
==== Front
BMC Genomics
BMC Genomics
BMC Genomics
1471-2164
BioMed Central London

10743
10.1186/s12864-024-10743-y
Research
Genomic identification and expression profiling of DMP genes in oat (Avena sativa) elucidate their responsiveness to seed aging
Ma Yuan 1
Liu Huan liuhuan@gsau.edu.cn

1
Wang Jinglong 2
Zhao Guiqin 1
Niu Kuiju 1
Zhou Xiangrui 1
Zhang Ran 3
Yao Ruirui 1
1 https://ror.org/05ym42410 grid.411734.4 0000 0004 1798 5176 Key Laboratory of Grassland Ecosystems, College of Grassland Science, Gansu Agricultural University, Lanzhou, 730070 China
2 https://ror.org/024d3p373 grid.464485.f 0000 0004 1777 7975 Tibet Grassland Science Research Institute, Tibet Academy of Agricultural and Animal Husbandry Sciences, Lhasa, 850000 China
3 grid.216566.0 0000 0001 2104 9346 Institute of Ecological Protection and Restoration, Chinese Academy of Forestry, Grassland Research Center, National Forestry and Grassland Administration, Beijing, 100091 China
16 9 2024
16 9 2024
2024
25 86327 3 2024
28 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

The Domain of unknown function 679 membrane protein (DMP) family, which is unique to plants, plays a crucial role in reproductive development, stress response and aging. A comprehensive study was conducted to identify the DMP gene members of oat (Avena sativa) and to investigate their structural features and tissue-specific expression profiles. Utilizing whole genome and transcriptome data, we analyzed the physicochemical properties, gene structure, cis-acting elements, phylogenetic relationships, conserved structural (CS) domains, CS motifs and expression patterns of the AsDMP family in A. sativa.

Results

The DMP family genes of A. sativa were distributed across 17 chromosomal scaffolds, encompassing a total of 33 members. Based on phylogenetic relationships, the AsDMP genes were classified into five distinct subfamilies. The gene structure also suggests that A. sativa may have undergone an intron loss event during its evolution. Covariance analysis indicates that genome-wide duplication and segmental duplication may be the major contributor to the expansion of the AsDMP gene family. Ka/Ks selective pressure analysis of the AsDMP gene family suggests that DMP gene pairs are generally conserved over evolutionary time. The upstream promoters of these genes contain several cis-acting elements, suggesting a potential role in abiotic stress responses and hormone induction. Transcriptome data revealed that the expression patterns of the DMP genes are involved in tissue and organ development. In this study, the AsDMP genes (AsDMP1, AsDMP19, and AsDMP22) were identified as potential regulators of seed senescence in A. sativa. These genes could serve as candidates for breeding studies focused on seed longevity and anti-aging germplasm in A. sativa. The study provides valuable insights into the regulatory mechanisms of the AsDMP gene family in the aging process of A. sativa germplasm and offers theoretical support for further function investigation into the functions of AsDMP genes and the molecular mechanisms underlying seed anti-aging.

Conclusions

This study identified the AsDMP genes as being involved in the aging process of A. sativa seeds, marking the first report on the potential role of DMP genes in seed aging for A. sativa.

Keywords

Avena sativa
DMP gene family
Gene expression
Seed aging
Expression profiling
http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China 32360344 Key Laboratory of Grassland Ecosystem Ministry of Education ProjectKLGE2022-16 Gansu Agricultural University Youth Tutor FundGAU-QDFC-2023-01 Fund by China scholarship councilTibet Autonomous Region Science and Technology ProjectXZ202201ZY0014N National Key Research and Development Program Foundation2022YFD1100502 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Membrane proteins are essential for numerous biological processes, such as cell proliferation and differentiation, signal transduction and recognition, and material transport [1–4]. The DMP (Domain of unknown function 679 membrane proteins) family comprises plant-specific genes that encode membrane proteins [5]. The DMP family genes commonly contains four transmembrane domains with cytoplasmic amino and carboxyl termini. It is involved in various physiological processes, particularly in plant reproductive development and senescence [6, 7]. At the whole-genome level of Arabidopsis thaliana, a total of 10 members of DMP gene family have been identified, each exhibiting distinct expression patterns across various tissues and organs. Among these, AtDMP1, AtDMP2, AtDMP3, AtDMP4, and AtDMP7 are involved in various types of programmed cell death, including organ senescence, silique dehiscence, and abscission of floral organs and siliques, while AtDMP8 and AtDMP9 promote gamete fusion during double fertilization [5, 8, 9]. The AtDMP1 is reported to be up-regulated during both developmental senescence and darkness-induced senescence, with its expression increasing from the onset to late stages of senescence. This suggests that AtDMP1 plays a consistent role in developmental senescence and induced senescence. In contrast, AtDMP3 and AtDMP4 are upregulated specifically during leaf senescence, indicating that they may have overlapping functions in this process [9, 10]. Studies have shown that both DMP1 T-DNA insertion mutants and DMP1 overexpressing plants age earlier than the wild type. Additionally, the aging-specific transcriptional activation of DMP1 is regulated by WRKY transcription factors [11]. Mutations in the two W-boxes (homologous binding sites for WRKY proteins) within the DMP1 promoter cause the loss of DMP1 expression during aging [11, 12]. In addition, DMP1 directly or indirectly participates in membrane division associated with endoplasmic reticulum decomposition in leaf aging, membrane fusion during root vacuole formation [7], and dual targeting of the vacuole membrane and plasma membrane [13]. The DMP gene has been extensively studied for haploid induction. Haploid induction systems have been established for polyploid mothers in A. thaliana, Zea mays, Brassica napus, and Nicotiana tabacum [14–16]. The ability of the DMP gene to induce haploids in polyploid monodicotyledonous crops was further confirmed. In Gossypium hirsutum, a systematic analysis identified 58 DMP genes. Analysis of their expression patterns revealed potential involvement in key biological processes, including plant aging, reproductive development, and stress response [17]. Developmentally programmed cell death (dPCD) genes that have been reported include BIFUNCTIONAL NUCLEASE1(BFN1), aspartic protease PASPA3, RIBONUCLEASE3(RNS3), CYSTEIN ENDOPEPDITASE(CEP1), DOMAIN OF UNKNOWN FUNCTION679 MEMBRANE PROTEIN4(DMP4), and EXITUS1(EXI1) [18]. During stigma senescence in A. thaliana, AtDMP4, along with BFN1, RNS3, EXI1, CEP1 and PASPA3, promotes both senescence and the dPCD process [19]. Importantly, DMP4 is the only protein among DMP proteins that interacts with DMP1 [11]. Studies have also identified genes associated with seed aging in several other crops. For example, WRKY genes in Medicago sativa have been shown to influence seed vigor [20]. In oat (Avena sativa), the Glutathione Reductase(GR) gene family is recognized for its role in seed aging [21]. Furthermore, the lipoxygenase family in Cicer arietinum is involved in regulating the artificial aging process [22].

Seed “aging”, or “deterioration”, is a common phenomenon during the storage of agricultural and pasture seeds. As storage time increases, it often results in irreversible declines in seed viability vigor, and germination ability [23, 24]. Seed aging can occur through natural or artificial accelerated processes. Natural aging involves the gradual loss of seed vigor after maturity under typical environmental conditions. In contrast, artificial accelerated aging accelerates the aging process through controlled conditions, leading to a rapid decline in seed vigor. This method is widely used to study seed deterioration and evaluate storage resistance [25, 26].

Avena sativa is an important grass crop known for its excellent nutritional quality and high economic value. It plays a significant role in livestock production [27]. Additionally, it helps reduce grazing pressure on grasslands, aids in the recovery of degraded grasslands, and contributes to ecological protection. In areas with fragile ecological conditions, it is regarded as an irreplaceable food and fodder crop in [28]. The aging of A. sativa seeds affects not only seed and seedling growth, yield and quality, but also the conservation, utilization and development of germplasm resources. Therefore, mitigating the economic losses caused by the decline in quality of A. sativa seeds due to aging and deterioration is of great significance in agricultural production. DMP proteins, which are membrane proteins found almost exclusively in green plants, have been systematically analyzed in A. thaliana [6], G. hirsutum [17], and Glycine max [9]. In addition, DMP proteins have been characterized in several species, including Oryza sativa (20), Vitis vinifera (7), Z. mays (15), Sorghum bicolor (15), and Ananas comosus (9). These studies have highlighted the involvement of DMPs in various biological processes, such as promoting gamete fusion during double fertilization, inducing maternal haploid production, and contributing to plant senescence, reproductive development, and stress response [17]. To date, most research on DMP genes has focused on haploid breeding, with relatively few studies investigating their role in aging. The response of DMP gene family members in A. sativa to aging stress remains unknown, and there is a notable lack of studies on the expression and function of DMP genes in A. sativa seeds during aging. In this study, we identified 33 members of the DMP gene family from the A. sativa genome and analyzed their phylogenetic relationships. using bioinformatics tools, we conducted a comprehensive analysis of physicochemical properties, protein structures, subcellular localization, conserved motifs, and chromosomal location of the AsDMP family members. We also characterized their expression patterns, which will provide theoretical support for further investigation into the molecular mechanisms of the AsDMP genes and breeding research.

Results

Identification of the DMP proteins in oat

Thirty-three DMP sequences were identified and designated as AsDMP1 through AsDMP33 based on their chromosomal positions (Table 1). In addition, we determined the physicochemical properties of these AsDMP genes, including amino acid sequence length (aa), isoelectric point (pI), protein molecular weight (kDa), instability index, aliphatic index, and subcellular localization. All 33 DMP genes encode proteins with amino acid lengths ranging from 169 (AsDMP6) to 325 (AsDMP24) aa. Theoretical isoelectric points (pI) range from 5.26 (AsDMP28) to 9.04 (AsDMP33). Molecular weight range 17.88 (AsDMP6) to 35.50 (AsDMP24) kDa. The predicted aliphatic index range was 76.04 to 107.62. The aliphatic index reflects the thermal stability of proteins. Additionally, hydrophilicity and hydrophobicity of proteins is one of the most important factors affecting the structural stability of proteins. All AsDMP proteins were analyzed and found to be hydrophilic (Fig. 1), suggesting their transmembrane nature. In addition, all AsDMP proteins contained between 3 and 4 transmembrane structural domains and lacked signal peptides, suggesting that they are transmembrane, non-secretory proteins. Predictions of the subcellular localization of DMP proteins indicate that all proteins are localized to the plasma membrane, aligning with the known function of DMPs. In addition, AsDMP14, AsDMP19, AsDMP24, AsDMP25, AsDMP26 and AsDMP32 were localized extracellularly, while AsDMP15 and AsDMP21 were found in chloroplasts. These findings suggest that DMPs also regulate biological processes both inside and outside the plasma membrane.

Table 1 Physico-chemical properties of DMP family in A. sativa: an in-depth overview of amino acid sequence length, isoelectric point, molecular weight, instability index, aliphatic index, transmembrane domains, and subcellular localization

