP expression was determined after 24 h stimulation. (C) The HDR template for sgRNA4 was delivered by AAV6, and GFP expression was determined before and after stimulation. (D) Co-expression of GFP and IFN-γ in GFP engineered cells were determined by intracellular staining. (E) Cells were stimulated with CD3/28 beads for 24 h, and the levels of IFN-γ in the supernatant were determined using enzyme-linked immunosorbent assay (ELISA) (N = 3). (F) GFP-engineered T cells were stimulated with CD3/28 beads, and GFP expression at different time points were determined by flow cytometry. CTL, control.

Implement the IFN-UTR-IRES inducible circuit for the expression of IL-15

IL-15 is a pro-inflammatory cytokine and has been investigated in preclinical and clinical studies.18 While many studies have addressed the therapeutic benefits of IL-15, constitutive expression of IL-15 could pose a risk of malignancy transformation.19 We hypothesized that the IL-15 gene driven by IFN-UTR-IRES should be capable of producing sufficient IL-15, generating polyfunctional T cells. This would allow us to leverage the benefits of IL-15 while avoiding potential risks. To better track IL-15 expression, the IL-15 gene was followed by a 2A self-cleaving peptide and GFP (Figure 3A). By measuring GFP, we illustrated that GFP expression is strictly dependent on antigen stimulation (Figure 3B). Furthermore, IL-15 expression also exhibited an antigen-dependent pattern and rapidly became undetectable when the stimuli were removed from the culture (Figures 3C and 3D). Although the GFP intensity in T-IL15GFP cells was reduced compared with T-GFP cells (highly likely because of insufficient self-cleavage), the expression of IFN-γ remained unaffected (Figures 3E and 3F). Constitutive expression of IL-15 could impact T cell proliferation and phenotype.19 In our study, IL-15 was regulated by the endogenous IFN-γ promoter and expected to remain silent during T cell culture in the absence of stimuli. Therefore, we compared the cell proliferation and phenotype of the ex vivo cultured GFP knock-in cells with IL-15 knock-in cells. As shown in Figures 3G and 3H, no significant differences were observed between T-GFP and T-IL15GFP, indicating the absence of IL-15 expression.Figure 3 IL-15 is co-expressed with IFN-γ in antigen-stimulation-dependent manner

(A) Schematic illustration of the IL15GFP knock-in strategy targeting the IFN-γ 3′ UTR via HDR. (B) IL15GFP engineered T cells were restimulated with CD3/28 beads for 24 h, and knock-in efficiency was determined by measuring GFP expression. (C) IL15GFP engineered T cells were restimulated with CD3/28 beads for different durations, and IL-15 levels in the supernatant were determined by ELISA. (D) Schematic diagram of experiment design (left), and IL-15 concentrations in the supernatants collected at different time points. (E) Co-expression of GFP and IFN-γ in IL15GFP engineered cells was determined by intracellular staining. (F) Cells were stimulated with CD3/28 beads for 24 h, and the levels of IFN-γ in the supernatant were determined using ELISA (N = 3). (G and H) GFP and IL15GFP engineered T cells were cultured for an additional 9 days after electroporation, and cell proliferation (G) and phenotype were determined (H). FMO, fluorescence minus one; ND, not detected.

Manufacturing claudin 18.2 CAR T cells with IL-15 driven by the IFN-UTR-IRES

Claudin18.2 has emerged as a promising target for CAR-T therapy in solid tumors.20 By immunizing mice with human claudin 18.2, we identified an antibody (designed 007) that exhibits high affinity and specificity. Based on the antibody sequence, a second-generation CAR with 4-1BB was constructed and cloned into a lentiviral plasmid for viral preparation (Figure 4A). Human T cells were activated with CD3/28 Dynabeads for 24 h, then transduced with different multiplicities of infection (MOIs) of lentiviral vector (LVV). High transduction efficiency was achieved across different donors (Figure 4B). To assess CAR function, we selected the gastric cancer-derived HGC-27 cell line, transduced with claudin 18.2 lentivirus (designated HGC-27-035), as the target cells for in vitro cytotoxicity assays. We found that only CAR-expressing T cells could kill target cells and produce IFN-γ (Figures 4C and 4D), suggesting CAR-dependent cytotoxicity. The general procedure for manufacturing CAR T cells involved transducing T cells after 24-h activation. To prevent mutual interference of LVV transduction and gene editing and streamline the manufacturing process, we conducted the virus transduction on day 0 and ribonucleoprotein (RNP) nucleofection as well as AAV transduction on day 3 (Figure 4E). Interestingly, despite the simultaneous activation and LVV transduction, the transduction efficiency was nearly comparable with that of pre-activated T cells (Figure 4F). In contrast, we observed 20%–30% knock-in efficiency for both the CAR-GFP and CAR-IL15GFP groups, which is also comparable with that of non-LVV-transduced T cells (Figure 4G). We also monitored GFP expression at different time points and confirmed its stability throughout the manufacturing process, although the GFP intensity of CAR-IL15GFP cells is lower than that in CAR-GFP cells (Figure 4H). To better characterize the impact of IL-15 on CAR T cell function, we enriched the knock-in cells using flow cytometry. As illustrated in Figure 4I, a 3-fold enrichment of knock-in cells was able to be achieved. To further confirm IL-15 expression upon tumor antigen stimulation, CAR T cells were co-cultured with tumor cells for 24 h. Subsequently, IL-15 levels in the supernatant were determined by ELISA. As expected, IL-15 was only detectable in the CAR-IL15GFP group (Figure 4J).Figure 4 Manufacturing of anti-claudin18.2 CAR T cells engineered to express IL-15

