
==== Front
101573691
39703
Cell Rep
Cell Rep
Cell reports
2211-1247

39018246
10.1016/j.celrep.2024.114510
nihpa2019505
Article
Proteomic analysis reveals a PLK1-dependent G2/M degradation program and a role for AKAP2 in coordinating the mitotic cytoskeleton
Mouery Ryan D. 12
Lukasik Kimberly 3
Hsu Carolyn 2
Bonacci Thomas 24
Bolhuis Derek L. 6
Wang Xianxi 24
Mills C. Allie 5
Toomer E. Drew 24
Canterbury Owen G. 4
Robertson Kevin C. 24
Branigan Timothy B. 78
Brown Nicholas G. 24
Herring Laura E. 245
Gupton Stephanie L. 23
Emanuele Michael J. 249*
1 Department of Genetics, The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA
2 Lineberger Comprehensive Cancer Center, The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA
3 Department of Cell Biology and Physiology, The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA
4 Department of Pharmacology, The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA
5 UNC Proteomics Core Facility, Department of Pharmacology, The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA
6 Department of Biochemistry and Biophysics, The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA
7 Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02215, USA
8 Department of Medicine, Harvard Medical School, Boston, MA 02115, USA
9 Lead contact
AUTHOR CONTRIBUTIONS

R.D.M. and M.J.E. conceived the experiments. R.D.M. performed most cell and molecular experiments. C.H., X.W., T.B., E.D.T., and O.G.C. helped with cell and molecular biology experiments. D.L.B., N.G.B., and M.J.E. designed reagents for in vitro assays. D.L.B. and K.C.R. purified proteins, and D.L.B. performed assays under the supervision of N.G.B. and M.J.E. C.A.M. and L.E.H. assisted in designing proteomics experiments and performed and helped analyze data for all mass spectrometry experiments. R.D.M., M.J.E., K.L., and S.L.G. designed microscopy experiments. K.L. carried out all microscopy and image analysis. T.B.B. generated HCT116 Cyclin F knockout cell lines. R.D.M. and M.J.E. discussed, drafted, and wrote the manuscript. All authors provided feedback on the final draft.

* Correspondence: emanuele@email.unc.edu
9 9 2024
27 8 2024
16 7 2024
16 9 2024
43 8 114510114510
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (https://creativecommons.org/licenses/by-nc-nd/4.0/).
SUMMARY

Ubiquitination is an essential regulator of cell division. The kinase Polo-like kinase 1 (PLK1) promotes protein degradation at G2/M phase through the E3 ubiquitin ligase Skp1-Cul1-F box (SCF)βTrCP. However, the magnitude to which PLK1 shapes the mitotic proteome is uncharacterized. Combining quantitative proteomics with pharmacologic PLK1 inhibition revealed a widespread, PLK1-dependent program of protein breakdown at G2/M. We validated many PLK1-regulated proteins, including substrates of the cell-cycle E3 SCFCyclin F, demonstrating that PLK1 promotes proteolysis through at least two distinct E3 ligases. We show that the protein-kinase-A-anchoring protein A-kinase anchor protein 2 (AKAP2) is cell-cycle regulated and that its mitotic degradation is dependent on the PLK1/βTrCP signaling axis. Expression of a non-degradable AKAP2 mutant resulted in actin defects and aberrant mitotic spindles, suggesting that AKAP2 degradation coordinates cytoskeletal organization during mitosis. These findings uncover PLK1’s far-reaching role in shaping the mitotic proteome post-translationally and have potential implications in malignancies where PLK1 is upregulated.

In brief

Mouery et al. utilize deep, quantitative proteomics to reveal a PLK1-regulated program of G2/M protein degradation. They show that the PKA-anchoring protein AKAP2 is degraded in a manner dependent on PLK1 and the E3 ubiquitin ligase SCFβTrCP and that disruption of AKAP2 degradation results in defects of the mitotic cytoskeleton.

Graphical Abstract
==== Body
pmcINTRODUCTION

Cell-cycle progression enables duplication and segregation of the genome into identical daughter cells. A fundamental feature of the eukaryotic cell cycle is that it proceeds in a unidirectional and irreversible manner. The timely degradation of cell-cycle regulatory proteins by the ubiquitin-proteasome system ensures cell-cycle irreversibility, prevents genome reduplication, and maintains genome integrity.1 The ubiquitin system regulates protein degradation by utilizing a cascade of enzymes termed E1, E2, and E3, which culminates in the post-translational attachment of the small protein ubiquitin to target proteins. The formation of polyubiquitin chains on substrates is often a proteolytic signal that targets substrates to the proteasome, triggering their degradation. E3 ubiquitin ligases are the enzymes responsible for directly binding to substrates and thus confer substrate specificity in the ubiquitin pathway.2 Despite the importance of ubiquitin signaling in cell-cycle regulation, less is known about its role at the G2/M transition. This is despite the importance of G2/M in proliferative decision-making and cell-cycle arrest in response to genotoxic stress.3–6