Gene name	Gene ID	Protein length (aa)	Isoeletric point (PI)	Molecular weight (MW)/kDa	Instability index	Aliphatic index	Transmembrane domains	signal peptide	Predicted subcellular localization	
AsDMP1	AVESA.00010b.r2.1AG0036510.1	239	6.50	25.35	50.20	96.78	4	NO	PlasmaMembrane	
AsDMP2	AVESA.00010b.r2.1AG0004840.1	236	6.03	25.01	44.79	97.58	4	NO	PlasmaMembrane	
AsDMP3	AVESA.00010b.r2.1DG0155630.1	235	6.28	24.95	47.51	99.23	4	NO	PlasmaMembrane	
AsDMP4	AVESA.00010b.r2.2CG0263910.1	284	6.22	30.45	34.11	97.29	4	NO	PlasmaMembrane	
AsDMP5	AVESA.00010b.r2.2DG0399840.1	215	8.40	22.92	37.84	90.37	4	NO	PlasmaMembrane	
AsDMP6	AVESA.00010b.r2.2DG0382070.1	169	7.58	17.88	47.24	86.75	3	NO	PlasmaMembrane	
AsDMP7	AVESA.00010b.r2.3AG0415880.1	216	6.03	22.95	31.51	90.37	4	NO	PlasmaMembrane	
AsDMP8	AVESA.00010b.r2.3CG0462960.1	216	6.17	23.21	28.56	95.32	4	NO	PlasmaMembrane	
AsDMP9	AVESA.00010b.r2.3CG0495930.1	173	7.73	18.60	25.81	103.12	4	NO	PlasmaMembrane	
AsDMP10	AVESA.00010b.r2.3CG0514780.1	219	7.69	24.54	50.08	98.36	4	NO	PlasmaMembrane	
AsDMP11	AVESA.00010b.r2.3CG0515720.1	231	6.82	24.79	43.59	83.25	4	NO	PlasmaMembrane	
AsDMP12	AVESA.00010b.r2.3CG0515740.1	237	7.69	25.30	32.07	83.21	4	NO	PlasmaMembrane	
AsDMP13	AVESA.00010b.r2.3DG0517300.1	216	6.03	22.93	30.89	92.18	4	NO	PlasmaMembrane	
AsDMP14	AVESA.00010b.r2.3DG0543000.1	226	5.92	24.87	42.77	96.73	3	NO	PlasmaMembrane、Extracellular	
AsDMP15	AVESA.00010b.r2.4AG0601280.1	230	9.01	24.65	42.54	76.04	4	NO	PlasmaMembrane、 Chloroplast	
AsDMP16	AVESA.00010b.r2.4AG0640750.1	218	8.30	24.35	44.69	99.72	4	NO	PlasmaMembrane	
AsDMP17	AVESA.00010b.r2.4AG0641780.1	233	6.29	24.95	46.68	83.82	4	NO	PlasmaMembrane	
AsDMP18	AVESA.00010b.r2.4CG1263690.1	185	6.70	19.46	22.93	107.62	4	NO	PlasmaMembrane	
AsDMP19	AVESA.00010b.r2.4CG1314570.1	193	8.38	20.80	32.02	82.44	4	NO	PlasmaMembrane、Extracellular	
AsDMP20	AVESA.00010b.r2.4DG0745150.1	181	8.46	20.13	39.60	84.09	4	NO	PlasmaMembrane	
AsDMP21	AVESA.00010b.r2.4DG0745170.1	229	7.75	24.56	44.47	76.42	4	NO	PlasmaMembrane、 Chloroplast	
AsDMP22	AVESA.00010b.r2.4DG0768120.1	177	6.41	19.36	42.26	86.05	3	NO	PlasmaMembrane	
AsDMP23	AVESA.00010b.r2.4DG0769210.1	233	6.07	24.97	46.92	81.33	4	NO	PlasmaMembrane	
AsDMP24	AVESA.00010b.r2.4DG0769220.1	325	8.27	35.50	30.29	77.78	4	NO	PlasmaMembrane、Extracellular	
AsDMP25	AVESA.00010b.r2.5AG0809890.1	193	8.39	20.78	34.74	84.46	4	NO	PlasmaMembrane、Extracellular	
AsDMP26	AVESA.00010b.r2.5DG0998080.1	193	8.39	20.78	34.74	84.46	4	NO	PlasmaMembrane、Extracellular	
AsDMP27	AVESA.00010b.r2.6AG1010130.1	210	7.60	21.65	39.73	82.90	4	NO	PlasmaMembrane	
AsDMP28	AVESA.00010b.r2.6AG1060270.1	212	5.26	21.92	25.48	97.22	4	NO	PlasmaMembrane	
AsDMP29	AVESA.00010b.r2.6AG1060280.1	185	8.38	19.38	23.78	106.05	4	NO	PlasmaMembrane	
AsDMP30	AVESA.00010b.r2.6CG1110230.1	243	8.85	26.01	39.66	80.78	4	NO	PlasmaMembrane	
AsDMP31	AVESA.00010b.r2.7AG1213710.1	214	8.78	22.84	36.62	92.62	4	NO	PlasmaMembrane	
AsDMP32	AVESA.00010b.r2.7CG0697010.1	227	6.37	24.56	43.24	76.96	4	NO	PlasmaMembrane、Extracellular	
AsDMP33	AVESA.00010b.r2.7DG1394100.1	213	9.04	22.80	40.14	90.75	4	NO	PlasmaMembrane	

Fig. 1 The hydropathicity map of the AsDMP protein: analysis of amino acid residue hydrophobicity and hydrophilicity. The x-axis represents the position of amino acid residues, while they-axis indicates the hydrophobicity or hydrophilicity score. Peaks and troughs in the curve correspond to regions with high hydrophobicity or high hydrophilicity respectively

Protein structure prediction of oat DMP family members

The main secondary structures of proteins inlcude alpha-helixces(α-helixes), beta-sheets(β-sheets), beta-turns(β-turns), random coils, and extended chains. The predicted secondary structure of AsDMP, based on its amino acid sequence, mainly consists of α-helices, β-turns, random coils and extended chains (Table 2). Furthermore, α-helixes and random coils account for a significant proportion of the secondary structure in all AsDMPs members, suggesting that the amino acid secondary structure of AsDMPs is primarily composed of α-helices and random coils. By predicting the tertiary structures of AsDMP family proteins, it was observed that AsDMP1, AsDMP2, AsDMP3, AsDMP4, AsDMP18, AsDMP20, AsDMP28, AsDMP29, AsDMP5, AsDMP7, AsDMP8, AsDMP13, AsDMP31, AsDMP10, AsDMP16, AsDMP22, AsDMP11, AsDMP12, AsDMP15, AsDMP21, AsDMP23, AsDMP24, AsDMP19, AsDMP25, AsDMP26, AsDMP27, and AsDMP30 proteins showed a high degree of similarity. This high degree of structural similarity suggests potential functional similarities. However, these groups displayed distinct morphologies from one another and differed from the tertiary structures of other family members, suggesting a diversity of tertiary structures within the AsDMP family (Fig. 2).

Table 2 AsDMP proteins secondary structure characterization (%): alpha-helix, extended strand, random coil and beta turn

name	Alpha-helix	Extended strand	Random coil	Beta turn	
AsDMP1	41.84	11.72	40.17	6.28	
AsDMP2	41.53	11.86	40.68	5.93	
AsDMP3	40.43	11.91	41.70	5.96	
AsDMP4	46.83	13.32	35.92	4.93	
AsDMP5	39.53	15.35	38.60	6.51	
AsDMP6	45.56	15.38	32.54	6.51	
AsDMP7	40.28	13.43	41.67	4.63	
AsDMP8	41.20	12.04	41.67	5.09	
AsDMP9	44.51	16.18	32.37	6.94	
AsDMP10	42.01	17.35	36.99	3.65	
AsDMP11	35.93	16.88	42.42	4.76	
AsDMP12	34.18	18.99	41.77	5.06	
AsDMP13	36.57	16.20	43.06	4.17	
AsDMP14	45.13	11.06	37.17	6.64	
AsDMP15	33.91	15.22	45.22	5.65	
AsDMP16	39.45	18.81	35.78	5.96	
AsDMP17	39.48	15.02	40.34	5.15	
AsDMP18	43.78	14.59	34.59	7.03	
AsDMP19	37.82	16.06	41.45	4.66	
AsDMP20	44.20	14.92	34.25	6.63	
AsDMP21	37.12	14.85	41.05	6.99	
AsDMP22	31.64	21.47	40.68	6.21	
AsDMP23	40.77	16.31	37.34	5.58	
AsDMP24	41.54	14.15	39.38	4.92	
AsDMP25	39.90	13.99	38.86	7.25	
AsDMP26	39.90	13.99	38.86	7.25	
AsDMP27	35.71	14.76	44.29	5.24	
AsDMP28	41.98	13.21	38.68	6.13	
AsDMP29	47.03	12.97	34.05	5.95	
AsDMP30	39.51	12.76	42.39	5.35	
AsDMP31	36.45	18.22	39.72	5.61	
AsDMP32	37.00	15.86	40.97	6.17	
AsDMP33	38.50	16.43	41.31	3.76	

Fig. 2 Three-dimensional structure of putative DMP proteins from A. sativa generated through homology modelling. All AsDMP proteins were modeled using SWISS-MODEL (https://swissmodel.expasy.org)

Phylogenetic analysis of DMP gene family in oat

To analyze the phylogenetic relationships among DMP family members from different species, we constructed phylogenetic trees for A. sativa, A. thaliana, Z. mays, O. sativa, and S. bicolor using the neighbor-joining (NJ) method with MEGA 11 software (version 11.0.10). The phylogenetic tree analysis revealed that the plant DMP gene family can be classified into five subfamilies: I, II, III, IV and V (Fig. 3). Subfamily V contains the largest number of DMPs, with a total of 40 genes, including 15 AsDMPs. This was followed by subfamilies III, I, IV, and II, with 23, 15, 10, and 5 genes, respectively, and 8, 7, 3, and 0 of these being AsDMPs. The AsDMP gene has experienced a significant expansion compared to the DMP genes in A. thaliana, Z. mays, O. sativa, and S. bicolor. Additionally, the branching clustering pattern of AsDMP proteins closely resembles that reported for G. hirsutum [17].

Fig. 3 Unrooted Classification tree representing relationships among DMP genes of 5 species. Phylogenetic relationship of the 93 identified DMP genes from 5 plant species. DMP protein sequences were aligned with ClustalW, and a phylogenetic tree was constructed with MEGA11 using the neighbor-joining method and 1,000 bootstrap replicates. The members were divided into subfamilies I, II, III, IV and V

Conserved motifs of the oat DMP gene and analysis of gene structure

To further elucidate the diversity and conservation of the AsDMP gene family during evolution, we analyzed the conserved motifs, conserved domains and gene structures based on phylogeny (Fig. 4). A total of 10 motifs were predicted using the MEME website (http://meme-suite.org/tools/meme) (Figs. 4B and 5), with each DMP protein containing between 4 and 9 motifs. All DMP members shared Motif 3, 4, and 5, suggesting that these motifs are highly conserved among the 33 AsDMP members. The basal composition and distribution of DMP members within the same subfamily are largely consistent, suggesting functional similarities among these members. It is noteworthy that there are variations in the motif composition among some proteins, both within the same subfamily and between different subfamilies. For instance, Motif 8 and Motif 10 are present only in certain proteins within subfamily V, highlighting their functional variability. In addition, some motifs are absent in certain subfamily members, while others are found exclusively in specific genes. For example, Motif 1 and Motif 7 are absent in all AsDMP members of subfamily III, while Motif 7 is also missing in subfamily IV. Motif 6 is present only in subfamily III, and Motif 8, 9, 10 are present only in some members of their respective subfamilies. Determining whether the presence or absence of these specific motifs confers unique functional roles to the DMP genes requires further study. The variation in motif composition among subfamilies may be attributed to their functional diversity. Gene structure analysis revealed that introns were present only in AsDMP4 from subfamily I and AsDMP24 from subfamily V (Fig. 4D). This indicates that, despite the functional similarities among DMP family members, there are notable differences among individual genes.

Fig. 4 Phylogenetic tree, conserved motif, conserved domain and gene structure of AsDMP gene family. A: Phylogenetic tree of AsDMP genes was constructed using MEGA11 and the neighbor-joining (NJ) method; B: Conserved motif of AsDMP proteins was analyzed on the MEME tool, and the results were visualized in TBtools. The motifs, labeled as 1–10 and represented by different colored boxes, demonstrate the conserved patterns in the protein sequences. The scale at the bottom allows for estimation of protein lengths.; C: The conserved domain of the AsDMP gene family indicates that they are members of the same gene family; D: The gene structure of AsDMP genes was determined, with the coding regions for the AsDMP domain highlighted in yellow. Regions labeled as CDS without the region coding for the AsDMP domain, indicated in green

Fig. 5 Conserved domain sequence identification: AsDMP protein

Chromosome localization, collinear analysis and Ka/Ks selection pressure analysis

To better understand the distribution of AsDMPs genes across chromosomes, a chromosome map of 33 AsDMP genes was constructed (Fig. 6). These genes were found to be distributed across 17 chromosomes. Five genes are distributed on chromosomes chr 3 C and chr 4D each, three genes on chr 4 A and chr 6 A each, two genes on chr 1 A, chr 2D, chr 3D, and chr 4 C each, and one gene is found on each of the remaining chromosomes. Tandem duplications were observed on chromosomes 3 C, 4D, and 6 A.

Fig. 6 Chromosomal mapping of DMP genes in A. sativa. Chromosome numbers are displayed in black font on the side. The AsDMP gene is shown in red font on the side. The scale is marked in megabases (Mb)

Gene family evolution primarily involves whole genome duplication(WGD), segmental duplication and tandem duplication [29]. Most plants have undergone ancient genome-wide replication events, also known as polyploidy, which led to the duplication of all genes across the genome [30]. This large-scale chromosomal doubling event resulted in the retention of numerous duplicated genomic fragments [31]. Tandem repeats occur on the same chromosome, adjacent to each other, and often have similar sequences and functional clusters [32]. Segmental duplications involve gene copies that are located distantly from each other or on different chromosomes. These duplications are a primary driver of gene family expansion and amplification [33, 34].

