
==== Front
Mol Ther
Mol Ther
Molecular Therapy
1525-0016
1525-0024
American Society of Gene & Cell Therapy

S1525-0016(24)00382-4
10.1016/j.ymthe.2024.05.040
Original Article
In vivo selection in non-human primates identifies AAV capsids for on-target CSF delivery to spinal cord
Hanlon Killian S. 123411
Cheng Ming 12311
Ferrer Roberto Montoro 56
Ryu Jae Ryun 7
Lee Boram 7
De La Cruz Demitri 123
Patel Nikita 123
Espinoza Paula 123
Santoscoy Miguel C. 123
Gong Yi 13
Ng Carrie 123
Nguyen Diane M. 123
Nammour Josette 123
Clark Sean W. 8
Heine Vivi M. 910
Sun Woong 7
Kozarsky Karen 8
Maguire Casey A. cmaguire@mgh.harvard.edu
123∗
1 Department of Neurology, Massachusetts General Hospital, Boston, MA 02115, USA
2 Molecular Neurogenetics Unit, Massachusetts General Hospital, Charlestown, MA 02129, USA
3 Harvard Medical School, Boston, MA 02116, USA
4 University College London, London, UK
5 Department of Pediatric Neurology, Emma Children’s Hospital, Amsterdam UMC, Amsterdam Leukodystrophy Center, Amsterdam Neuroscience, University of Amsterdam, Amsterdam, the Netherlands
6 Department of Complex Trait Genetics, Center for Neurogenomics and Cognitive Research, Vrije Universiteit Amsterdam, Amsterdam Neuroscience, De Boelelaan, Amsterdam, the Netherlands
7 Department of Anatomy, Brain Korea 21 Plus Program for Biomedical Science, Korea University College of Medicine, Seoul, Republic of Korea
8 SwanBio Therapeutics, Bala Cynwyd, PA 19005, USA
9 Department of Child and Adolescent Psychiatry, Emma Center for Personalized Medicine, Emma Children's Hospital, Amsterdam UMC, Amsterdam Neuroscience, Amsterdam, the Netherlands
10 Department of Complex Trait Genetics, Center for Neurogenomics and Cognitive Research, Vrije Universiteit Amsterdam, Amsterdam Neuroscience, De Boelelaan, Amsterdam, the Netherland
∗ Corresponding author: Casey A. Maguire, Department of Neurology, Massachusetts General Hospital, Boston, MA 02115, USA. cmaguire@mgh.harvard.edu
11 These authors contributed equally

05 6 2024
07 8 2024
05 6 2024
32 8 25842603
12 4 2024
31 5 2024
© 2024 The Author(s)
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Systemic administration of adeno-associated virus (AAV) vectors for spinal cord gene therapy has challenges including toxicity at high doses and pre-existing immunity that reduces efficacy. Intrathecal (IT) delivery of AAV vectors into cerebral spinal fluid can avoid many issues, although distribution of the vector throughout the spinal cord is limited, and vector entry to the periphery sometimes initiates hepatotoxicity. Here we performed biopanning in non-human primates (NHPs) with an IT injected AAV9 peptide display library. We identified top candidates by sequencing inserts of AAV DNA isolated from whole tissue, nuclei, or nuclei from transgene-expressing cells. These barcoded candidates were pooled with AAV9 and compared for biodistribution and transgene expression in spinal cord and liver of IT injected NHPs. Most candidates displayed increased retention in spinal cord compared with AAV9. Greater spread from the lumbar to the thoracic and cervical regions was observed for several capsids. Furthermore, several capsids displayed decreased biodistribution to the liver compared with AAV9, providing a high on-target/low off-target biodistribution. Finally, we tested top candidates in human spinal cord organoids and found them to outperform AAV9 in efficiency of transgene expression in neurons and astrocytes. These capsids have potential to serve as leading-edge delivery vehicles for spinal cord-directed gene therapies.

Graphical abstract

IT delivery of AAV vectors results in low on-target delivery to spinal cord and high-off target delivery to the periphery. Maguire and colleagues identify new capsids that mediate a favorable on-target/off-target profile in NHPs and robust transduction of human SCOs.

Keywords

adeno-associated virus
AAV
viral vector
spinal cord
gene therapy
lumbar injection
AAV capsid libraries
spinal cord organoids
engineered AAV capsids
intrathecal injection
==== Body
pmcIntroduction

Genetic diseases that affect the spinal cord are devastating, owing to their debilitating effects on quality of life as well as lack of effective treatments. Gene therapy for the CNS using adeno-associated virus (AAV) vectors has risen to the forefront with promising clinical data showing the efficacy of therapy targeting the CNS and spinal cord.1,2 Many of these approaches use systemic delivery of AAV serotypes such as AAV9 which can cross the blood-brain barrier (BBB). This generally gives reasonable distribution of transgene expression in neurons throughout the brain and spinal cord, although the efficiency with AAV9 and natural serotypes is low and requires high doses of vector.3 Systemic dosing also has major translational challenges such as pre-existing neutralizing antibodies to the AAV capsid, the high cost of generating the large doses (>1014 vg/kg) required for therapy, and even dose-limiting toxicities due to apparent innate immune activation and liver dysfunction.4,5 There is also concern of off-target expression of transgene in dorsal root ganglion neurons causing toxicity, as has been demonstrated in large animal models,6 although this can be mitigated with microRNA (miRNA) transgene expression detargeting strategies.7

Therefore, research has been focused on developing AAV-based gene therapies using direct injection of vector into the cerebral spinal fluid (CSF). Intrathecal (IT) injection into the CSF around the lumbar spinal cord with AAV usually gives good transduction of motor neurons in the lumbar region, but less transduction of cervical regions and the brain.8,9 Positioning the subject in Trendelenburg can enhance vector biodistribution of the cervical region somewhat.9,10 In contrast, cisterna magna injection of AAV vectors gives better cervical and brain transduction, but less so in the lumbar region.11 There is also a surprisingly high amount of vector that enters the circulation after CSF delivery that ends up in the liver,12,13 which could lower the safety benefits of this route of delivery, and reduce the amount of vector available for on-site spinal cord transduction. In fact, in a recent study, liver toxicity in cynomolgus monkeys after IT delivery was observed.14 And in a clinical trial for spinal muscular atrophy (SMA), 2 out of 25 patients receiving IT administered AAV9-sc-CBA-SMN1 (onasemnogene abeparvovec [Zolgensma]) had liver enzyme elevations.15 There is a clear need for AAV vectors that can transduce the spinal cord with the following properties: (1) high efficiency at a lower dose, (2) distribution throughout the entire spinal cord from lumbar to cervical regions, and (3) low off-target leakage and transduction of peripheral organs, especially the liver.

With this in mind, we developed an in vivo selection strategy with an AAV9 peptide display library (iTransduce) that allows selection of transduction competent AAV capsids.16 We further developed the system to be utilized in non-human primates (NHPs) to maximize clinical translation of the capsids’ transduction properties, owing to physiological and anatomical (e.g., organ size, CSF volume) differences between primates and mice. We performed two rounds of in vivo selection in NHPs after IT injection of the AAV peptide display library. In the second round, we utilized iTransduce to isolate AAV variants that led to functional transduction. We then identified capsids that outperformed AAV9 in terms of biodistribution and transduction efficiency in the NHP spinal cord and lowered biodistribution to liver, as well as enhanced transduction of human spinal cord organoids (SCOs).

Results

In vivo IT injection AAV library selection strategy in NHPs

We have previously reported on the use of the iTransduce AAV peptide display library. The genome construct consists of a promoter driving a Cre-recombinase cassette as well as p41 promoter-driven AAV9 capsid gene with 7-mer peptide inserts between amino acids 588 and 589 of VP1. This allows surface display of 50 copies of peptides on VP3 on the capsid surface (and 5 copies each on internally localized VP1 and VP2 proteins). For round one of our in vivo selection strategy in NHPs, we produced the AAV peptide display library and injected it IT into Old World monkeys (cynomolgus macaques;Figure 1A; Table S1). Next, AAV genome DNA was recovered by PCR from cervical, thoracic, and lumbar regions of the spinal cord and subjected to next-generation sequencing (NGS) to analyze the content of the 7-mer encoding inserts. These capsid inserts were pooled and packaged into the round one-selected spinal cord library (Figure 1A). For the second selection round, we developed a strategy to enable selection of capsids that could mediate transduction expression in a non-transgenic animal such as an NHP. To do this, we used a two-vector approach as outlined in Figure 1B. The first vector is the AAV iTransduce library genome shown in Figure 1A, that is packaged inside the round one rescued capsid inserts. The second vector is a Floxed reporter cassette encoding an H2B-fused mPlum protein called AAV-CBA-Floxed-STOP-H2B-mPlum. We used H2B-mPlum (mPlum with a nuclear localization signal) to allow sorting of fluorescent nuclei from either fresh or frozen tissue (cytoplasmic proteins are likely to leak out of freeze/thawed tissues). When the AAV capsid library encoding Cre is co-injected or sequentially injected with the AAV9-CBA-floxed-STOP-H2B-mPlum, cells that are co-transduced with library capsids able to express Cre along with the AAV9 capsid will excise the stop cassette and express H2B-mPlum in the nucleus (Figure 1B). Spinal cord is isolated and DNA can be purified from whole frozen tissue, purified nuclei, or H2BmPlum flow-sorted nuclei. Peptide inserts are analyzed by NGS and candidate AAV capsids chosen for further characterization.Figure 1 Overview of the in vivo selection in NHPs to identify AAV capsids with the ability to efficiently transduce spinal cord

(A) Round one of selection. The iTransduce AAV genome plasmid has a CBA-driven Cre cassette followed by a p41 driven AAV9 capsid with randomized 21mer bp inserts encoding for 7mer peptides inserted into the capsid. NHPs are injected IT with the library and three weeks later animals are sacrificed and spinal cord removed. NGS is performed on AAV genomes containing 21mer inserts amplified from three spinal cord regions. The rescued cap inserts are inserted into the iTransduce backbone and packaged into the R1 rescued library. (B) Round two of selection. A second reporter AAV expression plasmid is used to allow transduction-based selection in a non-transgenic animal. The reporter contains a Cre-sensitive floxed-STOP-H2B-mPlum cassette. When co-injected IT into NHPs with iTransduce library from Round one, cells that are co-transduced with Cre-expressing capsids can rescue nuclear mPlum expression. Spinal cord is again isolated and DNA isolated using three different strategies: (1) whole tissue DNA as in 1a, (2) flow-sorted nuclei, and (3) flow-sorted H2B-mPlum nuclei (contains transduction-competent capsid DNA). NGS is performed and AAV capsids are identified for further screening for spinal cord transduction.

Round one of selection of IT injected AAV9 peptide display library in NHPs

A preparation of the iTransduce AAV9 peptide display library was produced, purified, and titered. Library diversity was assessed by NGS before injection, with quality cutoffs to ensure diversity (see methods). A male cynomolgus monkey was injected IT with 9 × 1011 vector genomes (vgs) of the AAV library. Three weeks later, the animal was killed, perfused with sterile saline, and tissues including the spinal cord were flash frozen and stored at −80°C. We isolated DNA from homogenized, whole, spinal cord samples from the cervical, thoracic, and lumbar regions. Next, we performed a PCR with primers surrounding the 21-mer base pair inserts and submitted the three samples for NGS. We obtained diverse inserts from the sequencing data; reads and unique inserts frequencies are shown in Table S2. Read diversity (number of unique reads) in the cervical sample was much lower than thoracic or lumbar. This is likely due to few capsids with the ability to traffic from the lumbar region to the cervical region after IT injection. We pooled amplified capsid DNA fragments containing 21-mer inserts from all three spinal cord regions and ligated them into the iTransduce plasmid library backbone.