The Skp1-Cul1-F box (SCF) family of E3 ubiquitin ligases plays critical roles in cell-cycle progression.7,8 The SCF relies on a family of ~70 substrate receptors termed F-box proteins, which recruit substrates to the SCF for ubiquitination.9,10 The F-box proteins βTrCP and Cyclin F, among others, play critical roles in cell-cycle progression.11 βTrCP1 and βTrCP2 (hereafter βTrCP, unless otherwise noted) are functionally redundant and remain constitutively active throughout the cell cycle to control the degradation of many different proteins.12 βTrCP recognizes substrates containing a consensus DSGxx(x)S phospho-degron13 following phosphorylation by upstream kinases.14 Cyclin F is the founding member of the F-box family, and its expression is cell-cycle regulated.15 While it contains a cyclin homology domain that binds to Cy motifs in substrates, Cyclin F neither binds to nor activates a cyclin-dependent kinase. Instead, Cyclin F drives cell-cycle progression via ubiquitination.16 Both Cyclin F and βTrCP control the destruction of many cell-cycle proteins and play key roles in proliferation.

Polo-like kinase 1 (PLK1) is a multifunctional cell-cycle kinase that is most highly active during G2 phase and mitosis. The activation of PLK1 at G2 helps promote mitotic entry in many cell types through the coordinated phosphorylation of myriad substrates.17–20 Once cells enter mitosis, PLK1 plays vital roles in controlling spindle organization, microtubule dynamics, and kinetochore function. Later in mitosis, PLK1 promotes mitotic exit and cytokinesis, altogether highlighting PLK1’s critical role in cell division.21 PLK1 has also been shown to coordinate protein degradation at mitotic entry. Established PLK1-dependent degradation substrates include EMI122,23 and USP37,24 both of which antagonize the cell-cycle E3 APC/C; WEE1,25 which controls cyclin-dependent kinase activity; and Claspin,26–28 which promotes DNA-damage-checkpoint signaling in S phase. In addition, PLK1-mediated degradation of Bora promotes normal progression through mitosis by regulating the function of Aurora kinase A.29,30 PLK1 regulates the degradation of these proteins through the phosphorylation of the aforementioned degron sequence, allowing for binding to SCFβTrCP. Since PLK1 activity is cell-cycle regulated,31,32 there is a limited temporal window in which the degradation of these substrates is controlled.

Despite our knowledge of the PLK1/βTrCP signaling axis and the importance of PLK1 in normal and cancer cell cycles, the magnitude to which PLK1 shapes the mitotic proteome through regulated protein degradation has not been studied. Determining the extent to which PLK1 controls proteome dynamics will shed light on the mechanisms of G2/M control and the potential clinical use of PLK1 inhibitors.

We used mass spectrometry (MS) to perform global, quantitative proteomic analysis on mitotically synchronized, PLK1-inhibited colorectal cancer cells that harbor activating mutations in the oncogenic small GTPase KRAS. We identified over 200 proteins whose abundances are negatively regulated by PLK1 activity. Together with the validation of many substrates, this demonstrates a widespread, PLK1-regulated G2/M degradation program. Significantly, we found that the degradation of most known SCFCyclin F substrates is PLK1 dependent, suggesting that PLK1 coordinates degradation through at least two cell-cycle E3 ubiquitin ligases.

Among the many proteins validated was A-kinase anchor protein 2 (AKAP2), which we show to be degraded in mitosis in a PLK1- and βTrCP-dependent manner, and we reveal a function for AKAP2 in organizing the mitotic cytoskeleton. AKAP family proteins bind to the regulatory subunit of protein kinase A (PKA) and function as scaffolds to facilitate localized PKA signaling within distinct areas of the cell.33 There are over 50 members of the AKAP family, and these are implicated in diverse aspects of cell physiology.34 However, the functions of AKAP2 are poorly understood, and it has mainly been studied in specialized tissues such as chondrocytes,35 cardiomyocytes,36 ocular lens,37 and various cancer types.38,39 More recent studies have shown that AKAP2 localizes to the actin cytoskeleton to coordinate cell migration and motility.40,41

Collectively, our data highlight the role of protein degradation in the G2 phase of the cell cycle and provide a connection between PLK1, AKAP2, and the regulation of mitosis. We previously showed that PLK1 inhibition (PLK1i) or depletion has a synthetic lethal relationship with activating mutations in KRAS in colorectal cancer cells.42 PLK1 inhibitors are under clinical investigation and are being specifically tested in KRAS mutant colorectal cancers.43,44 Thus, our findings may have important implications for the treatment of cancer.