Through homology analysis of AsDMP genes, we visualized their relationships to elucidate the mechanisms underlying the expansion of the AsDMP gene family (Fig. 7). Among the 35 homologous gene pairs, four pairs were identified as resulting from tandem duplication events (AsDMP11/AsDMP12, AsDMP20/AsDMP21, AsDMP23/AsDMP24, AsDMP28/AsDMP29) (Fig. 6). Thirty-one gene pairs underwent WGD or segmental duplication. We therefore hypothesized that WGD or segmental duplication events are the major drivers of gene amplification in the evolution of the DMP gene family.

To further understand the evolutionary relationship of AsDMP genes, we constructed collinearity maps for the DMP families in A. sativa, S. bicolor and Z. mays (Fig. 8). Fourteen AsDMP genes were found to be collinear with at least two or more homologous genes. Specifically, there were 19 pairs of collinear relationships between 14 AsDMPs and five SbDMPs, and 14 pairs of collinear relationships between 14 AsDMPs and four ZmDMPs. Notably, the 14 AsDMP genes showing collinearity with both S. bicolor and Z. mays were identical, suggesting a higher degree of conservation among A. sativa, S. bicolor and Z. mays within the Poaceous plant. This suggests that these genes may have played an important role in evolution by participating more frequently in gene duplication events.

Selection pressure analysis was performed by evaluating the ratio of nonsynonymous substitutions per nonsynonymous site (Ka) to synonymous substitutions per synonymous site (Ks) (Ka/Ks) (Table 3). Not a Number (NaN) indicates that these gene pairs exhibit almost exclusively synonymous mutations at sites where such mutations are possible, indicating significant sequence divergence and a considerable evolutionary distance between them. We found that the Ks value for the gene pairs AsDMP-1/AsDMP-9, AsDMP-1/AsDMP-14, AsDMP-2/AsDMP-9, AsDMP-2/AsDMP-14, AsDMP-3/AsDMP-9, AsDMP-3/AsDMP-14 are NaN, resulting in a NaN Ka/Ks ratio. Among the gene pairs with WGD or segmental duplication, 22 pairs have Ka/Ks ratios less than 0.5, while three pairs have Ka/Ks ratios between 0.5 and 1.0, with all Ka/Ks ratios being less than 1. Additionally, four tandemly duplicated genes also have Ka/Ks ratios below 1. These findings indicate that these AsDMP genes experienced purifying selection during evolution, with functional differentiation occurring following WGD or segmental duplication.

Fig. 7 Chromosomal distribution and duplication events of AsDMP. The segmentally duplicated genes are connected by Colored lines, referring to the 33 genes highlighted in black

Fig. 8 Syntenic analysis of DMP genes in A. sativa in comparison with those in two plant species. The blue lines highlight the syntenic DMP gene pairs. The specie names with the prefixes “Sb”, “As"and “Zm” indicate S. bicolor, A. sativa, and Z. mays

Table 3 Ka/Ks values of duplicated DMP gene pairs from A. sativa species

Gene name	Gene name	Duplication type	Ka	Ks	Ka/Ks	
AsDMP1	AsDMP2	WGD/segmental	0.027307	0.168114	0.16243	
AsDMP1	AsDMP3	WGD/segmental	0.01553	0.027602	0.562622	
AsDMP1	AsDMP9	WGD/segmental	0.219878	NaN	NaN	
AsDMP1	AsDMP14	WGD/segmental	0.343854	NaN	NaN	
AsDMP2	AsDMP3	WGD/segmental	0.017651	0.137493	0.128376	
AsDMP2	AsDMP9	WGD/segmental	0.220654	NaN	NaN	
AsDMP2	AsDMP14	WGD/segmental	0.345933	NaN	NaN	
AsDMP3	AsDMP9	WGD/segmental	0.219878	NaN	NaN	
AsDMP3	AsDMP14	WGD/segmental	0.34523	NaN	NaN	
AsDMP4	AsDMP18	WGD/segmental	0.037855	0.0854	0.443265	
AsDMP4	AsDMP28	WGD/segmental	0.046803	0.114023	0.410471	
AsDMP5	AsDMP31	WGD/segmental	0.037644	0.103329	0.364314	
AsDMP5	AsDMP33	WGD/segmental	0.029288	0.152551	0.191988	
AsDMP6	AsDMP27	WGD/segmental	0.043386	0.064124	0.676584	
AsDMP6	AsDMP30	WGD/segmental	0.038638	0.081658	0.473172	
AsDMP7	AsDMP8	WGD/segmental	0.035414	0.089984	0.393563	
AsDMP7	AsDMP13	WGD/segmental	0.003156	0.063771	0.049493	
AsDMP8	AsDMP13	WGD/segmental	0.033273	0.109512	0.303831	
AsDMP10	AsDMP22	WGD/segmental	0.059639	0.350143	0.170326	
AsDMP11	AsDMP17	WGD/segmental	0.032496	0.128036	0.253804	
AsDMP11	AsDMP23	WGD/segmental	0.037483	0.125291	0.29917	
AsDMP15	AsDMP20	WGD/segmental	0.031438	0.084768	0.370873	
AsDMP15	AsDMP32	WGD/segmental	0.0463	0.25935	0.178524	
AsDMP17	AsDMP23	WGD/segmental	0.016389	0.050315	0.325726	
AsDMP18	AsDMP28	WGD/segmental	0.012423	0.04846	0.25635	
AsDMP19	AsDMP25	WGD/segmental	0.011719	0.100388	0.116737	
AsDMP19	AsDMP26	WGD/segmental	0.011714	0.077808	0.150555	
AsDMP20	AsDMP32	WGD/segmental	0.052084	0.305306	0.170598	
AsDMP25	AsDMP26	WGD/segmental	0	0.034058	0	
AsDMP27	AsDMP30	WGD/segmental	0.069509	0.108539	0.64041	
AsDMP31	AsDMP33	WGD/segmental	0.012844	0.069892	0.183765	
AsDMP11	AsDMP12	Tendem	0.106861	0.351275	0.304209	
AsDMP20	AsDMP21	Tendem	0.060096	0.281151	0.21375	
AsDMP23	AsDMP24	Tendem	0.11315	0.303374	0.372974	
AsDMP28	AsDMP29	Tendem	0.026374	0.119097	0.221446	

Cis-element analysis of AsDMP gene promotors

Gene expression was typically regulated by cis-elements in the upstream promoter sequence. Exploring the cis-regulatory elements contained within the promoter region of the AsDMP gene will help to understand the regulatory mechanism of the DMP gene and speculate on its potential functions. We used the PlantCARE database to perform a predictive analysis of promoter cis-regulatory elements. Based on their roles and functions, cis-regulatory elements are categorized as follows: hormone-responsive elements, which include auxin responsive elements, gibberellin-responsive elements, abscisic acid (ABA)-responsive elements, salicylic acid-responsive elements, and MeJA-responsive elements. Abiotic stress response elements include those responsive to low temperature, elements involved in defense and stress responses, MYB binding sites (MYBHv1, light response, drought and flavonoid biosynthetic regulation), and elements specific to anaerobic induction and hypoxia response. Growth and development-related regulatory elements include light-responsive elements, meristem expression-related elements, phytochrome-responsive elements, circadian rhythm control elements, cell cycle regulatory elements, and endosperm expression and seed-specific regulatory elements. Other responsive elements include AT-DNA (ATBP-1) binding sites, protein binding sites, activator mediated activation elements, and regulatory elements in zein metabolism.

Among the cis-elements involved in plant growth and development, light-responsive elements are the most abundant. All AsDMP genes, except AsDMP10, contain light-responsive elements that are widely distributed in their promoter regions. Elements related to endosperm expression are located in the promoter regions of AsDMP13, AsDMP15, AsDMP16, AsDMP21, AsDMP22, AsDMP29, AsDMP32, and AsDMP33. Seed-specific regulatory elements are located in the promoter regions of AsDMP5, AsDMP6, AsDMP7, AsDMP8, AsDMP11, AsDMP12, AsDMP13, AsDMP15, AsDMP17, AsDMP20, AsDMP21, AsDMP23, AsDMP24, AsDMP27, AsDMP29, AsDMP31 and AsDMP33.

Almost all promoters contain multiple hormone response elements, but these elements are not closely related to their subfamilies (Fig. 9). Among them, cis-acting elements responsive to MeJA were the most abundant in the AsDMP gene promoter regions, with 32 of the AsDMP gene promoter regions containing at least one MeJA response element. ABA-responsive elements are also widely present in the promoter regions of AsDMP genes, with 29 AsDMP family members having at least one ABA-responsive element in their promoters. Stress related cis-regulatory elements are also widely distributed in the promoter regions of AsDMP genes. Among the cis-acting elements related to abiotic stress, MYB elements are the most prevalent. Most AsDMP members contain one or more MYB elements in their promoters, which are involved in drought response, photo-response and the regulation of flavonoid biosynthesis genes. Twenty AsDMP genes are responsive to low temperatures, and thirteen AsDMP genes respond to defense and stress. In addition, some cis-acting elements are essential for hypoxia and anaerobic induction. These results indicate that the transcription of AsDMP genes may be influenced by multiple environmental factors.

Fig. 9 Cis-regulatory elements in the promoters of AsDMP gene families. Different colors represent the different types of cis-elements

Expression patterns of DMP gene in Oat at different tissue and developmental stages

Utilizing A. sativa transcriptome data, we analyzed the expression pattern of the AsDMP gene across various tissues and developmental stages, including spikes, roots, and leaves during seedling development, and seeds at early, middle and late stages of development (Fig. 10). According to the transcriptome results, AsDMP5, AsDMP6, AsDMP31, and AsDMP33 were not expressed in any of the above tissues. Among AsDMP1, AsDMP2, AsDMP3, and AsDMP29, AsDMP3 was not expressed in leaves, while AsDMP29 was not expressed in both ears and leaves but was expressed in other tissues. The expression of AsDMP1 and AsDMP3 was initially down-regulated and then up-regulated during the early, middle and late stages of seed development. In contrast, AsDMP2 was consistently up-regulated, and AsDMP29 was consistently down-regulated. AsDMP4 is expressed only during the mid-development of seeds, with no expression at the early or late stages. AsDMP7 and AsDMP8 were only expressed in spikes, suggesting a potential role in spike development or fruit formation. AsDMP27 was expressed solely in roots, indicating a possible involvement in root growth and development. AsDMP9, AsDMP10, AsDMP13, AsDMP14, AsDMP15, AsDMP16, AsDMP22, AsDMP28, and AsDMP30 were expressed at various stages of seed development. AsDMP19, AsDMP25, and AsDMP26 were expressed in spikes, roots, and leaves, and across all stages of seed development, showing an initial up-regulation followed by down-regulation throughout the seed development period. Interestingly, the expression of AsDMP25 and AsDMP26 was the highest among the 33 AsDMP genes during the middle stage of seed development. At this stage, the expression levels of these two genes were 4.2-fold and 2.3-fold higher compared to the early stage, and 9-fold and 4.7-fold higher compared to the late stage. In summary, it is hypothesized that among the 17 genes expressed during seed development, seven genes (AsDMP1, AsDMP2, AsDMP3, AsDMP19, AsDMP25, AsDMP26, AsDMP29) are involved throughout the entire seed development process. In contrast, two genes (AsDMP4 and AsDMP14) are specifically active during mid-seed development, while four genes (AsDMP9, AsDMP13, AsDMP15, and AsDMP30) are primarily involved in late seed development.

Fig. 10 Analysis of the expression pattern of AsDMP gene in different tissues and developmental stages. The expression levels of AsDMP genes were log2 transformed. Red or blue indicates the difference in expression levels for each gene

Expression analysis of DMP gene in response to high temperature and aging of oat seeds

To further investigate the expression of AsDMP genes under natural aging and artificial high-temperature conditions, we selected 10 genes from the AsDMP gene family (AsDMP1, AsDMP2, AsDMP3, AsDMP10, AsDMP19, AsDMP22, AsDMP25, AsDMP26, AsDMP28, and AsDMP29) for qPCR analysis (Fig. 11). This selection was based on transcriptome analysis and the observed expression changes of AsDMP genes during seed development. The qPCR results showed that the expression of AsDMP1 and AsDMP19 was up-regulated under both natural and artificial aging conditions, while the expression of AsDMP22 was consistently down-regulated in both aging treatments. This indicates that AsDMP1 and AsDMP19 are involved in regulating seed senescence and vigor loss in A. sativa under both natural and artificial aging conditions. Conversely, AsDMP22 contributes to delaying or reducing seed senescence under both natural aging and high-temperature artificial aging conditions. It is important to highlight that the expressions of AsDMP28 and AsDMP29 genes are observed only under artificial aging treatment, indicating that their expressions are induced under high temperatures but not by natural aging.

