
==== Front
BMC Genomics
BMC Genomics
BMC Genomics
1471-2164
BioMed Central London

10771
10.1186/s12864-024-10771-8
Research
Identification of MYC genes in four Cucurbitaceae species and their roles in the response to temperature stress
Liu Tao 1
Zheng Yani 1
Yang Jingyu 1
Li Rourou 1
Chang Huan 1
Li Nanyang 12
Suna Wang 12
Wang Liping 12
Wang Xing wangxing@hebeu.edu.cn

12
1 https://ror.org/036h65h05 grid.412028.d 0000 0004 1757 5708 School of Landscape and Ecological Engineering, Hebei University of Engineering, Handan, 056038 China
2 Hebei Engineering Research Center for Seedling Breeding of Solanaceae Vegetables, Handan, 056038 China
16 9 2024
16 9 2024
2024
25 8672 4 2024
4 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Background

Myelocytomatosis (MYC) transcription factors are crucial mediators of the response of plants to environmental stresses through via binding to DNA regulatory regions. However, few systematic characterizations of MYC genes are available in Cucurbitaceae species.

Results

In this study, we identified 10, 8, 12, and 10 MYC genes in Cucumis sativus, Cucumis melo, Citrullus lanatus, and Benincasa hispida, respectively. Characterization revealed that all of the MYC proteins contain a highly conserved H4-V5-E6-E8-R9-R11-R12 sequence, which is essential for the binding of DNA regulatory regions. Evolutionary analysis enabled us to categorize 40 predicted MYC proteins from seven species into five distinct groups and revealed that the expansion of the MYC genes occurred before the divergence of monocots and dicots. The upstream promoter regions of the MYC genes contain a variety of developmental, stress, and hormone-responsive regulatory elements. The expression of cucumber MYC genes varies significantly across organs, with particularly high expression of CsaV3_3G001710 observed across all organs. Transcriptomic analysis revealed that certain cucumber MYC genes undergo specific upregulation or downregulation in response to both biotic and abiotic stressors. In particular, under temperature stress, the cucumber genes CsaV3_3G007980 and CsaV3_3G001710 were significantly upregulated. Interestingly, the homologs of these two genes in C. lanatus presented a similar expression pattern to that in C. sativus, whereas in B. hispida, they presented the opposite pattern, i.e., significant downregulation. These findings indicated that these two genes indeed respond to temperature stress but with different expression patterns, highlighting the divergent functions of homologous genes across different species.

Conclusions

This study analyzed the size and composition of the MYC gene family in four Cucurbitaceae species and investigated stress-responsive expression profiles, especially under temperature stress. All the results showed that MYC genes play important roles in development and stress responses, laying a theoretical foundation for further investigations of these response mechanisms.

Keywords

Myelocytomatosis
Cucurbitaceae
stress responses
the Construction of Innovative Teams in Modern Agricultural Industry Systems in Hebei ProvinceHBCT2024140206 National Natural Science Foundation of China32302542 Hebei Natural Science FoundationC2024402002 the Science Research Project of the Hebei Education DepartmentQN2022062 and QN2024122 the Science and Technology Research and Developmental Guidance Program of Handan23313014019 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

Myelocytomatosis oncogene (MYC) transcription factors (TFs) are an important class of TFs belonging to the basic helix-loop-helix (bHLH) TF family and contain two conserved functional domains, namely, the bHLH_MYC_N domain in the N-terminal region and the bHLH region in the C-terminal region [1–3]. As a subfamily of the bHLH family, MYC plays important roles in plant growth and development, secondary metabolism and signal transduction [4].

The first MYC gene, AtMYC1, was cloned from Arabidopsis thaliana, and functional studies revealed that it plays a certain role in plant seed development [5]. Successively, more MYC genes have been found in Arabidopsis. MYC2 can regulate leaf aging by antagonizing bHLH IIId subfamily transcription factors [6] and can also interact with jasmonate ZIM-domain 7 (JAZ7) to inhibit leaf aging under dark conditions [7]. In Arabidopsis thaliana, AtMYC2 can cooperate with AtMYC3 and AtMYC4 to regulate leaf development [8], chlorophyll degradation [9], seed production and seed storage protein accumulation [10, 11]. Previous studies also revealed that AtMYC2 can inhibit the growth of leaf veins by inhibiting the synthesis of auxin in plant leaves [12]. In addition, the Arabidopsis Aborted Microspores (AMS) gene, which encodes a MYC transcription factor, plays a crucial role in tapetum cell development and pollen wall formation [13]. In addition, MYC genes in other plants are involved in plant growth and development. In apple (Malus pumila Mill.), at the fruit ripening stage, MdMYC2 can affect ethylene biosynthesis and promote fruit ripening by promoting the expression of MdACS1 and MdACO1 [14]. In rice (Oryza sativa), overexpressed OsMYC2 can interact with OsJAZ1 and activate the downstream gene OsMADS1, which then regulates the development of spikelets [15]. The MYC genes also have important effects on the accumulation of plant secondary metabolites. For example, overexpression of AtMYC3 and AtMYC4 resulted in excessive accumulation of anthocyanins in Arabidopsis. Similarly, wheat (Triticum aestivum) MYC1 can regulate anthocyanin synthesis in the pericarp [16]. CrMYC2 can control jasmonate-responsive expression of the ORCA genes, which regulate alkaloid biosynthesis in Catharanthus roseus. In a few cases, TcJAMYC could negatively regulate the jasmonic acid-responsive expression of taxol biosynthesis genes in cultured cells of Taxus cuspidata [17]. In Artemisia annua, AaMYC2 can bind to AaJAZ1-4 and activate the expression of the artemisinin biosynthetic enzymes CYP71AV1 and DBR2, which positively regulate artemisinin biosynthesis [18].

Although many studies on MYC genes in various species have been conducted, studies on MYC genes in Cucurbitaceae crops are still lacking. Cucurbitaceae is one of the most important edible plant families in the world, among which cucumbers, melons, watermelons and wax gourds are widely grown worldwide and have great economic benefits. In this study, we aimed to identify the MYC genes in four Cucurbitaceae crops and compare MYC gene evolution and variation among species through bioinformatics analysis. We also analyzed the expression patterns of MYC genes under biotic and abiotic stresses, with a focus on identifying MYC genes involved in the temperature stress response, to provide theoretical support for stress-resistant breeding in Cucurbitaceae crops.

Methods

Identification and bioinformatics analysis of the MYC gene family in Cucurbitaceae crops

The HMM model files (PF14215.7 and PF00010) for the MYC gene family were downloaded from the Pfam database (http://pfam.xfam.org/), and the protein sequence files of Cucumis sativus L., Cucumis melo L., Citrullus lanatus, and Benincasa hispida were downloaded from the Cucurbitaceae Genomic Database (http://cucurbitgenomics.org; [19–22]). The hidden Markov model (HMM) plugin in the HMMER v3 software package was used to predict candidate MYC gene family members in the Cucumis sativus L., Cucumis melo L., Citrullus lanatus, and Benincasa hispida genomes [23], and the sequence information of high-quality candidate proteins was extracted via Perl scripts (E < 1 × 10− 5). The candidate MYC gene family genes were subsequently identified via the BLASTP program and NCBI-Conserved Domain Data (CDD) (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi; [24]).

MYC gene family characterization and phylogenetic tree construction in Cucurbitaceae crops

Using the online tool ExPASy (https://web.expasy.org/protparam/) [25], we analyzed the amino acid length, molecular weight, isoelectric point, instability coefficient, aliphatic index, and average hydrophobicity of the members of the MYC gene family. We used the online website CELLO (http://cello.life.nctu.edu.tw/) for subcellular localization prediction. We employed the online software MEME (http://meme-suite.org/) to analyze the conserved motifs of MYC family proteins, with the parameters set as follows: 10 motifs and optimal motif width ranging from 6 to 200. Multiple sequence alignment was performed via ClustalX 2.0 and visualized via Jalview [26]. Phylogenetic analysis was performed via MEGA 7 [27] via the neighbor-joining (NJ) method, and the parameters used were the Poisson model, pairwise deletion, and 1000 bootstrap replications [28].

Chromosomal distribution and collinearity analysis of MYC genes

Based on the physical location information in the genome database, we used a mapchart to map the MYC gene family members onto Cucurbitaceae crop chromosomes [29]. The chromosomal distribution of the Cucurbitaceae crop SRS gene family was visualized via TBtools software [30]. Gene duplication events were analyzed via the multiple collinearity scan tool (MCScanX) [31]. A collinearity analysis plot was generated via Dual Synteny Plotter software (https://github.com/CJ-Chen/TBtools) [32].