(A) Schematic diagram of anti-claudin18.2 CAR construct. (B) T cells were activated for 24 h and subsequently transduced with anti-claudin18.2 CAR virus at MOIs of 1, 2, 3, and 4. CAR expression was determined on day 6 post transduction. (C and D) T cells were co-cultured with HGC-27-035 at effector-to-target (E:T) ratios of 3:1 and 1:1 for 48 h, and cytotoxicity (C) and IFN-γ expression (D) of CAR T cells were measured using xCELLigence RTCA and ELISA. (E) Manufacturing process of IL-15-secreting CAR T cells. (F) Viral transduction and T cell activation were conducted simultaneously on day 0, and the transduction efficiency of the CAR from three different healthy donors was determined by flow cytometry. (G) The knock-in efficiency of GFP and IL15GFP was determined by measuring GFP expression after 24 h stimulation with CD3/28 beads. (H) The percentage and intensity of GFP in GFP and IL15GFP engineered T cells were determined at different time points during the manufacturing process using flow cytometry. (I) The frequency of GFP-positive cells was determined before and after fluorescence-activated cell sorting enrichment using flow cytometry. (J) T cells were co-cultured with the HGC-27-035 tumor cells for 24 h, and the levels of IL-15 in the supernatant were determined by ELISA. NT, non-transduced T cells.

IL-15 driven by IFN-γ promoter enhances CAR T cell antitumor activity in vitro and in vivo

We have demonstrated that, upon antigen stimulation, CAR T cells with the IFN-UTR-IRES-IL15 circuit will produce IL-15. Next, we asked whether this level of IL-15 is sufficient to enhance CAR T antitumor activity. We first co-cultured CAR T cells with tumor cells for 2 days and monitored tumor cell growth. Unfortunately, we did not observe any difference between CAR-IL15GFP and CAR-GFP cells, as both can eliminate the tumor effectively (Figure 5B). We hypothesized that IL-15 might be more important for T cells during chronic stimulation, while it could be dispensable for acute stimulation. We, therefore, modified our in vitro tumor killing assay to mimic the chronic or persistent antigen stimulation conditions. As shown in Figure 5A, CAR T cells were co-cultured with tumor cells for 48 h and then transferred to a new plate where tumor cells had been seeded 1 day earlier. After four cycles, T cells were transferred to an E-plate pre-seeded with tumor cells, and tumor cell growth was monitored using the xCELLigence RTCA instrument. In the final round of killing, CAR-IL15GFP cells demonstrated enhanced antitumor activity in comparison to CAR-GFP cells (Figure 5C). In line with the cytotoxicity results, CAR-IL15GFP cells produced significantly higher levels of IFN-γ, IL-2, and tumor necrosis factor-α (TNF-α), indicating robust polyfunctionality and integrity of IFN-γ expression (Figure 5D). Phenotypic analysis revealed that CAR-IL15GFP cells possess higher proportion of CD62L+CD45RA+ stem cell memory/naïve-like T cells after co-culture, indicating a phenotypic impact of IL-15 (Figure 5E). Encouraged by the data from our in vitro assays, we proceeded to assess the cells' antitumor activity in a xenograft mouse model. HGC-27-035 tumor cells were subcutaneously injected, and after 7 days when tumors were established, 5 × 106 of CAR T cells were administered intravenously. Tumor size was monitored at 2- or 3-day intervals (Figure 5F). Consistent with in vitro results, CAR-IL15GFP cells eliminated the tumor effectively, whereas the tumor could not be controlled in CAR-GFP group. This suggests that IL-15 was effectively produced in the CAR-IL-15 group, and significantly enhanced cells antitumor activities (Figures 5G and 5H). No CAR T-related toxicity was detected from all groups, suggesting the safety of our IFN-γ promoter driven IL-15 expression system (Figures 5G and 5I).Figure 5 IL-15 driven by IFN-γ promoter enhances CAR T cell antitumor activity in vitro and in vivo

(A) Schematic diagram of the cytotoxicity assay for CAR T cells under repeated antigen stimulation. (B) Assessment of tumor-killing activity of CAR T cells by co-culture CAR T cells with HGC-27-035 tumor cells for 48 h. (C and D) Assessment of tumor-killing activity of T cells using repeated antigen stimulation assay. Tumor growth from the last round of co-culture (C) and cytokines in the supernatants (D) were determined using xCELLigence RTCA and ELISA, respectively. (E) T cell subsets after the last round co-culture was determined based on the expression of CD45RA and CD62L. (F) Schematic diagram of HGC-27-035 xenograft mouse model. (G) Tumor growth based on tumor volume (mm3 ± SD), with a sample size of n = 6 mice per group. (H) The body weight of each treatment groups. (I) Kaplan-Meier survival curves for each group, with 6 mice per group, and survival comparison conducted using the Gehan-Breslow-Wilcoxon test. DPBS, Dulbecco’s PBS. ∗∗p < 0.01.