Fig. 11 Relative expression of AsDMP under natural and artificial aging treatments. The data represent the means of three biological replicates ± SEM. B1: Control check (CK); B2: Seeds stored naturally for 1 years; B3: Seeds stored naturally for 2 years; B4: Seeds stored naturally for 3 years; AB1: Seeds artificially aged for 24 h; AB2: Seeds artificially aged for 48 h; AB3: Seeds artificially aged for 72 h; AB4: Seeds artificially aged for 96 h. Note Different letters represent significant differences (P < 0.05)

Discussion

As a membrane protein unique to green plants, the DMP gene family has only been identified in a limited number of studies. Currently, there are no reports on the analysis of DMP genes in A. sativa. This study used multiple bioinformatics approaches to identify a total of 33 DMP family members in the A. sativa genome. The number of AsDMP genes identified is more than those in A. thaliana, Z. mays, O. sativa, and S. bicolor, but fewer than the number of DMP genes found in G. hirsutum. As an allohexaploid, the A. sativa genome size is 11Gb, whereas the genome sizes of A. thaliana, Z. mays, O. sativa, and S. bicolor are 125 Mb, 2300 Mb, 430 Mb, and 709 Mb, respectively. The number of DMPs in A. sativa (33 genes) is only 3.3 times that of A. thaliana (10 genes), 2.2 times that of Z. mays (15 genes), 1.7 times that of O. sativa (20 genes), and 2.2 times that of S. bicolor (15 genes). In this case, it seems that there is no direct correlation between the number of DMP genes and genome size in these plants. This variation is likely due to differences in genome size and gene duplication during plant evolution, A. sativa possesses a large genome and a high content of repetitive sequences [35]. This highlights the genomic expansion and complexity of the DMP gene family in A. sativa.

Determining the physical and chemical properties of AsDMP genes, and understanding their protein structure, chromosomal distribution, evolutionary relationships, conserved domains, cis-regulatory elements, and gene expression patterns, is crucial for exploring the functional diversity of the DMP gene and enhancing seed viability. The substantial disparities in the physicochemical properties among DMP members, coupled with the existence of divergent conserved motifs, indicate that during the evolutionary process, DMP genes have undergone modifications in their intrinsic properties. This evolutionary diversification implies that within the context of A. sativa growth and development, different DMP genes could potentially be involved in a variety of distinct biological functions, reflecting their adaptability and functional specialization over time. Prediction of the subcellular localization of AsDMP proteins revealed that all proteins were located at the cell membrane, is consistent with the known function of DMP proteins. AsDMP14, AsDMP15, AsDMP19, AsDMP21, AsDMP24, AsDMP25, AsDMP26, and AsDMP32 were found to be localized not only in the cell membrane but also in the extracellular space and chloroplasts. This indicates that DMP are involved in various biological processes and exhibit diverse mechanisms in response to adversity. Differences in subcellular localization also highlight the functional variability among AsDMP members. Similar to other aging-related genes, in addition to inhibiting seed aging and improving seed storage tolerance, these proteins are also involved in various other biological processes. For example, small heat shock proteins (sHSPs) are involved not only in seed aging but also in adversity stress, seed germination, pollen development, and fruit ripening [36, 37]. LOX (lipoxygenase, LOX) regulates plant development and synthesizes signaling substances such as phytodienoic acid, jasmonic acid, and abscisic acid in O. sativa [38, 39]. PLD (phospholipase D, PLD) is involved in numerous processes in A. thaliana such as plant growth and development, interactions between phytohormones and abiotic stress signals, defense against fungal pathogens, and stomatal closure [40–45]. This suggests that most aging-related genes are multifunctional. In addition, studies have shown that several biological stresses seem to induce the transcription of DMP1. This gene responds moderately to strongly to pathogens such as Botrytis cinerea and Phytophtora infestans, as well as to both virulent and avirulent strains of Pseudomonas syringae. It also reacts to bacterial elicitors such as Flg22, HrpZ and NPP1 [11]. These findings suggest that DMP may be involved in the plant immune system.

Conserved motif analysis showed that three motifs exist in all AsDMPs, while other motifs only exist in specific genes. These unique motifs are a key factor in the functional differentiation of AsDMP proteins. Gene structure analysis revealed that most AsDMP genes lack introns, a pattern similar to that observed in the DMP gene families of G. max and G. hirsutum [9, 17]. It is speculated that these genes may have specialized functions. Increased genetic sequencing suggests that ancestral eukaryotes initially possessed intron-rich genes, and that most eukaryotes experienced a loss of introns during the course of evolution [46]. The higher proportion of intron-less genes in A. sativa suggests that this species may have also experienced intron loss events during evolution [47].

Protein secondary structure is a key factor in predicting protein function, as it directly influences protein stability [20]. This study found that AsDMP proteins predominantly feature random coil and α-helix structures. Variations in the proportions of α-helix, extended strand, random coil and β-turn lead to differences in the spatial folding of proteins, supporting the functional diversity among DMP members. In the phylogenetic analysis, subfamilies I, III, IV, and V all contain DMP members from the five species, whereas subfamily II includes DMP members from four species excluding A. sativa, suggesting that they may have originated from a common ancestor. Tandem duplication and WGD/segmental duplication are key factors in gene doubling, gene functional specificity and diversification. While promoting the expansion of eukaryotic gene families, these processes may also lead to gene functional redundancy [48, 49]. AsDMP has four pairs of genes that have undergone tandem duplication during the evolution of A. sativa, while 31 pairs have experienced WGD/segmental duplication events. WGD/segmentation duplication may be the main reason for the expansion of the AsDMP gene family, originating from the WGD event in A. sativa [35]. This result is consistent with the research on G. hirsutum DMP genes [17]. In addition, the Ka/Ks ratio for all duplicated AsDMP genes is less than 1, indicating that these genes have undergone strong purifying selection during the evolution of A. sativa. This suggests that the functional constraints on AsDMP genes mainly come from purifying selection. However, the Ka/Ks ratios for most gene pairs range from 0 to 0.49, indicating that DMP gene pairs tend to be conserved throughout evolution [50].

Gene expression is typically regulated by cis-elements located in the upstream promoter region. These cis-elements, located in non-coding DNA upstream of the gene transcription start site, regulate gene expression in response to various environmental conditions or specific tissues. Hormone and stress response elements are the main functional factors detected in the promoter regions of the AsDMP gene, similar to the results for cis-elements in the DMP gene of G. hirsutum [17]. This study analyzed the expression of AsDMP genes under stress during seed aging, but the response of AsDMP genes to hormones should also be concerned. The interaction between hormones and redox signaling plays a key role in regulating plant resistance, leaf senescence, seed germination, seed development, and seed longevity [51–53]. Plant growth and environmental adaptation are regulated by various combinations of cis-elements, with only a small set of responsive genes being regulated by a single cis-element [54]. GA, ABA, SA, MeJA, and IAA responsive elements, along with stress-responsive elements, may play an important role in regulating stress resistance and development. In addition, seed-specific regulatory elements were identified in 17 of the AsDMP genes, suggesting that these specific genes may play a vital role in regulating seed vigor. These highly diverse cis-regulatory elements in the promoter region of AsDMP genes may also reflect the functional divergence at the transcriptional level. Expression profiling is essential for understanding gene functions and identifying candidate genes. Genes that are specifically expressed in various tissues often have distinct functions. We identified 17 AsDMP genes expressing during seed development, suggesting their involvement in the regulation of seed vigor. Overall, AsDMP genes showed diverse expression patterns across different tissues and stages of seed development in A. sativa, indicating their multiple roles in A. sativa development.

Currently, it is widely accepted that seed aging and deterioration are primarily due to lipid peroxidation caused by free radicals [55, 56]. This has been confirmed in various plant seeds, such as Zoysia japonica Steud [57], Ulmus pumila [58] and Jatropha curcas [59]. It has also been demonstrated in other aging-related genes, such as sHSP, that they can enhance tolerance to oxidative stress by protecting photosystem II and increasing peroxidase (POD) activity [60]. In this study, we analyzed the expression of DMP genes in A. sativa seeds under high temperature and aging stress. The results showed that AsDMP1 and AsDMP19 were up-regulated and expressed in response to both natural and artificial aging treatments. The endoplasmic reticulum (ER) contains a variety of antioxidant enzymes, such as peroxidases and GR, which can directly decompose reactive oxygen species (ROS), preventing oxidative damage. However, the expression of the DMP gene triggers a series of membrane remodeling events that affect the structure of the ER and vacuoles. These changes lead to the disruption of the entire ER network and vacuolar integrity, causing a massive accumulation of ROS and oxidative damage, which in turn leads to aging [6, 7]. This may be the primary reason for DMP-induced aging. On the other hand, studies have shown that Jasmonic Acid (JA) acts as a positive regulator in the aging process [12, 61]. It was found that after the overexpression of DMP1, CYP94B3, which mediates the inactivation and degradation of biologically active Jasmonic Acid-Isoleucine conjugate (JA-Ile), shows enhanced regulatory activity. This could potentially lead to the accumulation of JA-Ile, resulting in aging [11]. However, down-regulation was observed after three years of natural storage. It was hypothesized that this may be due to the extended storage period of naturally aged seeds, which resulted in the accumulation of harmful substances such as ROS and peroxides. These substances can induce membrane lipid peroxidation, damage the internal structure and function of the seeds, cause chromosomal aberrations and DNA damage, and compromise gene integrity, leading to decreased expression of AsDMP [62, 63]. In contrast, while AsDMP22 was down-regulated in both natural and artificial aging treatments, its expression was slightly up-regulated in the artificial aging treatment. It is speculated that high temperature aging treatment leads to increased hydrogen peroxide (H2O2) levels in mitochondria and damage to mitochondrial structure. In addition, during mitochondrial aging, changes in ROS scavenging enzymes and antioxidant levels result in ROS accumulation within seed embryos mitochondria, causing oxidative damage and inducing gene expression [64]. Interestingly, the AsDMP28 and AsDMP29 genes are expressed only under artificial aging treatments, indicating that their expressions are induced by high temperatures and are less associated with natural seed deterioration.

Phytohormones are key signaling compounds that regulate plant growth, development, and responses to environmental stresses [65]. During plant senescence, abscisic acid, salicylic acid or jasmonic acid alter the expression of aging-related genes, thereby regulating the aging process [10]. Many regulatory elements responsive to plant hormones are found in the promoter regions of DMP genes [9, 17]. This suggests that DMP expression may be closely related to hormones. However, the mechanism by which hormones regulate DMP and how AsDMP genes influence high-temperature aging require further investigation.

Conclusions

In this study, we identified 33 AsDMP members in A. sativa, which are unevenly distributed across 17 chromosomes and classified into five subfamilies based on phylogenetic relationships. The study analyzed the basic characteristics, protein structures, subcellular localization, conserved motifs, and gene locations of these DMP members, providing insights into the evolutionary relationships within the DMP gene family. Most AsDMP genes lack introns, indicating a highly conserved gene structure. While DMP members within the same subfamily exhibit broad similarities, differences in motif composition among some proteins in different subfamilies, or even within the same subfamily, suggest both functional similarities and differences. The qRT-PCR analysis identified AsDMP genes (AsDMP1, AsDMP19, and AsDMP22) that may play key roles in regulating A. sativa seed senescence and maintaining redox homeostasis. These genes are potential candidates for germplasm breeding studies aimed at enhancing A. sativa anti-aging. However, this study only provides a preliminary characterization of the DMP genes in A. sativa. Further functional validation is needed to fully understand the roles of these genes in different biological processes and to elucidate the exact mechanism by which DMP genes regulate seed senescence. Despite this, this study provides valuable insights into factors affecting seed vigor and presents new opportunities for developing aging-resistant A. sativa varieties.

Materials and methods

Identification of DMP protein family members

The genome sequences of Z. mays (version 1.1), O. sativa (version 7.0), and S. bicolor (Version 3.1) were obtained from phytozome (https://phytozome-next.jgi.doe.gov/). The A. sativa (version 1.1) genome sequence as well as annotation files were downloaded from the Ensembl Plants database (https://plants.ensembl.org/index.html), while the published A. thaliana AtDMP proteins were retrieved from the A. thaliana Information Resource (TAIR, version 10, http://www.arabidopsis.org). The amino acid sequences of AtDMPs were used as query sequences in a blastp search to identify candidate sequences in A. sativa. Subsequently, Interproscan 5 (http://www.ebi.ac.uk/interpro/) and CDD (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) were used to search for the DMP domain (IPR007770, pfam05078) in the candidate sequences, leading to the identification of the DMP sequences [66, 67]. ExPAsy ProtParam (https://web.expasy.org/protparam/) and ExPAsy ProtScale (https://web.expasy.org/protscale/) were used to analyze the physical and chemical properties and hydrophilicity of the AsDMPs proteins [68]. The subcellular localization of each gene was predicted using the CELLO v2.5 server [69]. The number of transmembrane domains in AsDMP proteins was predicted using the Deep TMHMM tool (https://dtu.biolib.com/DeepTMHMM) [70]. Signal peptide amino acid sequence of AsDMP were forecasted using SignaIP-6.0 (https://services.healthtech.dtu.dk/services/SignalP-6.0/) [71].