Gene expression analysis

Transcriptome sequencing data related to cucumbers were downloaded from the NCBI database (https://www.ncbi.nlm.nih.gov/). The SRA-to-Fastq plugin in TBtools was used to convert the downloaded SRA data into Fastq format. Data quality was assessed via the FastQC plugin [33], and adapter sequences and low-quality sequences were removed via the Trimmomatic plugin [34], resulting in clean data. The filtered transcriptome data were aligned to the cucumber ChineseLong_V3 genome via the STAR plugin, generating SAM files [35]. Gene expression levels were analyzed via the StringTie Quantify plugin [36]. Finally, differential gene expression analysis was conducted via the DESeq2 plugin [37].

Tissue-specific expression analysis of cucumber MYC genes

Using transcriptome sequencing data from the NCBI database (PRJNA80169) [38], we analyzed the tissue-specific expression of the cucumber MYC gene family in various tissues and organs, including cucumber leaves, stems, female flowers, male flowers, unfertilized ovaries, fertilized ovaries, ovaries, roots, tendrils, and tendril bases. We utilized TBtools software to create an expression heatmap depicting the specific expression patterns of the cucumber MYC gene family in different cucumber tissues and organs.

Stress-responsive expression analysis of cucumber MYC genes

Using transcriptome sequencing data from the NCBI database, including PRJNA634519 [39], PRJNA438923 [40], PRJNA477930 [41], PRJNA321023 [42], and PRJNA419665 [43], we analyzed the specific expression patterns of the cucumber MYC gene family in response to various stress conditions, such as high temperature, low temperature, high salinity, silicon, powdery mildew, downy mildew, and southern root-knot nematodes. We used TBtools software to create expression heatmaps illustrating the gene expression responses of the cucumber MYC gene family under abiotic and biotic stress conditions.

Temperature stress treatment, RNA extraction and qRT‒PCR

The cultivars Jinyan-4 (Cucumis sativus), Harukei-3 (Cucumis melo), B227 (Benincasa hispida), and 8424 (Citrullus lanatus) provided by the Hebei Engineering Research Center for Seedling Breeding of Solanaceae and Fruit Vegetables of Hebei University Engineering were used to explore gene expression under temperature stress. The seedlings (two-leaf and one-heart stage) of the four cultivars were treated at 42 °C, and the leaves of the seedlings were removed at 0, 3, 6 and 12 h after treatment for qRT‒PCR. At the same time, the seedlings of the four cultivars were treated at 10 °C, and the leaves of the seedlings were removed at 0, 3, 6 and 12 h after treatment for qRT‒PCR. Three biological replicates were prepared for all samples, which were frozen in liquid nitrogen and then immediately stored at -80 °C.

Total RNA was extracted via the RNAprep Pure Plant Kit (DP432; Tiangen Biotech, Beijing, China) according to the manufacturer’s instructions. cDNA was synthesized from total RNA via the PrimeScript RT Kit (Takara). Specific primers for each gene were designed through Primer 6 (Table 1). The synthesized cDNA was subsequently subjected to qRT‒PCR on an Opticon thermocycler (CFX96 Connect Real-Time System; Bio-Rad, Hercules, CA) with SYBR Green PCR master mix (Vazyme, Nanjing, China) according to the manufacturer’s instructions. The 2-ΔΔCT method was used to calculate the relative expression of the MYC genes [44]. The value of relative expression showed the log2 FC (Fold change) of each gene compared with that of the control. The data analysis was conducted by Excel.

Table 1 List of primers used in quantitative RT‒PCR. All primers used were designed with primer 6

Gene	Sense Primer	Anti-sense Primer	
CsaV3_3G007980	TAGTCAGTGGAGTCAGAGAT	CTACACGGTTAATCACAGAAG	
CsaV3_3G001710	GGATGCGATGATAAGGATTC	TCTTCACTGTTGCTTGTTG	
Bhi01M000362	GCGGTTCTATGCTCTACG	TTGAGGTGAGGCTGGATT	
Cla97C05G080890	CTAGTTAATGGAGTCAGAGATG	CACGGTTAATCACAGAAGG	
MELO3C006016	CGGTGAGGAATGATGAGAA	AATGAGACAGTTGCCAGAA	
MELO3C013851	CGAGACGAGTTCTTGGATT	ACGGTGGTGGTAATTGAAT	
Bhi11M000137	CGACTCAGACCACTCAGA	GATTCAATGGCTCTTCTCTTC	
Cla97C10G186220	GGACTCAGACCACTCAGA	GATTCAATGGCTCTTCTCTTC	
Bhi10G001911(Actin)	ATGTTCACAACCACTGCCGA	GTCGAGCGCAACATAAGCAA	
MELO3C008032(Actin)	CATGTTCACCACCACTGCCGA	TGGCTGGAATAGAACTTCTGGGC	
Cla97C02G026960.1(ClActin)	CCATGTATGTTGCCATCCAG	GGATAGCATGGGGTAGAGCA	
Csa6M484600(CuActin)	CTGGTGATGGTGTGAGTC	AGAGATGGCTGGAATAGAAC	

Results

Identification and physicochemical property analysis of MYC genes

A total of 40 MYC genes were identified in the genomes of four Cucurbitaceae crops: 10 in C. sativus, 8 in C. melo, 12 in C. lanatus, and 10 in B. hispida. The MYC genes were unequally distributed on each chromosome. For example, C. sativus L. contains 6 MYC genes on chromosome 3, whereas there are no MYC genes on chromosomes 1, 2, 4, or 5. In C. melo L., chromosomes 2, 3, 5, 7, 8, 9, 10, and 12 contain no MYC genes, but the other chromosomes each have up to 3 MYC genes (Fig. 1). Sequence analysis revealed that the amino acid lengths encoded by the CsMYC genes varied from 431 aa (CsMYC8) to 694 aa (CsMYC5), those encoded by the CmMYC genes varied from 433 aa (CmMYC8) to 745 aa (CmMYC1), those encoded by the ClMYC genes varied from 423 aa (ClMYC3) to 969 aa (ClMYC1), and those encoded by the BhMYC genes varied from 501 aa (BhMYC4) to 968 aa (BhMYC3). Except for the acidic proteins encoded by CsMYC1, CmMYC5, ClMYC10 and BhMYC1, the MYC proteins in these Cucurbitaceae crops are alkaline proteins. Most proteins are unstable (with an instability index greater than 40), with the exceptions of CsMYC5, CmMYC1, ClMYC12, BhMYC7, and BhMYC9. The average hydropathicity values of all the proteins are less than 0, indicating that all the proteins are hydrophobic. Subcellular localization prediction revealed that most MYC proteins are localized in the cell nucleus, followed by chloroplasts. (Table 2).

Fig. 1 Distribution of MYC family genes on the chromosomes of four Cucurbitaceae crop species. (A), C. sativus (B), C. melo (C), B. hispida (D), C. lanatus