Site-specific integration of CAR and GFP using a single AAV vector

Thus far, we have demonstrated the effectiveness of the IFN-γ promoter in driving IL-15 expression. However, the current process involves delivering two components, CAR and IL-15, using two viruses, LVV and AAV. The complexity and cost associated with this approach may impede its clinical translation. To address this issue, we investigated ways to knock in both CAR and IL-15 genes with one AAV vector. Due to the limited packaging capacity of AAV (approximately 4.7 kb), we chose to utilize the endogenous TCR promoter for CAR expression.21 As a pilot experiment, we used GFP to track the knock-in efficiency in IFN-γ 3′ UTR locus, given its ease of tracking and longer length compared with the IL-15 gene. The CAR and GFP knock-in cassettes were directly linked in tandem and cloned into an AAV vector (Figure S1A). We selected and assessed the editing efficiency of a reported TRAC gRNA22 and demonstrated that this gRNA can generate greater than 95% CD3 deficiency T cells (Figure S1B). When we combined TRAC and IFN-γ gRNAs and conducted a double knockout experiment, we found that the editing efficiency of both genes are unaffected (Figure S1C). After that, we conducted a knock-in experiment with TRAC gRNA and double knock-in AAV vector. Unfortunately, we only achieved about 30% knock-in efficiency (Figure S1D). To further enhance editing efficiency, we added a previously reported DNA-PK inhibitor, AZD7648, to the culture after electroporation.23 Strikingly, knock-in efficiency increased 2-fold when using a 3-μM concentration of AZD7648, while minimal impact on cell viability was observed (Figure S1E). Finally, we combined TRAC and IFN-γ gRNAs with AAV and assessed the efficiency of double knock-ins. As anticipated, AZD7648 treatment dramatically improved knock-in efficiency for both CAR and GFP. Surprisingly, the proportion of GFP+CAR+ T cells increased almost 3-fold (approximately 30%), implying the potential enrichment capability of AZD7648 for double knock-in cells (Figure S1F).

CAR and IL-15 double knock-in cells demonstrate improved antitumor efficacy

To generate CAR and IL-15 double knock-in cells, we designed an HDR template AAV vector containing a nectin cell adhesion molecule 4 (Nectin4) targeting CAR and IL-15 (Figure 6A). Given the high double knock-in efficiency observed previously and the elimination of the need for LVV, the manufacturing process was greatly streamlined (Figure 6B). With the new process, we were able to achieve approximately 60% CAR knock-in efficiency across multiple donors (Figure 6C). To confirm the integration of IL-15, four pairs of PCR primers were designed. As expected, target bands (P3 and P4) were only detected in DKI-IL15 group, suggesting successful integration of IL-15 at IFN-γ locus (Figure 6D). Consistently, IL-15 knock-in cells stimulated with phorbol 12-myristate 13-acetate-ionomycin can produce a high level of IL-15 for more than 120 h (Figure 6E). Multiplex gene editing can result in chromosomal translocations.24 Using Sanger sequencing and primer extension-mediated sequencing (PEM-seq), we confirmed the presence of chromosomal translocation in our TRAC and IFN-γ double-edited cells (RNP only; approximately 1.23%), however, the chromosomal translocation is undetectable in the final cell products (DKI-GFP and DKI-IL15) (Figure S2). To evaluate cells antitumor activity, we further performed a serial killing assay using Nectin4-expressing HGC-27 cells (designated HGC-27-180). Both DKI-GFP and DKI-IL15 cells can effectively eliminate the tumor cells at the first round of killing, but only DKI-IL15 maintained the cytotoxicity at the fourth round (Figure 6F). Moreover, IL-15 was still detectable in the supernatant after the last round of killing, indicating tumor antigen-driven IL-15 expression (Figure 6G). To better evaluate the impact of IL-15 in double knock-in cells, as well as our new manufacturing process, the in vivo antitumor efficacy of double knock-in cells was investigated in mouse model. As expected, the DKI-IL15 group, despite not achieving complete tumor eradication, demonstrated delayed tumor growth and extended mouse survival compared with the DKI-GFP group (Figures 6H and 6I). This indicates that IL-15, driven by the IFN-γ promoter, improves CAR T cell antitumor activity.Figure 6 IL-15 driven by IFN-γ promoter enhances antitumor activity of CAR T cells constructed via CAR and IL-15 double knock-in

(A) Schematic diagram of the DKI-IL15 AAV vector. LA, left homology arm; RA, right homology arm; P2A, porcine teschovirus-1 2A; pA, poly A tail. (B) Manufacturing process of double knock-in CAR T cells. (C) The efficiency of CAR knock-in in double knock-in cells was determined using flow cytometry. (D) The integration of IL-15 at the IFN-γ locus was confirmed using PCR. (E) Cells were stimulated with phorbol 12-myristate 13-acetate (PMA)-ionomycin, and the levels of IL-15 in the supernatant were determined at different timepoints using ELISA. (F) Nectin4-targeting CAR T cells were manufactured as (B) and later subjected to multiple-round killing assay. After the final round of killing, supernatant was collected, and IL-15 levels were determined by ELISA. (G) We inoculated 5 × 106 Nectin4-expressing HGC-27 cells (designated HGC-27-180) subcutaneously. (H and I) After 7 days, once the tumor was established, 5 × 106 T cells were infused, and tumor growth (H) and survival (I) were determined (N = 6). DKI, double knock-in; ∗∗p < 0.01.

Discussion

Cytokine transgenic CAR T cells have exhibited enhanced anti-solid tumor activity in multiple preclinical models. To avoid potential toxicities, many researchers have been using synthetic inducible promoters for transgene expression.25 Unfortunately, while synthetic promoters have shown effectiveness in preclinical models, their in vivo performance is not yet satisfactory.9 In contrast with synthetic promoters, endogenous promoters are more natural and reliable. IFN-γ is a major pro-inflammatory effector cytokine and plays a pivotal role in inflammation. Its expression is predominantly restricted to TCR signaling, making it an ideal safe harbor for transgene expression.13 Moreover, since IFN-γ is mainly produced by effector T cells, the transgene expression can further be limited within the local tumor site. Hence, we conducted this proof-of-concept study to explore the feasibility of employing the IFN-γ promoter for cytokine (IL-15) expression. There are two major considerations for this design. (1) IFN-γ expression cannot be affected. (2) T cells should be able to produce enough IL-15 for functional enhancement of CAR T cells. Based on our data, GFP-expressing T cells can produce IFN-γ normally, while IL-15 transgenic CAR T cells exhibited improved antitumor activity, suggesting the effectiveness of IL-15 expression.