Prediction of protein structure of Oat DMP gene family

The secondary structure of proteins was predicted using the SOPMA tool (https://npsa-prabi.ibcp.fr/cgi-bin/ npsa_ automat. pl? page = npsa%20_sopma.html) [72]. The tertiary structure of proteins was predicted using the SWEISS-MODEL tool (https://swissmodel.expasy.org) [73].

Phylogenetic analysis of DMPgene

We selected Z. mays, O. sativa, and S. bicolor, which are in the same grass family as A. sativa, along with the model plant A. thaliana, to construct an unrooted phylogenetic tree. This tree aims to explore the phylogenetic relationships and classification of AsDMP genes in A. sativa. Based on the reported DMP gene IDs for Z. mays, O. sativa and S. bicolor, the corresponding DMP sequences were extracted from their respective genomic sequences [17]. The obtained AsDMP sequences were compared with the amino acid sequences of A. thaliana, Z. mays, O. sativa and S. bicolor using ClustalW in MEGA 11 software. A phylogenetic tree was constructed using neighbor-joining (NJ) method in MEGA 11 with 1000 bootstrap replicates [74]. Utilizing EvolView v3 for the visualization and beautification of phylogenetic trees [75].

Analysis of the conserved protein motifs and gene structure

Conserved motifs were predicted using the MEME (Multiple Expectation Maximization for Motif Elicitation, version 5.5.5) tool (http://meme-suite.org/tools/meme) [76], with the number of output motifs set to 10 and other parameters at their defaults settings. The conserved structural domains in AsDMP sequences were identified using Batch CD-Search (https://www.ncbi.nlm.nih.gov/Structure/bwrpsb/bwrpsb.cgi) [77]. The distribution of the motifs, along with the phylogenetic tree and gene structures, was visualized using TBtools software [78].

Chromosomal localization and collinearity of oat DMPs gene

The Gene Density Profile tool in TBtools was used to determine the gene density across A. sativa chromosomes, and Gene Location Visualize from GTF/GFF was employed to visualize the chromosomal locations of AsDMP genes. To analyze the interspecific collinearity between the DMP gene families of A. sativa, Z. mays and S. bicolor, One Step MCScanX in TBtools was utilized, and the results were visualized using the Multiple Synteny Plot program [78].

Calculation of selection pressure for duplicated gene pairs

Duplicated DMP gene pairs were used to calculate non-synonymous (Ka) and synonymous substitution rates (Ks) using the Ka/Ks calculator in the TBtools software [78]. A Ka/Ks ratio > 1 indicates positive selection, a ratio = 1 indicates neutral selection, and a ratio < 1 suggests negative or purifying selection. The selection pressure of each duplicated DMP gene pair was then estimated [17].

Analysis of DMPs promoter regions and differentially expressed genes of RNA-Seq data

We used TBtools software to extract the 2000 bp DNA sequence upstream of the AsDMP genes from the A. sativa genome. Cis-regulatory elements related to phytohormones, plants growth and development and abiotic stress in promotor regions of DMP genes were predicted and analyzed using the PlantCARE website (https://bioinformatics.psb.ugent.be/webtools/plantcare/html/) for prediction and analysis of [79]. RNA-Seq data for analyzing expression patterns in different tissues or developmental stages were obtained from the Plant Genomics & Phenomics Research Data Repository (10.5447/ipk/2022/2) [80]. The heat map, along with the phylogenetic tree and cis-elements, was generated using TBtools software [78].

qRT-PCR of AsDMPs

The materials tested were A. sativa “Baiyan No.7” varieties, naturally stored for 0, 1, 2 and 3 years at an average annual temperature of approximately 10 °C. Seeds harvested in 2023 were subjected to artificial aging under high temperature and high humidity conditions. Initially, seed moisture content was adjusted to 10%~14% and placed in an aging chamber set at 45 °C with a relative humidity of 95%. Aging durations were 24, 48, 72, and 96 h. After aging treatments, seeds are dried until their moisture content returned to the original state and then stored at 4 °C [81]. Unaged seeds served as the control check (CK).

The Total RNA extraction kit (TIANGEN, DP419, China) was used to extract RNA from A. sativa seeds. RNA quality was assessed by 1% agarose gel electrophoresis, while RNA concentration and purity were determined by the Nanopro 2010/2020 ultra-micro ultraviolet spectrophotometer (Beijing, China). Reverse transcription of RNA was performed using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, RR047A, China).

The specific primers for AsDMPs used in the qRT-PCR analysis are detailed in Table 4. qRT-PCR analysis was conducted with the TIANGEN fluorescence quantitative kit (FP206-02). The reaction mix was prepared in a total volume of 20 µL, consisting of 5 µL template, 1.6 µL primer, 3.4 µL ddH2O, and 10 µL of 2×SuperReal PreMix Plus. The qRT-PCR conditions were as follows: pre-denaturation at 95℃ for 15 min, followed by 40 amplification cycles including denaturation at 95℃ for 10 s and annealing at 58℃ for 30 s. The solution curve analysis was performed with the following steps: 1 s at 95℃, 15 s at 65℃, and 1 s at 95℃. AsActin (KP257585.1) was sed as the internal reference gene. Each experiment was independently repeated three times, and the relative expression levels of AsDMP genes were measured using the 2−ΔΔCt method [82].

Table 4 Sequences of primers used in qRT-PCR

Name	Forward primer (5′-3′)	Reverse primer (5′-3′)	
AsDMP1	CAACGCAGCACGAATCAG	TCGTCTACGAGGATCTGGTC	
AsDMP2	TCGTCACCGTCATGGTCTT	ACCGGGTAGAAGCATGACAC	
AsDMP3	GGTAAGGTTCCTCGACCTC	GAAGCATGACACCACGTTC	
AsDMP10	ATGAACCTTGTCCTGAGTGG	AGATGGCGAAAGTCAGGATG	
AsDMP19	CACGGTCTTCATGTTCCAGT	CGCTGAGGACCTTGTTGTAT	
AsDMP22	ATTCTGACCTTCGCCATCTT	GGTCAGGACGTGGTTGATG	
AsDMP25	CCTTCTCATCCTTCACCGAC	AAGACCAAGAGCGAGAGC	
AsDMP26	TCTCGCTCTTGGTGTTCG	ACATCATGAAGGCGTAGCTG	
AsDMP28	GTCAGGTACGGCATCGTAA	AACACGATCACGGAGAAGAG	
AsDMP29	CCCTGAGGGATTTCTCAAAGTA	CGAACACGATCACGGAGAA	
AsActin(KP257585.1)	CATTGGTATGGAAGCTGCTG	CACTGAGCACAATGTTACCG	

Statistical analysis

One-way analysis of variance (ANOVA) was performed using IBM SPSS Statistics 23.0 software, with data presented as means ± standard errors. Mapping was conducted using Origin 2021 software (OriginLab Corporation, 2021).

Acknowledgements

The authors are thankful to teachers, such as Jiangang Chen, Director of the Laboratory, for providing the required laboratory facilities. We thank Yong Wang and Xin Li for their valuable comments and strong support for the experiment.

Author contributions

Y.M, H.L., G.Z., J.W., K.N. and X.Z. conceived and designed the project; J.W. provided the experimental materials; Y.M. conducted the experiments and wrote the first draft; H.L. and R.Z. reviewed and revised the first draft, and H.L. provided financial support for the experiments; R.Y. conducted the experiment instruction. All authors edited and approved the final manuscript.

Funding

This research was funded by China National Natural Science Foundation (32360344), Key Laboratory of Grassland Ecosystem Ministry of Education Project (KLGE2022-16), and Gansu Agricultural University Youth Tutor Fund (GAU-QDFC-2023-01), National Key Research and Development Program Foundation (2022YFD1100502), Fund by China scholarship council, Tibet Autonomous Region Science and Technology Project (XZ202201ZY0014N).

Data availability

The genome sequences of Zea mays (version 1.1), Oryza sativa (version 7.0), and Sorghum bicolor (Version 3.1) were acquired from phytozome (https://phytozome-next.jgi.doe.gov/). The Avena sativa genome sequence as well as annotation files were downloaded from the Ensembl Plants database (https://plants.ensembl.org/index.html). The published Arabidopsis AtDMP protein sequence was downloaded from the TAIR Web site (http://www.arabidopsis.org). RNA-Seq data were obtained from the Plant Genomics & Phenomics Research Data Repository (10.5447/ipk/2022/2) to analyse expression patterns in different tissues or at different developmental periods in the same tissue. In this study, Avena sativa seeds were obtained from Gansu Agricultural University.

Declarations

Ethics approval and consent to participate

In this study, Avena sativa seeds were obtained and collected from Gansu Agricultural University. Professor Huan Liu has gained the permission from Gansu Agricultural University to perform a breeding trial.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Abbreviations

DMP Domain of unknown function 679 membrane protein

dPCD Development-programmed cell death

BFN1 Bifunctional nuclease1

PASPA3 Putative aspartic protease A3

RNS3 Ribonuclease3

CEP1 Cystein endopepditase1

EXI1 Exitus1

GR Glutathione reductase

CK Control check

NaN Not a number

Ka/Ks The ratio of the number of nonsynonymous substitutions per nonsynonymous site (Ka) to the number of synonymous substitutions per synonymous site (Ks)

ABA Abscisic acid

sHSP Small heat shock protein

LOX Lipoxygenase

PLD Phospholipase D

POD Peroxidase

JA Jasmonic acid

ROS Reactive oxygen species

H2O2 Hydrogen peroxide

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yuan Ma and Huan Liu contributed equally to this work and are considered co-first authors.
==== Refs
References