RESULTS

PLK1 regulates a G2/M degradation program

To understand how the mitotic proteome is affected by PLK1 activity, we arrested HCT116 cells in prometaphase using nocodazole in the presence of DMSO or either of two distinct small-molecule inhibitors targeting PLK1 (BI2536 and BI6727). Synchronized cells were collected using mitotic “shake-off,” and whole-cell extracts were prepared for label-free, quantitative proteomics using data-independent acquisition (Figure 1A and Table S1). In parallel, we analyzed asynchronous HCT116 cells and compared these to the DMSO-treated mitotically arrested cells. Validating our synchronization, we identified many key mitotic proteins among those most strongly upregulated in mitosis. These include Cyclin B1; Aurora kinase A; components of the chromosomal passenger complex (AURKB, BIRC5/Survivin, INCENP, and CDCA8/Borealin); the centromere/kinetochore proteins CENP-F, BUB1, Shugoshin 1, and Shugoshin 2; and PLK1 (Figure 1B and Table S1).

To understand how PLK1 impacts total protein levels in mitosis, we focused on changes in mitotic cells following PLK1i. Data from the two PLK1 inhibitors were strongly correlated (Pearson’s correlation coefficient = 0.9167), suggesting that the changes seen are not simply off-target effects of the small molecules (Figure 1C). Using cutoffs of 0.6 for log2 ratio (PLK1i/mitosis) and a p value of 0.01 for statistical significance, we identified more than 200 proteins whose abundances were upregulated in PLK1-inhibited mitotic cells compared to control mitotic cells (Figures 1D and S1A/B). BI2536 treatment yielded a greater number of significant changes than did BI6727 treatment. This is likely because, at the concentrations used, BI2536 provides a more robust inhibition of PLK1 activity, as indicated by the phosphorylation of serine 46 on TCTP, an established PLK1 substrate (Figure S1C). Among the proteins upregulated in mitosis in response to PLK1i, we identified WEE1, Claspin, Bora, and FBXO5/EMI1, whose mitotic degradation has been previously shown to be PLK1 dependent. We performed gene ontology (GO) analysis on the proteins upregulated in response to PLK1i and found that “regulation of cell cycle process” and “cell division” were among the most enriched GO terms, consistent with PLK1’s role as a cell-cycle regulator (Figure 1E and Table S2).

Established PLK1/βTrCP substrates were strongly downregulated in mitosis compared to asynchronous cells and strongly upregulated in PLK1-inhibited mitotic cells compared to control mitotic cells (Figure 1F). We therefore searched our dataset for additional proteins following this pattern, as these are strong candidates for PLK1-dependent proteasomal targets at G2/M phase. This analysis identified the RNA helicase DDX24 and transcriptional regulators YAP1 and TAZ as downregulated in mitosis in a PLK1-dependent manner, and all three were validated by endogenous immunoblot (Figure 1G). Interestingly, this analysis also identified many known substrates of the cell-cycle E3 ubiquitin ligase SCFCyclin F (Figure 1F). In HCT116 cells, we validated by immunoblot of endogenous proteins that the mitotic regulation of the Cyclin F substrates SLBP, RRM2, CP110, Cdc6, and E2F145–50 is PLK1 dependent (Figure 1G).

Importantly, PLK1i did not result in non-specific changes to cell-cycle proteins. Cell synchrony was confirmed by immunoblotting for total Cyclin B, phosphorylation of PLK1 within its activation loop (residue T210), and phosphorylation of Histone H3 on S10 (Figure 1G). PLK1 belongs to the family of Polo-like kinases, which includes PLK2, PLK3, and PLK4. Given the potential for off-target inhibitor effects, we examined the abundance of the validated proteins above in response to five different PLK1 inhibitors (Figure S1D). These small molecules rely on differing scaffolds to inhibit PLK1, and all five behaved similarly. The PLK2 inhibitor ON1231320 had no effect on the abundance of these proteins. Together, these data indicate that the differences in protein abundances seen are a result of PLK1i and not a result of unequal synchronization or non-specific inhibition of related Polo-like kinases.

PLK1 promotes SCFCyclin F substrate degradation

To test whether the PLK1-dependent regulation of Cyclin F substrates occurs in multiple cell types, we examined HeLa cells arrested in mitosis with or without PLK1i. Cyclin F substrate degradation was similarly prevented by PLK1i in HeLa cells, suggesting that this regulation is not limited to a single cell type (Figure S2A). We also examined whether the regulation of Cyclin F substrates by PLK1 is indeed Cyclin F dependent and not through βTrCP or another E3. The abundance of Cyclin F substrates in mitosis was unchanged in Cyclin-F-knockout cells following PLK1i (Figures S2B and S2C), demonstrating an epistatic relationship in which PLK1 functions upstream of Cyclin F to promote the degradation of its substrates.