A two-vector system allows detection of transduction competent AAV capsids in non-transgenic large animals

To create a system that would allow us to detect transgene expression at the protein level of transduction-competent AAV library variants, we designed a second vector, AAV-CBA-Floxed-STOP-H2B-mPlum, as described in Figure 1B. To test the function of the system, we transduced cultured 293T cells with AAV capsids packaging the following expression cassettes: (1) AAV-PHP.B-CBA-Cre only, (2) AAV9-floxed-STOP-H2B-mPlum only, and (3) a mixture of AAV-PHP.B-CBA-Cre with AAV9-floxed-STOP-H2B-mPlum. Three days later, cells were examined by fluorescence microscopy for both DAPI and H2B-mPlum fluorescence. As expected, nuclear-localized mPlum fluorescence was detected only in the cells co-transduced with both vectors (Figure 2A). To test whether the system worked in non-transgenic animals in vivo, we intravenously injected wild type C57BL/6 mice with the following groups of vectors: (1) AAV-F-CBA-Cre only, (2) AAV-F-Floxed-STOP-H2B-mPlum only, or (3) a mixture of AAV-F-CBA-Cre with AAV-F-Floxed-STOP-H2B-mPlum. We used the previously described AAV-F capsid as it efficiently transduces the brain after systemic injection.16,17 Sixteen days after injection, mice were perfused with PBS and brains flash frozen. Next, we isolated nuclei from dissociated brain, labeled total nuclei with a violet-fluorescing dye, and then analyzed nuclei from each group for mPlum fluorescence (Figure 2B). All groups had nuclei, as observed by the violet dye stain. However, only the AAV-Floxed-STOP-H2B-mPlum-positive AAV-Cre group showed many fluorescent mPlum-positive nuclei, which demonstrates the specificity and functionality of the two-vector system (Figure 2C). The flow data was confirmed in brain sections from the different injected groups (Figure S1).Figure 2 Two-vector iTransduce system allows detection of transduction competent AAV in vitro and in vivo

(A) We transduced 293T cells with AAV-Cre or AAV-Floxed-STOP-H2B-mPlum vectors alone (first two columns) or co-transduced with both vectors (far right column). Nuclear H2B-mPlum fluorescence was only detected in co-transduced cells. Scale bar, 100 μm. (B) Wild-type C57Bl/6 mice were iv injected with the following vector groups (n = 2 mice/group): (1) AAV-Floxed-STOP-H2B-mPlum, (2) AAV-Cre, or (3) a mixture of both vectors in 1 and 2. (C) Brains were harvested, frozen, and nuclei isolated and then labeled with violet dye and analyzed with flow cytometry for violet and H2B-mPlum.

Round two of selection enriches for capsids in the NHP spinal cord after IT injection

For the second round of selection, we performed two separate IT injections into one female cynomolgus macaque. The animal was first IT injected with 2 × 1011 vg of the recovered iTransduce library from round 1 and 3 h later, while the animal was still anesthetized, IT injected with 3 × 1013 vg of AAV9-CBA-Floxed-STOP-H2B-mPlum. Three weeks later, the animal was killed and spinal cord and other tissues collected and flash frozen. As shown in Figure 1B, we isolated AAV genomes containing the 21 bp inserts via three methods: (1) whole tissue as in round one, (2) sorting dye-labeled nuclei from dissociated spinal cord, and (3) sorting H2B-mPlum-positive nuclei from cells co-transduced by a transduction competent AAV capsid (Cre-expressing) and the AAV9-Floxed-STOP-H2B-mPlum vector. For whole tissue isolated DNA, we used samples from all three regions of the spinal cord as in round one. For the nuclei isolation, we used the lumbar region of the spinal cord to increase the chances of detecting mPlum expression, as this was the injected region for the vector and should have the highest vector concentration. We purified nuclei using iodixanol density gradients, labeled the nuclei using violet dye, and flow sorted the nuclei in both mPlum-negative and mPlum-positive fractions. We set the mPlum-positive nuclei gate based on a round one spinal cord sample, which was not injected with the AAV9-Floxed-STOP-H2B-mPlum vector (Figure S2). mPlum-positive nuclei were detected in the co-injected animal (Figure S2), and we obtained 2.09 × 106 mPlum-negative nuclei and 1.70 × 104 mPlum-positive nuclei. For the whole tissue isolated DNA, and the nuclei from both mPlum-positive and mPlum-negative fractions, we were able to amplify the insert-containing PCR product. All PCR amplicons were analyzed by NGS. For the whole tissue DNA samples isolated from thoracic and lumbar spinal cord regions we observed many of the same top peptides from round one. There was strong enrichment however, with top peptides showing up to 15- to 21-fold enrichment compared with the round one recovered library (Figures 3A and 3B; Table S3). The read frequency of the top clones was 0.25% and 0.28% for lumbar and thoracic, respectively. For the cervical sample, there was an even greater enrichment in round two recovered sequences compared with the round one recovered library. The top peptides were enriched by 25- to 67-fold (Figure 3C; Table S3). For the mPlum-positive and -negative nuclei, there were far fewer variants. The top peptide in the mPlum-positive fraction, HTPLPRP, represented 88% of reads and in the mPlum-negative was 17% of reads. Due to the surprising level of read frequency of one peptide in the mPlum-positive nuclei fractions, we repeated the PCR on the nuclei DNA template for a total of three times. Interestingly, in the two repeat runs of the mPlum-positive fraction, the top peptides, PKYPLLG and RPDHVRK, were both at high frequencies (>99% of reads). Based on these findings of different peptides dominating the NGS reads in the same spinal cord sample but in independent PCR reactions, we assumed that we were observing stochastic effects of the PCR owing to the low amount of nuclei present for template in the PCR. However, we considered all of these top peptides to be viable candidates, as they were found in the mPlum-positive fraction.Figure 3 Isolation and selection of candidate variants in NHPs

(A–C) Bubble plots of NGS reads from round two of the whole tissue DNA selection for lumbar (A), thoracic (B), and cervical (C) regions. Enrichment compared with the previous selection round is indicated by relative circle size. Candidates chosen for downstream analysis are highlighted as shown. Gold ring indicates that a variant was found in more than one spinal cord region. Green indicates whole tissue chosen candidate. Purple indicates identification of mPlum nuclei selected candidates, where present. Brown indicates a peptide displaying capsid that was highly enriched, but produced poorly. (D) Candidate variants were chosen from whole tissue isolation, mPlum-negative nuclei, and mPlum-positive (transduced) nuclei. The names and insert peptides of each variant are listed. (E) The frequency of amino acids at each position for the selected candidates is given. A larger size indicates more frequent incorporation of a given amino acid, for a given position. (F) Overall production yield of each capsid variant when individually produced, compared with AAV9 (in black).

To choose candidates for further screening, we included the following parameters. (1) For the whole tissue isolated DNA data, we chose peptides based on NGS read frequency and enrichment between the injected library and the round two recovered library (Figure 3A), as well as the parameters 2–4 below. (2) We included peptides that were enriched in the cervical region of the spinal cord to increase chances of having capsids that can traffic from lumbar to cervical region. We found KSPSKVR (DK1) to have a high frequency in cervical (and it was also in thoracic spinal cord reads). (3) We included candidates from the nuclei-sorted samples (mPlum-positive and -negative) to increase chances of having transduction-competent capsids. We also looked in the DNeasy barcode data for the peptides isolated via the mPlum nuclei selection. Interestingly, we found the mPlum nuclei peptides, TP1 and TH2, and the nuclei peptide NR1, at relatively low frequency in the lumbar and thoracic reads (Figures 3A and 3B). (4) We looked for common motifs in the peptides, as well as peptides that were present at high frequency in two or more spinal cord regions. For example, DK1 was present in both cervical and thoracic spinal cord and DP1 at high frequency in both lumbar and thoracic spinal cord. Also the DNeasy isolated peptide HRALPLP (DH1) shares high homology with mPlum nuclei isolated peptide HPARALP (TH1). Based on these parameters we chose 13 candidate peptides for further analysis (Figure 3D; Table 1). An amino acid frequency calculator showed a characteristic LPLP motif at positions 4–7 (Figure 3E). Initially, we wanted to also include the peptide PKQSPTN present at high frequency. In both lumbar and thoracic spinal cord (Figures 3A and 3B), however, this capsid produced extremely poorly in pilot experiments, so it was excluded (data not shown).Table 1 Barcoded spinal cord candidate capsids for screen

Candidate name	Peptide sequence	Selection type	Reason for choosing	
DK1	KSPSKVR	whole tissue	one of the top peptides in cervical region	
DP1	PKGTPTT	whole tissue	PKX motif, XTT motif, high frequency in lumbar and thoracic regions	
DR2	RVAPPTL	whole tissue	highest enrichment in thoracic region, high in lumbar region	
DR1	RPHLPTT	whole tissue	LP motif at 4,5 position, RP motif, XTT motif, enriched in cervical region	
DH1	HRALPLP	whole tissue	LP motif at 4,5 position	
DV1	VTQFGCR	whole tissue	top peptide in cervical region	
NL1	LTTEGRR	Nuclei	XTT motif, high frequency	
NR1	RMPPQLD	Nuclei	high frequency	
TR2	RTTASLM	mPlum-positive nuclei	XTT motif, detected at low frequency in mPlum-positive reads	
TH1	HPARALP	mPlum-positive nuclei	detected at low frequency in mPlum-positive reads; similar sequence to whole tissue peptide HRALPLP	
TP1	PKYPLLG	mPlum-positive nuclei	PKX motif, top frequency read	
TR1	RPDHVRK	mPlum-positive nuclei	common RP motif, top frequency read	
TH2	HTPLPRP	mPlum-positive nuclei	LP motif at 4,5; RP motif, top frequency read	

We next tested the yield of individually produced candidates (in addition to AAV9 for comparison) to understand if they would be manufacturable for further development. The majority of capsids (10/13) produced very well, better than or very close to the yield of AAV9 (Figure 3F). Three other capsids produced lower yields. We classed these capsids A, B, and C, based on their production efficiency, with A having the highest and C the lowest (Figure 3F).

Barcoded capsid screen reveals variants with enhanced biodistribution in spinal cord and decreased liver biodistribution compared with AAV9

To assess the potential of the candidate peptides identified from round two of selection to mediate transduction of spinal cord, we engineered an AAV transgene expression cassette (Figure 4A). We used a human frataxin cDNA fused to a hemagglutinin tag similar to Goertsen et al.,18 as this construct has shown to express well in NHP CNS and potentially avoid confounding effects of immunogenic or toxic fluorescent proteins like GFP. We added a barcode region, which allows us to differentiate each of our candidate capsids via NGS at both the DNA and RNA levels. We tested the barcode system to measure biodistribution and transduction differences between AAV capsids by comparing NGS reads from barcodes at the DNA and RNA levels using systemically injected pooled AAV9 and AAV-F16 vectors (each with their own barcode) in C57BL/6 mice. Based on ours and others prior work,16,19,20 the AAV-F capsid has been shown to mediate enhanced biodistribution and transduction of brain compared with AAV9, so we expected the barcode data to yield a similar profile if it was performing as expected. Similar to our prior data with single capsid comparisons,16 AAV-F mediated a 13-fold increase and 28-fold increase in AAV genomes and encoded RNA, respectively (Figure S3). For the experiment in NHPs, we individually produced each of the 13 capsid candidates, as well as AAV9, which served as our benchmarking capsid (Figure 4A). Next, we pooled the library candidates as well as AAV9. Ten Class A capsids (which includes AAV9) were at a dose of 4 × 1011 vg/capsid, two from class B at a dose of 2 × 1010 vg/capsid, and one from class C at 3.98 × 109 vg. Two adult male cynomolgus monkeys (Table S1) were each injected IT with 4.48 × 1012 vg of the pooled barcoded capsids. Three weeks later, animals were killed, and spinal cord and other tissues isolated. We isolated DNA and RNA from the cervical, thoracic, and lumbar regions of the spinal cord and DNA and RNA from the liver. To understand the level of the pooled capsid genome in the spinal cord, we performed qPCR, which detects AAV genomes using primers and probes to the poly A signal of the expression cassette. For both NHPs, AAV genomes were highest in the lumbar region with a steep gradient from lumbar to thoracic and further drop-off to cervical spinal cord (Figure S4), which is expected, given the low dose of administered vectors and that it was a pool of different capsids. To understand the frequency of each capsid at each level of the spinal cord as well as from the liver, NGS was performed using the barcode unique for each capsid. As can be observed in the heatmap of the NGS data, many capsids displayed higher frequency than AAV9 in all three spinal cord regions, with some variability between animals (Figure 4B). Remarkably, 10 capsids outperformed AAV9 in amounts of vg in the lumbar region, ranging from 2- to 265-fold (Figures 4C and 4D). Several capsids had higher amounts of genomes in thoracic (up to 30-fold) and cervical regions (up to 10-fold) compared with AAV9, although there was more inter-animal variability compared with the lumbar region (Figures 4C and 4D). Notably, biodistribution to the liver was reduced for the majority of tested capsids (Figure 4B), with ranges of 2- to 1,250-fold lower than AAV9 (Figure 4E). NGS barcode analysis of DNA from heart also suggested a lower biodistribution of most of the capsids to peripheral organs compared with AAV9 (Figure S5). We also performed barcode analysis on the capsids in four brain regions and dorsal root ganglia (three levels of spinal cord) (Figure S6). There was a high degree of variability between capsids and inter-animal differences for the same capsid in some cases. Some capsids, such as DH1, showed a much higher read frequency in most brain samples compared with AAV9. Finally, we performed barcoded frequency analysis for each of the capsids in the following nerves isolated from the two NHPs: sciatic nerve, cranial nerve VIII, sural nerve, and ulnar nerve (Figure S7). While there was variability between the two animals for some capsids, there were some trends for increased frequency in certain nerves over AAV9. For examples capsids DP1 and DR2 had high read frequencies in sural and ulnar nerves compared with AAV9, DH1 had higher levels in sciatic nerve and 8th cranial nerve, and DK1 in cranial nerve VIII.Figure 4 Barcoded candidate capsid screen identifies variants with enhanced biodistribution in NHP spinal cord and reduced biodistribution to liver

(A) Schematic showing the procedure used for this experiment. Each capsid variant was barcoded between the protein-coding region and post-transcriptional sequences. Following IT injection, DNA was isolated from (1) each region of the spinal cord, (2) liver, (3) brain, (4) peripheral nerves, and (5) heart. These were subjected to NGS. (B) Heatmap showing relative frequency of each variant (or AAV9) in each region of the spinal cord and liver for each animal. Variants are clustered by expression pattern (higher expression = lighter color). (C and D) Average spinal cord bar code reads normalized to AAV9 at different spinal cord levels. (C) The DNeasy selected capsids (top) and the nuclei isolated capsids (bottom) across the lumbar, thoracic, and cervical regions. The dashed line indicates AAV9 levels. A red × indicates reads were not detected after the prior spinal cord region. (D) Depicts the data in (C), except all three spinal cord levels are show for each capsid/bar. (E) Liver biodistribution of each variant expressed as fold-change vs. AAV9. Zero values are not displayed owing to logarithmic scaling of the graphs. Error bars represent standard error. L, T, C (L1 = NHP #1001, L2 = NHP #1002, etc.): lumbar, thoracic, and cervical regions of the spinal cord. Li (Li1, 2) = liver samples #1001 and #1002, respectively. Color coding for the different capsids on the x axis: Green = whole tissue isolated; Blue = nuclei isolate; Purple = mPlum-positive nuclei isolated. ∗∗∗∗p < 0.0001.