Table 2 Protein information for MYC gene family members in Cucurbitaceae crops

Species	Gene ID	Name	Number of amino acids (aa)	Molecular weight (D)	pI	Instability index	Aliphatic index	Average of hydropathicity	Prediction of subcellular location	
Cucumis sativus L.	CsaV3_3G000850.1	CsMYC1	447	49398.41	8.65	43.61	82.37	-0.416	Nucleus	
CsaV3_3G001710.1	CsMYC2	642	69911.19	6.21	50.44	64.14	-0.578	Nucleus	
CsaV3_3G007980.1	CsMYC3	649	71943.89	5.83	49.00	77.66	-0.490	Nucleus	
CsaV3_3G022420.1	CsMYC4	501	55301.14	5.70	44.81	78.60	-0.445	Nucleus	
CsaV3_3G034600.1	CsMYC5	694	78486.44	5.24	38.28	84.84	-0.370	Chloroplast/Nucleus	
CsaV3_3G049150.1	CsMYC6	688	75666.20	5.11	58.15	69.71	-0.617	Nucleus	
CsaV3_6G000530.1	CsMYC7	644	72769.50	5.51	43.25	78.57	-0.500	Nucleus	
CsaV3_6G008940.1	CsMYC8	431	48394.52	5.42	47.63	76.43	-0.429	Nucleus	
CsaV3_6G037080.1	CsMYC9	650	71869.01	5.91	48.30	83.31	-0.347	Nucleus	
CsaV3_7G027460.1	CsMYC10	691	76190.07	5.66	41.31	76.58	-0.372	Nucleus	
Cucumis melo L.	MELO3C015748.2.1	CmMYC1	745	82003.24	5.70	37.16	81.25	-0.269	Nucleus	
MELO3C003412.2.1	CmMYC2	723	79597.55	5.32	56.07	68.62	-0.628	Nucleus	
MELO3C024041.2.1	CmMYC3	501	55262.12	6.16	48.09	78.06	-0.486	Nucleus	
MELO3C006016.2.1	CmMYC4	586	65067.91	5.55	47.76	80.00	-0.535	Nucleus	
MELO3C013772.2.1	CmMYC5	442	48984.93	7.68	48.03	81.52	-0.439	Nucleus	
MELO3C013851.2.1	CmMYC6	662	72281.88	6.03	49.58	64.24	-0.570	Nucleus	
MELO3C021212.2.1	CmMYC7	656	74227.22	5.61	42.86	79.07	-0.473	Nucleus	
MELO3C022250.2.1	CmMYC8	433	48684.93	5.59	47.11	76.07	-0.442	Nucleus	
Citrullus lanatus	Cla97C03G062520.1	ClMYC1	969	105839.97	6.15	47.45	78.86	-0.415	Nucleus	
Cla97C05G080890.1	ClMYC2	618	68589.08	5.85	46.81	76.99	-0.547	Nucleus	
Cla97C06G112130.1	ClMYC3	423	47569.45	5.14	52.02	71.70	-0.513	Nucleus	
Cla97C06G112140.1	ClMYC4	427	47692.74	5.09	52.44	52.44	-0.424	Nucleus	
Cla97C06G113160.1	ClMYC5	645	72922.74	5.78	46.22	79.64	-0.469	Nucleus	
Cla97C07G128490.1	ClMYC6	637	70287.21	6.36	45.59	81.93	-0.368	Nucleus	
Cla97C07G129080.1	ClMYC7	501	55179.91	5.96	49.98	76.47	-0.504	Nucleus	
Cla97C09G170270.1	ClMYC8	690	76046.16	5.87	40.82	80.36	-0.345	Nucleus	
Cla97C09G174730.1	ClMYC9	680	74878.38	5.24	53.48	70.68	-0.610	Nucleus	
Cla97C10G185380.1	ClMYC10	463	51021.92	8.77	53.53	79.74	-0.471	Nucleus	
Cla97C10G186220.1	ClMYC11	694	76681.99	6.35	49.20	64.81	-0.573	Nucleus	
Cla97C10G204640.1	ClMYC12	695	78085.01	4.97	38.55	83.87	-0.326	Chloroplast/Nucleus	
Benincasa hispida	BhiUN179M27	BhMYC1	453	49798.89	8.19	47.72	83.43	-0.371	Nucleus	
Bhi01M000362	BhMYC2	617	68250.67	5.77	44.99	78.36	-0.520	Nucleus	
Bhi02M001191	BhMYC3	968	105559.53	6.12	44.22	79.96	-0.421	Nucleus	
Bhi05M000179	BhMYC4	501	55182.03	6.02	45.65	79.20	-0.464	Nucleus	
Bhi05M000251	BhMYC5	647	71471.31	5.91	43.64	80.06	-0.370	Nucleus	
Bhi05M000336	BhMYC6	682	75237.76	5.22	48.52	71.17	-0.632	Nucleus	
Bhi09M000958	BhMYC7	604	66789.67	6.01	39.23	80.83	-0.350	Nucleus	
Bhi11M000137	BhMYC8	660	72104.63	5.99	47.48	65.35	-0.570	Nucleus	
Bhi11M001900	BhMYC9	697	78638.85	5.07	39.16	84.61	-0.314	Chloroplast/Nucleus	
Bhi12M001654	BhMYC10	643	72375.09	5.60	47.35	80.34	-0.451	Nucleus	

Structure and phylogenetic analysis of the Cucurbitaceae crop MYC genes

Motif prediction analysis of the protein sequences of the MYC family members revealed that among 10 categorized motifs, no MYC family member contained all of them (Fig. 2). Motifs 1, 2, 5, 7, and 8 were relatively conserved and were common to all MYC genes. Gene structure analysis revealed that the number of exons in the MYC genes ranged from 1 to 15 (Fig. 2). The gene structures of most MYC genes within the same lineage are similar, further indicating the conservation of protein motifs and gene structures within each MYC evolutionary branch.

Fig. 2 Phylogenetic tree, gene structure and conserved domains of the MYC genes of the four Cucurbitaceae crop species. (A), The MYC phylogenetic tree is divided into five groups, and different colors indicate different branches. (B), Conserved sequence of the MYC genes. (C), MYC gene structure; green indicates the CDS, yellow indicates the untranslated region, and the black line indicates introns

According to an alignment of the bHLH domains in the MYC proteins, there is a basic amino acid region (Basic) composed of approximately 12 amino acids. This region contained a highly conserved H4-V5-E6-E8-R9-R11-R12 sequence, which was essential for the binding of bHLHs to target genes. This region also included two helical structures, consisting of approximately 37 amino acids. Notably, the 22nd and 38th amino acids in the HLH domain, both leucine (Leu), were highly conserved, indicating their necessity for dimer formation (Fig. 3).

Fig. 3 Sequence alignment of the MYC proteins of the four Cucurbitaceae species

To clarify the evolutionary relationships among the MYC gene family members in the Cucurbitaceae crops and in Zea mays, Brachypodium distachyon, and Oryza sativa, we constructed a phylogenetic tree. All the MYC proteins can be divided into five subgroups, labeled I to V. Each subgroup included both monocotyledonous and dicotyledonous plants, indicating that the MYC genes were relatively conserved during the evolution of both monocots and dicots. Group IV is the largest subgroup, consisting of 4, 4, 6, 3, 2, 1, and 1 MYC proteins from C. sativus L., C. melo L., C. lanatus, B. hispida, Z. mays, B. distachyon, and O. sativa, respectively. Group I was the smallest, with only 4 MYC genes (Fig. 4). In group II, there were 7 MYC genes, only 1 of which was from a monocotyledonous plant.

Fig. 4 Phylogenetic tree of MYC family members in C. sativus, C. melo, C. lanatus, B. hispida, Z. mays, B. distachyon, and O. sativa

Collinearity analysis of the MYC genes among Cucurbitaceae crops

A total of 36 MYC genes (9 in C. sativus L., 7 in C. melo L., 11 in C. lanatus, and 9 in B. hispida) were located within synteny blocks in the four Cucurbitaceae genomes (Fig. 5; Table 3). We identified five orthologous gene pairs that exist among all four species. These MYC genes were conserved during the evolution of all four Cucurbitaceae species, suggesting conserved roles. Furthermore, some MYC genes have been lost in some species. For example, certain MYC genes, such as the CsaV3_3G000850/MELO3C013772.2/Cla97C10G185380 collinear gene pair, were found in C. sativus L., C. melo L., and B. hispida but were absent in B. hispida. These results revealed the specific traits of different Cucurbitaceae species during evolution and amplification of the genome. In addition, two collinear gene pairs were detected in only C. lanatus and B. hispida.

Table 3 Collinear gene pairs present in the four Cucurbitaceae genomes

Number	Cucumber	Melon	Watermelon	Wax gourd	
1	CsaV3_3G000850	MELO3C013772.2	Cla97C10G185380	-	
2	CsaV3_7G027460	MELO3C015748.2	Cla97C09G170270	Bhi09M000958	
3	CsaV3_6G037080	-	Cla97C07G128490	Bhi05M000251	
4	CsaV3_6G008940	MELO3C022250.2	Cla97C06G112130	-	
5	CsaV3_6G000530	MELO3C021212.2	Cla97C06G113160	Bhi12M001654	
6	CsaV3_3G049150

CsaV3_3G001710

	MELO3C003412.2

MELO3C013851.2

	Cla97C09G174730

Cla97C10G186220

	Bhi05M000336

Bhi11M000137

	
7	
8	CsaV3_3G007980	MELO3C006016.2	Cla97C05G080890	Bhi01M000362	
9	CsaV3_3G034600	-	Cla97C10G204640	Bhi11M001900	
10	-	-	Cla97C03G062520	Bhi02M001191	
11	-	-	Cla97C07G129080	Bhi05M000179	

Fig. 5 Syntenic analysis of the MYC genes among C. sativus, C. melo, C. lanatus, and B. hispida. The gray lines in the background indicate the collinear blocks within the C. sativus, C. melo, C. lanatus, and B. hispida genomes, whereas the red lines highlight the homologous gene pairs

Regulatory TFs of the MYC genes

The 1.5-kb upstream sequences of the MYC genes were selected for prediction of the TFs that regulate them. Three types of cis-elements related to development, hormone stress, and abiotic stress were identified (Fig. 6). Among the cis-elements related to development, the number of G-box (CACGTC) elements, which are light-responsive elements, is the greatest. For example, the genes MELO3C021212.2.1, MELO3C003412.2.1, and Cla97C10G186220.1 contain 9 G-box elements, indicating that they might be regulated by the light environment. Among the cis-elements related to hormone stress, the abscisic acid (ABA)-responsive element (ABRE) (ACGTG) is present in relatively large proportions, with 8 in MELO3C021212.2.1, MELO3C003412.2.1, and Cla97C10G186220.1 and 6 in Bhi02M001191, CsaV3_3G001710.1, and Bhi11M000137. Among the cis-elements related to abiotic stress, anaerobic induction AREs (AAACCA) were detected in a series of members, with 6 in Cla97C07G128490.1 and CsaV3_3G007980.1 and 5 in Cla97C05G080890.1.