IRES element and 2A peptides are two commonly used strategies for co-expressing multiple genes. Based on previous studies, the 2A peptide can better balance upstream and downstream gene expression levels, but its insertion to the protein coding region can inevitably impact endogenous gene expression due to the insufficient cleavage efficiency.26 In our study, the expression level of GFP driven by T2A is significantly lower than that directly driven by IRES, indicating the occurrence of inefficient cleavage (see Figure 4H). Despite the downstream gene expression level typically being 10%–20% lower than that of the upstream gene, the insertion site of the IRES element is outside of the protein coding region. Therefore, the expression of upstream gene will be unaffected. Considering the crucial role of IFN-γ in reshaping the tumor microenvironment, we therefore chose IRES for IL-15 expression. In fact, IFN-γ is one of the most elevated cytokines during CAR T therapy in clinics, so its promoter should be sufficient for transgene expression.27,28

Cytokines can influence T cell cytotoxicity and persistence, as well as trafficking, and the co-expression of cytokines such as IL-7, IL-15, and IL-18 has been investigated both in preclinical and clinical settings.3,29,30 In this study, we selected IL-15 as our modulating cytokine because the effects of IL-15 on T cells have been well studied and overexpression of IL-15 can significantly enhance the therapeutic efficacy of CAR T cells.31 Of note, to enhance IL-15 expression, we had replaced the signal peptide of IL-15 with the IL-2 signal peptide.32,33 Soluble single-chain IL-15 is unstable and prone to degradation; however, it provided us with an opportunity to evaluate the robustness of the endogenous promoter and IRES element. In future studies, it would be interesting to test stable version of IL-15 (IL-15/IL-15Rα heterodimer) or other stable cytokines.

In this study, we used AAV to deliver the repair template due to its high efficiency and low toxicity.21 To reduce costs and streamline the manufacturing process, we explored delivering two repair templates using a single AAV vector. While using one vector increased the chance of having two repair templates in the same cells, the double knock-in population did not increase accordingly. In fact, given the low efficiency of HDR, double knock-in may delay or impair the cell recovery from editing. In contrast, we observed a dramatic enrichment in the double-positive proportion when AZD7648 was applied. Therefore, it seems that multiple gene editing also increased the probability of non-homologous end-joining (NHEJ) events. Although NHEJ is a much more efficient repair pathway than HDR, more NHEJ events could sensitize cells to AZD7648 treatment. It would be worthwhile to investigate if the double knock-in population can be further enriched by inhibiting other error-prong DNA repair pathways, such as microhomology-mediated end-joining. Additionally, while our study focused on double knock-in with one vector, our data strongly support the idea that triple or more knock-ins can be achieved by using a single DNA fragment as repair template.

Although we have successfully knocked CAR and IL-15 genes into primary T cells simultaneously with only one AAV vector, the length of additional cargo was limited by AAV packaging capacity. Genes longer than 1,500 bp would be difficult to co-deliver with CAR. Non-viral methods have demonstrated great promise in T cell editing. Despite challenges related to knock-in efficiency and cell viability that remain, investigating their application could potentially overcome size limitations and decrease costs. In contrast, off-target editing and chromosome translocation induced by multiplex gene editing could cause unpredictable adverse effects. Interestingly, in our study, we observed chromosome translocation in the double-edited cells (RNP only), but not in the final cell product (with AAV). The underlying mechanism is unknown, but the potential risks of chromosome abnormality still need to be investigated.

In summary, we have developed a novel IFN-γ promoter-controlled, TCR-inducible transgene expression system. This strategy could be easily expanded to harness other endogenous promoters or express other cytokines. Taken together, this study provides a novel strategy to make more potent and safer CAR T cells, and advancements in DNA delivery and gene editing fields will further improve the efficiency of this strategy.

Materials and methods

Cell lines

Human gastric cell line, HGC-27, was purchased from Cell Culture Center of Chinese Academy of Medical Sciences (Beijing, China). LVVs overexpressing full-length human Claudin18.2/Nectin4 (pHBLV-CMV-MCS-Claudin18.2/Nectin4-EF1-ZsGreen) and a negative control (pHBLV-CMV-MCS-EF1-ZsGreen) were purchased from Hanbio Tech (Shanghai, China). Following validation by sequencing, lentiviral packaging was carried out. Subsequently, the Claudin18.2/Nectin4-overexpressing LVV were transduced into HGC-27 cells. These cells were cultured in DMEM (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY, USA) at 37°C in a humidified atmosphere containing 5% CO2. After 4 days, individual clones were isolated and expanded. Positive clones (HGC-27-035/180) were identified using flow cytometry.

Construction of claudin 18.2 CAR molecule and lentivirus packaging

The second-generation CAR structure is composed of the mouse Claudin18.2 monoclonal antibody (mAb) scFv (007) and sequence linked to the CD8α hinge and transmembrane region, the intracellular domain of 4-1BB and CD3ζ signal peptide. The synthesized structures were cloned onto the pHBLV LVV purchased from Hanbio Tech (Shanghai, China). Plasmids were mixed with packaging plasmids containing pMD2.G and psPAX2 purchased from Addgene (Cambridge, MA, USA) to create a DNA mix. Subsequently, transfection was conducted using Lipofectamine 3000 purchased from Invitrogen (Thermo Fisher Scientific, Waltham, MA, USA) to produce LVV in 293T cells cultured in a cell incubator at 37°C and 5% CO2. After 48 h, the supernatants containing viral particles were harvested and filtrated with 0.45 μm filter, then were concentrated by 100 kDa centrifugal filter unit purchased from Millipore with centrifugation at 3,500×g for 45 min at 4°C.