Interestingly, unlike in the case of βTrCP, Cyclin F does not directly recognize phospho-degrons in substrates.51 This raises the question as to how PLK1 promotes the degradation of Cyclin F substrates. We hypothesized that PLK1 may regulate Cyclin F itself, rather than its individual substrates. Consistently, we found that transient PLK1i resulted in the loss of Cyclin F abundance in six different cell lines (Figure S3A). The loss of Cyclin F showed a dose-dependent response to BI2536 treatment, suggesting the effect is PLK1 specific (Figure S3B). Conversely, the abundance of exogenously expressed Cyclin F increased when co-expressed with PLK1 (Figure S3C), suggesting that PLK1 positively regulates Cyclin F abundance. To gain insight into how PLK1 regulates Cyclin F abundance, we combined PLK1i (Figures S3D and S3E) or PLK1 overexpression (Figures S3F and S3G) with cycloheximide chase analysis. PLK1i decreased Cyclin F stability, whereas PLK1 overexpression markedly increased Cyclin F stability, suggesting that PLK1 regulates Cyclin F through a post-translational mechanism.

The C-terminal PEST domain has been reported to contribute to Cyclin F stability52 and contains several putative PLK1 phosphorylation sites. We co-expressed Cyclin F truncation mutants with or without PLK1 to identify the region(s) necessary for PLK1-mediated stabilization (Figure S4A). However, all Cyclin F truncations tested were stabilized by PLK1 expression, suggesting that multiple regions of Cyclin F may be regulated by PLK1. While Cyclin F and PLK1 interact by co-immunoprecipitation (coIP) (Figure S4B), the mechanism by which PLK1 regulates Cyclin F stability is unclear (Figure S4C).

Altogether, these data suggest that PLK1 regulates a G2/M degradation program in coordination with at least two distinct E3 ubiquitin ligases.

AKAP2 is a cell-cycle-regulated protein

Most proteins whose degradation is controlled by PLK1 are cell-cycle regulated, and their expression is decreased in mitosis. Among the most significantly downregulated proteins in mitosis is AKAP2 (Figure 2A). Proteomic data also suggested that AKAP2 is significantly increased in mitotic cells treated with BI2536 and BI6727, compared to control mitotic cells (Figures S1A and S1B). AKAP2 has not been described previously to be regulated in a cell-cycle-dependent manner. We found that AKAP2 protein level dynamics were remarkably similar to those of Claspin, whose phosphorylation by PLK1 in G2/M triggers its ubiquitination and degradation (Figure 2B). We therefore hypothesized that AKAP2 is a cell-cycle-regulated protein whose mitotic degradation is regulated by PLK1.

We found by immunoblot that endogenous AKAP2 abundance is reduced in HCT116 cells arrested in mitosis with nocodazole (Figure 2C), but not when cells (HCT116 and RPE1) were arrested in other cell-cycle phases (Figures 2D and 2E). To monitor AKAP2 expression in cycling cells, we released HeLa cells from G1/S-phase synchronization following a double-thymidine block. AKAP2 protein levels began to decrease coinciding with the timing of mitotic entry, as indicated by phospho-H3 S10 staining (Figure 2F). We next monitored AKAP2 expression beginning from mitotic synchronization with nocodazole. AKAP2 protein levels decreased for several hours as the cells exited mitosis and reaccumulated 8–10 h following release, correlating with the start of S phase, marked by the appearance of Cyclin E and Cyclin A (Figure 2G). Together, these data demonstrate that AKAP2 is a cell-cycle-regulated protein whose expression is downregulated in mitosis.

PLK1 regulates AKAP2 abundance in mitosis

Our proteomic analysis suggested that the downregulation of AKAP2 abundance during mitosis is mediated by PLK1. To test this, we arrested cells in mitosis with nocodazole in the presence or absence of small-molecule inhibitors targeting PLK1. In HCT116 (Figure 3A) and HeLa cells (Figure S5A), the decrease in AKAP2 abundance in mitosis was rescued when PLK1 was inhibited with either BI6727 or BI2536. Similarly, the reduction in AKAP2 in mitosis was blocked by treatment with onvansertib (NMS-P937), a third-generation PLK1 inhibitor currently under clinical investigation in KRAS mutant colorectal cancer (NCT05593328), as well as the PLK1 inhibitors plogosertib (CYC140) and GSK461364 (Figure S1D). AKAP2 was also downregulated in a PLK1-dependent manner when cells were synchronized in mitosis using paclitaxel, suggesting that the effect is not related to the microtubule destabilizing effects of nocodazole (Figure S5B). Similarly, AKAP2 protein levels were increased in mitotic cells following transient depletion of PLK1 with small interfering RNA (siRNA) (Figure 3B).

We next utilized a chemical genetic approach using RPE-1 cells in which endogenous PLK1 was replaced with wild type (WT) or an ATP analog-sensitive (AS) version of PLK1.53 PLK1-AS has a mutation in the gatekeeper residue that allows for specific PLK1i using the bulky ATP analog 3MB-PP1. We synchronized PLK1-WT or PLK1-AS cells in mitosis in the presence or absence of either 3MB-PP1 or the small-molecule PLK1 inhibitor BI2536 (Figure 3C). As expected, PLK1-WT cells are insensitive to 3MB-PP1, showing no change in PLK1 activity based on the substrate marker p-TCTP (S46) and, consistently, no change in AKAP2 abundance. These cells, however, remain sensitive to the PLK1 inhibitor BI2536, which caused a decrease in p-TCTP and increase in AKAP2 expression. PLK1-AS cells are sensitive to 3MB-PP1, showing reduced PLK1 activity and a significant increase in AKAP2 abundance. Further, PLK1-AS cells were previously shown to exhibit reduced sensitivity to BI253654 and, consistently, we could not rescue AKAP2 protein levels by BI2536 treatment in PLK1-AS cells. Thus, PLK1 abundance and activity are necessary for the downregulation of AKAP2 in mitosis across multiple cell lines.