Fig. 6 Heatmap of various cis-elements in the promoters of each Cucurbitaceae MYC gene. The colors represent the quantity of the cis-elements, with deeper red indicating greater quantities. The numbers in the image represent the counts of the cis-elements

Tissue-specific expression analysis of the MYC genes in C. Sativus

To investigate the expression profiles of the MYC gene family members in different tissues, using cucumber as a representative, we conducted transcriptome analysis on various tissues based on publicly available cucumber transcriptome sequencing data (PRJNA80169). The results revealed significant variation in the expression of MYC gene family members across different tissues (Fig. 7). For example, while the CsaV3_3G001710 gene presented a relatively high level of expression across all tissues or organs, three genes (CsaV3_3G000850, CsaV3_6G008940, and CsaV3_6G037080) presented relatively low expression levels across all tissues or organs. Some genes presented significant tissue-specific expression patterns. For example, the CsaV3_3G049150 gene presented relatively high expression in roots and fertilized ovaries but low expression in other tissues or organs. Similarly, compared with other tissues or organs, the CsaV3_7G027460 gene presented greater expression in roots. These results indicate that cucumber MYC family genes play distinct roles in the development of tissues or organs, contributing to various functions in plant growth and development.

Fig. 7 Expression heatmaps of MYC family genes in different tissues of C. sativus

Expression analysis of cucumber MYC genes under different stress conditions

Using publicly available transcriptome data from the NCBI SRA database, we analyzed the expression levels of the cucumber MYC genes under both biotic and abiotic (high temperature, low temperature, salt and silicon stress, powdery mildew, and southern root-knot nematode) stress conditions.

Under high-temperature stress, most MYC genes were not significantly differentially expressed (Fig. 8). For example, the expression levels of the genes CsaV3_6G037080, CsaV3_3G000850, and CsaV3_6G008940 did not change under high-temperature stress, and their expression levels were relatively low. However, the CsaV3_3G001710 gene was significantly upregulated at 6 h after high-temperature treatment (6 hph), whereas the CsaV3_3G007980 gene presented high expression levels at both 3 hph and 6 hph. These results suggest that the CsaV3_3G007980 gene is likely involved in the response of cucumber to high-temperature stress.

Fig. 8 Expression heatmap of the cucumber MYC genes under high-temperature stress. HT0h represents the control treatment, HT3h represents high-temperature treatment for 3 h, and HT6h represents high-temperature treatment for 6 h. (A), The data in the table represent the raw FPKM values. (B), The data in the table represent the log2 FC values of the raw FPKM values

Under low-temperature stress, the expression levels of four genes (CsaV3_6G037080, CsaV3_3G000850, CsaV3_6G008940, and CsaV3_6G000530) did not significantly change and remained relatively low. Two genes presented relatively high expression levels during the low-temperature treatment, with the CsaV3_3G007980 gene being significantly upregulated at 6 hph. The expression levels of the other genes remained unchanged before and after low-temperature treatment. Additionally, the expression of CsaV3_3G049150 was significantly downregulated at both 6 hph and 12 hph. Notably, the expression levels of all the genes did not significantly change at 3 hph. These results suggest that the CsaV3_3G007980 and CsaV3_3G049150 genes play key roles in the response of cucumber to prolonged low-temperature stress and that CsaV3_3G007980 is positively regulated, whereas CsaV3_3G049150 is negatively regulated (Fig. 9).

Fig. 9 Expression heatmap of cucumber MYC family genes under low-temperature stress. CT represents the control treatment, CS_2h represents low-temperature treatment for 2 h, CS_6h represents low-temperature treatment for 6 h, and CS_12h represents low-temperature treatment for 12 h. (A), The data in the table represent the raw FPKM values. (B), The data in the table represent the log2 FC of the raw FPKM values

Under salt and silicon treatment, most genes did not show differential expression after NaCl and silicon treatments. One gene (CsaV3_3G000850) was significantly downregulated after NaCl treatment and significantly upregulated after silicon treatment. However, when the plants were treated simultaneously with NaCl and silicon, a greater degree of downregulation was found (Fig. 10). Despite the significant differential expression of the CsaV3_3G00850 gene after treatment, its expression level remained relatively low under both the control and stress conditions.

Fig. 10 Expression heatmap of the cucumber MYC family genes under salt and silicon treatment treatments. CT represents the control treatment, NaCl represents salt treatment, Silicon represents silicon treatment, and NaCl + Silicon represents combined salt and silicon treatment. (A), The data in the table represent the raw FPKM values. (B), The data in the table represent the log2 FC of the raw FPKM values

Similarly, we analyzed the response of the MYC genes to biotic stress. Forty-eight hours after inoculation with powdery mildew, the expression of most genes did not significantly differ between the resistant (SSL508-28) and susceptible (D8) materials (Fig. 11). However, certain MYC genes presented differential expression patterns between SSL508-28 and D8. For example, CsaV3_3G000850 was upregulated to a significantly greater degree in D8 than in SSL508-28 after powdery mildew treatment. Interestingly, post-inoculation, the absolute expression level of CsaV3_3G000850 in D8 was much lower than its expression in SSL508-28. In addition, after inoculation with powdery mildew, CsaV3_3G049150 presented significantly downregulated expression in D8 and some degree of upregulation in SSL508-28.

Fig. 11 Expression patterns of the cucumber MYC family genes under powdery mildew stress treatment. SSL508-28: resistant material; D8: susceptible material; CT: uninfected; 48 h, 48 h after inoculation. (A), The data in the table represent the raw FPKM values. (B), The data in the table represent the log2 FC of the raw FPKM values

After inoculation with root-knot nematodes (Meloidogyne incognita), the expression levels of most genes, such as CsaV3_3G000850 and CsaV3_3G034600, in both resistant (IL10-1) and susceptible (CC3) materials generally exhibited similar trends (Fig. 12). However, two genes, CsaV3_6G000530 and CsaV3_6G037080, were upregulated in resistant materials but downregulated in susceptible materials. Nevertheless, the degree of differential expression of these genes is relatively low between the resistant and susceptible materials.

Fig. 12 Expression patterns of the cucumber MYC family genes under southern root–knot nematode stress treatment. IL10-1: resistant material; CC3: susceptible material; 0d, 1d, 2d, and 3d represent 0 days, 1 day, 2 days, and 3 days after inoculation, respectively. (A), The data in the table represent the raw FPKM values. (B), The data in the table represent the log2 FC of the raw FPKM values

The response of eight genes in the four Cucurbitaceae crops under temperature stress

Eight genes in the four Cucurbitaceae crops (CsaV3_3G007980, CsaV3_3G001710, MELO3C006016, MELO3C013851, Bhi01M000362, Bhi11M000137, Cla97C10G186220, and Cla97C05G080890) were selected for analysis of the response to temperature stress. As shown in Fig. 13, in Cucumis sativus, the genes CsaV3_3G007980 and CsaV3_3G001710 were upregulated under both low- and high-temperature stress. Especially under high temperature treatment, its expression level increased significantly as the treatment time increased. Which is relatively consistent with the transcriptome results, indicating their involvement in the cucumber response to temperature stress (Fig. 13A and B). This expression pattern also appeared in Cucumis melo and Citrullus lanatus. The CsaV3_3G007980 homologs MELO3C013851 and Cla97C05G080890 were upregulated under high-temperature stress (Fig. 13C and G). However, the homologous gene MELO3C006016 was significantly downregulated at 3 and 6 h of high-temperature treatment and then upregulated at 12 h of high-temperature treatment (Fig. 13D). However, the expression pattern of this gene was opposite under low-temperature treatment compared to high-temperature treatment. Under low-temperature treatment, gene MELO3C006016 was upregulated at 3 h of high-temperature treatment and then significantly downregulated at 6 and12 hours of high-temperature treatment. In Benincasa hispida, the expression of the two homologous genes Bhi01M000362 and Bhi11M000137 was downregulated at all time points under both the low- and high-temperature treatment groups (Fig. 13E and F).

Fig. 13 Expression of MYC genes in the four Cucurbitaceae crops under high-temperature and low-temperature stress. HT: high-temperature; LT: low-temperature; CK: control. The error bars in the graphs indicate SD. The value of relative expression showed the log2 FC of each gene compared with that of the control. Letters (a, b, c) indicates a significant difference at p < 0.05

Discussion

Characteristics of the MYC genes in the Cucurbitaceae crops

The MYC transcription factors have been reported to participate in various life activities in plants, playing crucial roles in regulating the growth and development of plant organs and in modulating tolerance to abiotic stress responses. The MYC protein has a bHLH_MYC_N domain in the N-terminal region, which consists of two subdomains: JID and TAD. The former is essential for interacting with JAZ proteins, whereas the latter is a putative transcriptional activation domain [45]. In the C-terminal region, the conserved bHLH domain determines its specificity and affinity for DNA sequence binding, and it can facilitate the formation of various homodimers and heterodimers [46]. The bHLH domain comprises a basic region and an HLH region. The basic region is located at the N-terminus of the domain and contains sites for DNA recognition and binding. In this study, a highly conserved H4-V5-E6-E8-R9-R11-R12 sequence was found in the basic region, in which the highly conserved Leu at residues 22 and 38 were necessary for dimer formation (Fig. 3); it has been shown [47] that mutations at these two Leu sites significantly affect bHLH dimerization in Arabidopsis. bHLH-type transcription factors can be classified into six main groups (designated A to F) according to the differences in the recognition mode between the basic region and the cis-acting elements [1]. Most of the MYC genes in Cucurbitaceae crops can specifically bind to the G-box (5’-CACNTG-3’), which could be bounded by the GBF family of bZIP proteins [48], and belong to Group B. Consistent with previous findings, the C-terminus of the domain includes a conserved helix‒loop‒helix (HLH) structure that can form homodimers or heterodimers with other proteins.