Generation of CAR T cells

Primary human blood cells were collected and cryopreserved following an institutional review board-approved protocol. The blood cells were obtained from anonymous healthy donors purchased from the AoNeng Biotechnology (Shanghai, China). T cells were stimulated by using CD3/CD28 Dynabeads (Thermo Fisher Scientific) at a bead-to-cell ratio of 3:1. After activation, the T cells were transduced with lentiviral supernatants containing the claudin 18.2 CAR construct at varying MOIs of 1–4. The cells were cultured in X-VIVO 15 serum-free medium purchased from Lonza (Walkersville, MD, USA) at 37°C and 5% CO2 for 6 or 24 h, which depends on the individual experiment. After transducing the cells with LVV, fresh X-VIVO 15 serum-free medium supplemented with 5% AB serum purchased from GemCell (West Sacramento, CA, USA) and 300 U/mL recombinant human IL-2 (Thermo Fisher Scientific) were used as a replacement to remove the LVV. The CAR T cells were cultured for another 2 days, followed by the removal of the CD3/CD28 Dynabeads (Thermo Fisher Scientific) before being genetic modified by clustered regularly interspaced short palindromic repeats/CRISPR-Cas9.

Gene editing of CAR T cells

Four CRISPR sgRNAs of targeting IFN-γ 3′ UTR and one sgRNA targeting TRAC were designed and synthesized by Genscript Biotech Corporation (Nanjing, China). The gRNA sequences were listed in Table 1. The Lonza 4D-Nucleofector (Basel, Switzerland) was utilized to perform electroporation on the cells. The CAR T cells were electroporated using the P3 Primary Cell 4D-Nucleofector X Kit (Lonza). To deliver Cas9 and gRNAs, the RNP complex was created by incubating 100 pM TrueCut Cas9 Protein purchased from Invitrogen (Thermo Fisher Scientific) with 8 μg gRNA and 80 μg poly-l-glutamic acid (PGA) purchased from Sigma-Aldrich for 15 min at room temperature. The CAR T cells were centrifuged at 100×g for 10 min and then resuspended in Lonza electroporation buffer at a concentration of 2 × 106 cells/20 μL. Electroporation was carried out using the pulse code EH-115. After electroporation, CAR T cells were incubated with 80 μL prewarmed PBS at 37°C for 1 h. Afterward, they were transduced with a recombinant AAV vector containing the donor template DNA for the insertion of IL15GFP and GFP constructs. The AAV virus was produced by PackGene Biotechnology (Guangzhou, China). After electroporation and transduction, the modified CAR T cells were cultured for 7 days in X-VIVO 15 medium supplemented with 5% AB serum and IL-2 to facilitate their expansion. The efficiency of LVV and AAV transduction was determined using flow cytometry. After this, the cells were either stored in liquid nitrogen for preservation or sorted for GFP enrichment using a cell sorter purchased from Sony Corporation (Tokyo, Japan) for further in vitro and in vivo experiments.Table 1 The sequences of gRNAs

gRNA	Sequence	
IFN-γ gRNA1	CTTTATCTCAGGGGCCAACT	
IFN-γ gRNA2	CCAACCTAAGCAAGATCCCA	
IFN-γ gRNA3	CAACCTAAGCAAGATCCCAT	
IFN-γ gRNA4	CAACTGTGACTGTACCCAAA	
TRAC gRNA	AGAGTCTCTCAGCTGGTACA	

Double knock-in strategy for targeted CAR and IL-15 integration in T cells

T cells were initially stimulated using CD3/CD28 Dynabeads at a bead-to-cell ratio of 3:1. Subsequently, on day 3, the T cells underwent electroporation to introduce Cas9 alongside specific IFN-γ sgRNA and TRAC sgRNA separately. These two RNP complexes were formed by incubating TrueCut Cas9 Protein with 8 μg sgRNAs and 80 μg PGA for 15 min at room temperature. The electroporation process was performed utilizing the pulse code T cell human stim. After electroporation, the CAR T cells were incubated with 80 μL prewarmed PBS at 37°C for 15 min. Then, they were transduced with a recombinant AAV vector containing the donor template DNA designed for the insertion of CAR and GFP/IL-15 constructs. To enhance the efficiency of the double knock-in process, we utilized AZD7648 obtained from Selleck Chemicals (Houston, TX, USA) at a concentration of 3 μM. After an additional five days of culturing, flow cytometry analysis was conducted to assess the integration efficiency of GFP and CAR.

Immunostaining of intracellular IFN-γ

The T cells were initially stimulated in X-VIVO 15 complete culture medium, which included CD3/CD28 Dynabeads, Golgi Plug (Brefeldin A) and Golgi Stop (Monensin) purchased from BD Biosciences (San Jose, CA, USA) at a concentration of 1 μL/mL in a cell incubator. For activation of IFN-γ experiment, T cells were stimulated for durations of 1, 2, 3, and 4 h. For study deactivation kinetics, T cells were pre-treated overnight with beads. Then, the beads were removed, and protein transport inhibitors were added at intervals of 1, 2, 3, and 4 h of incubation. Immunostaining of cell surface markers was conducted using unfixed cells before proceeding to stain for intracellular cytokines. Subsequently, the cells underwent two washes in PBS. Following this, they were fixed and permeabilized using Cytofix/Cytoperm and Perm/Wash buffer purchased from eBioscience (San Diego, CA, USA) according to the manufacturer’s instructions. The cells were then stained with directly conjugated primary antibody for detection of intracellular IFN-γ to cells and incubate for 20–60 min at room temperature. Finally, the cells were washed twice in PBS with 0.1% BSA purchased from Sigma-Aldrich. Following this, they were resuspended in a 2% paraformaldehyde solution (Sigma-Aldrich) prepared in PBS in preparation for flow cytometry analysis.