We examined the effects of PLK1 on AKAP2 stability by using ectopic overexpression in HEK293T cells. Levels of exogenously expressed AKAP2 were reduced when co-expressed with WT PLK1 (Figure 3D). However, no reduction in AKAP2 was seen when co-expressed with a catalytically inactive mutant of PLK1 (PLK1T210A). Next, we asked whether PLK1 binds AKAP2. Indeed, WT PLK1 interacts with AKAP2, as determined by exogenous co-immunoprecipitation in HEK293T cells (Figure 3E). PLK1 uses two key residues in its Polo-box domain to bind substrates that have been “primed” by phosphorylation by a separate kinase.55 Mutations in these residues (PLK1Pincer) abrogate binding to AKAP2, suggesting that the Polo-box domain of PLK1 is important for its regulation of AKAP2 (Figure 3E). We also tested whether endogenous AKAP2 and PLK1 can interact. HCT116 cells were synchronized in mitosis using nocodazole and then treated with the neddylation inhibitor MLN4924 for 4 h prior to harvesting to rescue AKAP2 degradation (see below). Indeed, we detected an interaction between endogenous PLK1 and AKAP2 following immunoprecipitation of AKAP2 (Figure 3F). Altogether, these data suggest that PLK1 binds to AKAP2 to regulate its abundance during mitosis.

To test whether PLK1 promotes AKAP2 degradation through direct phosphorylation, we performed an in vitro kinase assay followed by MS analysis to identify specific sites in AKAP2 whose phosphorylation would be increased by PLK1. FLAG-AKAP2 was isolated from HEK293T cells, incubated in vitro with recombinant PLK1, and analyzed by MS. We identified multiple sites on AKAP2 that were phosphorylated in the presence of PLK1, suggesting that AKAP2 is a direct PLK1 substrate (Figure 3G and Table S3).

SCFβTrCP mediates the proteasomal degradation of AKAP2 during mitosis

To understand the mechanism by which AKAP2 is reduced during mitosis, we arrested cells in mitosis using nocodazole in the presence of the neddylation inhibitor MLN4924, which inhibits Cullin-RING ligases that depend on neddylation for activity,56 or the proteasome inhibitor bortezomib (Figure 4A). The reduction in AKAP2 expression in mitosis was blocked by treatment with each inhibitor, suggesting that AKAP2 is degraded by the ubiquitin-proteasome system and, specifically, through the activity of a Cullin-RING ubiquitin ligase. AKAP2 abundance was also increased if cells were treated transiently with MLN4924 or with the proteasome inhibitor MG132 after mitotic synchronization, suggesting that AKAP2 is actively degraded in mitotically arrested cells (Figure S6A).

To determine the roles of βTrCP and Cyclin F in shaping the mitotic proteome, and their potential roles in AKAP2 degradation, we transiently depleted βTrCP or Cyclin F using siRNA, arrested cells in mitosis, and performed label-free, quantitative proteomics (Figures S6B–S6D and Table S4). Several of the top hits in the βTrCP-depleted samples were established substrates, including WEE1, USP37, and Claspin (Figure S6C). AKAP2 was also among these top hits, showing a significant increase in expression in mitotic cells depleted of βTrCP compared to our non-targeting control (Figure S6C). When comparing the data from our PLK1i proteomics with our βTrCP siRNA proteomics, we found that 27 proteins were upregulated by both treatments (Figure 4B). Of these 27 proteins, 7 contain the minimal “DSG” βTrCP motif, 15 contain a previously mapped phosphorylation site that is predicted to be targeted by a Polo-like kinase, and 6 contain both (Table S5). Among these 6, AKAP2 scored among the most upregulated proteins in both datasets, strongly suggesting that its degradation is mediated along the PLK1/βTrCP-signaling axis, similar to WEE1 and Claspin (Figure 4B). Indeed, siRNA knockdown followed by immunoblot confirmed that AKAP2 degradation is dependent on Cullin 1, the scaffold protein utilized by all F-box proteins, and βTrCP, but not Cyclin F (Figure 4C). Consistently, we were able to detect an interaction between AKAP2 and both βTrCP1 and βTrCP2 by coIP following ectopic expression in HEK293T cells (Figure 4D). Moreover, mutations in the WD40 repeats of βTrCP1 (βTrCP1WD40Mut) and βTrCP2 (βTrCP2WD40Mut) that disrupt binding to substrates57,58 reduced their interaction with AKAP2 (Figures 4E and S6E). Finally, endogenous βTrCP and AKAP2 interact in mitotically arrested cells following immunoprecipitation of endogenous AKAP2 (Figure 4F).