Enhanced transduction in spinal cord and lower transduction of liver with several candidate capsids

Initially, we attempted to detect transgene expression by in situ fluorescence imaging of RNA barcodes. Unfortunately, likely owing to low doses of each individual capsid, we did not detect significant staining. Thus, to assess expression levels of the capsids, we assessed levels of cDNA reverse transcribed from frataxin-HA mRNA using RT-qPCR. The cDNA levels were detected in both animals in the lumbar region, although the levels were significantly higher (12.5-fold) in NHP #1001 than #1002 (Figure 5A). This could be due to differences in transduction efficiency between animals, as the vg were quite similar between animals (Figure 4B). The levels of cDNA in thoracic and cervical regions were not above the negative controls, likely owing to the low injected dose of each capsid, so further analysis of mRNA/cDNA was focused on the lumbar region of spinal cord and the liver. NGS was performed on the barcode cDNA from mRNA isolated from lumbar spinal cord and liver. We obtained high numbers of reads from the lumbar region of both animals, and the frequencies of top capsids were relatively consistent between independent PCR runs (four runs/animal) (Figure 5B). In contrast with the DNA biodistribution data, at the RNA level fewer capsids outperformed AAV9. None of capsids from the whole tissue DNA isolation outperformed AAV9 in at least one of the injected animals by a factor of two or more. In contrast, one of two in the nuclei isolation did, and three of five in the mPlum-positive nuclei isolation did (Figure 5B). The average enhancement ranged from 1.8- to 2.4-fold for the four capsids over AAV9 and up to 3.5-fold in one of the two animals (Figure 5B). Liver RNA expression appeared similar to the DNA biodistribution data; capsid variants showed expression levels 2- to 30,000-fold lower compared with AAV9 (Figure 5C).Figure 5 Barcoded capsid screen identifies variants with enhanced transgene RNA levels in spinal cord and reduced RNA levels in liver

(A) Expression levels of the AAV transgene in the lumbar portion of the spinal cord of each NHP (#1001, #1002), relative to GAPDH mRNA. (B and C) Average RNA expression values for the lumbar region of the spinal cord (B) and liver (C), expressed as fold change vs. AAV9. Zero values are not displayed owing to logarithmic scaling of the graphs. Error bars denote standard error. Lumbar 1 = NHP #1001; Lumbar 2 = NHP #1002. Liver 1 = NHP #1001; Liver 2 = NHP 1002. ∗p < 0.05; ∗∗p < 0.01; ∗∗∗∗p < 0.0001.

Generating a profile of candidate capsid features allows identification of top candidates for preclinical development

Based on the data in NHPs from biodistribution in spinal cord and liver and transduction in spinal cord as well as production efficiency, we selected the top candidate capsids to move forward with (Table S4). This allowed us to narrow 13 initial candidates down to four peptides, which were peptides NL1, TH1, TP1, and TR2. It is important to note that all chosen capsids were from the higher-yield class A capsids injected at the same dose as AAV9.

Enhanced transduction by NHP-selected capsids in human SCOs

Due to the low dose necessitated by the multiple screened capsids and limitations of volume injected IT in NHPs, we set out to test the potency of transduction and cell type tropism in another clinically relevant system, human SCOs. We transduced SCOs with our top four candidate capsids (NL1, TH1, TP1, and TR2) and compared them with AAV9. We tested the capsids in two separate organoid laboratories. We packaged a single-stranded AAV genome encoding a CAG-driven GFP cassette into each capsid (Figure 6A). In SCO laboratory 1, day 66 and day 225 old SCOs were transduced with 1.17 × 1011 vg/organoid (1.17 × 1012 vg/mL) and 6 days later organoids were imaged for GFP expression by confocal microscopy (Figure 6B). In day 66 old SCOs, all capsids provided statistically significantly higher GFP fluorescence ranging from 2.4- to 4.4-fold higher than AAV9. Capsids TR2 and TP1 had the highest GFP fluorescence. In day 225 old SCOs, all capsids had significantly higher fluorescence as well, ranging from 1.7- to 2.7-fold higher than AAV9, with capsids TH1 and TP1 providing the highest fluorescence (Figure 6C). Next, to determine whether the new capsids could transduce clinically relevant cell types in the human SCOs, we performed immunostaining on transduced day 225 old organoids for the following markers: NeuN for mature neurons and GFAP for astrocytes. Both the number of GFP-positive cells as well as their intensity was visibly increased for all four capsids compared with AAV9 and co-localization with astrocytes and neurons was observed (Figures 6D and 6E). We also observed SOX2, a neural stem marker, colocalization and internexin, a neurite marker, colocalization with transduced cells in the day 66 and day 225 old organoids, respectively (Figure S8). To assess transduction throughout the organoids, z stacks of confocal images were analyzed through multiple slices from the top (closest to the laser) to lower in the stack (Figure 6F). Visualization through the z stack showed obvious enhanced transduction throughout the organoids with all novel capsids compared with AAV9 (Video S1). We quantitated the fluorescence intensity starting at the top of the organoid (dorsal slices) and further down the image stacks (ventral slices). For all capsids except for NL1, peak fluorescence was observed in slice #2 and gradually decreased through slice #11. TR2 had the highest intensity, surpassing AAV9 by more than 8-fold in slice #2 (Figure 6G). This was likely an underestimate of enhancement, as pixel values were saturated for TR2 in several of the top sections, which indicate its robust transduction capacity. Interestingly, NL1 fluorescence intensity peaked in slice #5, with a 4.9-fold increase over AAV9 (Figure 6G). This may be due to high transduction into the core of the organoid (Video S1). We also performed counts of GFP positive cells in three slices in each organoid with one slice near the top of the confocal stack, one in the middle, and one near the end (the same slices were analyzed for each capsid). TR2 had the highest number of GFP-positive cells in the top and middle slices, being 2.9-fold and 2.1-fold higher than AAV9, respectively (Figure 6H). TH1 had the highest GFP-positive count at the bottom slice, being 2.1-fold higher than AAV9 (Figure 6H).Figure 6 NHP selected capsids transduce human SCOs more efficiently than AAV9

Organoid laboratory #1 (A) Schematic of experiment. A single-stranded AAV genome with a GFP expression cassette was packaged inside each of the top four candidate and AAV9 capsids and used to transduce human SCOs. (B) Representative whole organoid images showing intrinsic GFP expression (day 6 after transduction) by each capsid in younger and older organoids. (C) Quantitation of maximum projection images of all organoids per group (n = 4–6/capsid). (D and E) Colocalization of GFP with markers for neurons and astrocytes in day 225 old SCOs. (F) Schematic for quantitation of confocal z stacks to quantitate transgene expression throughout the organoids. (G) Fluorescence intensity taken at 35 μm intervals starting at the top of the imaging stack (280 μm total depth analyzed). (H) GFP-positive cell counts for each group taken from three slices near the top, middle, and bottom of the z stack. ∗p < 0.05; ∗∗p< 0.01; ∗∗∗p < 0.001; ∗∗∗∗p < 0.0001.

Video S1. Video displaying top to bottom confocal microscopy slices of GFP expression by AAV9 and each capsid variant in human spinal cord organoids

In the SCO laboratory 2, day 55 old SCOs were transduced with a lower dose/concentration of each capsid, 2.5 × 1010 vg/organoid and 2.5 × 1010 vg/mL. Serial live cell imaging was performed mean GFP fluorescence was calculated for transduced SCOs at days 1, 7, and 10 after transduction. GFP intensity increased greatly between day 1 and day 7 and was highest at day 10 for all capsids (Figure 7). At day 10, TR2 and NL1 had the highest mean fluorescence compared with AAV9 which were 4.7-fold and 4-fold, respectively (Figures 7A and 7B). Next, organoids were serially sectioned and imaged by confocal microscopy. Bright GFP-positive cells that colocalized with NeuN were detected for all capsids. The percentage of GFP-positive cells were counted in serial sections of SCOs. There was significantly enhanced (1.7- to 2.1-fold) transduction of SCOs by NL1 and TR2 compared with AAV9 (Figure 7C). We also quantitated AAV genomes in organoids incubated with each capsid and found gene transfer to be enhanced 1.9- to 2.1-fold compared with AAV9 (Figure 7D). Finally, we tested whether the enhanced transduction properties observed in the three-dimensional (3D) SCOs was observed in 2D cultures of human induced pluripotent stem cells (hiPSC)-derived motor neurons. At the tested dose, all capsids (including AAV9) efficiently transduced these cells (Figures 7E and 7F).Figure 7 NHP selected capsids transduce human SCOs more efficiently than AAV9

Organoid laboratory #2. (A) Representative immunofluorescent confocal images of SCOs transduced with AAV9 and AAV variants stained against GFP in green at day 55, 10 days after transduction (scale bar, 100 μm). (B) Quantification of mean GFP intensity in whole live organoids at days 1, 7, and 10. Day 7 GFP signal of NL1 and TR2 was increased in comparison with AAV9 (n = 2; p = 0.03 and 0.0059, respectively). Day 10 GFP signal of all AAV variants was superior to AAV9 (n = 2; NL1 p < 0.0001, TH1 p = 0.049, TP1 p = 0.0146, TR2 p < 0.0001). Quantifications were performed in three organoids per hiPSC line per capsid. The p values were calculated using two-way ANOVA with Bonferroni’s multiple comparison correction test. (C) Quantification of the percentage of GFP-positive cells in transduced organoids 10 days post transduction (n = 2). Quantifications were performed in 5–7 organoids between both hiPSC lines, with more than 5,000 DAPI nuclei included. (∗p < 0.05; ∗∗p < 0.01). The p values were calculated using nested one-way ANOVA with Bonferroni’s multiple comparison correction test. (D) Quantification of AAV genomes in organoids 10 days after transduction (n = 2). Three organoids per hiPSC line per capsid were pulled to perform DNA isolation. (∗p < 0.05; ∗∗p < 0.01). (E and F) Quantification of the percentage of GFP-positive ISL1+ motor neurons in transduced monocultures 6 days after transduction. Representative image of motor neurons transduced with NL1 is shown in (E). Quantifications were performed with 2× images per coverslip per hiPSC line per capsid; one coverslip per line, with more than 175 ILS1+ neurons included. No statistical significance was reach using nested one-way ANOVA with Bonferroni’s multiple comparison correction test. (E) Scale bar, 50 μm.

NHP-selected capsids transduce murine spinal cord after IT injection

Since the selection of the library was performed in NHPs, it is likely that the transduction profile would be more efficient in this species compared with rodents. However, since most neurological models of human disease are developed in transgenic mice, it would be convenient for preclinical development if the NHP-selected capsids were also functional in mice. To assess whether the AAV capsids selected in NHP were backward compatible, adult 6- to 8-week-old C57BL/6 mice were injected IT in the lumbar region individually with either AAV9, NL1, TH1, TP1, or TR2. AAV capsids packaged a single-stranded AAV-CBA-eGFP genome. Four weeks later, we harvested spinal cords to perform quantitation of GFP concentrations for each group. Caudal and rostral spinal cord segments were homogenized and a GFP ELISA was conducted. We compared the average GFP concentrations in spinal cord for the four candidate capsids with AAV9. Interestingly, both TH1 and TR2 had higher concentrations of GFP compared with AAV9 (data not shown). In a separate cohort of mice (n = 5 mice/capsid), the same dosing scheme as above was performed. Four weeks after injection, mice were euthanized, and spinal cords and livers were harvested and cryosectioned. All capsids were able to transduce both neurons and glia (data not shown).