1. Xicluna J Lacombe B Dreyer I Alcon C Jeanguenin L Sentenac H Increased functional diversity of Plant K + channels by preferential heteromerization of the Shaker-like subunits AKT2 and KAT2 J Biol Chem 2007 282 486 94 10.1074/jbc.M607607200 17085433
Xicluna J, Lacombe B, Dreyer I, Alcon C, Jeanguenin L, Sentenac H, et al. Increased functional diversity of Plant K + channels by preferential heteromerization of the Shaker-like subunits AKT2 and KAT2. J Biol Chem. 2007;282:486–94. 10.1074/jbc.M607607200.17085433 10.1074/jbc.M607607200
2. Yamada K Osakabe Y Mizoi J Nakashima K Fujita Y Shinozaki K Functional analysis of an Arabidopsis thaliana Abiotic stress-inducible facilitated diffusion transporter for Monosaccharides J Biol Chem 2010 285 1138 46 10.1074/jbc.M109.054288 19901034
Yamada K, Osakabe Y, Mizoi J, Nakashima K, Fujita Y, Shinozaki K, et al. Functional analysis of an Arabidopsis thaliana Abiotic stress-inducible facilitated diffusion transporter for Monosaccharides. J Biol Chem. 2010;285:1138–46. 10.1074/jbc.M109.054288.19901034 10.1074/jbc.M109.054288
3. Chen Y Weckwerth W Mass Spectrometry untangles Plant membrane protein signaling networks Trends Plant Sci 2020 25 930 44 10.1016/j.tplants.2020.03.013 32359835
Chen Y, Weckwerth W. Mass Spectrometry untangles Plant membrane protein signaling networks. Trends Plant Sci. 2020;25:930–44. 10.1016/j.tplants.2020.03.013.32359835 10.1016/j.tplants.2020.03.013
4. Chen Y Heazlewood JL Organellar Proteomic profiling to analyze membrane trafficking pathways Trends Plant Sci 2021 26 299 300 10.1016/j.tplants.2020.11.008 33309103
Chen Y, Heazlewood JL. Organellar Proteomic profiling to analyze membrane trafficking pathways. Trends Plant Sci. 2021;26:299–300. 10.1016/j.tplants.2020.11.008.33309103 10.1016/j.tplants.2020.11.008
5. Cyprys P Lindemeier M Sprunck S Gamete fusion is facilitated by two sperm cell-expressed DUF679 membrane proteins Nat Plants 2019 5 253 7 10.1038/s41477-019-0382-3 30850817
Cyprys P, Lindemeier M, Sprunck S. Gamete fusion is facilitated by two sperm cell-expressed DUF679 membrane proteins. Nat Plants. 2019;5:253–7. 10.1038/s41477-019-0382-3.30850817 10.1038/s41477-019-0382-3
6. Kasaras A Kunze R Expression, localisation and phylogeny of a novel family of plant-specific membrane proteins Plant Biol 2010 12 140 52 10.1111/j.1438-8677.2010.00381.x 20712629
Kasaras A, Kunze R. Expression, localisation and phylogeny of a novel family of plant-specific membrane proteins. Plant Biol. 2010;12:140–52. 10.1111/j.1438-8677.2010.00381.x.20712629 10.1111/j.1438-8677.2010.00381.x
7. Kasaras A Melzer M Kunze R Arabidopsis senescence-associated protein DMP1 is involved in membrane remodeling of the ER and tonoplast BMC Plant Biol 2012 12 54 10.1186/1471-2229-12-54 22530652
Kasaras A, Melzer M, Kunze R. Arabidopsis senescence-associated protein DMP1 is involved in membrane remodeling of the ER and tonoplast. BMC Plant Biol. 2012;12:54. 10.1186/1471-2229-12-54.22530652 10.1186/1471-2229-12-54
8. Takahashi T Mori T Ueda K Yamada L Nagahara S Higashiyama T The male gamete membrane protein DMP9/DAU2 is required for double fertilization in flowering plants Development 2018 145 dev170076 10.1242/dev.170076 30487178
Takahashi T, Mori T, Ueda K, Yamada L, Nagahara S, Higashiyama T, et al. The male gamete membrane protein DMP9/DAU2 is required for double fertilization in flowering plants. Development. 2018;145:dev170076. 10.1242/dev.170076.30487178 10.1242/dev.170076
9. Nawade B Bosamia TC Lee JH Jang JH Lee OR Genome-wide characterization of the soybean DOMAIN OF UNKNOWN FUNCTION 679 membrane protein gene family highlights their potential involvement in growth and stress response Front Plant Sci 2023 14 1216082 10.3389/fpls.2023.1216082 37745995
Nawade B, Bosamia TC, Lee JH, Jang JH, Lee OR. Genome-wide characterization of the soybean DOMAIN OF UNKNOWN FUNCTION 679 membrane protein gene family highlights their potential involvement in growth and stress response. Front Plant Sci. 2023;14:1216082. 10.3389/fpls.2023.1216082.37745995 10.3389/fpls.2023.1216082
10. Van Der Graaff E Schwacke R Schneider A Desimone M Flügge U-I Kunze R Transcription Analysis of Arabidopsis Membrane Transporters and hormone pathways during Developmental and Induced Leaf Senescence Plant Physiol 2006 141 776 92 10.1104/pp.106.079293 16603661
Van Der Graaff E, Schwacke R, Schneider A, Desimone M, Flügge U-I, Kunze R. Transcription Analysis of Arabidopsis Membrane Transporters and hormone pathways during Developmental and Induced Leaf Senescence. Plant Physiol. 2006;141:776–92. 10.1104/pp.106.079293.16603661 10.1104/pp.106.079293
11. Kasaras A. Characterization of the senescence-associated membrane protein DMP1 and the DMP family in Arabidopsis thaliana. 2013. 10.17169/refubium-16407
12. Jiang Y Liang G Yang S Yu D Arabidopsis WRKY57 functions as a node of convergence for Jasmonic acid– and auxin-mediated signaling in Jasmonic Acid–Induced Leaf Senescence Plant Cell 2014 26 230 45 10.1105/tpc.113.117838 24424094
Jiang Y, Liang G, Yang S, Yu D, Arabidopsis. WRKY57 functions as a node of convergence for Jasmonic acid– and auxin-mediated signaling in Jasmonic Acid–Induced Leaf Senescence. Plant Cell. 2014;26:230–45. 10.1105/tpc.113.117838.24424094 10.1105/tpc.113.117838
13. Kasaras A Kunze R Dual-targeting of Arabidopsis DMP1 isoforms to the tonoplast and the plasma membrane PLoS ONE 2017 12 e0174062 10.1371/journal.pone.0174062 28384172
Kasaras A, Kunze R. Dual-targeting of Arabidopsis DMP1 isoforms to the tonoplast and the plasma membrane. PLoS ONE. 2017;12:e0174062. 10.1371/journal.pone.0174062.28384172 10.1371/journal.pone.0174062
14. Zhong Y Chen B Li M Wang D Jiao Y Qi X A DMP-triggered in vivo maternal haploid induction system in the dicotyledonous Arabidopsis Nat Plants 2020 6 466 72 10.1038/s41477-020-0658-7 32415294
Zhong Y, Chen B, Li M, Wang D, Jiao Y, Qi X, et al. A DMP-triggered in vivo maternal haploid induction system in the dicotyledonous Arabidopsis. Nat Plants. 2020;6:466–72. 10.1038/s41477-020-0658-7.32415294 10.1038/s41477-020-0658-7
15. Zhong Y Liu C Qi X Jiao Y Wang D Wang Y Mutation of ZmDMP enhances haploid induction in maize Nat Plants 2019 5 575 80 10.1038/s41477-019-0443-7 31182848
Zhong Y, Liu C, Qi X, Jiao Y, Wang D, Wang Y, et al. Mutation of ZmDMP enhances haploid induction in maize. Nat Plants. 2019;5:575–80. 10.1038/s41477-019-0443-7.31182848 10.1038/s41477-019-0443-7
16. Zhong Y Wang Y Chen B Liu J Wang D Li M Establishment of a dmp based maternal haploid induction system for polyploid Brassica napus and Nicotiana tabacum J Integr Plant Biol 2022 64 1281 94 10.1111/jipb.13244 35249255
Zhong Y, Wang Y, Chen B, Liu J, Wang D, Li M, et al. Establishment of a dmp based maternal haploid induction system for polyploid Brassica napus and Nicotiana tabacum. J Integr Plant Biol. 2022;64:1281–94. 10.1111/jipb.13244.35249255 10.1111/jipb.13244
17. Zhu S Wang X Chen W Yao J Li Y Fang S Cotton DMP gene family: characterization, evolution, and expression profiles during development and stress Int J Biol Macromol 2021 183 1257 69 10.1016/j.ijbiomac.2021.05.023 33965485
Zhu S, Wang X, Chen W, Yao J, Li Y, Fang S, et al. Cotton DMP gene family: characterization, evolution, and expression profiles during development and stress. Int J Biol Macromol. 2021;183:1257–69. 10.1016/j.ijbiomac.2021.05.023.33965485 10.1016/j.ijbiomac.2021.05.023
18. Olvera-Carrillo Y, Van Bel M, Van Hautegem T, Fendrych M, Van Durme M, Huysmans M et al. A conserved core of PCD indicator genes discriminates developmentally and environmentally induced programmed cell death in plants. Plant Physiol. 2015;:pp.00769.2015. 10.1104/pp.15.00769
19. Gao Z Daneva A Salanenka Y Van Durme M Huysmans M Lin Z KIRA1 and ORESARA1 terminate flower receptivity by promoting cell death in the stigma of Arabidopsis Nat Plants 2018 4 365 75 10.1038/s41477-018-0160-7 29808023
Gao Z, Daneva A, Salanenka Y, Van Durme M, Huysmans M, Lin Z, et al. KIRA1 and ORESARA1 terminate flower receptivity by promoting cell death in the stigma of Arabidopsis. Nat Plants. 2018;4:365–75. 10.1038/s41477-018-0160-7.29808023 10.1038/s41477-018-0160-7
20. Sun S Ma W Mao P Genomic identification and expression profiling of WRKY genes in alfalfa (Medicago sativa) elucidate their responsiveness to seed vigor BMC Plant Biol 2023 23 568 10.1186/s12870-023-04597-x 37968658
Sun S, Ma W, Mao P. Genomic identification and expression profiling of WRKY genes in alfalfa (Medicago sativa) elucidate their responsiveness to seed vigor. BMC Plant Biol. 2023;23:568. 10.1186/s12870-023-04597-x.37968658 10.1186/s12870-023-04597-x
21. Sun M Sun S Jia Z Ma W Mao C Ou C Genome-wide analysis and expression profiling of Glutathione Reductase Gene Family in Oat (Avena sativa) indicate their responses to abiotic stress during seed imbibition Int J Mol Sci 2022 23 11650 10.3390/ijms231911650 36232950
Sun M, Sun S, Jia Z, Ma W, Mao C, Ou C, et al. Genome-wide analysis and expression profiling of Glutathione Reductase Gene Family in Oat (Avena sativa) indicate their responses to abiotic stress during seed imbibition. Int J Mol Sci. 2022;23:11650. 10.3390/ijms231911650.36232950 10.3390/ijms231911650
22. Malviya R Dey S Pandey A Gayen D Genome-wide identification and expression pattern analysis of lipoxygenase genes of chickpea (Cicer arietinum L.) in response to accelerated aging Gene 2023 874 147482 10.1016/j.gene.2023.147482 37187244
Malviya R, Dey S, Pandey A, Gayen D. Genome-wide identification and expression pattern analysis of lipoxygenase genes of chickpea (Cicer arietinum L.) in response to accelerated aging. Gene. 2023;874:147482. 10.1016/j.gene.2023.147482.37187244 10.1016/j.gene.2023.147482
23. Jeevan Kumar SP Rajendra Prasad S Banerjee R Thammineni C Seed birth to death: dual functions of reactive oxygen species in seed physiology Ann Bot 2015 116 663 8 10.1093/aob/mcv098 26271119
Jeevan Kumar SP, Rajendra Prasad S, Banerjee R, Thammineni C. Seed birth to death: dual functions of reactive oxygen species in seed physiology. Ann Bot. 2015;116:663–8. 10.1093/aob/mcv098.26271119 10.1093/aob/mcv098
24. Reiter R Tan D Rosales-Corral S Galano A Zhou X Xu B Mitochondria: Central Organelles for Melatonin′s antioxidant and anti-aging actions Molecules 2018 23 509 10.3390/molecules23020509 29495303
Reiter R, Tan D, Rosales-Corral S, Galano A, Zhou X, Xu B. Mitochondria: Central Organelles for Melatonin′s antioxidant and anti-aging actions. Molecules. 2018;23:509. 10.3390/molecules23020509.29495303 10.3390/molecules23020509
25. Feng L Zhu S Zhang C Bao Y Feng X He Y Identification of Maize Kernel Vigor under different accelerated aging Times using Hyperspectral Imaging Molecules 2018 23 3078 10.3390/molecules23123078 30477266
Feng L, Zhu S, Zhang C, Bao Y, Feng X, He Y. Identification of Maize Kernel Vigor under different accelerated aging Times using Hyperspectral Imaging. Molecules. 2018;23:3078. 10.3390/molecules23123078.30477266 10.3390/molecules23123078
26. Liang L Xie A Yang H Li N Ma P Wei S Quantitative Acetylome Analysis of Soft Wheat seeds during Artificial Ageing Foods 2022 11 3611 10.3390/foods11223611 36429203
Liang L, Xie A, Yang H, Li N, Ma P, Wei S, et al. Quantitative Acetylome Analysis of Soft Wheat seeds during Artificial Ageing. Foods. 2022;11:3611. 10.3390/foods11223611.36429203 10.3390/foods11223611