These data further support the notion that SCFβTrCP is the E3 ubiquitin ligase responsible for the proteasomal degradation of AKAP2 during mitosis.

SCFβTrCP utilizes a non-canonical degron to bind and degrade AKAP2

The canonical degron sequence found in βTrCP substrates is DSGxx(x)S, in which both serine residues are typically required to be phosphorylated for efficient βTrCP binding. However, many substrates with variable βTrCP degrons have been reported, such as CDC25A and CDC25B.59 AKAP2 does not have a fully canonical βTrCP degron; however, it does contain three DSG minimal sequence motifs (Figure 5A). We examined the binding to βTrCP of three separate AKAP2 mutants in which the DSG motifs were individually disrupted by mutating each residue within the motif to alanine (referred to as AKAP2DSG1, AKAP2DSG2, or AKAP2DSG3). Notably, AKAP2DSG1 is not conserved across species, whereas AKAP2DSG2 and AKAP2DSG3 are well conserved (Figures 5B,S7A, and S7B). AKAP2WT, AKAP2DSG1, and AKAP2DSG3 all similarly co-immunoprecipitated with βTrCP (Figure 5C). However, AKAP2DSG2 (amino acids 472–474) was unable to interact with βTrCP, suggesting that DSG2 is likely to be the functional degron.

The glutamic acid residue (E477) downstream of the DSG2 motif could potentially serve as a phospho-mimetic and contribute to βTrCP binding. In addition, serine 479 falls within the canonical PLK1 phosphorylation motif and may also help complete an atypical degron. We therefore tested their contribution to βTrCP binding by coIP analysis in HEK293T cells (Figure S7C). Whereas the AKAP2DSG2 mutant bound less βTrCP than AKAP2WT, the AKAP2E477A and AKAP2S479A mutants showed no reduction in βTrCP binding. Consistently, S479 was not found to be phosphorylated by PLK1 in vitro (Figure 3G). This suggests these residues do not contribute to βTrCP binding.

Next, we tested whether the AKAP2DSG2 mutant is stabilized in mitosis. We generated HCT116 cells stably expressing either FLAG-AKAP2WT or FLAG-AKAP2DSG2. In asynchronous cells, FLAG-AKAP2DSG2 was more abundant than FLAG-AKAP2WT, consistent with the lack of binding to βTrCP (Figure S7D). Significantly, similar to endogenous AKAP2, FLAG-AKAP2WT was degraded in mitosis, whereas FLAG-AKAP2DSG2 was resistant to degradation (Figure 5D). Other βTrCP substrates, such as Claspin, were degraded normally in cells expressing FLAG-AKAP2DSG2. Stabilized AKAP2 does not interfere with the cell’s ability to arrest in mitosis, as indicated by equal levels of Cyclin B1 and phospho-H3 S10. We also engineered HCT116 cells in which expression of AKAP2WT or AKAP2DSG2 was under the control of a doxycycline-inducible promoter. To monitor AKAP2 stability, we arrested these cells in mitosis in the presence of doxycycline to induce AKAP2 expression (Figure S7E). Using the same concentration of doxycycline, AKAP2DSG2 expression was higher than that of AKAP2WT, suggesting that AKAP2DSG2 is resistant to degradation in mitosis.

The role of PLK1 in promoting the degradation of βTrCP substrates is to phosphorylate the target at one of the serine residues within the βTrCP degron sequence to promote the interaction between the E3 ligase and its substrate. Our phospho-proteomic analysis showed that PLK1 promotes the phosphorylation of serine 473 within the DSG2 motif (Figure 3G). Thus, AKAP2DSG2 should be unaffected by PLK1i. To test this hypothesis, we arrested our FLAG-AKAP2WT- or FLAG-AKAP2DSG2-expressing HCT116 cells in mitosis with or without PLK1i using BI2536 (Figure 5E). FLAG-AKAP2WT was degraded in mitosis, and this effect was reversed upon inhibition of PLK1. Conversely, FLAG-AKAP2DSG2 was not degraded in mitosis and showed no change in abundance when PLK1 was inhibited with BI2536. Interestingly, although the abundance of AKAP2DSG2 was unaffected by PLK1i, there was a slight electrophoretic shift of the protein, consistent with PLK1 phosphorylating AKAP2 at additional sites beyond serine 473 (Figure 3G). Consistently, AKAP2DSG2 is still able to interact with PLK1 by coIP (Figure S7F). When co-expressed ectopically with PLK1, AKAP2WT is degraded, whereas AKAP2DSG2 is not (Figure S7F; see input lanes). However, PLK1 expression results in a slower migrating form of AKAP2DSG2, suggesting that these additional sites in AKAP2 may be phosphorylated to promote functions independent of protein degradation. Next, we assessed the ability of PLK1 to promote the ubiquitination of AKAP2WT or AKAP2DSG2 using an in vivo ubiquitination assay following ectopic expression in HEK293T cells (Figure 5F). Cells were transfected with Myc-tagged AKAP2 (WT or DSG2) and 63HIS-FLAG-ubiquitin in combination with FLAG-PLK1. To increase total protein abundance and to prevent deubiquitination, cells were treated with the proteasome inhibitor MG132 and the pan-DUB inhibitor PR-619 for 4 h prior to harvest. Cells were then lysed under denaturing conditions and subjected to ubiquitin purification by pull-down on Ni2+-NTA resin. Expression of PLK1 increased the polyubiquitination of AKAP2WT, as indicated by the slower migrating species of AKAP2 observed by SDS-PAGE (lane 2 vs. lane 3). However, even in the presence of PLK1, AKAP2DSG2 displayed less ubiquitination than AKAP2WT alone (lane 2 vs. lane 5). This suggests that an intact DSG2 motif is important for the ubiquitination of AKAP2.