Discussion

While AAV9 has been successfully developed for transgene delivery to the spinal cord to treat the neuromuscular disease, SMA,21 there is room for improvement. When delivered at high systemic doses, AAV vectors can cause liver enzyme elevation, complement activation, thrombotic microangiopathy, and even sepsis, organ failure, and death.4,22 Although immunosuppressive and modulatory regimens may mitigate some of these serious adverse events,23 these pharmacological interventions are not without risk and may not be feasible or effective in all patients. Thus, much recent research is focused on developing AAV gene therapies for CNS disorders using a CSF route of administration.

Delivery of AAV directly into the CSF has been shown to decrease exposure to the neutralizing antibodies that are present at much lower levels than in blood.24 While there is less systemic exposure to vector than a systemic route of administration, there is still a large amount of vector that can enter the blood and peripheral organs after CSF injection. A recent study performed lumbar IT injection of NHPs and measured vgs in CNS and peripheral tissues 4 weeks after injection.12 Remarkably, liver received more than 100 times the number of AAV genomes compared with the brain and approximately 10 times more than the spinal cord after lumbar IT injection.12 Furthermore, transgene expression was higher in the liver and heart compared with spinal cord.12 Other studies using radiolabeled AAV capsids injected into the CSF of NHPs—including AAV9—has demonstrated that up to approximately 90% of administered capsid can enter the periphery.13,25 Obviously, this high off-target biodistribution runs completely counter to the intent of a direct CSF administration. Transduction of liver after IT injected AAV is more than just a theoretical risk for toxicity. Recently, it was found that both intravenously and IT-injected AAV9 encoding a self-complementary GFP or SMN1 transgene cassette resulted in hepatotoxicity as measure by liver enzyme elevations and chemistry, histopathology, cytokines, and complement activation.14 Immunosuppression with prednisolone or rituximab/everolimus was not able to mitigate these effects, suggesting that current pharmaceuticals will not suffice.14 Interestingly, the researchers found that AAV transduction needed to occur, as empty capsids and promoterless transgene cassettes did not result in toxicity.14 The most straightforward way to avoid transgene expression in the liver is to either avoid biodistribution to liver using engineered capsids like the ones described in our study or restrict transgene expression away from the liver using tissue specific promoters26 or miRNA-based transgene mRNA degradation.27,28

There has been an intense effort in recent years by several groups, including ours, to identify capsids that cross the BBB after they transduce brain parenchyma after systemic injection.16,29,30 Interestingly, selection of AAV peptide display libraries via this route of administration has resulted in capsids that target very specific (likely transcytotic) receptors on the endothelium, such as Ly6a and Ly6c in mice19,31 and ALPL in NHPs.32 However, the selective pressures on an AAV library are likely quite different between a systemic and an IT route of administration. Our work is, to our knowledge, the first selection of an AAV peptide display library in NHPs using the IT route. Remarkably, the majority of the top capsids identified in our selection showed greatly reduced biodistribution (up to 1,250-fold less frequent reads) and transduction (up to 30,000-fold less frequent reads) in liver compared with AAV9. Most of the capsids also had lower biodistribution to heart, which suggests lower peripheral circulation of these capsids compared with AAV9. This desirable feature may allow for less toxicity observed with liver transduction, although this will need to be confirmed by testing with individual capsids encoding transgenes of interest in investigational new drug (IND)-enabling toxicology studies in NHPs. They also showed increased persistence/biodistribution in the spinal cord, with up to 265-fold, 30-fold, and 10-fold higher vgs in lumbar, thoracic, and cervical regions, respectively (Figure 4). Furthermore, the top candidate capsids were more efficient than AAV9 (up to 3.5-fold in one of the two NHPs) at spinal cord transduction at the RNA level (Figure 5B). This latter outcome may have been influenced by the selection approach. To enable detection of transgene expressing cells during the selection rounds, we made some modifications to our prior reported iTransduce system16 to allow its use in non-transgenic animals. To do this, we used a two-vector system with the library encoding Cre recombinase as usual and the second vector packaging the Cre-inducible reporter (Floxed-STOP-H2B-mPlum). Using this system, we were able to flow sort H2B-mPlum fluorescent nuclei that applied additional selective pressure to identify transduction-competent capsids. The reporter capsid (AAV9 in our case) likely influences the selection outcome, as fluorescent nuclei are restricted to cells that can be transduced by AAV9. In our study, this was a benefit and something we desired, as we wanted to maintain the tropism of AAV9 in the spinal cord (glia and neurons), while improving transduction efficiency and biodistribution. However, if other cell types outside the tropism of AAV9 are desired as targets, this approach may not be feasible, or a different capsid packaging the reporter gene that can transduce the target cell would need to be utilized. That said, we did account for the fact that we may miss some effective capsids using this two-vector approach. Therefore, in the second round, in addition to the H2B-mPlum nuclei selection, we also harvested DNA from all three levels of the spinal cord using a conventional, whole tissue isolation approach that was independent of AAV9 co-transduction. We chose six peptides from this isolation approach (DH1, DK1, DP1, DR1, DR2, and DV1) and tested them in the pooled barcoded screen along with the other candidates.

We made several interesting observations during the study. First, many of the peptides had distinct motifs (even across the selection methods) such as LP, XTT, and RALP in the 7-mer sequence, which may be important in their enhanced biodistribution in the spinal cord compared with AAV9 (Figure 4D). Second, we found that the capsids isolated from nuclei or from nuclei in transduced cells had higher levels of transduction (RNA-based reads) compared with capsids identified from the whole-tissue isolated DNA (Figure 5B). Whole tissue isolation is likely to contain AAV genomes that may be outside the cell (still inside capsids) or nucleus or not uncoated in the nucleus (i.e., not transcriptionally active). In contrast, nuclear isolation and transgene-based selection is at or close to the final steps of transduction. While this observation was based on a limited number of capsids from each method, owing to a limit of capsids that we could test by barcoding, it does suggest, in line with other reports,16,29,30,33 that selection as far downstream in the transduction process as technically feasible is likely to yield capsids capable of transduction. It is interesting that two of five of the mPlum-selected peptides were detected in the NGS reads for analysis of whole tissue isolated peptides (Figures 3A and 3B). However, they were at low frequency compared with the top peptides from this isolation, which again may indicate that selecting for one parameter (AAV genome presence in a tissue) does not necessarily indicate the most efficient capsid for transgene expression.

While we did observe capsids that appear more efficient than AAV9 at both the biodistribution (DNA) and transduction (RNA) levels, the fold differences for RNA were much lower than for DNA. This could be due to several reasons. First, because we did a pooled injection, with strict volume limitations imposed by IT injections, the injected dose of vector was quite low (4.48 × 1012 vg), with most capsids represented at only 4 × 1011 vg each, so transgene RNA levels were quite low in spinal cord (see RT-qPCR) (Figure 5A), which could only be reliably detected in the lumbar region. We could not assess the transduction in the thoracic or cervical regions due to low transgene cDNA levels. This dose of the pooled library is approximately 3- to 10-fold lower than what is typically delivered for therapeutic IT dosing studies in NHPs and 30- to 100-fold lower at the individual capsid level. At this low dose, the amount of AAV genomes available to concatemerize to allow robust expression may have been too low, near the limit of detection. In the future, it may be advisable to test the candidate capsids packaging a barcoded self-complementary AAV genome to maximize the detection of mRNA expressed from low-dose pools of capsids. Similarly, for future testing of our top candidate capsids in NHPs, using a self-complementary AAV genome may allow increased sensitivity of reporter gene expression as was utilized in a recent study with engineered BBB-penetrating capsids.32 As an interim step prior to future testing in NHPs, we tested the capsids for transduction of human SCOs. Human organoid systems are being pursued as preclinical models for drug and gene therapy testing, including AAV vectors.34,35,36,37 Here, we used SCOs to assess the cellular tropism and transduction efficiency and potency of our selected candidates compared with AAV9. We observed that our selected capsids had higher transgene expression efficiency (in both the number of cells transduced, 2-fold, and the level of transgene product, up to 8-fold, compared with AAV9). We also found that the candidates could transduce motor neurons and glia, two of the major clinically relevant cell types for spinal cord gene therapy. These data should be impactful for the field; they demonstrate that capsids selected with desired properties in NHPs were effective in a 3D human organoid preclinical model. The human organoid model could serve important roles in the preclinical development of gene therapy. First, they could help to narrow down the list of candidates from initial pooled barcoded AAV screens in NHPs. The human SCO data helped us to narrow our top candidates to TR2 being the lead for further expensive NHP testing. Additionally, the organoids containing disease-specific mutations could serve in parallel to test therapeutic outcomes of AAV’s encoding therapeutic cargo (a feature the NHP model does not provide). Overall, for the work described here, the human SCO served to validate the capsids that we had chosen from our NHP selections were potent at transduction of clinically relevant cells. Furthermore, these new capsids should serve as very useful gene delivery tools for basic biology studies in SCOs. Additionally, the capsids efficiently transduced human iPSC-derived motor neurons, so they can be utilized in gene delivery experiments in this system as well.

Of course, in future validating IND-enabling studies, one or more of these candidates along with AAV9 should be injected individually in NHPs at a higher dose and packaging an optimized transgene expression cassette (such as with a self-complementary genome as mentioned above), and careful stereological quantitation of transduced cells should be performed.

While not a primary objective of the study, we also assessed AAV-encoded DNA barcode frequency for the pooled capsids in brain and peripheral nerves. From these data, certain capsids seem to outperform AAV9 in biodistribution to certain brain regions and nerves. This includes capsid DH1 in brain and DH1, DP1, and DR2 in nerves. It may be of future interest to test these individual capsids in NHPs after IT injection to assess transduction of brain and nerves. Furthermore, based on the increased biodistribution observed with some of these capsids, testing them via alternative CSF delivery routes in NHPs such as into the cisterna magna or intracerebroventricular injection may also be worthwhile.

An advanced capsid for IT spinal cord delivery requires properties that address multiple parameters of gene delivery including enhanced biodistribution throughout the tissue, transduction of target cells (e.g., motor neurons), and reduced off target biodistribution to the periphery. Taking a complete view of our data, we believe the identified capsids, in particular TR2, fulfill these features and should be considered leading preclinical candidates for spinal cord gene therapy.

Methods

Animal experiments

Animal studies were performed at Biomere-Biomedical Research Models (Worcester, MA, USA) according to animal use guidelines and approved procedures. The Test Facility is accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care, International and registered with the United States Department of Agriculture to conduct research in laboratory animals.

NHPs

A total of four cynomolgus monkeys (Macaca fascicularis) were used in this study (see Table S1 for complete animal information).

Cell culture

Human 293T cells were obtained from American Type Culture Collection (Manassas, VA, USA). Cells were cultured in high glucose Dulbecco’s modified Eagle’s medium containing HEPES (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) (Sigma, St. Louis, MO, USA) and 100 U/mL penicillin, 100 μg/mL streptomycin (Invitrogen) in a humidified atmosphere supplemented with 5% CO2 at 37°C.