Gene structure analysis revealed that the MYC genes in groups III and IV had fewer introns (less than or equal to 2), with approximately 50% of all MYC genes lacking introns. In contrast, the MYC genes in the other three groups contained many introns. Previous studies have indicated that introns and exons play important roles in the diversity and evolution of gene families through gain/loss and insertion/deletion events [49, 50]. The significant difference in the number of introns among the MYC genes suggests that the Cucurbitaceae crops have undergone intron loss events during their evolution to adapt to environmental changes. Jeffares et sl. reported that having fewer introns in genes enables plants to respond more rapidly to environmental changes [51]. In addition, in an evolutionary analysis between monocots and dicots, all the groups included both monocot and dicot species, indicating that the MYC genes have been relatively conserved during the evolution of both monocots and dicots.

Functions of the MYC genes and their role in the response to temperature stress

Many studies have shown that MYC transcription factors play significant roles in the growth and development of plants. For example, MYC TFs are involved in regulating processes such as plant seed production [52], stamen development [53], hormone regulation [54], and secondary metabolism [55]. In this study, the majority of the MYC genes were expressed in roots, leaves, and unfertilized ovaries (Fig. 7). Coupled with the identification of numerous cis-elements related to development and hormone stress, these findings further underscore their functions in growth and development.

Moreover, MYC genes play important roles in the response to abiotic and biotic stresses. Previous research found that silicon application promotes the growth of plants under salt stress, significantly reduces the Na+ content, especially in the leaves, and counteracts the effects of NaCl on gas exchange [56]. Zhu et al. found that silicon confers resistance to salt stress in cucumber by regulating proline and cytokinins [57]. In this study, The CsaV3_3G000850 gene was significantly downregulated after NaCl treatment and significantly upregulated after silicon treatment. These results indicate that silicon treatment induced high expression of CsaV3_3G000850, thereby increasing salt tolerance in cucumber. Similar results have been reported in Arabidopsis, MYB2 and MYC2 function in ABA-inducible gene expression of the RD22 gene, where overexpression of the AtMYC2 gene significantly increased osmotic stress tolerance [58]. In recent years, there has been a growing focus on the responses of MYC genes to temperature stress. Overexpressing SlICE1, which encodes a MYC-type transcription factor, enhances cold tolerance in tomato [59]. In Arabidopsis, MYC67 and MYC70 interact with ICE1, leading to negative regulation of cold tolerance [60]. The overexpression of PtrbHLH, a basic helix-loop-helix transcription factor from Poncirus trifoliata, confers enhanced cold tolerance in pummelo (Citrus grandis) by regulating Catalase (CAT) to modulate the level of H2O2 [61]. Under cold conditions, StICE1 in potato enhances the stability of cell membranes by increasing the expression of the StLTI6A gene, thereby increasing its tolerance [62]. The MYC-type TF MdbHLH4 negatively regulates apple cold tolerance by inhibiting the expression of MdCBF1/3 and the promoter-binding activity of MdICE1L, as well as by promoting the expression of MdCAX3L-2 and the cold-induced degradation of MdICE1L [63]. In this study, we identified two MYC genes (CsaV3_3G007980 and CsaV3_3G001710) in cucumber that are significantly differentially expressed under temperature stress (Figs. 8 and 9). To validate the involvement of these two genes in the temperature stress response in the other cucurbit species, we analyzed their homologous genes for their reactions under temperature stress (Fig. 13). Gene expression analysis revealed differential expression of these two genes across all four species, albeit with varying patterns. Comparative functional genomics research has indicated that if regulatory elements in evolutionarily related species are conserved, then gene expression characteristics within species are correspondingly conserved [64]. In this study, cis-regulatory element analysis revealed certain differences in both the type and quantity of these elements among the eight homologous genes, which may account for the differential expression of homologous genes across species. These findings suggest that CsaV3_3G007980 and CsaV3_3G001710, along with their homologs in the other Cucurbitaceae crops, are highly responsive to temperature stress. However, the differential expression patterns between species remain unresolved. Further exploration of the response mechanisms of these genes to temperature stress will be the focus of future research.

Conclusions

In summary, we identified 10, 8, 12, and 10 MYC genes in C. sativus, C. melo, C. lanatus, and B. hispida, respectively, each of which play distinct roles in plant development. In particular, under environmental stress, some genes respond actively to external pressures through the upregulation or downregulation of expression. Additionally, we identified two genes that are relatively more sensitive to temperature stress, namely, CsaV3_3G007980 and CsaV3_3G001710. However, these two genes exhibit contrasting expression patterns across the different species. This finding implied that some degree of alterations in gene function occurred following species divergence. These results provide valuable insights for future functional studies of MYC genes and present potential candidate genes for enhancing the environmental adaptability of Cucurbitaceae species.

Abbreviations

MYC Myelocytomatosis

TF Transcription factor

JAZ Jasmonate ZIM-domain

AMS Arabidopsis Aborted Microspores

CDD Conserved domain data

ABA Abscisic acid

Hph Post high-temperature treatment

HLH Helix-loop-helix

Acknowledgements

Not applicable.

Author contributions

W.X. designed, performed the experiments, analyzed data and wrote the paper; L.T. prepared the material and wrote the paper; Z.Y.N., Y.J.Y., L.R.R. and C.H. analyzed data; L.N.Y. revised the paper; W.S.N. and W.L.P. wrote and revised the paper. All authors read and approved the final version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32302542) and Hebei Natural Science Foundation (C2024402002), which provided support for the design of the study; the Science Research Project of the Hebei Education Department (QN2022062 and QN2024122), which provided support for data collection; the Science and Technology Research and Developmental Guidance Program of Handan (23313014019); and the Construction of Innovative Teams in Modern Agricultural Industry Systems in Hebei Province (HBCT2024140206), which supported the analysis and interpretation of the data.

Data availability

The authors confirm that the data supporting the findings of this study from NCBI database with accession numbers of PRJNA80169 [39], PRJNA634519 [39], PRJNA438923 [40], PRJNA477930 [41], PRJNA321023 [42], and PRJNA419665 [43] are available within the manuscript.