Finally, we reconstituted the ubiquitination of AKAP2 in vitro (Figure 5G). Purified components of the SCFβTrCP complex were mixed with ubiquitin, E1 and E2 enzymes, and a fluorescently labeled AKAP2 peptide containing the DSG2 motif. Notably, ubiquitination of the peptide was observed only when the serine residue within the DSG2 degron was phosphorylated. Unphosphorylated and phosphorylated β-catenin peptides, which are similarly regulated by SCFβTrCP, served as a positive control (Figure S7G). Together, these data suggest that PLK1 phosphorylates AKAP2 within its second DSG-degron motif, which allows βTrCP to bind to and ubiquitinate AKAP2.

Interactome analysis reveals a role for AKAP2 in actin cytoskeleton organization

AKAP2 is poorly studied and has no reported roles in cell-cycle regulation. We sought to understand the biological significance of AKAP2 in cell cycle and proliferation. To do so, we defined the AKAP2 interactome by performing immunoprecipitation MS (IP-MS) analysis of triplicate samples using exogenously expressed Myc-AKAP2 in HEK293T cells (Figure 6A and Table S6). We recovered the entire SCFβTrCP complex as well as both the catalytic and the regulatory subunits of PKA, which are known interactors with the AKAP proteins (Figures 6B and S8A). In addition, actin and many actin-related proteins were among the top AKAP2 interactors. GO analysis of the AKAP2 interactors showed enrichment for processes including “cell cycle,” “G2/M transition,” “intracellular signaling by second messengers,” and “cell division” (Figure S8B and Table S2). In addition, AKAP2 co-immunoprecipitated with many proteins involved in coordinating signal transduction pathways, including multiple components of the STRIPAK complex (PDCD10, STK24, and STK26) and the adaptor protein GRB2 (Figure 6C). Immunofluorescence microscopy analysis of our FLAG-AKAP2WT cells showed that AKAP2 co-localizes with F-actin, largely on the periphery of the cell surface (Figure 6D). Together, these results suggest that AKAP2 degradation may contribute to cytoskeletal organization during mitosis.

AKAP2 degradation contributes to normal mitotic spindle formation

Actin filaments and the microtubule-based mitotic spindle play key roles in mitotic progression and chromosome segregation. The localization of AKAP2 to the actin cytoskeleton and its interactions with many actin-regulatory proteins prompted us to investigate what role AKAP2 degradation may have during mitosis, which requires a drastic reorganization of the cytoskeleton. To determine whether AKAP2 expression may affect levels of actin and microtubules in mitosis, we used fluorescent phalloidin to mark the filamentous actin (F-actin) cytoskeleton and immune-labeled α-tubulin and AKAP2 in FLAG-AKAP2WT and FLAG-AKAP2DSG2 cells. Using microscopy analysis, we found that F-actin levels during metaphase were significantly lower in AKAP2DSG2 cells compared to AKAP2WT cells (Figures 7A and 7B). Quantification of α-tubulin and cell area during metaphase suggested that microtubule levels and cell area were not affected by AKAP2DSG2 expression (Figures S9A and S9B). To determine whether the abnormal levels of F-actin caused by AKAP2DSG2 expression affected the microtubule-based mitotic spindle or spindle length, we measured spindle pole-to-pole distance using the α-tubulin images. The pole-to-pole distance of the mitotic spindle was increased in FLAG-AKAP2DSG2 cells compared to FLAG-AKAP2WT-expressing cells (Figure 7C). In addition, whereas control cells normally align their mitotic spindle nearly parallel to the growth surface, the spindle pole in FLAG-AKAP2DSG2 cells was mis-oriented, with one spindle often tilted out of focus as indicated by spindle pole and astral microtubule position (Figure 7A). Indeed, quantification of spindle pole angle of the spindle poles’ xy positions and z depth relative to the substrate demonstrated an increase in spindle pole angle (Figure 7D). Taken together, these results suggest that AKAP2 degradation during mitosis regulates mitotic spindle stability and orientation in mitosis, potentially by regulating F-actin levels.