AAV plasmid constructs

The iTransduce plasmid, pAAV-CBA-Cre-mut/p41-Cap9 (containing the insert with 7mer peptide sequences) has been previously described.16 pAAV-CBA-Floxed-STOP-H2B-mPlum plasmid was constructed by digesting the AAV ITR containing plasmid, AAV-CBA-WPRE, after the CBA promoter with HindIII and NheI restriction sites. A DNA fragment for a floxed transcription stop transcription site (three copies of SV40 late poly A sequence) followed by a H2B protein fused to mPlum was synthesized by Genscript (Piscataway, NJ, USA) and inserted into pUC57-Kanamycin plasmid. Next pUC57-Kan with Floxed-STOP-H2B-mPlum was digested with HindIII and NheI and inserted into the above digested AAV plasmid to create pAAV-CBA-Floxed-STOP-H2B-mPlum (plasmid electronic map available upon request).

pAAV-CBA-hFrataxin-HA-BC-WPRE plasmid was constructed by digesting the AAV transgene expression plasmid, pAAV-CBA-GFP, with AgeI and NheI to remove the GFP cDNA fragment. A double-stranded DNA gBlock fragment was ordered from Integrated DNA Technologies (IDT, Coralville, Iowa, USA) which contained human frataxin cDNA fused with a hemagglutinin (HA) tag on its C-terminus. This fragment was inserted into the pAAV plasmid above using the Gibson Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). This base plasmid, pAAV-CBA-hFrataxin-HA was used as the acceptor plasmid to insert barcode fragments downstream of the HA sequence (plasmid map available on request). To insert the unique DNA/RNA barcode sequences into the base plasmid, pAAV-CBA-hFrataxin-HA was digested with XhoI. Next, we ordered double stranded DNA gBlock fragments (130 bp) from IDT which had unique 21mer bp barcodes (for 14 capsid candidates as well as AAV9) with flanking homology arms. These 15 different barcodes were individually cloned into the XhoI-digested pAAV-CBA-hFrataxin-HA plasmid using Gibson Assembly as before. Each barcoded pAAV-CBA-hFrataxin-HA plasmid was complete-plasmid sequenced at PlasmidSaurus (Eugene, OR, USA). AAV9 capsid candidates containing unique 7mer peptides were individually cloned into the AAV9 rep/cap plasmid, pAR9, as previously described.16 The plasmid AAV-CBA-GFP has been previously described38 and was used in the individual capsid comparisons in mice and in human SCOs. This AAV expression plasmid encodes a single stranded AAV genome with inverted terminal repeat-flanked transgene cassette with a cytomegalovirus I/E enhancer, chicken beta actin promoter, a chimeric intron, a woodchuck hepatitis virus post-transcriptional regulatory element, and tandem bovine growth hormone (BGH) and SV40 polyA signal sequences.

AAV library production

Production of the AAV9 iTransduce library was performed as previously described16 with some changes. Fifty tissue culture dishes (15 cm in diameter) were used (1.5 × 107 293T cells seeded per plate), with cells cultured in DMEM containing 10% FBS and 100 U/mL penicillin, 100 μg/mL streptomycin, and 292 μg/mL L-glutamine (Invitrogen). Twenty-four hours after plating, cells were triple transfected using a polyethylenimine (PEI) transfection reagent, adding to each 15-cm plate: pAAV-CBA-Cre-mut/p41-Cap9 (containing the insert with 7mer peptide sequences; 200 ng), pAR9-Cap9-stop/AAP/Rep (provides rep in trans; 7 μg), and pAdΔF6 (helper plasmid; 15 μg), and sheared salmon sperm DNA (6 μg). Seventy-two hours after transfection, AAV was isolated from a pool of clarified cell lysate and polyethylene glycol (PEG)-precipitated vector from the conditioned media. The pooled virus was then purified by iodixanol density-gradient ultracentrifugation. Buffer exchange to PBS containing 0.001% Pluronic F-68 (Gibco, Grand Island, NY, USA) was done using ZEBA spin columns (7K MWCO; Thermo Fisher Scientific, Waltham, MA, USA) and further concentration was performed using Amicon Ultra 100 kDa MWCO ultrafiltration centrifugal devices (Millipore, Burlington, MA, USA). We quantified AAV vgs in AAV preparations using TaqMan qPCR with BGH polyA-sequence specific primers and probe.39 Endotoxin for both vector preparations was determined to be less than 1 EU/mL using Endosafe LAL Cartridges and the Endosafe nexgen PTS device (Charles River, Charleston, SC, USA). Vector purity was assessed by silver staining of SDS PAGE gels in which 1 × 1010 vg of each vector was run/lane. The purity of both preparations were greater than 90%. Vector was stored at −80°C until use.

AAV9-CBA-floxed-STOP-H2B-mPlum production

This vector was produced, purified, and titered by Vector Biolabs (Malvern, PA, USA). Endotoxin level was less than 1 EU/mL.

Barcoded AAV capsid candidate production

We individually packaged the AAV-CBA-hFrataxin barcoded genome in each capsid candidate and the AAV9 capsid. For each vector we transfected five tissue culture dishes (15-cm diameter, 1.5 × 107 293T cells seeded per plate), with cells cultured in DMEM containing 10% FBS and 100 U/mL of penicillin, 100 μg/mL streptomycin, and 292 μg/mL L-glutamine (Invitrogen). Twenty-four hours after plating, cells were triple transfected using PEI transfection reagent, adding to each 15-cm plate: pAAV-CBA-hFrataxin-HA-barcode (6 μg), pAR9-peptide of interest (7 μg), and pAdΔF6 (helper plasmid, 15 μg). Seventy-two hours after transfection, AAV was isolated from a pool of clarified cell lysate and PEG-precipitated vector from the conditioned media. The pooled virus was then purified by iodixanol density-gradient ultracentrifugation. Buffer exchange to PBS containing 0.001% Pluronic F68 (Gibco) was done using ZEBA spin columns (7K MWCO; Thermo Fisher Scientific) and further concentration was performed using Amicon Ultra 100 kDa MWCO ultrafiltration centrifugal devices (Millipore). We quantified AAV vgs in AAV preparations using TaqMan qPCR with BGH polyA-sequence-specific primers and probe.39 We next pooled the barcoded vectors and endotoxin was determined to be less than 1 EU/mL using Endosafe LAL Cartridges and the Endosafe nexgen PTS device (Charles River). Pooled vector purity was assessed by staining SDS-PAGE gels with GelCode Blue (Thermo Fisher Scientific) in which 1 × 1011 vgs were run/lane. The purity of both preparations was greater than 90%. Vector was stored at −80°C until use.

AAV capsid production for human SCO transduction

AAV production was identical to that described in Barcoded AAV capsid candidate production above, with the exception that the expression plasmid was AAV-CBA-GFP (this encodes a single-stranded genome). The Maguire laboratory produced, purified, and titered the vectors used in the mouse study and the SCO experiments in the Heine laboratory. The Sun laboratory produced, purified, and titered the vectors used in the SCO experiments conducted in their laboratory.

NHP library selection

Animals were considered acclimated to the environment at the time of transfer to the study. Prior to the study, serum from each animal was tested for neutralizing antibodies to AAV9 by the University of Pennsylvania Gene Therapy Program Immunology Core run by Dr. Jessica Chichester. Titers for all animals were at or below 1:5.

Round one selection

On day 0, the animal received an IT dose of unselected AAV library as appropriate to group (per the study design Table S1). The dose volume injected was 0.74 mL and vector dose of 9 × 1011 vg. The animal was given buprenorphine (0.03 mg/kg, intramuscularly [IM]) and meloxicam (0.2 mg/kg, subcutaneously [SC]) prior to the procedure for the purpose of analgesia. The animal was sedated with ketamine 7.5–12 mg/kg and dexdomitor 0.01–0.03 mg/kg mixture, IM; atipamezole (0.1–0.3 mg/kg, IM) was used for reversal. The animal was positioned in lateral recumbency while on a circulating warm water blanket and/or forced warm air blanket during the procedure. The head was kept in line with the spine and the hips and shoulders were perpendicular to the table. The lower back was arched to increase spacing between the spinous processes. The lumbosacral region (the area over ∼L4/5 for cynomolgus) was clipped and aseptically prepared utilizing three alternating scrubs of either povidone iodine or chlorhexidine scrub solution and sponges soaked in 70% isopropyl alcohol. A line block (i.e., lidocaine/bupivacaine) ∼0.20–0.50 mL, SC was administered at the lumbar puncture site. A final application of ChloraPrep or appropriate antimicrobial was applied to the puncture site and allowed to dry.

The wings of the ileum were palpated to provide anatomical landmarks. The two spinous processes were identified, and in between which the spinal needle (22G × 1.5″) was introduced. The skin was penetrated and the needle slowly advanced. After confirmation of placement in the IT space, ∼0.5 mL of CSF was removed prior to dose administration. Next, the AAV vector was slowly administered over 1–2 min. After administering the dose, the syringe and needle was left in place for ∼5 s; after removal, pressure applied to the injection site. Parameters were observed constantly throughout the procedure including heart rate, respiratory rate, and oxygen saturation. Animals were recovered from anesthesia and moved to a recovery area, placed on a circulating warm water blanket and/or forced warm air blanket, and covered with a dry towel. Animals were observed after the procedure and kept in the recovery area until the animal was conscious and able to hold itself in a sitting position. Animals were then transported to their home cage. Approximately 2 h after vector dosing, animals were immunosuppressed with IM dosing of 0.5 mg/kg of dexamethasone, which continued daily until necropsy at day 21.

Round two selection

The IT injection and animal care was identical to round one with the following changes. First, the animal was lumbar-injected with the recovered and packaged round one library at a dose of 2 × 1011 vg in a volume of 0.6 mL. CSF was collected before injection. Three hours later, the animal was IT-injected in a different lumbar region than the first dose with 3 × 1013 vg of AAV9-CBA-FLOXED-STOP-H2B-mPlum vector in a total volume of 0.6 mL.

NHP necropsy and tissue processing

On day 21 ± 1 day, animals were anesthetized with ketamine 7.5–12 mg/kg and dexdomitor 0.01–0.03 mg/kg mixture. Nembutal was administered at 15–30 mg/kg. Once deeply anesthetized, the animal was perfused via left cardiac ventricle with cold heparinized (100 U/mL) saline until the outflow ran clear. Approximately 1 L of heparinized saline was used with a perfusion pump set to ∼400 rpm. Euthanasia was performed per AMVA guidelines. For rounds 1 and 2, flash frozen samples were collected for the entire spinal cord and brain and stored at −80°C.

DNA isolation from NHP tissue during selection rounds

Whole tissue isolation

Spinal cord samples (0.5–1 cm in length) were homogenized using 1.4-mm ceramic beads in a BeadBug tissue homogenizer (Benchmark Scientific, Sayreville, NJ, USA) in buffer ATL of the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany). After homogenization, we followed the manufacturer’s instructions to purify DNA. DNA concentration was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific).

Nuclei isolation and flow sorting

Spinal cord samples were dissociated using a GentleMACS Dissociator (Miltenyi Biotec, Westphalia, Germany) using Nuclei Extraction Buffer (Miltenyi Biotec) and homogenate filtered through a 30 μm Smart Strainer (Miltenyi Biotec). Nuclei were next purified using a 30% OptiPrep iodixanol (Axis-Shield, Oslo, Norway) gradient (iodixanol serves to purify away cellular debris and the nuclei are pelleted to the bottom of the tube). The homogenate containing nuclei was layered directly on top of the 30% iodixanol gradient and centrifuged at 10,000×g at 4°C for 30 min in a fixed angle rotor (FA-45-6-30, Eppendorf, Enfield, CT, USA). The gradient was carefully aspirated leaving the nuclei pellet in the tube. Nuclei were resuspended in 500 μL cold PBS. Next nuclei were labeled with Vybrant DyeCycle Violet Stain (Thermo Fisher Scientific) and were sorted on a BD FACS Aria II Cell Sorter (Becton Dickinson, Franklin Lakes, NJ, USA). First, violet stain positive nuclei were gated on (PI) using Pacific Blue-A laser. Then, singlets were selected using FSC-A and FSC-H axes (P2). Finally, we selected mPlum-positive nuclei using a PE-Cy5-A laser. Nuclei (mPlum-positive or -negative) were sorted into tubes and stored at −80°C until DNA isolation. For DNA isolation, we used the Arcturus PicoPure DNA Extraction Kit (Thermo Fisher Scientific).

NGS of library

NGS was performed on the plasmid AAV9 library pool, as well as following packaging of capsids. Before injection, packaged naive library was amplified by PCR and sequenced at a depth of ∼105 reads to ensure adequate read depth and a lack of bias. Minimum requirements were more than 95% unique variant reads, and no single variant appearing in more than 10 sequencing reads. Sequencing was also performed following PCR rescue of the cap gene fragment (either from NHP spinal cord tissue or from nuclei sorted by flow cytometry). For each round of selection, vector DNA corresponding with the insert-containing region was amplified by PCR using either Phusion High-Fidelity enzyme or Q5 polymerase (both from New England Biolabs using Forward primer: 5′-AATCCTGGACCTGCTATGGC-3′, and reverse primer: 5′-TGCCAAACCATACCCGGAAG-3′). PCR products were purified using a QIAquick PCR Purification Kit (Qiagen). Unique barcode adapters were annealed to each sample, and samples were sequenced on an Illumina MiSeq (150-bp reads) at the Massachusetts General Hospital Center for Computational and Integrative Biology DNA Core. Approximately 50,000–100,000 reads per sample were analyzed. Sequence output files were quality checked initially using FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and analyzed on a program custom-written in Python. Briefly, sequences were binned based on the presence or absence of insert; insert-containing sequences were then compared with a baseline reference sequence and error-free reads were tabulated based on incidences of each detected unique insert. Inserts were translated and normalized.