Declarations

Ethics approval and consent to participate

This study did not directly involve humans, animals or plants.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Ledent V Vervoort M The basic helix-loop-helix protein family: comparative genomics and phylogenetic analysis Genome Res 2001 11 754 70 10.1101/gr.177001 11337472
Ledent V, Vervoort M. The basic helix-loop-helix protein family: comparative genomics and phylogenetic analysis. Genome Res. 2001;11:754–70.11337472 10.1101/gr.177001
2. Nuno P Liam D Origin and diversification of basic-helix-loop-helix proteins in plants Mol Biol Evol 2010 27 862 74 10.1093/molbev/msp288 19942615
Nuno P, Liam D. Origin and diversification of basic-helix-loop-helix proteins in plants. Mol Biol Evol. 2010;27:862–74.19942615 10.1093/molbev/msp288
3. Xu YH Liao YC Lv FF Zhang Z Sun PW Gao ZH Hu KP Sui C Jin Y Wei JH Transcription factor AsMYC2 controls the Jasmonate-responsive expression of ASS1 regulating Sesquiterpene Biosynthesis in Aquilaria sinensis (Lour.) Gilg Plant Cell Physiol 2017 58 1924 33 10.1093/pcp/pcx122 29016977
Xu YH, Liao YC, Lv FF, Zhang Z, Sun PW, Gao ZH, Hu KP, Sui C, Jin Y, Wei JH. Transcription factor AsMYC2 controls the Jasmonate-responsive expression of ASS1 regulating Sesquiterpene Biosynthesis in Aquilaria sinensis (Lour.) Gilg. Plant Cell Physiol. 2017;58:1924–33.29016977 10.1093/pcp/pcx122
4. Pires N Dolan L Origin and diversification of basic-helix-loop-helix proteins in plants Mol Biol Evol 2010 27 4 862 74 10.1093/molbev/msp288 19942615
Pires N, Dolan L. Origin and diversification of basic-helix-loop-helix proteins in plants. Mol Biol Evol. 2010;27(4):862–74.19942615 10.1093/molbev/msp288
5. Urao T Yamaguchi-Shinozaki K Mitsukawa N Molecular cloning and characterization of a gene that encodes a MYC-related protein in Arabidopsis Plant Mol Biol 1996 32 3 571 6 10.1007/BF00019112 8980509
Urao T, Yamaguchi-Shinozaki K, Mitsukawa N, et al. Molecular cloning and characterization of a gene that encodes a MYC-related protein in Arabidopsis. Plant Mol Biol. 1996;32(3):571–6.8980509 10.1007/BF00019112
6. Butterfield DA Drake J Pocernich C Evidence of oxidative damage in Alzheimer’s disease brain: central role for amyloid β-peptide Trends Mol Med 2001 7 12 548 54 10.1016/S1471-4914(01)02173-6 11733217
Butterfield DA, Drake J, Pocernich C, et al. Evidence of oxidative damage in Alzheimer’s disease brain: central role for amyloid β-peptide. Trends Mol Med. 2001;7(12):548–54.11733217 10.1016/S1471-4914(01)02173-6
7. Zong S Zeng G Zou B Effects of Polygonatum sibiricum polysaccharide on the osteogenic differentiation of bone mesenchymal stem cells in mice Int J Clin Exp Pathol 2015 8 6 6169 26261494
Zong S, Zeng G, Zou B, et al. Effects of Polygonatum sibiricum polysaccharide on the osteogenic differentiation of bone mesenchymal stem cells in mice. Int J Clin Exp Pathol. 2015;8(6):6169.26261494
8. Qi T Wang J Huang H Regulation of jasmonate-induced leaf senescence by antagonism between bHLH subgroup IIIe and IIId factors in Arabidopsis Plant Cell 2015 27 6 1634 49 10.1105/tpc.15.00110 26071420
Qi T, Wang J, Huang H, et al. Regulation of jasmonate-induced leaf senescence by antagonism between bHLH subgroup IIIe and IIId factors in Arabidopsis. Plant Cell. 2015a;27(6):1634–49.26071420 10.1105/tpc.15.00110
9. Zhu X Chen J Xie Z Jasmonic acid promotes degreening via MYC 2/3/4-and ANAC 019/055/072‐mediated regulation of major chlorophyll catabolic genes Plant J 2015 84 3 597 610 10.1111/tpj.13030 26407000
Zhu X, Chen J, Xie Z, et al. Jasmonic acid promotes degreening via MYC 2/3/4-and ANAC 019/055/072‐mediated regulation of major chlorophyll catabolic genes. Plant J. 2015;84(3):597–610.26407000 10.1111/tpj.13030
10. Qi T Huang H Song S Regulation of jasmonate-mediated stamen development and seed production by a bHLH-MYB complex in Arabidopsis Plant Cell 2015 27 6 1620 33 10.1105/tpc.15.00116 26002869
Qi T, Huang H, Song S, et al. Regulation of jasmonate-mediated stamen development and seed production by a bHLH-MYB complex in Arabidopsis. Plant Cell. 2015b;27(6):1620–33.26002869 10.1105/tpc.15.00116
11. Gao C, Qi S, Liu K et al. MYC2, MYC3, and MYC4 function redundantly in seed storage protein accumulation in Arabidopsis. Plant Physiol Biochem. 2016;108:63–70.
12. Huang CF Yu CP Wu YH Elevated auxin biosynthesis and transport underlie high vein density in C4 leaves[J] PNAS 2017 114 33 E6884 91 10.1073/pnas.1709171114 28761000
Huang CF, Yu CP, Wu YH, et al. Elevated auxin biosynthesis and transport underlie high vein density in C4 leaves[J]. PNAS. 2017;114(33):E6884–91.28761000 10.1073/pnas.1709171114
13. Sorensen AM Kröber S Unte US The Arabidopsis ABORTED MICROSPORES (AMS) gene encodes a MYC class transcription factor[J] Plant J 2003 33 2 413 23 10.1046/j.1365-313X.2003.01644.x 12535353
Sorensen AM, Kröber S, Unte US, et al. The Arabidopsis ABORTED MICROSPORES (AMS) gene encodes a MYC class transcription factor[J]. Plant J. 2003;33(2):413–23.12535353 10.1046/j.1365-313X.2003.01644.x
14. Li T Xu Y Zhang L The jasmonate-activated transcription factor MdMYC2 regulates ETHYLENE RESPONSE FACTOR and ethylene biosynthetic genes to promote ethylene biosynthesis during apple fruit ripening[J] Plant Cell 2017 29 6 1316 34 10.1105/tpc.17.00349 28550149
Li T, Xu Y, Zhang L, et al. The jasmonate-activated transcription factor MdMYC2 regulates ETHYLENE RESPONSE FACTOR and ethylene biosynthetic genes to promote ethylene biosynthesis during apple fruit ripening[J]. Plant Cell. 2017;29(6):1316–34.28550149 10.1105/tpc.17.00349
15. Uji Y Taniguchi S Tamaoki D Overexpression of OsMYC2 results in the up-regulation of early JA-rresponsive genes and bacterial blight resistance in rice[J] Plant Cell Physiol 2016 57 9 1814 27 10.1093/pcp/pcw101 27335352
Uji Y, Taniguchi S, Tamaoki D, et al. Overexpression of OsMYC2 results in the up-regulation of early JA-rresponsive genes and bacterial blight resistance in rice[J]. Plant Cell Physiol. 2016;57(9):1814–27.27335352 10.1093/pcp/pcw101
16. Zong Y Xi X Li S Allelic variation and transcriptional isoforms of wheat TaMYC1 gene regulating anthocyanin synthesis in pericarp[J] Front Plant Sci 2017 8 1645 10.3389/fpls.2017.01645 28983311
Zong Y, Xi X, Li S, et al. Allelic variation and transcriptional isoforms of wheat TaMYC1 gene regulating anthocyanin synthesis in pericarp[J]. Front Plant Sci. 2017;8:1645.28983311 10.3389/fpls.2017.01645
17. Lenka SK Nims NE Vongpaseuth K Jasmonate-responsive expression of paclitaxel biosynthesis genes in Taxus cuspidata cultured cells is negatively regulated by the bHLH transcription factors TcJAMYC1, TcJAMYC2, and TcJAMYC4[J] Front Plant Sci 2015 6 115 10.3389/fpls.2015.00115 25767476
Lenka SK, Nims NE, Vongpaseuth K, et al. Jasmonate-responsive expression of paclitaxel biosynthesis genes in Taxus cuspidata cultured cells is negatively regulated by the bHLH transcription factors TcJAMYC1, TcJAMYC2, and TcJAMYC4[J]. Front Plant Sci. 2015;6:115.25767476 10.3389/fpls.2015.00115
18. Shen Q Lu X Yan T The jasmonate-responsive AaMYC2 transcription factor positively regulates artemisinin biosynthesis in Artemisia annua New Phytol 2016 210 4 1269 81 10.1111/nph.13874 26864531
Shen Q, Lu X, Yan T, et al. The jasmonate-responsive AaMYC2 transcription factor positively regulates artemisinin biosynthesis in Artemisia annua. New Phytol. 2016;210(4):1269–81.26864531 10.1111/nph.13874
19. Li Q Li H Huang WU A chromosome-scale genome assembly of cucumber (Cucumis sativus L) GigaScience 2019 8 6 giz072 10.1093/gigascience/giz072 31216035
Li Q, Li H, Huang WU, et al. A chromosome-scale genome assembly of cucumber (Cucumis sativus L). GigaScience. 2019;8(6):giz072.31216035 10.1093/gigascience/giz072
20. Garcia-Mas J Benjak A Sanseverino W The genome of melon (Cucumis melo L) PNAS 2012 109 29 11872 7 10.1073/pnas.1205415109 22753475
Garcia-Mas J, Benjak A, Sanseverino W, et al. The genome of melon (Cucumis melo L). PNAS. 2012;109(29):11872–7.22753475 10.1073/pnas.1205415109