Flow cytometry

APC anti-human IFN-γ (clone 4S.B3), APC Mouse lgG1, K lsotype Ctrl Antibody (clone MOPC-21), APC anti-human CD3 Antibody (clone OKT3), PE anti-human CD45 (clone HI30), PE anti-human CD279 (clone MIH4), Hu/NHP CD69 PerCP-Cy5.5 FN50 (clone FN50) were purchased from BioLegend (San Diego, CA, USA). APC-H7 Mouse Anti-Human CD45RA (clone HI100), PE Mouse Anti-Human CD62L (clone DREG-56), APC-Cy7 Mouse Anti-Human CD8 (clone RPA-T8), CD4 PerCP-Cy5.5 (clone RPA-T4) were purchased from BD Biosciences. CAR expression was detected by staining with Biotin-SP-conjugated AffiniPure Goat Anti-Mouse IgG, F(ab')2 Fragment Specific followed by secondary APC streptavidin (BioLegend) and Anti-G4S linker (B2H1) mAb purchased from Hycells (Shanghai, China). Flow cytometry data were acquired by Beckman Coulter (Miami, FL, USA) and analyzed using FlowJo LLC (Ashland, OR, USA).

Real-time cytotoxicity assay

Real-time cytotoxicity assay (RTCA) was performed using xCELLigence system from Acea Biosciences, Inc. (Santa Clara, CA, USA) to assess CAR T cell-mediated cytotoxicity. In each well of a 24-well plate, a total of 1 × 105 HGC-27-035 cells were plated with 500 μL growth medium and allowed to grow overnight in a 37°C incubator. After approximately 24 h, the growth medium was replaced with 500 μL of CAR T cells at an E:T ratio of 0.5:1 with the tumor cell targets. Cell-mediated killing was performed over the next 24 h. After this period, the CAR T cells were collected from the initial 24-well plate and transferred into another prepared 24-well plate containing the same amount of HGC-27-035 cells. Cell killing was carried out in a 24-well plate for four rounds. Subsequently, adherent HGC-27-035 cells in 150 μL were seeded into E-plate 16 (Acea Biosciences) at 1.5 × 104 per well and monitored in culture overnight using the impedance-based RTCA xCELLigence system. Then, 50 μL of CAR T cells at the same E:T ratio from the existing 24-well plate of the last round were transferred into the adherent tumor cell targets. The cells in the E-plate were continuously monitored for an additional 1–2 days using the RTCA system, and impedance measurements were recorded over time. Cytolysis was calculated as follows: Cytolysis (%) = [(target cells only cell index − test cell index)/target cells only cell index] × 100.

Cytokines release assay

A cytokine release assay was conducted in triplicate, involving the co-culture of the CAR T cells at an effector-to-target ratio of 0.5:1. At the endpoint of the cytotoxicity assay, the supernatant was collected for the assessment of cytokine secretion. The levels of IFN-γ, TNF-α, IL-15, and IL-2 in the culture supernatants were quantified using a Bio-Plex Pro Reagent Kit from Bio-Rad Laboratories (Hercules, CA, USA).

Detection of IL-15 integration in double knock-in cells

Plasmid or genomic DNA was extracted by using Agencourt chloropure from Beckman Coulter (Brea, CA, USA) according to the manufacturer’s protocol. PCR amplifications were performed using four pairs of primers targeting different regions of the genomic recombinant as follows: P1-F (5′-TTCCCGATAGGTAACTGACTTGA-3′) and P1-R (5′-AGAGCCATTTGACTCTTTCCACA-3′); P2-F (5′-GATTACAAGGCTTTATCTCAGGG-3′) and P2-R (5′-GAGCCATTTGACTCTTTCCACA-3′); P3-F (5′-AGAATGTGAGGAACTGGAGGAAA-3′) and P3-R (5′-AGGAAATAGGAAGGTGGAGAAGG-3′); P4-F (5′-TGACTACAAGGACGACGATGAC-3′) and P4-R (5′-TTCTTTCACTCCAGGTCTCACT-3′).

Detection of chromosomal translocation

Translocation events between the IFNG and TRAC loci were detected by PCR using the primer pairs: F_CTGAGTCCCAGTCCATCACG and R_CACAGCTAAGAAGACTCCCCTC. A synthesized TRAC-IFNG DNA fragment was used as a positive control. The PCR amplicons were detected with electrophoresis, and the bands were cut and purified for Sanger sequencing (GENEWIZ, Inc., Suzhou, China).

The frequency of chromosomal translocation was determined using PEM-seq (GeneRulor, Zhuhai, China). Briefly, genomic DNA from unedited or edited T cells of three healthy donors was extracted and pooled together, then randomly fragmented to 500 bp by Bioruptor Pico (Diagenode, Liège, Belgium) ultra-sonication. Biotinylated primers were annealed to the fragmented DNA, and primer extension was carried out through repeated cycles of annealing and denaturation. After removing excess biotinylated primers, bridge adapter molecules containing 14-base random molecular barcodes were ligated to the DNA fragments. Subsequently, PCR amplification was performed to enrich the library for Illumina sequencing. The library was sequenced on the MGI 2000 platform with 150-bp paired-end reads. Data analysis was conducted using dedicated PEM-seq analysis software.

In vivo experiments

All mice utilized in this study were housed and maintained at the experimental animal center of Guangdong Medical University and handled following protocols approved by the Animal Care and Use Committee (Reference number: GDY2304011). Tumor cells or CAR T cells were suspended in 200 μL of normal saline and administered through the indicated routes. SPF-grade 6-week-old female NCG mice received an injection of 5 × 106 HGC-27-035 tumor cells under the skin of the abdomen, and 7 days later, 5 × 106 CAR T cells were administered to the mice via intravenous injection. Afterward, the tumor volume and body weight of each animal were measured every other day.