NHP candidate barcoded library screen

Two adult male cynomolgus monkeys (see Table S1 for NHP information) were IT-injected in the same manner as for the selection, except with 4.48 × 1012 vg of the pooled barcoded capsids. Three weeks later, animals were perfused with sterile heparinized saline. Samples for DNA and RNA extraction were immediately frozen on dry ice and stored at −80°C.

DNA and RNA isolation from NHP whole tissue for barcoded AAV capsid candidates

DNA isolation

Spinal cord (and other tissue) samples (0.5–1 cm in length) were homogenized using 1.4-mm ceramic beads in a BeadBug tissue homogenizer (Benchmark Scientific) in buffer ATL of the DNeasy Blood and Tissue Kit (Qiagen). After homogenization, we followed the manufacturer’s instructions to purify DNA. DNA concentration was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific).

RNA isolation

Spinal cord (and liver samples) was placed into Qiazol (Qiagen) and subjected to homogenization with 1.4 mm ceramic beads in a BeadBug tissue homogenizer (Benchmark Scientific). After performing a phenol/chloroform extraction of RNA, the RNA was precipitated using isopropranol and centrifugation, followed by a 75% ethanol wash. The RNA pellet was resuspended in RNase-free water and stored at −80°C until further processing. The RNA sample was further purified using RNeasy spin columns (Qiagen) and the sample was eluted in RNase-free water. Next residual DNA contamination was removed using DNaseI treatment with a DNA-free kit (Ambion by Life Technologies, Carlsbad, CA, USA). cDNA was synthesized from RNA (approximate input 500 ng RNA) using the SuperScript IV VILO Master Mix reverse transcriptase (RT) kit (Thermo Fisher Scientific). For each sample, we did a control where the RT enzyme was left out to ensure the PCR amplicons originated from RNA and not contaminating DNA in the RNA samples.

Quantitative PCR to measure absolute amounts of AAV genomes and transgene mRNA in spinal cord of pooled AAV injection in NHPs

DNA and RNA isolation and cDNA synthesis from NHP spinal cord were performed as described immediately above. To determine the amounts of AAV vgs or transgene expression (frataxin-HA) we used the same Taqman probes and primers targeting BGH polyA used to titer our AAV vectors. For AAV vgs, we used a standard curve with an AAV plasmid to perform absolute quantitation. We used 54 ng genomic DNA template from lumbar, thoracic, and cervical spinal cord as input for the qPCR. A separate qPCR reaction for each sample was performed to detect the NHP gene UBE2D2 (ubiquitin-conjugating enzyme E2 D2) using the Taqman Gene Expression Assays 20× mix (Catalog #4351372, assay ID Mf07285893_s1, Thermo Fisher Scientific). AAV genomes were inferred from the AAV plasmid standard curve and adjusted to AAV genomes/μg of genomic DNA. For each AAV genome sample we calculated the 2ΔCt (sample Ct – sample with lowest Ct) of the UBE2D2 qPCR sample and then normalized the AAV genomes to that value. This compensated for DNA input differences for each sample.

For the RT-qPCR samples, we used the AAV plasmid as a standard curve as above to calculate absolute amounts of cDNA. We used 1 μL of the RT reaction from mRNA isolated from NHP lumbar spinal cord as template for the qPCR. A separate qPCR reaction for each sample was performed to detect the NHP cDNA of GAPDH (glyceraldehyde-3-phosphate dehydrogenase) using the Taqman Gene Expression Assays 20× mix (assay ID Mf04392546_g1, Thermo Fisher Scientific). This probe spans exons, so it is selective for cDNA detection over genomic DNA. cDNA values for AAV transgene were normalized to the respective GAPDH Ct values for each sample to control for differences in input total cDNA. All qPCR reactions were performed in a 7500 FAST qPCR system (Applied Biosystems).

Quantitative PCR to measure absolute amounts of AAV genomes in SCOs

We used the same protocol as above with for Quantitative PCR to measure absolute amounts of AAV genomes and transgene mRNA in spinal cord of pooled AAV injection in NHPs with the following modifications. DNA was extracted and purified from organoids using a phenol/chloroform protocol. The same Taqman probe and primer set described above was used for AAV genomes. For human cDNA detection used for normalization we used a probe and primer set specific for the human ubiquitin-conjugating enzyme E2 D3 (UBE2D3) Taqman Gene Expression Assays 20× mix (Assay Id Hs00704312_s1, Thermo Fisher Scientific).

PCR to amplify barcodes for NGS

For both the DNA and RNA samples from the pooled barcoded library injected NHPs, we used the following reagents. A PCR using either the DNeasy-purified DNA or the cDNA from the RT reaction as template was performed (150 ng DNA template input). We used Q5 polymerase (NEB, Ipswich, MA, USA) and primers that amplify a 182 bp amplicon which contains the unique barcode for each capsid. Primers were: SC-Lib-Fwd (5′ GATGCTTACCCTTACGACGT 3′) and SC-Lib-Rev (5′ CAGCGTATCCACATAGCGTA 3′). The PCR product was purified using the PureLink PCR Purification Kit (Thermo Fisher Scientific) and samples were submitted for NGS as described above. We initially sequenced an aliquot of the pooled barcoded library to ascertain the precise frequencies of the barcoded variants on input. Output frequencies in all tissues were normalized to these initial ratios. Insert-containing sequence reads were binned using Hamming distance, compared with the known barcode sequences; additional quality control was undertaken to ensure only true barcoded reads were assigned to each capsid.

SCOs

Sun lab (organoid laboratory #1)

Production of SCOs and transduction

SCOs were generated as previously described.40 hESCs (H9) were grown in the mTeSR1 (Stem Cell Technologies, Vancouver, Canada) medium in 35 mm-diameter tissue culture dishes coated with Matrigel (Corning, 354277; 1:25 in DMEM/F12). hESCs were detached from 35-mm-diameter dishes using ReLeSR (Stem Cell Technologies), and cell aggregates in mTeSR were added to each well of a 12-well micropattern plate. The following day, mTeSR medium was replaced with the neural cell induction medium (DM, DMEM/F12, 1% N2 supplement, 2% B27 supplement, 1% NEAA, 1% penicillin, and 0.1% 2-mercaptoethanol) containing 10 μM SB431542 (R&D) and 3 μM CHIR99021 (Sigma), and was subsequently replaced every day. After 3 days, colonies were detached using the pressure of a cell recovery solution (Corning, Cat#.354253) from the pipette under a stereoscopic microscope and transferred into an Ultra-Low Attachment 96-well clear round bottom plate (Corning-Costar). Further, they were further grown in 3D with DM containing 20 ng/mL basic fibroblast growth factor (bFGF). After 6 days of bFGF treatment, 3D structures were grown without bFGF in the neural cell induction medium, and further grown in mixture of neurobasal medium and DM. After 30 days, organoids were transferred to six-well plate and grown while shaking at 80 rpm. For AAV transduction, organoids of 66 days or 225 days were transferred into an Ultra-Low Attachment 96-well plate. We added 35 μL of 1.17 × 1011 gc of AAV in PBS containing 10% sucrose to each organoid.34 After 1-h incubation at 37°C incubator, the organoids were transferred to 6 well plate and incubated while shaking at 80 rpm. After 6 days, live images of each organoid were taken in 5- μm steps along the z axis using confocal microscope (Leica Microsystems, Wetzlar, Germany, TCS SP8 confocal microscope). Stacked images using z stack maximal projection were used for quantification using ImageJ.

Immunostaining

SCOs were fixed using 4% paraformaldehyde in 0.1 M PBS (pH 7.4) for 1 h at 25°C. Organoids were washed three times with PBS and incubated with 30% sucrose in PBS at 4°C overnight, embedded in Tissue-Tek Optimal Cutting Temperature (OCT Compound, Sakura, Torrance, CA, USA), frozen on dry ice, and cryosectioned. Sliced samples on New Silane IIWE coating slide (Muto Pure Chemicals, Tokyo, Japan) were blocked with 0.2% Triton X-100 with 3% BSA in PBS for 30 min at 25°C. Subsequently, samples were incubated with primary antibodies in a blocking buffer overnight at 4°C. Samples were washed three times with PBST (0.2% Triton X-100 in PBS) and incubated with secondary antibodies, with Hoechst for cell nuclei staining (1:2,000), in the blocking buffer for 1 h at 25°C. After washing with PBST, samples were mounted in Crystal Mount (Biomed, San Diego, CA, USA) and imaged using a confocal microscope (Leica TCS SP8 confocal microscope).

Antibodies

GFP (1:2000, Abcam, ab13970).

NeuN (1:1000, Synaptic systems, 266 004).

Internexin (1:1000, Novus, NB200-140).

SOX2 (1:500, Millipore, AB5603).

GFAP (1:1000, DAKO, z0334).

Fluorescence intensity measurement

To quantify the fluorescence throughout the organoid samples the original TIFF files were loaded into ImageJ and the channels were split into two windows. For each window (DAPI and GFP) the Slice Keeper (Image>Stacks>Tools>Slice Keeper) function was used to extract every seventh slice from the stacks. The brightness and contrast for the DAPI stack was adjusted to be able to visualize the whole perimeter of the organoid for each slice while all the slices in the GFP stack were set to the same minimum and maximum displayed value (minimum, 12; maximum, 54). To use the DAPI channel as the region of interest the windows needed to be synchronized (Analyze>Tools>Synchronize Windows). After synchronizing the windows, the freehand selection cursor was used to outline the signal of the DAPI channel. The following measurements were acquired: area, mean gray value, minimum and maximum gray values, and integrated density. All data were saved in Excel spreadsheets.

Cell counting

We counted GFP-positive cells in the confocal z stacks images for three organoids/capsid. We used the Cell Counter Plugin. For each sample we counted GFP-positive cells in the 7th, 25th, and 49th slices of the z stack. All GFP-positive cells were manually selected in each slice and counted with the software and exported into Excel spreadsheets.

Heine lab (SCO laboratory #2)

SCO generation

SCOs were generated from hiPSCs as previously described41 with the following modifications. In short, hiPSC colonies cultured on vitronectin (Stem Cell Technologies, #7180) and in TeSR-E8 medium (Stem Cell Technologies, #5940) were dissociated with Accutase (Merck, Rahway, NJ, USA, #SF006) at 37°C for 7 min, made into a single-cell suspension, and 9,000 cells were plated into individual ultra-low attachment U-bottom 96-well plates (Corning, #CLS7007) in 150 μL TeSR-E8 medium (Stem Cell Technologies, #5940) supplemented with ROCK inhibitor (10 μM; Selleckchem, Houston TX, USA, #S1049) and FGF2 (4 ng/mL; Peprotech, Cranbury, NJ, USA, #AF-100-18B). On day 2, 150 μL TeSR-E8 medium supplemented with the two SMAD inhibitors dorsomorphin (2.5 μM; Selleckchem, #S7306) and SB431542 (10 μM; Selleckchem, #S1067) was added. Two-thirds of this medium was refreshed daily for the next 5 days, supplementing with CHIR 99021 (3 μM; Cayman Chemicals, Ann Arbor, MI, #13122) from day 6 to day 20. On day 7, medium was changed to Neural Maintenance Medium (NMM) consisting of 1:1 DMEM/F12 (Thermo Fisher Scientific, #11330) and Neurobasal Medium (Thermo Fisher Scientific, #10888) supplemented with 0.5% N2 (Thermo Fisher Scientific, #175020), 1% B27 (Thermo Fisher Scientific, #17504), human insulin (5 μg/mL; Merck, #I9278), L-glutamine (1.5 mM; Thermo Fisher Scientific, #25030), non-essential amino acids (100 μM; Thermo Fisher Scientific, #11140), β-mercaptoethanol (10 μM; Thermo Fisher Scientific, #21985023), and penicillin-streptomycin (100 U/mL; Thermo Fisher Scientific, #15140), and supplemented with EGF (20 ng/mL; Peprotech, #AF-10015), FGF2 (10 ng/mL; Peprotech, #AF-100-18B), and RA (0.1 μM, ReproCell, #04–0021) until day 20, with the addition of SAG (0.1 μM; Cayman Chemicals, #11914) from day 13. From day 8 on, medium was refreshed every other day. On day 21, SCOs were moved to Poly(2-hydroxyethyl methacrylate)-treated (Merck, #P3932) 24-well plates (VWR, # 734–2325), one organoid per well, in NMM supplemented with NT3 (20 ng/mL; Peprotech, #450-03), Brain-derived nerve factor (BDNF) (20 ng/mL; Peprotech, #450-02), insulin growth factor 1 (IGF1) (10 ng/mL; Peprotech, #100-11), cAMP (1 μM; Merck, #D0260), and ascorbic acid (150 μM; Merck, #A4544), with three-quarters medium refreshments every 3–4 days. From day 35 onward, SCOs were maintained in NMM supplemented with PDGF (10 ng/mL; Bio-techne, #221-AA), IGF1 (10 ng/mL), T3 (60 ng/mL; Merck, #T6397), cAMP (1 μM), and Ascorbic acid (150 μM).