27. He X Bjørnstad Å Diversity of north European oat analyzed by SSR, AFLP and DArT markers Theor Appl Genet 2012 125 57 70 10.1007/s00122-012-1816-8 22350091
He X, Bjørnstad Å. Diversity of north European oat analyzed by SSR, AFLP and DArT markers. Theor Appl Genet. 2012;125:57–70. 10.1007/s00122-012-1816-8.22350091 10.1007/s00122-012-1816-8
28. Zhang M-X Bai R Nan M Ren W Wang C-M Shabala S Evaluation of salt tolerance of oat cultivars and the mechanism of adaptation to salinity J Plant Physiol 2022 273 153708 10.1016/j.jplph.2022.153708 35504119
Zhang M-X, Bai R, Nan M, Ren W, Wang C-M, Shabala S, et al. Evaluation of salt tolerance of oat cultivars and the mechanism of adaptation to salinity. J Plant Physiol. 2022;273:153708. 10.1016/j.jplph.2022.153708.35504119 10.1016/j.jplph.2022.153708
29. Xu G Guo C Shan H Kong H Divergence of duplicate genes in exon–intron structure Proc Natl Acad Sci 2012 109 1187 92 10.1073/pnas.1109047109 22232673
Xu G, Guo C, Shan H, Kong H. Divergence of duplicate genes in exon–intron structure. Proc Natl Acad Sci. 2012;109:1187–92. 10.1073/pnas.1109047109.22232673 10.1073/pnas.1109047109
30. Flagel LE Wendel JF Gene duplication and evolutionary novelty in plants New Phytol 2009 183 557 64 10.1111/j.1469-8137.2009.02923.x 19555435
Flagel LE, Wendel JF. Gene duplication and evolutionary novelty in plants. New Phytol. 2009;183:557–64. 10.1111/j.1469-8137.2009.02923.x.19555435 10.1111/j.1469-8137.2009.02923.x
31. Dai M Zhou N Zhang Y Zhang Y Ni K Wu Z Genome-wide analysis of the SBT gene family involved in drought tolerance in cotton Front Plant Sci 2023 13 1097732 10.3389/fpls.2022.1097732 36714777
Dai M, Zhou N, Zhang Y, Zhang Y, Ni K, Wu Z, et al. Genome-wide analysis of the SBT gene family involved in drought tolerance in cotton. Front Plant Sci. 2023;13:1097732. 10.3389/fpls.2022.1097732.36714777 10.3389/fpls.2022.1097732
32. Xing H Pudake RN Guo G Xing G Hu Z Zhang Y Genome-wide identification and expression profiling of auxin response factor (ARF) gene family in maize BMC Genomics 2011 12 178 10.1186/1471-2164-12-178 21473768
Xing H, Pudake RN, Guo G, Xing G, Hu Z, Zhang Y, et al. Genome-wide identification and expression profiling of auxin response factor (ARF) gene family in maize. BMC Genomics. 2011;12:178. 10.1186/1471-2164-12-178.21473768 10.1186/1471-2164-12-178
33. Chothia C Gough J Vogel C Teichmann SA Evolution of the protein repertoire Science 2003 300 1701 3 10.1126/science.1085371 12805536
Chothia C, Gough J, Vogel C, Teichmann SA. Evolution of the protein repertoire. Science. 2003;300:1701–3. 10.1126/science.1085371.12805536 10.1126/science.1085371
34. Magadum S Banerjee U Murugan P Gangapur D Ravikesavan R Gene duplication as a major force in evolution J Genet 2013 92 155 61 10.1007/s12041-013-0212-8 23640422
Magadum S, Banerjee U, Murugan P, Gangapur D, Ravikesavan R. Gene duplication as a major force in evolution. J Genet. 2013;92:155–61. 10.1007/s12041-013-0212-8.23640422 10.1007/s12041-013-0212-8
35. Peng Y Yan H Guo L Deng C Wang C Wang Y Reference genome assemblies reveal the origin and evolution of allohexaploid oat Nat Genet 2022 54 1248 58 10.1038/s41588-022-01127-7 35851189
Peng Y, Yan H, Guo L, Deng C, Wang C, Wang Y, et al. Reference genome assemblies reveal the origin and evolution of allohexaploid oat. Nat Genet. 2022;54:1248–58. 10.1038/s41588-022-01127-7.35851189 10.1038/s41588-022-01127-7
36. Lubaretz O Zur Nieden U Accumulation of plant small heat-stress proteins in storage organs Planta 2002 215 220 8 10.1007/s00425-002-0745-1 12029471
Lubaretz O, Zur Nieden U. Accumulation of plant small heat-stress proteins in storage organs. Planta. 2002;215:220–8. 10.1007/s00425-002-0745-1.12029471 10.1007/s00425-002-0745-1
37. Waters ER Vierling E Plant small heat shock proteins – evolutionary and functional diversity New Phytol 2020 227 24 37 10.1111/nph.16536 32297991
Waters ER, Vierling E. Plant small heat shock proteins – evolutionary and functional diversity. New Phytol. 2020;227:24–37. 10.1111/nph.16536.32297991 10.1111/nph.16536
38. Huang J Cai M Long Q Liu L Lin Q Jiang L OsLOX2, a rice type I lipoxygenase, confers opposite effects on seed germination and longevity Transgenic Res 2014 23 643 55 10.1007/s11248-014-9803-2 24792034
Huang J, Cai M, Long Q, Liu L, Lin Q, Jiang L, et al. OsLOX2, a rice type I lipoxygenase, confers opposite effects on seed germination and longevity. Transgenic Res. 2014;23:643–55. 10.1007/s11248-014-9803-2.24792034 10.1007/s11248-014-9803-2
39. Liao Z Wang L Li C Cao M Wang J Yao Z The lipoxygenase gene OsRCI-1 is involved in the biosynthesis of herbivore‐induced JAs and regulates plant defense and growth in rice Plant Cell Environ 2022 45 2827 40 10.1111/pce.14341 35538611
Liao Z, Wang L, Li C, Cao M, Wang J, Yao Z, et al. The lipoxygenase gene OsRCI-1 is involved in the biosynthesis of herbivore‐induced JAs and regulates plant defense and growth in rice. Plant Cell Environ. 2022;45:2827–40. 10.1111/pce.14341.35538611 10.1111/pce.14341
40. Yuan Y Yu J Kong L Zhang W Hou X Cui G Genome-wide investigation of the PLD gene family in alfalfa (Medicago sativa L.): identification, analysis and expression BMC Genomics 2022 23 243 10.1186/s12864-022-08424-9 35350974
Yuan Y, Yu J, Kong L, Zhang W, Hou X, Cui G. Genome-wide investigation of the PLD gene family in alfalfa (Medicago sativa L.): identification, analysis and expression. BMC Genomics. 2022;23:243. 10.1186/s12864-022-08424-9.35350974 10.1186/s12864-022-08424-9
41. Li L Zhang C Zhang M Yang C Bao Y Wang D Genome-wide analysis and expression profiling of the phospholipase D Gene Family in Solanum tuberosum Biology 2021 10 741 10.3390/biology10080741 34439973
Li L, Zhang C, Zhang M, Yang C, Bao Y, Wang D, et al. Genome-wide analysis and expression profiling of the phospholipase D Gene Family in Solanum tuberosum. Biology. 2021;10:741. 10.3390/biology10080741.34439973 10.3390/biology10080741
42. Guo L Devaiah SP Narasimhan R Pan X Zhang Y Zhang W Cytosolic glyceraldehyde-3-Phosphate dehydrogenases interact with phospholipase Dδ to Transduce Hydrogen Peroxide Signals in the Arabidopsis response to stress Plant Cell 2012 24 2200 12 10.1105/tpc.111.094946 22589465
Guo L, Devaiah SP, Narasimhan R, Pan X, Zhang Y, Zhang W, et al. Cytosolic glyceraldehyde-3-Phosphate dehydrogenases interact with phospholipase Dδ to Transduce Hydrogen Peroxide Signals in the Arabidopsis response to stress. Plant Cell. 2012;24:2200–12. 10.1105/tpc.111.094946.22589465 10.1105/tpc.111.094946
43. Hong Y Devaiah SP Bahn SC Thamasandra BN Li M Welti R Phospholipase Dε and phosphatidic acid enhance Arabidopsis nitrogen signaling and growth Plant J 2009 58 376 87 10.1111/j.1365-313X.2009.03788.x 19143999
Hong Y, Devaiah SP, Bahn SC, Thamasandra BN, Li M, Welti R, et al. Phospholipase Dε and phosphatidic acid enhance Arabidopsis nitrogen signaling and growth. Plant J. 2009;58:376–87. 10.1111/j.1365-313X.2009.03788.x.19143999 10.1111/j.1365-313X.2009.03788.x
44. Hong Y, Lu S. Phospholipases in Plant Response to Nitrogen and Phosphorus availability. Phospholipases Plant Signal. 2014;159–80. 10.1007/978-3-642-42011-5_9.
45. Zhao J Devaiah SP Wang C Li M Welti R Wang X Arabidopsis phospholipase Dβ1 modulates defense responses to bacterial and fungal pathogens New Phytol 2013 199 228 40 10.1111/nph.12256 23577648
Zhao J, Devaiah SP, Wang C, Li M, Welti R, Wang X. Arabidopsis phospholipase Dβ1 modulates defense responses to bacterial and fungal pathogens. New Phytol. 2013;199:228–40. 10.1111/nph.12256.23577648 10.1111/nph.12256
46. William Roy S Gilbert W The evolution of spliceosomal introns: patterns, puzzles and progress Nat Rev Genet 2006 7 211 21 10.1038/nrg1807 16485020
William Roy S, Gilbert W. The evolution of spliceosomal introns: patterns, puzzles and progress. Nat Rev Genet. 2006;7:211–21. 10.1038/nrg1807.16485020 10.1038/nrg1807
47. Pan J Zhou Q Wang H Chen Y Wang Z Zhang J Genome-wide identification and characterization of abiotic stress responsive GRAS family genes in oat (Avena sativa) PeerJ 2023 11 e15370 10.7717/peerj.15370 37187518
Pan J, Zhou Q, Wang H, Chen Y, Wang Z, Zhang J. Genome-wide identification and characterization of abiotic stress responsive GRAS family genes in oat (Avena sativa). PeerJ. 2023;11:e15370. 10.7717/peerj.15370.37187518 10.7717/peerj.15370
48. Soltis PS Soltis DE Ancient WGD events as drivers of key innovations in angiosperms Curr Opin Plant Biol 2016 30 159 65 10.1016/j.pbi.2016.03.015 27064530
Soltis PS, Soltis DE. Ancient WGD events as drivers of key innovations in angiosperms. Curr Opin Plant Biol. 2016;30:159–65. 10.1016/j.pbi.2016.03.015.27064530 10.1016/j.pbi.2016.03.015
49. Ren R Wang H Guo C Zhang N Zeng L Chen Y Widespread whole genome duplications contribute to Genome Complexity and species Diversity in Angiosperms Mol Plant 2018 11 414 28 10.1016/j.molp.2018.01.002 29317285
Ren R, Wang H, Guo C, Zhang N, Zeng L, Chen Y, et al. Widespread whole genome duplications contribute to Genome Complexity and species Diversity in Angiosperms. Mol Plant. 2018;11:414–28. 10.1016/j.molp.2018.01.002.29317285 10.1016/j.molp.2018.01.002
50. Panchy N Lehti-Shiu M Shiu S-H Evolution of gene duplication in plants Plant Physiol 2016 171 2294 316 10.1104/pp.16.00523 27288366
Panchy N, Lehti-Shiu M, Shiu S-H. Evolution of gene duplication in plants. Plant Physiol. 2016;171:2294–316. 10.1104/pp.16.00523.27288366 10.1104/pp.16.00523
51. Bailly C The signalling role of ROS in the regulation of seed germination and dormancy Biochem J 2019 476 3019 32 10.1042/BCJ20190159 31657442
Bailly C. The signalling role of ROS in the regulation of seed germination and dormancy. Biochem J. 2019;476:3019–32. 10.1042/BCJ20190159.31657442 10.1042/BCJ20190159
52. Jurdak R Launay-Avon A Paysant‐Le Roux C Bailly C Retrograde signalling from the mitochondria to the nucleus translates the positive effect of ethylene on dormancy breaking of Arabidopsis thaliana seeds New Phytol 2021 229 2192 205 10.1111/nph.16985 33020928
Jurdak R, Launay-Avon A, Paysant‐Le Roux C, Bailly C. Retrograde signalling from the mitochondria to the nucleus translates the positive effect of ethylene on dormancy breaking of Arabidopsis thaliana seeds. New Phytol. 2021;229:2192–205. 10.1111/nph.16985.33020928 10.1111/nph.16985
53. Zimmermann P Zentgraf U The correlation between oxidative stress and leaf senescence during plant development Cell Mol Biol Lett 2005 10 515 34 10.1002/9780470988855.ch4 16217560
Zimmermann P, Zentgraf U. The correlation between oxidative stress and leaf senescence during plant development. Cell Mol Biol Lett. 2005;10:515–34. 10.1002/9780470988855.ch4.16217560 10.1002/9780470988855.ch4
54. Zou C Sun K Mackaluso JD Seddon AE Jin R Thomashow MF Cis -regulatory code of stress-responsive transcription in Arabidopsis thaliana Proc Natl Acad Sci 2011 108 14992 7 10.1073/pnas.1103202108 21849619
Zou C, Sun K, Mackaluso JD, Seddon AE, Jin R, Thomashow MF, et al. Cis -regulatory code of stress-responsive transcription in Arabidopsis thaliana. Proc Natl Acad Sci. 2011;108:14992–7. 10.1073/pnas.1103202108.21849619 10.1073/pnas.1103202108
55. Sathiyamoorthy P Nakamura S FREE-RADICAL-INDUCED LIPID PEROXIDATION IN SEEDS Isr J Plant Sci 1995 43 295 302 10.1080/07929978.1995.10676616
Sathiyamoorthy P, Nakamura S. FREE-RADICAL-INDUCED LIPID PEROXIDATION IN SEEDS. Isr J Plant Sci. 1995;43:295–302. 10.1080/07929978.1995.10676616.10.1080/07929978.1995.10676616