Statistical analysis

The data are presented as means with accompanying SDs. Statistical analysis encompassed the utilization of two-way repeated-measure ANOVA for assessing tumor burden, which included parameters such as tumor volume and photon counts. Furthermore, Student’s t test was employed to ascertain variations in the absolute numbers of transferred T cells, cytokine secretion, and specific cytolysis. All statistical calculations were performed using GraphPad Prism 5.0 (GraphPad Software, La Jolla, CA, USA), with a significance threshold set at p < 0.05.

Data and code availability

The data generated in this study are available upon request from the corresponding author.

Supplemental information

Document S1. Figures S1 and S2

Document S2. Article plus supplemental information

Acknowledgments

We thank Dr. Zhongsheng Wang and Prof. Ke Ning for helping us revise the manuscript.

Author contributions

H.S. designed and directed the experiments. L.M., K.Z., T.J., X.D., J.Z., F.R., D.K., M.Y., Y.L., and J.W. performed the experiments. H.S., K.Z., and J.H. analyzed the data. L.M. and H.S. supervised the project. H.S., J.X., and L.M. wrote the manuscript. D.L. and W.X. provided experimental material. All authors read and approved the final manuscript.

Declaration of interests

The study was funded by Shenzhen Celconta Life Science Co., Ltd. Two patents related to this study have been filed, and Shenzhen Celconta Life Science Co., Ltd. holds the right of the patents.

Declaration of generative AI and AI-assisted technologies in the writing process

During the preparation of this work the authors used ChatGPT to improve readability and language. After using these tools, the authors reviewed and edited the content as needed and take full responsibility for the content of the publication.

Supplemental information can be found online at https://doi.org/10.1016/j.ymthe.2024.06.017.
==== Refs
References