21. Guo S Zhang J Sun H The draft genome of watermelon (Citrullus lanatus) and resequencing of 20 diverse accessions Nat Genet 2013 45 1 51 8 10.1038/ng.2470 23179023
Guo S, Zhang J, Sun H, et al. The draft genome of watermelon (Citrullus lanatus) and resequencing of 20 diverse accessions. Nat Genet. 2013;45(1):51–8.23179023 10.1038/ng.2470
22. Xie D Xu Y Wang J The wax gourd genomes offer insights into the genetic diversity and ancestral cucurbit karyotype Nat Commun 2019 10 1 5158 10.1038/s41467-019-13185-3 31727887
Xie D, Xu Y, Wang J, et al. The wax gourd genomes offer insights into the genetic diversity and ancestral cucurbit karyotype. Nat Commun. 2019;10(1):5158.31727887 10.1038/s41467-019-13185-3
23. Robert DF Jody C Sean RE HMMER web server: interactive sequence similarity searching Nucleic Acids Res 2011 39 29 37 10.1093/nar/gkr367
Robert DF, Jody C, Sean RE. HMMER web server: interactive sequence similarity searching. Nucleic Acids Res. 2011;39:29–37.10.1093/nar/gkr367
24. Marchlerbauer A Bo Y Han L He J Lanczycki CJ Lu S Chitsaz F Derbyshire MK Geer RC Gonzales NR CDD/SPARCLE: functional classification of proteins via subfamily domain architectures Nucleic Acids Res 2017 45 D200 3 10.1093/nar/gkw1129 27899674
Marchlerbauer A, Bo Y, Han L, He J, Lanczycki CJ, Lu S, Chitsaz F, Derbyshire MK, Geer RC, Gonzales NR. CDD/SPARCLE: functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 2017;45:D200–3.27899674 10.1093/nar/gkw1129
25. Walker JM The proteomics protocols handbook Biochemistry 2006 71 6 696 696
Walker JM. The proteomics protocols handbook. Biochemistry. 2006;71(6):696–696.
26. Waterhouse A Procter J Martin DA Jalview: visualization and analysis of molecular sequences, alignments, and structures[J] BMC Bioinformatics 2005 6 3 1 1 15631638
Waterhouse A, Procter J, Martin DA, et al. Jalview: visualization and analysis of molecular sequences, alignments, and structures[J]. BMC Bioinformatics. 2005;6(3):1–1.15631638
27. Kumar S Stecher G Tamura K MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets Mol Biol Evol 2015 33 1870 4 10.1093/molbev/msw054
Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2015;33:1870–4.10.1093/molbev/msw054
28. Sinsheimer JS Little RJA Lake JA Rooting gene trees without outgroups: EP Rooting Genome Biol Evol 2012 4 8 709 19 10.1093/gbe/evs047 22593551
Sinsheimer JS, Little RJA, Lake JA. Rooting gene trees without outgroups: EP Rooting. Genome Biol Evol. 2012;4(8):709–19.22593551 10.1093/gbe/evs047
29. Voorrips RE MapChart: software for the graphical presentation of linkage maps and QTLs J Hered 2002 93 1 77 8 10.1093/jhered/93.1.77 12011185
Voorrips RE. MapChart: software for the graphical presentation of linkage maps and QTLs. J Hered. 2002;93(1):77–8.12011185 10.1093/jhered/93.1.77
30. Chen C Chen H Zhang Y Thomas HR Frank MH He Y Xia R TBtools: an integrative toolkit developed for interactive analyses of big biological data Mol Plant 2020 13 8 1194 202 10.1016/j.molp.2020.06.009 32585190
Chen C, Chen H, Zhang Y, Thomas HR, Frank MH, He Y, Xia R. TBtools: an integrative toolkit developed for interactive analyses of big biological data. Mol Plant. 2020;13(8):1194–202.32585190 10.1016/j.molp.2020.06.009
31. Wang Y, Tang H, Jeremy DD, Xu T, Li J, Wang X, Lee T, Jin H, Barry M, Guo H, Kissinger J, Paterson A. 2012. MCScanX: a toolkit for detection and evolutionary analysis of gene synteny and collinearity. 40 (7):e49–49.
32. Liu C Xie T Chen C Luan A Long J Li C Ding Y He Y Genome-wide organization and expression profiling of the R2R3-MYB transcription factor family in pineapple(Ananas comosus) BMC Genomics 2017 18 1 503 10.1186/s12864-017-3896-y 28668094
Liu C, Xie T, Chen C, Luan A, Long J, Li C, Ding Y, He Y. Genome-wide organization and expression profiling of the R2R3-MYB transcription factor family in pineapple(Ananas comosus). BMC Genomics. 2017;18(1):503.28668094 10.1186/s12864-017-3896-y
33. Brown J Pirrung M McCue LA FQC Dashboard: integrates FastQC results into a web-based, interactive, and extensible FASTQ quality control tool Bioinformatics 2017 33 3137 9 10.1093/bioinformatics/btx373 28605449
Brown J, Pirrung M, McCue LA. FQC Dashboard: integrates FastQC results into a web-based, interactive, and extensible FASTQ quality control tool. Bioinformatics. 2017;33:3137–9.28605449 10.1093/bioinformatics/btx373
34. Bolger AM Lohse M Usadel B Trimmomatic: a flexible trimmer for Illumina sequence data Bioinformatics 2014 30 2114 20 10.1093/bioinformatics/btu170 24695404
Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–20.24695404 10.1093/bioinformatics/btu170
35. Li H Handsaker B Wysoker A Fennell T Ruan J Homer N Marth G Abecasis G Durbin R The sequence alignment/map format and SAMtools Bioinformatics 2009 25 2078 9 10.1093/bioinformatics/btp352 19505943
Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R. The sequence alignment/map format and SAMtools. Bioinformatics. 2009;25:2078–9.19505943 10.1093/bioinformatics/btp352
36. Pertea M Pertea GM Antonescu CM Chang TC Mendell JT Salzberg SL StringTie enables improved reconstruction of a transcriptome from RNA-seq reads Nat Biotechnol 2015 33 3 290 5 10.1038/nbt.3122 25690850
Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol. 2015;33(3):290–5.25690850 10.1038/nbt.3122
37. Varet H Brillet-Guéguen L Coppée JY Dillies MA SARTools: a DESeq2- and EdgeR-Based R pipeline for comprehensive differential analysis of RNA-seq data PLoS ONE 2016 11 e0157022 10.1371/journal.pone.0157022 27280887
Varet H, Brillet-Guéguen L, Coppée JY, Dillies MA. SARTools: a DESeq2- and EdgeR-Based R pipeline for comprehensive differential analysis of RNA-seq data. PLoS ONE. 2016;11:e0157022.27280887 10.1371/journal.pone.0157022
38. Li Z Zhang Z Yan P Huang S Fei Z Lin K RNA-Seq improves annotation of protein-coding genes in the cucumber genome BMC Genomics 2011 12 1 11 10.1186/1471-2164-12-540 21194499
Li Z, Zhang Z, Yan P, Huang S, Fei Z, Lin K. RNA-Seq improves annotation of protein-coding genes in the cucumber genome. BMC Genomics. 2011;12:1–11.21194499 10.1186/1471-2164-12-540
39. Chen C Chen X Han J Lu W Ren Z Genome-wide analysis of the WRKY gene family in the cucumber genome and transcriptome-wide identification of WRKY transcription factors that respond to biotic and abiotic stresses BMC Plant Biol 2020 20 1 19 10.1186/s12870-020-02625-8 31898482
Chen C, Chen X, Han J, Lu W, Ren Z. Genome-wide analysis of the WRKY gene family in the cucumber genome and transcriptome-wide identification of WRKY transcription factors that respond to biotic and abiotic stresses. BMC Plant Biol. 2020;20:1–19.31898482 10.1186/s12870-020-02625-8
40. Li C Dong S Liu X Bo K Miao H Beckles DM Zhang S Gu X Genome-wide characterization of Cucumber(Cucumis sativus L.)GRAS genes and their response to various abiotic stresses Horticulturae 2020 6 4 110 27 10.3390/horticulturae6040110
Li C, Dong S, Liu X, Bo K, Miao H, Beckles DM, Zhang S, Gu X. Genome-wide characterization of Cucumber(Cucumis sativus L.)GRAS genes and their response to various abiotic stresses. Horticulturae. 2020;6(4):110–27.10.3390/horticulturae6040110
41. Zhu Y Yin J Liang Y Liu J Jia J Huo H Wu Z Yang R Gong H Transcriptomic dynamics provide an insight into the mechanism for silicon-mediated alleviation of salt stress in cucumber plants Ecotoxicol Environ Saf 2019 174 245 54 10.1016/j.ecoenv.2019.02.075 30831473
Zhu Y, Yin J, Liang Y, Liu J, Jia J, Huo H, Wu Z, Yang R, Gong H. Transcriptomic dynamics provide an insight into the mechanism for silicon-mediated alleviation of salt stress in cucumber plants. Ecotoxicol Environ Saf. 2019;174:245–54.30831473 10.1016/j.ecoenv.2019.02.075
42. Xu Q Xu X Shi Y Qi X Chen X Elucidation of the molecular responses of a cucumber segment substitution line carrying Pm5.1 and its recurrent parent triggered by powdery mildew by comparative transcriptome profiling BMC Genomics 2017 18 1 14 10.1186/s12864-016-3438-z 28049423