56. Yao Z Liu L Gao F Rampitsch C Reinecke DM Ozga JA Developmental and seed aging mediated regulation of antioxidative genes and differential expression of proteins during pre- and post-germinative phases in pea J Plant Physiol 2012 169 1477 88 10.1016/j.jplph.2012.06.001 22742946
Yao Z, Liu L, Gao F, Rampitsch C, Reinecke DM, Ozga JA, et al. Developmental and seed aging mediated regulation of antioxidative genes and differential expression of proteins during pre- and post-germinative phases in pea. J Plant Physiol. 2012;169:1477–88. 10.1016/j.jplph.2012.06.001.22742946 10.1016/j.jplph.2012.06.001
57. Mao PS Wang XG Wang YH Han JG Effect of storage temperature and duration on the vigor of zoysiagrass (Zoysia japonica Steud.) Seed harvested at different maturity stages Grassl Sci 2009 55 1 5 10.1111/j.1744-697x.2009.00129.x
Mao PS, Wang XG, Wang YH, Han JG. Effect of storage temperature and duration on the vigor of zoysiagrass (Zoysia japonica Steud.) Seed harvested at different maturity stages. Grassl Sci. 2009;55:1–5. 10.1111/j.1744-697x.2009.00129.x.10.1111/j.1744-697x.2009.00129.x
58. Hu D Ma G Wang Q Yao J Wang Y Pritchard HW Spatial and temporal nature of reactive oxygen species production and programmed cell death in elm (Ulmus pumila L.) seeds during controlled deterioration Plant Cell Environ 2012 35 2045 59 10.1111/j.1365-3040.2012.02535.x 22582978
Hu D, Ma G, Wang Q, Yao J, Wang Y, Pritchard HW, et al. Spatial and temporal nature of reactive oxygen species production and programmed cell death in elm (Ulmus pumila L.) seeds during controlled deterioration. Plant Cell Environ. 2012;35:2045–59. 10.1111/j.1365-3040.2012.02535.x.22582978 10.1111/j.1365-3040.2012.02535.x
59. Nithiyanantham S Siddhuraju P Francis G A promising approach to enhance the total phenolic content and antioxidant activity of raw and processed Jatropha curcas L. kernel meal extracts Ind Crops Prod 2013 43 261 9 10.1016/j.indcrop.2012.07.040
Nithiyanantham S, Siddhuraju P, Francis G. A promising approach to enhance the total phenolic content and antioxidant activity of raw and processed Jatropha curcas L. kernel meal extracts. Ind Crops Prod. 2013;43:261–9. 10.1016/j.indcrop.2012.07.040.10.1016/j.indcrop.2012.07.040
60. Kim K-H Alam I Kim Y-G Sharmin SA Lee K-W Lee S-H Overexpression of a chloroplast-localized small heat shock protein OsHSP26 confers enhanced tolerance against oxidative and heat stresses in tall fescue Biotechnol Lett 2012 34 371 7 10.1007/s10529-011-0769-3 21984008
Kim K-H, Alam I, Kim Y-G, Sharmin SA, Lee K-W, Lee S-H, et al. Overexpression of a chloroplast-localized small heat shock protein OsHSP26 confers enhanced tolerance against oxidative and heat stresses in tall fescue. Biotechnol Lett. 2012;34:371–7. 10.1007/s10529-011-0769-3.21984008 10.1007/s10529-011-0769-3
61. Wojciechowska N Sobieszczuk-Nowicka E Bagniewska‐Zadworna A Plant organ senescence – regulation by manifold pathways Plant Biol 2018 20 167 81 10.1111/plb.12672 29178615
Wojciechowska N, Sobieszczuk-Nowicka E, Bagniewska‐Zadworna A. Plant organ senescence – regulation by manifold pathways. Plant Biol. 2018;20:167–81. 10.1111/plb.12672.29178615 10.1111/plb.12672
62. Jin X Zhang W Zhao G Chai J Wang M Jiao R Effects of storage years on seed physiological and biochemical characteristics of oat Acta Agrestia Sinica 2019 27 356 63 10.11733/j.issn.1007-0435.2019.02.012
Jin X, Zhang W, Zhao G, Chai J, Wang M, Jiao R, et al. Effects of storage years on seed physiological and biochemical characteristics of oat. Acta Agrestia Sinica. 2019;27:356–63. 10.11733/j.issn.1007-0435.2019.02.012.10.11733/j.issn.1007-0435.2019.02.012
63. Huang Y Liu H Zhao G Wang Q Luo J Yao R Effects of natural aging and artificial aging on germination characteristics and genetic integrity of oat seeds Acta Agrestia Sinica 2022 30 2066 74 10.11733/j.issn.1007-0435.2022.08.017
Huang Y, Liu H, Zhao G, Wang Q, Luo J, Yao R. Effects of natural aging and artificial aging on germination characteristics and genetic integrity of oat seeds. Acta Agrestia Sinica. 2022;30:2066–74. 10.11733/j.issn.1007-0435.2022.08.017.10.11733/j.issn.1007-0435.2022.08.017
64. Liu B Song Y Sun M Mao P Physiological responses of mitochondrial AsA-GSH cycle to ilmbibition of deteriated oat seeds Acta Agrestia Sinica 2021 29 211 9 10.11733/j.issn.1007-0435.2021.02.001
Liu B, Song Y, Sun M, Mao P. Physiological responses of mitochondrial AsA-GSH cycle to ilmbibition of deteriated oat seeds. Acta Agrestia Sinica. 2021;29:211–9. 10.11733/j.issn.1007-0435.2021.02.001.10.11733/j.issn.1007-0435.2021.02.001
65. Huang J Hai Z Wang R Yu Y Chen X Liang W Genome-wide analysis of HSP20 gene family and expression patterns under heat stress in cucumber (Cucumis sativus L) Front Plant Sci 2022 13 968418 10.3389/fpls.2022.968418 36035708
Huang J, Hai Z, Wang R, Yu Y, Chen X, Liang W, et al. Genome-wide analysis of HSP20 gene family and expression patterns under heat stress in cucumber (Cucumis sativus L). Front Plant Sci. 2022;13:968418. 10.3389/fpls.2022.968418.36035708 10.3389/fpls.2022.968418
66. Marchler-Bauer A Lu S Anderson JB Chitsaz F Derbyshire MK DeWeese-Scott C CDD: a conserved domain database for the functional annotation of proteins Nucleic Acids Res 2011 39 D225 9 10.1093/nar/gkq1189 21109532
Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, et al. CDD: a conserved domain database for the functional annotation of proteins. Nucleic Acids Res. 2011;39:D225–9. 10.1093/nar/gkq1189.21109532 10.1093/nar/gkq1189
67. Jones P Binns D Chang H-Y Fraser M Li W McAnulla C InterProScan 5: genome-scale protein function classification Bioinformatics 2014 30 1236 40 10.1093/bioinformatics/btu031 24451626
Jones P, Binns D, Chang H-Y, Fraser M, Li W, McAnulla C, et al. InterProScan 5: genome-scale protein function classification. Bioinformatics. 2014;30:1236–40. 10.1093/bioinformatics/btu031.24451626 10.1093/bioinformatics/btu031
68. Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, et al. Protein Identification and Analysis Tools on the ExPASy server. Humana Press. 2005;571–607. 10.1385/1-59259-890-0:571.
69. Yu C Lin C Hwang J Predicting subcellular localization of proteins for Gram-negative bacteria by support vector machines based on n ‐peptide compositions Protein Sci 2004 13 1402 6 10.1110/ps.03479604 15096640
Yu C, Lin C, Hwang J. Predicting subcellular localization of proteins for Gram-negative bacteria by support vector machines based on n ‐peptide compositions. Protein Sci. 2004;13:1402–6. 10.1110/ps.03479604.15096640 10.1110/ps.03479604
70. Hallgren J Tsirigos KD Pedersen MD Almagro Armenteros JJ Marcatili P Nielsen H DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks BioRxiv 2022 10.1101/2022.04.08.487609
Hallgren J, Tsirigos KD, Pedersen MD, Almagro Armenteros JJ, Marcatili P, Nielsen H, et al. DeepTMHMM predicts alpha and beta transmembrane proteins using deep neural networks. BioRxiv. 2022. 10.1101/2022.04.08.487609.10.1101/2022.04.08.487609
71. Teufel F Almagro Armenteros JJ Johansen AR Gíslason MH Pihl SI Tsirigos KD SignalP 6.0 predicts all five types of signal peptides using protein language models Nat Biotechnol 2022 40 1023 5 10.1038/s41587-021-01156-3 34980915
Teufel F, Almagro Armenteros JJ, Johansen AR, Gíslason MH, Pihl SI, Tsirigos KD, et al. SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol. 2022;40:1023–5. 10.1038/s41587-021-01156-3.34980915 10.1038/s41587-021-01156-3
72. Combet C Blanchet C Geourjon C Deleage G NPS@ network protein sequence analysis Trends Biochem sci 2000 25 147 50 10.1016/s0968-0004(99)01540-6 10694887
Combet C, Blanchet C, Geourjon C, Deleage G. NPS@ network protein sequence analysis. Trends Biochem sci. 2000;25:147–50. 10.1016/s0968-0004(99)01540-6.10694887 10.1016/s0968-0004(99)01540-6
73. Waterhouse A Bertoni M Bienert S Studer G Tauriello G Gumienny R SWISS-MODEL: homology modelling of protein structures and complexes Nucleic Acids Res 2018 46 W296 303 10.1093/nar/gky427 29788355
Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, et al. SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res. 2018;46:W296–303. 10.1093/nar/gky427.29788355 10.1093/nar/gky427
74. Tamura K Stecher G Kumar S MEGA11: Molecular Evolutionary Genetics Analysis Version 11 Mol Biol Evol 2021 38 3022 7 10.1093/molbev/msab120 33892491
Tamura K, Stecher G, Kumar S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol. 2021;38:3022–7. 10.1093/molbev/msab120.33892491 10.1093/molbev/msab120
75. Subramanian B Gao S Lercher MJ Hu S Chen W-H Evolview v3: a webserver for visualization, annotation, and management of phylogenetic trees Nucleic Acids Res 2019 47 W270 5 10.1093/nar/gkz357 31114888
Subramanian B, Gao S, Lercher MJ, Hu S, Chen W-H. Evolview v3: a webserver for visualization, annotation, and management of phylogenetic trees. Nucleic Acids Res. 2019;47:W270–5. 10.1093/nar/gkz357.31114888 10.1093/nar/gkz357
76. Bailey TL Boden M Buske FA Frith M Grant CE Clementi L MEME SUITE: tools for motif discovery and searching Nucleic Acids Res 2009 37 W202 8 10.1093/nar/gkp335 19458158
Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L, et al. MEME SUITE: tools for motif discovery and searching. Nucleic Acids Res. 2009;37:W202–8. 10.1093/nar/gkp335.19458158 10.1093/nar/gkp335
77. Wang J Chitsaz F Derbyshire MK Gonzales NR Gwadz M Lu S The conserved domain database in 2023 Nucleic Acids Res 2023 51 D384 8 10.1093/nar/gkac1096 36477806
Wang J, Chitsaz F, Derbyshire MK, Gonzales NR, Gwadz M, Lu S, et al. The conserved domain database in 2023. Nucleic Acids Res. 2023;51:D384–8. 10.1093/nar/gkac1096.36477806 10.1093/nar/gkac1096
78. Chen C Chen H Zhang Y Thomas HR Frank MH He Y TBtools: an integrative Toolkit developed for interactive analyses of big Biological Data Mol Plant 2020 13 1194 202 10.1016/j.molp.2020.06.009 32585190
Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, He Y, et al. TBtools: an integrative Toolkit developed for interactive analyses of big Biological Data. Mol Plant. 2020;13:1194–202. 10.1016/j.molp.2020.06.009.32585190 10.1016/j.molp.2020.06.009
79. Lescot M Déhais P Thijs G Marchal K Moreau Y Peer YV PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences Nucleic Acids Res 2002 30 325 7 10.1093/nar/30.1.325 11752327
Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Peer YV, et al. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002;30:325–7. 10.1093/nar/30.1.325.11752327 10.1093/nar/30.1.325
80. Kamal N Tsardakas Renhuldt N Bentzer J Gundlach H Haberer G Juhász A The mosaic oat genome gives insights into a uniquely healthy cereal crop Nature 2022 606 113 9 10.1038/s41586-022-04732-y 35585233
Kamal N, Tsardakas Renhuldt N, Bentzer J, Gundlach H, Haberer G, Juhász A, et al. The mosaic oat genome gives insights into a uniquely healthy cereal crop. Nature. 2022;606:113–9. 10.1038/s41586-022-04732-y.35585233 10.1038/s41586-022-04732-y
81. Zheng X, Ren Z, Zheng G. Discussion on methods for determining seed viability——III. Artificial accelerated aging method. Seed. 1982:31 – 4. 10.16590/j.cnki.1001-4705.1982.04.024
82. Livak KJ Schmittgen TD Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method Methods 2001 25 402 8 10.1006/meth.2001.1262 11846609
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method. Methods. 2001;25:402–8. 10.1006/meth.2001.1262.11846609 10.1006/meth.2001.1262