1 Markley J.C. Sadelain M. IL-7 and IL-21 are superior to IL-2 and IL-15 in promoting human T cell-mediated rejection of systemic lymphoma in immunodeficient mice Blood 115 2010 3508 3519 10.1182/blood-2009-09-241398 20190192
2 Lee E.H.J. Murad J.P. Christian L. Gibson J. Yamaguchi Y. Cullen C. Gumber D. Park A.K. Young C. Monroy I. Antigen-dependent IL-12 signaling in CAR T cells promotes regional to systemic disease targeting Nat. Commun. 14 2023 4737 10.1038/s41467-023-40115-1 37550294
3 Hu B. Ren J. Luo Y. Keith B. Young R.M. Scholler J. Zhao Y. June C.H. Augmentation of Antitumor Immunity by Human and Mouse CAR T Cells Secreting IL-18 Cell Rep. 20 2017 3025 3033 10.1016/j.celrep.2017.09.002 28954221
4 Ma X. Shou P. Smith C. Chen Y. Du H. Sun C. Porterfield Kren N. Michaud D. Ahn S. Vincent B. Interleukin-23 engineering improves CAR T cell function in solid tumors Nat. Biotechnol. 38 2020 448 459 10.1038/s41587-019-0398-2 32015548
5 Zhang L. Kerkar S.P. Yu Z. Zheng Z. Yang S. Restifo N.P. Rosenberg S.A. Morgan R.A. Improving adoptive T cell therapy by targeting and controlling IL-12 expression to the tumor environment Mol. Ther. 19 2011 751 759 10.1038/mt.2010.313 21285960
6 Chmielewski M. Abken H. TRUCKs: the fourth generation of CARs Expert Opin. Biol. Ther. 15 2015 1145 1154 10.1517/14712598.2015.1046430 25985798
7 Melenhorst J.J. Chen G.M. Wang M. Porter D.L. Chen C. Collins M.A. Gao P. Bandyopadhyay S. Sun H. Zhao Z. Decade-long leukaemia remissions with persistence of CD4(+) CAR T cells Nature 602 2022 503 509 10.1038/s41586-021-04390-6 35110735
8 Gust J. Ponce R. Liles W.C. Garden G.A. Turtle C.J. Cytokines in CAR T Cell-Associated Neurotoxicity Front. Immunol. 11 2020 577027 10.3389/fimmu.2020.577027
9 Zhang L. Morgan R.A. Beane J.D. Zheng Z. Dudley M.E. Kassim S.H. Nahvi A.V. Ngo L.T. Sherry R.M. Phan G.Q. Tumor-infiltrating lymphocytes genetically engineered with an inducible gene encoding interleukin-12 for the immunotherapy of metastatic melanoma Clin. Cancer Res. 21 2015 2278 2288 10.1158/1078-0432.CCR-14-2085 25695689
10 Bell M. Gottschalk S. Engineered Cytokine Signaling to Improve CAR T Cell Effector Function Front. Immunol. 12 2021 684642 10.3389/fimmu.2021.684642
11 Smole A. Benton A. Poussin M.A. Eiva M.A. Mezzanotte C. Camisa B. Greco B. Sharma P. Minutolo N.G. Gray F. Expression of inducible factors reprograms CAR-T cells for enhanced function and safety Cancer Cell 40 2022 1470 1487.e7 10.1016/j.ccell.2022.11.006 36513049
12 Rafiq S. Hackett C.S. Brentjens R.J. Engineering strategies to overcome the current roadblocks in CAR T cell therapy Nat. Rev. Clin. Oncol. 17 2020 147 167 10.1038/s41571-019-0297-y 31848460
13 Fenimore J. A Young H. Regulation of IFN-gamma Expression Adv. Exp. Med. Biol. 941 2016 1 19 10.1007/978-94-024-0921-5_1 27734406
14 Belk J.A. Daniel B. Satpathy A.T. Epigenetic regulation of T cell exhaustion Nat. Immunol. 23 2022 848 860 10.1038/s41590-022-01224-z 35624210
15 de Araujo-Souza P.S. Hanschke S.C. Viola J.P. Epigenetic control of interferon-gamma expression in CD8 T cells J. Immunol. Res. 2015 2015 849573 10.1155/2015/849573
16 Yang J. Murphy T.L. Ouyang W. Murphy K.M. Induction of interferon-gamma production in Th1 CD4+ T cells: evidence for two distinct pathways for promoter activation Eur. J. Immunol. 29 1999 548 555 10.1002/(SICI)1521-4141(199902)29:02<548::AID-IMMU548>3.0.CO;2-Z 10064070
17 Young H.A. Bream J.H. IFN-gamma: recent advances in understanding regulation of expression, biological functions, and clinical applications Curr. Top. Microbiol. Immunol. 316 2007 97 117 10.1007/978-3-540-71329-6_6 17969445
18 Shi H. Li A. Dai Z. Xue J. Zhao Q. Tian J. Song D. Wang H. Chen J. Zhang X. IL-15 armoring enhances the antitumor efficacy of claudin 18.2-targeting CAR-T cells in syngeneic mouse tumor models Front. Immunol. 14 2023 1165404 10.3389/fimmu.2023.1165404
19 Hsu C. Jones S.A. Cohen C.J. Zheng Z. Kerstann K. Zhou J. Robbins P.F. Peng P.D. Shen X. Gomes T.J. Cytokine-independent growth and clonal expansion of a primary human CD8+ T-cell clone following retroviral transduction with the IL-15 gene Blood 109 2007 5168 5177 10.1182/blood-2006-06-029173 17353346
20 Qi C. Gong J. Li J. Liu D. Qin Y. Ge S. Zhang M. Peng Z. Zhou J. Cao Y. Claudin18.2-specific CAR T cells in gastrointestinal cancers: phase 1 trial interim results Nat. Med. 28 2022 1189 1198 10.1038/s41591-022-01800-8 35534566
21 Eyquem J. Mansilla-Soto J. Giavridis T. van der Stegen S.J.C. Hamieh M. Cunanan K.M. Odak A. Gönen M. Sadelain M. Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection Nature 543 2017 113 117 10.1038/nature21405 28225754
22 Ren J. Liu X. Fang C. Jiang S. June C.H. Zhao Y. Multiplex Genome Editing to Generate Universal CAR T Cells Resistant to PD1 Inhibition Clin. Cancer Res. 23 2017 2255 2266 10.1158/1078-0432.CCR-16-1300 27815355
23 Wimberger S. Akrap N. Firth M. Brengdahl J. Engberg S. Schwinn M.K. Slater M.R. Lundin A. Hsieh P.P. Li S. Simultaneous inhibition of DNA-PK and Polϴ improves integration efficiency and precision of genome editing Nat. Commun. 14 2023 4761 10.1038/s41467-023-40344-4 37580318
24 Stadtmauer E.A. Fraietta J.A. Davis M.M. Cohen A.D. Weber K.L. Lancaster E. Mangan P.A. Kulikovskaya I. Gupta M. Chen F. CRISPR-engineered T cells in patients with refractory cancer Science 367 2020 eaba7365 10.1126/science.aba7365
25 Greenshpan Y. Sharabi O. Ottolenghi A. Cahana A. Kundu K. M Yegodayev K. Elkabets M. Gazit R. Porgador A. Synthetic promoters to induce immune-effectors into the tumor microenvironment Commun. Biol. 4 2021 143 10.1038/s42003-021-01664-7 33514819
26 Liu Z. Chen O. Wall J.B.J. Zheng M. Zhou Y. Wang L. Vaseghi H.R. Qian L. Liu J. Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector Sci. Rep. 7 2017 2193 10.1038/s41598-017-02460-2 28526819
27 Tau G.Z. Cowan S.N. Weisburg J. Braunstein N.S. Rothman P.B. Regulation of IFN-gamma signaling is essential for the cytotoxic activity of CD8(+) T cells J. Immunol. 167 2001 5574 5582 10.4049/jimmunol.167.10.5574 11698428
28 Frey N. Porter D. Cytokine Release Syndrome with Chimeric Antigen Receptor T Cell Therapy Biol. Blood Marrow Transpl. 25 2019 e123 e127 10.1016/j.bbmt.2018.12.756
29 Battram A.M. Bachiller M. Lopez V. Fernández de Larrea C. Urbano-Ispizua A. Martín-Antonio B. IL-15 Enhances the Persistence and Function of BCMA-Targeting CAR-T Cells Compared to IL-2 or IL-15/IL-7 by Limiting CAR-T Cell Dysfunction and Differentiation Cancers (Basel) 13 2021 3534 10.3390/cancers13143534
30 Adachi K. Kano Y. Nagai T. Okuyama N. Sakoda Y. Tamada K. IL-7 and CCL19 expression in CAR-T cells improves immune cell infiltration and CAR-T cell survival in the tumor Nat. Biotechnol. 36 2018 346 351 10.1038/nbt.4086 29505028
31 Gargett T. Ebert L.M. Truong N.T.H. Kollis P.M. Sedivakova K. Yu W. Yeo E.C.F. Wittwer N.L. Gliddon B.L. Tea M.N. GD2-targeting CAR-T cells enhanced by transgenic IL-15 expression are an effective and clinically feasible therapy for glioblastoma J. Immunother. Cancer 10 2022 e005187 10.1136/jitc-2022-005187
32 He X. Li W. Lu N. Qi F. Zhao N. Qiu Y. Zhu L. Amplified interleukin-15 expression vectors for cancer immunogene therapy Mol. Med. Rep. 1 2008 369 374 21479419
33 Bamford R.N. DeFilippis A.P. Azimi N. Kurys G. Waldmann T.A. The 5' untranslated region, signal peptide, and the coding sequence of the carboxyl terminus of IL-15 participate in its multifaceted translational control J. Immunol. 160 1998 4418 4426 9574546