SCO transduction

On day 45, two-thirds of medium (total of 1 mL) was refreshed with the addition of 2.5 × 1010 vg/organoid of AAV9, NL1, TH1, TP1, and TR2 capsids. GFP signal was monitored in live-organoids and medium was refreshed every three to four days. At 10 days after transduction, organoids were collected for DNA isolation and immunohistochemistry (IHC).

Generation of hiPSC-derived motor neurons

hiPSC-motor neurons were generated following42 with the following modifications. Briefly, hiPSC colonies cultured on vitronectin (Stem Cell Technologies, #7180) and in TeSR-E8 medium (Stem Cell Technologies, #5940) were dissociated with Accutase (Merck, #SF006) at 37°C for 5 min, made into a single-cell suspension, and 9,000 cells were plated into individual ultra-low attachment U-bottom 96-well plates (Corning, #CLS7007) in 150 μL TeSR-E8 medium (Stem Cell Technologies, #5940) supplemented with ROCK inhibitor (10 μM; Selleckchem, #S1049) and FGF2 (4 ng/mL; Peprotech, #AF-100-18B). On day 2, 150 μL NMM supplemented with CHIR 99021 (3 μM; Cayman Chemicals, #13122), SB-431542 SB431542 (2 μM; Selleckchem, #S1067), Dorsomorphin (0.2 μM; Selleckchem, #S7306), and ascorbic acid (0.1 mM; Merck, #A4544), was added (motor neuron progenitor media 1). On day 8, MNP1 was changed to MNP2 consisting of NMM supplemented with CHIR (1 μM), 2 μM SB-431542 (2 μM), Dorsomorphin (0.2 μM), RA (0.1 μM, ReproCell, #04–0021), SAG (0.25 μM; Cayman Chemicals, #11914), and ascorbic acid (0.1mM). Two-thirds of the medium was changed daily from day 2 to day 7, and every other day from day 8 onwards On day 14, patterned embvroid bodies (EBs) were dissociated into single cells with Accutase at 37°C for 15 min in rotation and plated in geltrex-coated plates at a cell density of 70,000 cells/cm2 in MNP1 media (supplemented with 10 μM ROCK inhibitor on the plating day). On day 22, patterned progenitors were dissociated into single cells with Accutase at 37°C for 5 min and plated on poly-L-ornithine and laminin coated glass coverslips at a cell density of 35,000 cells/cm2 in motor neuron differentiation media consisting of NMM supplemented with RA (0.5 μM), SAG (0.1 μM), ascorbic acid (0.1mM), cAMP (1 μM), BDNF (20 ng/mL), NT3 (10 ng/mL), glial cell line-derived neurotrophic factor (10 ng/mL), IGF1 (10 ng/mL), and DAPT (10 μM) (supplemented with 10 μM ROCK inhibitor on the plating day). From day 22 onward, one-half of the media was changed every 3–4 days for the rest of the protocol.

Motor neuron transduction

On day 28, 105 vg/cell of AAV9, NL1, TH1, TP1, and TR2 capsids were added to the motor neuron cultures (12-well plates in 1 mL/well). GFP signal was monitored in live neurons and medium was refreshed every 3–4 days. Six days after transduction, neurons were fixed in 4% PFA for final imaging and analysis.

IHC

Briefly, organoids were washed with PBS, fixed in 4% paraformaldehyde (PFA in dH2O, ProSciTech, Kirwan, Queensland, Australia, #C004) at room temperature for 30 min, and followed by sucrose cryopreservation (30% sucrose in PBS at 4°C for 48 h), embedding in OCT (Tissue-Tec Oct Compound, #4583) and snap-freezing. For IHC, 20-μm-thick sections were cut using a cryostat (Leica). After six PBS washes of 5 min, antigen retrieval was performed by incubating slides in 0.01 M citrate buffer at 90°C for 30 min. After one PBS wash, slides were blocked for 1 h at room temperature with blocking buffer consisting of PBS + goat serum (5%; Thermo Fisher Scientific, #16210) + BSA (0.1%; Merck, #A9418) + Triton X-100 (0.3%, Merck, #T8787). Primary antibodies in blocking buffer were incubated for 1 h at room temperature and then overnight at 4°C. The next day, after six PBS washes of 5 min, organoids were incubated with secondary antibodies (1:1,000; Thermo Fisher Scientific, Alexa Fluor 488, 594, 647) for 2 h at room temperature. Afterward, cells were washed six times for 5 min with PBS, incubated with diamidino-2-phenylindole (1:1,000; DAPI; Merck, #D9542) for 2 min at room temperature, washed once with PBS, and embedded with Fluoromount-G (Southern Biotech, Birmingham, AL, USA, #0100-01).

Motor neurons were washed with PBS, and gradient fixed in 2% PFA at room temperature for 20 min, followed by 4% incubation for another 20 min. For immunocytochemistry, cells were washed six times with PBS and blocked for 1 h at room temperature with blocking buffer. Primary antibodies in blocking buffer were incubated for 1 h at room temperature and then overnight at 4°C. The next day, after six PBS washes of 5 min, cells were incubated with secondary antibodies (1:1,000; Thermo Fisher Scientific, Alexa Fluor 488, 594, 647) for 2 h at room temperature, washed once with PBS, and embedded with Fluoromount-G.

Antibodies

• Anti-GFP (1:1000; Aves Labs, #GFP-1020).

• ISL1 (1:2500; Abcam, #ab109517).

• NeuN (1:500; Synaptic Systems, #266006).

Organoid and neuronal imaging and analysis

Confocal images of organoids were acquired with a Nikon ECLIPSE Ti inverted microscope (Nikon Corporation, Tokyo, Japan) controlled by NIS-Elements 4.30 software (Nikon Corporation) and fluorescent images of motor neurons were acquired with a Leica DMi8 inverted light microscope (Leica Microsystems) controlled by LAS X 3.7 software (Leica Microsystems). GFP-positive cells in organoids and motor neurons were analyzed using CLIJ2 plugin for Fiji.43 Briefly, within CLIJ2 GFP-positive cells in both organoids and motor neurons were label by applying a subtracting a Gaussian Blur2D filter > Thresholding > Parametric Watershed > Connected components labeling Box > Duplicate and go ahead in Fiji. Next, GFP-positive somas were quantified in Fiji. All analyses were performed blinded.

Data analysis

To assess common amino acids across the 7-mer insert between the 13 chosen candidates, we used the web-based application WebLogo (https://weblogo.threeplusone.com/),44,45 which generates alignments of the input sequences, whereby the height of each amino acid corresponding to its frequency at that position.

Statistics

We used GraphPad Prism 9.0 for PC for statistical analysis. For comparison of biodistribution (AAV genomes) between animals and across regions we used an ANOVA followed by a Šídák’s multiple comparisons test. To compare cDNA levels of AAV transcripts between NHPs #1001 and #1002 in the lumbar region, we used an unpaired two-tailed t tests; p values of <0.05 were accepted as significant.

Data and code availability

The AAV rep/cap plasmids containing the inserts for the capsids described in the manuscript as well as the electronic sequence maps are available upon completion of a standard Material Transfer Agreement with The Massachusetts General Hospital. Additionally, Rep/cap plasmids are available at Addgene for capsid variants TR2 (#218403), NL1 (#218404), TH1 (#218405), and TP1 (#218406). Any other raw data and raw sequencing files that support the findings of this study are available from the corresponding author. All code written and used in this study can be freely accessed by emailing the authors, who will provide scripts and methods of use.

Supplemental information

Document S1. Figures S1–S8, Tables S1, S2, and S4

Table S3. Excel file of next-generation sequencing of recovered peptide-encoding sequences from Round 2 and pre-round 2 libraries after intrathecal injection in NHPs

Document S2. Article plus supplemental information

Acknowledgments

We thank the research team and especially Alan LaRochelle at Biomere Biomedical Research Models (Worcester, MA) for carrying out the animal studies. We thank Dr. Jessica Chichester of the University of Pennsylvania Human Immunology Core for performing the AAV9 neutralization assays. For generation of the artwork in the figures, BioRender software was utilized for some of the objects. For the AAV capsid cartoons, we used the Protein Data Bank (RCSB PDB) AAV9 capsid structure PDB: pdb7MT0.46 We exported the AAV9 structure in 3D viewer into a drawing program for custom coloring. We thank Dr. Servio H. Ramirez for advice during revision of the manuscript.

C.A.M. discloses support for the research described in this study from the 10.13039/100000002 NIH [grant# DC017117 ] and a sponsored research agreement (SRA) with SwanBio Therapeutics. The scientists affiliated with the Penn Vet Comparative Pathology Center are partially subsidized by the Abramson Cancer Center Support Grant [P30 CA016520 ]; the Aperio Versa 200 scanner used for imaging was acquired through an 10.13039/100000002 NIH Shared Instrumentation Grant [S10 OD023465-01A1 ]; the Leica BOND RXm instrument used for IHC was acquired through the Penn Vet IIZD Core pilot grant opportunity 2022. W.S. discloses support for the research described in this study from the 10.13039/501100003725 National Research Foundation of Korea (NRF) grant, funded by the Korean government (MSIP) (NRF-2021M3E5D9021368 ) and from Kun-hee Lee Seoul National University Hospital Child Cancer & Rare Disease Project, Republic of Korea (24B-001-0500 ).

Author contributions

C.A.M. and K.S.H. conceived of and designed the study. K.K. and S.W.C. designed experiments and analyzed data. D.D.L.C. and J.N. produced and purified AAV vectors for the study. M.C.S. performed molecular biology experiments to construct the barcoded AAV expression constructs. M.C. isolated DNA and RNA from NHP tissue. N.P. performed capsid DNA PCR amplification for the analysis of inserts by next generation sequencing. D.M.N. assisted in data analysis. Y.G. and C.N. performed experiments and analyzed data. V.M.H. designed, supervised, and analyzed data with the spinal cord organoids. R.M.F. designed and performed experiments and analyzed data from the spinal cord organoid transduction experiments. W.S. designed, supervised, and analyzed data with the spinal cord organoids. B.L. and J.R. designed and performed experiments and analyzed data from the spinal cord organoid transduction experiments. C.A.M. and K.S.H. wrote the manuscript with contributions from all authors.

Declaration of interests

C.A.M. has financial interests in Chameleon Biosciences, Skylark Bio, and Sphere Gene Therapeutics, companies developing adeno-associated virus (AAV) vector technologies for gene therapy applications. C.A.M. performs paid consulting work for all three companies. C.A.M. received sponsored research funding from SwanBio Therapeutics for the research described here. C.A.M. received royalty payments from licensing agreements between SwanBio Therapeutics and the Massachusetts General Hospital. C.A.M.’s interests were reviewed and are managed by Massachusetts General Hospital and Mass General Brigham in accordance with their conflict-of-interest policies. C.A.M. and K.S.H. have a filed patent application surrounding the iTransduce library. K.S.H. performed paid consulting work for SwanBio Therapeutics.