Xu Q, Xu X, Shi Y, Qi X, Chen X. Elucidation of the molecular responses of a cucumber segment substitution line carrying Pm5.1 and its recurrent parent triggered by powdery mildew by comparative transcriptome profiling. BMC Genomics. 2017;18:1–14.28049423 10.1186/s12864-016-3438-z
43. Wang X Cheng C Zhang K Tian Z Xu J Yang S Lou Q Li J Chen JF Comparative transcriptomics reveals suppressed expression of genes related to auxin and the cell cycle contributes to the resistance of cucumber against Meloidogyne incognita BMC Genomics 2018 19 1 14 10.1186/s12864-018-4979-0 29291715
Wang X, Cheng C, Zhang K, Tian Z, Xu J, Yang S, Lou Q, Li J, Chen JF. Comparative transcriptomics reveals suppressed expression of genes related to auxin and the cell cycle contributes to the resistance of cucumber against Meloidogyne incognita. BMC Genomics. 2018;19:1–14.29291715 10.1186/s12864-018-4979-0
44. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method[J]. methods. 2001;25(4):402–408.
45. Kazan K Manners JM MYC2: the Master in Action Mol Plant 2013 6 686 703 10.1093/mp/sss128 23142764
Kazan K, Manners JM. MYC2: the Master in Action. Mol Plant. 2013;6:686–703.23142764 10.1093/mp/sss128
46. Blackwood E Eisenman R Max A helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc Science 1991 251 1211 10.1126/science.2006410 2006410
Blackwood E, Eisenman R, Max. A helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc. Science. 1991;251:1211.2006410 10.1126/science.2006410
47. Heim MA Jakoby M Werber M Martin C Weisshaar B Bailey PC The Basic Helix-Loop-Helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity Mol Biol Evol 2003 20 735 47 10.1093/molbev/msg088 12679534
Heim MA, Jakoby M, Werber M, Martin C, Weisshaar B, Bailey PC. The Basic Helix-Loop-Helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. Mol Biol Evol. 2003;20:735–47.12679534 10.1093/molbev/msg088
48. Menkens AE Schindler U Cashmore AR The G-box: a ubiquitous regulatory DNA element in plants bound by the GBF family of bZIP proteins[J] Trends Biochem Sci 1995 20 12 506 10 10.1016/S0968-0004(00)89118-5 8571452
Menkens AE, Schindler U, Cashmore AR. The G-box: a ubiquitous regulatory DNA element in plants bound by the GBF family of bZIP proteins[J]. Trends Biochem Sci. 1995;20(12):506–10.8571452 10.1016/S0968-0004(00)89118-5
49. Jeffares DC Mourier T Penny D The biology of intron gain and loss[J] Trends Genet 2006 22 1 16 22 10.1016/j.tig.2005.10.006 16290250
Jeffares DC, Mourier T, Penny D. The biology of intron gain and loss[J]. Trends Genet. 2006;22(1):16–22.16290250 10.1016/j.tig.2005.10.006
50. Xu G Guo C Shan H Divergence of duplicate genes in exon–intron structure[J] PNAS 2012 109 4 1187 92 10.1073/pnas.1109047109 22232673
Xu G, Guo C, Shan H, et al. Divergence of duplicate genes in exon–intron structure[J]. PNAS. 2012;109(4):1187–92.22232673 10.1073/pnas.1109047109
51. Jeffares DC Penkett CJ Bähler J Rapidly regulated genes are intron poor[J] Trends Genet 2008 24 8 375 8 10.1016/j.tig.2008.05.006 18586348
Jeffares DC, Penkett CJ, Bähler J. Rapidly regulated genes are intron poor[J]. Trends Genet. 2008;24(8):375–8.18586348 10.1016/j.tig.2008.05.006
52. Qi TC Huang H Song SS Xie DX Regulation of Jasmonate-mediated stamen development and seed production by a bHLH-MYB complex in Arabidopsis Plant Cell 2015 27 1620 33 10.1105/tpc.15.00116 26002869
Qi TC, Huang H, Song SS, Xie DX. Regulation of Jasmonate-mediated stamen development and seed production by a bHLH-MYB complex in Arabidopsis. Plant Cell. 2015;27:1620–33.26002869 10.1105/tpc.15.00116
53. Li S, Hu Y, Yang H et al. The regulatory roles of MYC TFs in plant stamen development[J]. Plant Sci. 2023;111734.
54. Fukazawa J Mori K Ando H Jasmonate inhibits plant growth and reduces gibberellin levels via microRNA5998 and transcription factor MYC2[J] Plant Physiol 2023 193 3 2197 214 10.1093/plphys/kiad453 37562026
Fukazawa J, Mori K, Ando H, et al. Jasmonate inhibits plant growth and reduces gibberellin levels via microRNA5998 and transcription factor MYC2[J]. Plant Physiol. 2023;193(3):2197–214.37562026 10.1093/plphys/kiad453
55. Johnson LYD Major IT Chen Y Diversification of JAZ-MYC signaling function in immune metabolism[J] New Phytol 2023 239 6 2277 91 10.1111/nph.19114 37403524
Johnson LYD, Major IT, Chen Y, et al. Diversification of JAZ-MYC signaling function in immune metabolism[J]. New Phytol. 2023;239(6):2277–91.37403524 10.1111/nph.19114
56. Zuccarini P Effects of silicon on photosynthesis, water relations and nutrient uptake of Phaseolus vulgaris under NaCl stress[J] Biol Plant 2008 52 157 60 10.1007/s10535-008-0034-3
Zuccarini P. Effects of silicon on photosynthesis, water relations and nutrient uptake of Phaseolus vulgaris under NaCl stress[J]. Biol Plant. 2008;52:157–60.10.1007/s10535-008-0034-3
57. Zhu Y Jiang X Zhang J Silicon confers cucumber resistance to salinity stress through regulation of proline and cytokinins[J] Plant Physiol Bioch 2020 156 209 20 10.1016/j.plaphy.2020.09.014
Zhu Y, Jiang X, Zhang J, et al. Silicon confers cucumber resistance to salinity stress through regulation of proline and cytokinins[J]. Plant Physiol Bioch. 2020;156:209–20.10.1016/j.plaphy.2020.09.014
58. Shinozaki K Yamaguchi-Shinozaki K Gene networks involved in drought stress response and tolerance J Exp Bot 2007 58 221 7 10.1093/jxb/erl164 17075077
Shinozaki K, Yamaguchi-Shinozaki K. Gene networks involved in drought stress response and tolerance. J Exp Bot. 2007;58:221–7.17075077 10.1093/jxb/erl164
59. Miura K Shiba H Ohta M SlICE1 encoding a MYC-type transcription factor controls cold tolerance in tomato, Solanum lycopersicum[J] Plant Biotechnol J 2012 29 3 253 60 10.5511/plantbiotechnology.12.0303a
Miura K, Shiba H, Ohta M, et al. SlICE1 encoding a MYC-type transcription factor controls cold tolerance in tomato, Solanum lycopersicum[J]. Plant Biotechnol J. 2012;29(3):253–60.10.5511/plantbiotechnology.12.0303a
60. Ohta M Sato A Renhu N MYC-type transcription factors, MYC67 and MYC70, interact with ICE1 and negatively regulate cold tolerance in Arabidopsis[J] Sci Rep 2018 8 1 11622 10.1038/s41598-018-29722-x 30072714
Ohta M, Sato A, Renhu N, et al. MYC-type transcription factors, MYC67 and MYC70, interact with ICE1 and negatively regulate cold tolerance in Arabidopsis[J]. Sci Rep. 2018;8(1):11622.30072714 10.1038/s41598-018-29722-x
61. Geng J Wei T Wang Y Overexpression of PtrbHLH, a basic helix-loop-helix transcription factor from Poncirus trifoliata, confers enhanced cold tolerance in pummelo (Citrus grandis) by modulation of H2O2 level via regulating a CAT gene[J] Tree Physiol 2019 39 12 2045 54 31330032
Geng J, Wei T, Wang Y, et al. Overexpression of PtrbHLH, a basic helix-loop-helix transcription factor from Poncirus trifoliata, confers enhanced cold tolerance in pummelo (Citrus grandis) by modulation of H2O2 level via regulating a CAT gene[J]. Tree Physiol. 2019;39(12):2045–54.31330032
62. Wang X Song Q Guo H StICE1 enhances plant cold tolerance by directly upregulating StLTI6A expression[J] Plant Cell Rep 2023 42 1 197 210 10.1007/s00299-022-02949-9 36371722
Wang X, Song Q, Guo H, et al. StICE1 enhances plant cold tolerance by directly upregulating StLTI6A expression[J]. Plant Cell Rep. 2023;42(1):197–210.36371722 10.1007/s00299-022-02949-9
63. Yang J Guo X Mei Q MdbHLH4 negatively regulates apple cold tolerance by inhibiting MdCBF1/3 expression and promoting MdCAX3L-2 expression[J] Plant Physiol 2023 191 1 789 806 10.1093/plphys/kiac512 36331333
Yang J, Guo X, Mei Q, et al. MdbHLH4 negatively regulates apple cold tolerance by inhibiting MdCBF1/3 expression and promoting MdCAX3L-2 expression[J]. Plant Physiol. 2023;191(1):789–806.36331333 10.1093/plphys/kiac512
64. Lee JS Chu IS Mikaelyan A Application of comparative functional genomics to identify best-fit mouse models to study human cancer[J] Nat Genet 2004 36 12 1306 11 10.1038/ng1481 15565109
Lee JS, Chu IS, Mikaelyan A, et al. Application of comparative functional genomics to identify best-fit mouse models to study human cancer[J]. Nat Genet. 2004;36(12):1306–11.15565109 10.1038/ng1481