Supplemental information can be found online at https://doi.org/10.1016/j.ymthe.2024.05.040.
==== Refs
References

1 Kuzmin D.A. Shutova M.V. Johnston N.R. Smith O.P. Fedorin V.V. Kukushkin Y.S. van der Loo J.C.M. Johnstone E.C. The clinical landscape for AAV gene therapies Nat. Rev. Drug Discov. 20 2021 173 174 33495615
2 Day J.W. Finkel R.S. Chiriboga C.A. Connolly A.M. Crawford T.O. Darras B.T. Iannaccone S.T. Kuntz N.L. Peña L.D.M. Shieh P.B. Onasemnogene abeparvovec gene therapy for symptomatic infantile-onset spinal muscular atrophy in patients with two copies of SMN2 (STR1VE): an open-label, single-arm, multicentre, phase 3 trial Lancet Neurol. 20 2021 284 293 33743238
3 Thomsen G. Burghes A.H.M. Hsieh C. Do J. Chu B.T.T. Perry S. Barkho B. Kaufmann P. Sproule D.M. Feltner D.E. Biodistribution of onasemnogene abeparvovec DNA, mRNA and SMN protein in human tissue Nat. Med. 27 2021 1701 1711 34608334
4 Morales L. Gambhir Y. Bennett J. Stedman H.H. Broader Implications of Progressive Liver Dysfunction and Lethal Sepsis in Two Boys following Systemic High-Dose AAV Mol. Ther. 28 2020 1753 1755 32710826
5 Wilson J.M. Flotte T.R. Moving Forward After Two Deaths in a Gene Therapy Trial of Myotubular Myopathy Hum. Gene Ther. 31 2020 695 696 32605399
6 Hordeaux J. Buza E.L. Dyer C. Goode T. Mitchell T.W. Richman L. Denton N. Hinderer C. Katz N. Schmid R. Adeno-Associated Virus-Induced Dorsal Root Ganglion Pathology Hum. Gene Ther. 31 2020 808 818 32845779
7 Hordeaux J. Buza E.L. Jeffrey B. Song C. Jahan T. Yuan Y. Zhu Y. Bell P. Li M. Chichester J.A. MicroRNA-mediated inhibition of transgene expression reduces dorsal root ganglion toxicity by AAV vectors in primates Sci. Transl. Med. 12 2020 eaba9188
8 Bey K. Deniaud J. Dubreil L. Joussemet B. Cristini J. Ciron C. Hordeaux J. Le Boulc'h M. Marche K. Maquigneau M. Intra-CSF AAV9 and AAVrh10 Administration in Nonhuman Primates: Promising Routes and Vectors for Which Neurological Diseases? Mol. Ther. Methods Clin. Dev. 17 2020 771 784 32355866
9 Meyer K. Ferraiuolo L. Schmelzer L. Braun L. McGovern V. Likhite S. Michels O. Govoni A. Fitzgerald J. Morales P. Improving single injection CSF delivery of AAV9-mediated gene therapy for SMA: a dose-response study in mice and nonhuman primates Mol. Ther. 23 2015 477 487 25358252
10 Castle M.J. Cheng Y. Asokan A. Tuszynski M.H. Physical positioning markedly enhances brain transduction after intrathecal AAV9 infusion Sci. Adv. 4 2018 eaau9859 30443600
11 Bailey R.M. Rozenberg A. Gray S.J. Comparison of high-dose intracisterna magna and lumbar puncture intrathecal delivery of AAV9 in mice to treat neuropathies Brain Res. 1739 2020 146832
12 Meseck E.K. Guibinga G. Wang S. McElroy C. Hudry E. Mansfield K. Intrathecal sc-AAV9-CB-GFP: Systemic Distribution Predominates Following Single-Dose Administration in Cynomolgus Macaques Toxicol. Pathol. 50 2022 415 431 35658751
13 Ballon D.J. Rosenberg J.B. Fung E.K. Nikolopoulou A. Kothari P. De B.P. He B. Chen A. Heier L.A. Sondhi D. Quantitative Whole-Body Imaging of I-124-Labeled Adeno-Associated Viral Vector Biodistribution in Nonhuman Primates Hum. Gene Ther. 31 2020 1237 1259 33233962
14 Hudry E. Aihara F. Meseck E. Mansfield K. McElroy C. Chand D. Tukov F.F. Penraat K. Liver Injury in Cynomolgus Monkeys Following Intravenous and Intrathecal scAAV9 Gene Therapy Delivery Mol. Ther. 31 2023 2999 3014 37515322
15 Finkel R.S. Darras B.T. Mendell J.R. Day J.W. Kuntz N.L. Connolly A.M. Zaidman C.M. Crawford T.O. Butterfield R.J. Shieh P.B. Intrathecal Onasemnogene Abeparvovec for Sitting, Nonambulatory Patients with Spinal Muscular Atrophy: Phase I Ascending-Dose Study (STRONG) J. Neuromuscul. Dis. 10 2023 389 404 36911944
16 Hanlon K.S. Meltzer J.C. Buzhdygan T. Cheng M.J. Sena-Esteves M. Bennett R.E. Sullivan T.P. Razmpour R. Gong Y. Ng C. Selection of an Efficient AAV Vector for Robust CNS Transgene Expression Mol. Ther. Methods Clin. Dev. 15 2019 320 332 31788496
17 Huang Q. Chen A.T. Chan K.Y. Sorensen H. Barry A.J. Azari B. Beddow T. Zheng Q. Zhao B. Tobey I.G. Targeting AAV vectors to the CNS via de novo engineered capsid-receptor interactions Preprint at bioRxiv 2022 10.1101/2022.10.31.514553
18 Goertsen D. Flytzanis N.C. Goeden N. Chuapoco M.R. Cummins A. Chen Y. Fan Y. Zhang Q. Sharma J. Duan Y. AAV capsid variants with brain-wide transgene expression and decreased liver targeting after intravenous delivery in mouse and marmoset Nat. Neurosci. 25 2022 106 115 34887588
19 Huang Q. Chen A.T. Chan K.Y. Sorensen H. Barry A.J. Azari B. Zheng Q. Beddow T. Zhao B. Tobey I.G. Targeting AAV vectors to the central nervous system by engineering capsid-receptor interactions that enable crossing of the blood-brain barrier Plos Biol. 21 2023 e3002112 37467291
20 Kawabata H. Konno A. Matsuzaki Y. Sato Y. Kawachi M. Aoki R. Tsutsumi S. Togai S. Kobayashi R. Horii T. Improving cell-specific recombination using AAV vectors in the murine CNS by capsid and expression cassette optimization Mol. Ther. Methods Clin. Dev. 32 2024 101185
21 Blair H.A. Onasemnogene Abeparvovec: A Review in Spinal Muscular Atrophy CNS Drugs 36 2022 995 1005 35960489
22 Lek A. Wong B. Keeler A. Blackwood M. Ma K. Huang S. Sylvia K. Batista A.R. Artinian R. Kokoski D. Unexpected Death of a Duchenne Muscular Dystrophy Patient in an N-of-1 Trial of rAAV9-delivered CRISPR-transactivator Preprint at medRxiv 2023 10.1101/2023.05.16.23289881
23 Salabarria S.M. Corti M. Coleman K.E. Wichman M.B. Berthy J.A. D'Souza P. Tifft C.J. Herzog R.W. Elder M.E. Shoemaker L.R. Thrombotic microangiopathy following systemic AAV administration is dependent on anti-capsid antibodies J. Clin. Invest. 134 2024 e173510
24 Gray S.J. Nagabhushan Kalburgi S. McCown T.J. Jude Samulski R. Global CNS gene delivery and evasion of anti-AAV-neutralizing antibodies by intrathecal AAV administration in non-human primates Gene Ther. 20 2013 450 459 23303281
25 Rosenberg J.B. Fung E.K. Dyke J. De B.P. Lou H. Kelly J. Reejhsinghani L. Ricart Arbona R.J. Sondhi D. Kaminsky S.M. Positron Emission Tomography Quantitative Assessment of Off-Target Whole-Body Biodistribution of I-124-labeled Adeno-associated Virus Capsids Administered to Cerebral Spinal Fluid Hum. Gene Ther. 34 2023 1095 1106 37624734
26 Finneran D.J. Njoku I.P. Flores-Pazarin D. Ranabothu M.R. Nash K.R. Morgan D. Gordon M.N. Toward Development of Neuron Specific Transduction After Systemic Delivery of Viral Vectors Front. Neurol. 12 2021 685802
27 Dhungel B. Ramlogan-Steel C.A. Steel J.C. Synergistic and independent action of endogenous microRNAs 122a and 199a for post-transcriptional liver detargeting of gene vectors Sci. Rep. 8 2018 15539
28 Ahmed S.S. Li H. Cao C. Sikoglu E.M. Denninger A.R. Su Q. Eaton S. Liso Navarro A.A. Xie J. Szucs S. A single intravenous rAAV injection as late as P20 achieves efficacious and sustained CNS Gene therapy in Canavan mice Mol. Ther. 21 2013 2136 2147 23817205
29 Deverman B.E. Pravdo P.L. Simpson B.P. Kumar S.R. Chan K.Y. Banerjee A. Wu W.L. Yang B. Huber N. Pasca S.P. Gradinaru V. Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain Nat. Biotechnol. 34 2016 204 209 26829320
30 Nonnenmacher M. Wang W. Child M.A. Ren X.Q. Huang C. Ren A.Z. Tocci J. Chen Q. Bittner K. Tyson K. Rapid evolution of blood-brain-barrier-penetrating AAV capsids by RNA-driven biopanning Mol. Ther. Methods Clin. Dev. 20 2021 366 378 33553485
31 Hordeaux J. Yuan Y. Clark P.M. Wang Q. Martino R.A. Sims J.J. Bell P. Raymond A. Stanford W.L. Wilson J.M. The GPI-Linked Protein LY6A Drives AAV-PHP The GPI-Linked Protein LY6A Drives AAV-PHP.B Transport across the Blood-Brain Barrier Mol. Ther. 27 2019 912 921 30819613
32 Moyer T.C. Hoffman B.A. Chen W. Shah I. Ren X.-Q. Knox T. Liu J. Wang W. Li J. Khalid H. Highly conserved brain vascular receptor ALPL mediates transport of engineered viral vectors across the blood-brain barrier Preprint at bioRxiv 2024 10.1101/2024.03.12.584703
33 Korbelin J. Dogbevia G. Michelfelder S. Ridder D.A. Hunger A. Wenzel J. Seismann H. Lampe M. Bannach J. Pasparakis M. A brain microvasculature endothelial cell-specific viral vector with the potential to treat neurovascular and neurological diseases EMBO Mol. Med. 8 2016 609 625 27137490
34 Depla J.A. Sogorb-Gonzalez M. Mulder L.A. Heine V.M. Konstantinova P. van Deventer S.J. Wolthers K.C. Pajkrt D. Sridhar A. Evers M.M. Cerebral Organoids: A Human Model for AAV Capsid Selection and Therapeutic Transgene Efficacy in the Brain Mol. Ther. Methods Clin. Dev. 18 2020 167 175 32637448
35 Ramamurthy R.M. Atala A. Porada C.D. Almeida-Porada G. Organoids and microphysiological systems: Promising models for accelerating AAV gene therapy studies Front. Immunol. 13 2022 1011143
36 Garita-Hernandez M. Routet F. Guibbal L. Khabou H. Toualbi L. Riancho L. Reichman S. Duebel J. Sahel J.A. Goureau O. Dalkara D. AAV-Mediated Gene Delivery to 3D Retinal Organoids Derived from Human Induced Pluripotent Stem Cells Int. J. Mol. Sci. 21 2020 994
37 Loewa A. Feng J.J. Hedtrich S. Human disease models in drug development Nat. Rev. Bioeng. 2023 1 15
38 Gyorgy B. Meijer E.J. Ivanchenko M.V. Tenneson K. Emond F. Hanlon K.S. Indzhykulian A.A. Volak A. Karavitaki K.D. Tamvakologos P.I. Gene Transfer with AAV9-PHP.B Rescues Hearing in a Mouse Model of Usher Syndrome 3A and Transduces Hair Cells in a Non-human Primate Mol. Ther. Methods Clin. Dev. 13 2019 1 13 30581889
39 Maguire C.A. Balaj L. Sivaraman S. Crommentuijn M.H.W. Ericsson M. Mincheva-Nilsson L. Baranov V. Gianni D. Tannous B.A. Sena-Esteves M. Microvesicle-associated AAV vector as a novel gene delivery system Mol. Ther. 20 2012 960 971 22314290
40 Seo K. Cho S. Shin H. Shin A. Lee J.H. Kim J.H. Lee B. Jang H. Kim Y. Cho H.M. Symmetry Breaking of Human Pluripotent Stem Cells (hPSCs) in Micropattern Generates a Polarized Spinal Cord-Like Organoid (pSCO) with Dorsoventral Organization Adv. Sci. 10 2023 e2301787
41 Andersen J. Revah O. Miura Y. Thom N. Amin N.D. Kelley K.W. Singh M. Chen X. Thete M.V. Walczak E.M. Generation of Functional Human 3D Cortico-Motor Assembloids Cell 183 2020 1913 1929.e26 33333020
42 Du Z.W. Chen H. Liu H. Lu J. Qian K. Huang C.L. Zhong X. Fan F. Zhang S.C. Generation and expansion of highly pure motor neuron progenitors from human pluripotent stem cells Nat. Commun. 6 2015 6626 25806427
43 Haase R. Royer L.A. Steinbach P. Schmidt D. Dibrov A. Schmidt U. Weigert M. Maghelli N. Tomancak P. Jug F. Myers E.W. CLIJ: GPU-accelerated image processing for everyone Nat. Methods 17 2020 5 6 31740823
44 Crooks G.E. Hon G. Chandonia J.M. Brenner S.E. WebLogo: a sequence logo generator Genome Res. 14 2004 1188 1190 15173120
45 Schneider T.D. Stephens R.M. Sequence logos: a new way to display consensus sequences Nucleic Acids Res. 18 1990 6097 6100 2172928
46 Penzes J.J. Chipman P. Bhattacharya N. Zeher A. Huang R. McKenna R. Agbandje-McKenna M. Adeno-associated Virus 9 Structural Rearrangements Induced by Endosomal Trafficking pH and Glycan Attachment J. Virol. 95 2021 e0084321 34260280