DISCUSSION

Ubiquitin-mediated proteolysis contributes to proteome remodeling during cell-cycle progression. This is most well established at the mitosis-to-G1 transition, when the APC/C ubiquitin ligase promotes the degradation of many dozens of substrates.60,61 The SCF family of E3 ligases plays similarly important and evolutionarily conserved roles in the cell-cycle-dependent protein degradation. SCF ligases regulate the destruction of many proteins, including the CDK inhibitory proteins in both yeast and humans.62–64 Despite the widespread role of ubiquitin signaling in sculpting cell-cycle proteomes, protein degradation at G2/M has remained less well characterized.

Our proteomic analysis identified more than 200 proteins that are downregulated in mitosis, including several previously established substrates of SCF ubiquitin ligases. Thus, the magnitude of protein degradation that occurs at G2/M is similar to what is seen at mitotic exit. Our approach is likely to have captured proteins degraded at different points prior to mitotic entry, and it will be interesting to assess specific degradative timing patterns for these diverse proteins.

PLK1 drives the degradation of some SCFβTrCP substrates at G2/M.22–30 Remarkably, the abundance of over 200 proteins is increased in mitosis following PLK1i. More than half of the proteins (~56%) that we found to be downregulated in mitosis were rescued by PLK1i. This suggests that PLK1 mediates a specific and widespread proteolytic program, which we predict is confined to the timing of PLK1 activation in the G2/M phase. Interestingly, while many PLK1-regulated proteins are involved in cell-cycle regulation, GO analysis revealed that many are also involved in transcription and ribosomal RNA processes. We speculate that PLK1-mediated ubiquitin signaling contributes to the transcriptional and translational repression associated with mitosis.65,66

Prior to this study, PLK1 was exclusively shown to regulate the degradation of SCFβTrCP substrates at G2/M. However, we found that the degradation of SCFCyclin F substrates during mitosis is also PLK1 dependent, suggesting that PLK1 coordinates protein degradation through at least two E3 ubiquitin ligases. To connect PLK1-dependent substrates with their respective E3 ligases, we performed a proteomics analysis of mitotic cells depleted of either βTrCP or Cyclin F. Interestingly, the proteins upregulated by knockdown of these two ligases do not account for all the proteins sensitive to PLK1i. Thus, there are likely yet-to-be-identified E3 ubiquitin ligases that cooperate with PLK1 to promote protein degradation at G2/M. There are also likely PLK1-independent protein degradation events that remain to be explored.

Many substrates of SCF ubiquitin ligases require phosphorylation within defined sequences, termed phospho-degrons, to promote binding to the ligase and subsequent degradation.67,68 We speculate that the degradation of Cyclin F substrates is independent of direct substrate phosphorylation by PLK1. Although the need for phosphorylation of some substrates has been suggested,46 Cyclin F does not directly recognize phospho-degrons. This is illustrated by the fact that Cyclin F substrates can be ubiquitinated in vitro without the need for phosphorylation.51 Although we have not elucidated the full mechanism, our data suggest that PLK1 regulates Cyclin-F-dependent degradation at the ligase level by promoting the stability of the Cyclin F protein, rather than through control of each individual substrate. In addition, there are no reported interactions between PLK1 and Cyclin F substrates that function to promote their proteolysis. This mode of regulation could allow PLK1 activity, which changes dynamically during the cell cycle and in response to DNA damage, to cooperate with other signaling inputs to control distinct sets of substrates at particular times or in response to specific stresses. Moreover, since some Cyclin F substrates are degraded earlier in the cell cycle, we predict that other factors, such as localization, could define the ability of Cyclin F to bind and ubiquitinate substrates. Interestingly, we have previously shown that Cyclin F is stabilized by AKT earlier in the cell cycle.69 There may, therefore, be cooperation between AKT and PLK1 to regulate Cyclin F stability throughout the cell cycle. Collectively, this suggests that the regulation of Cyclin F substrates depends on ligase-level control. This is in contrast to SCF ligases like βTrCP, where the destruction of substrates is dependent on substrate-level control. Altogether, this could represent a way to regulate the ordering of substrate destruction, which is likely to be important for proper cell-cycle progression.

We identified AKAP2 as a cell-cycle-regulated protein whose mitotic degradation is regulated along the PLK1/βTrCP-signaling axis. The role of AKAP family proteins is to scaffold PKA in distinct areas of the cell. This helps to create localized PKA signaling hubs and allows for specificity, acceleration, and amplification of PKA-dependent responses.70 AKAP2 has been reported to bind actin40,71; however, few other interactors of AKAP2 have been reported.

PKA plays a well-established role in cell division, although this has been most well established in meiosis.72,73 Several AKAPs are reported to contribute to processes of cell-cycle regulation, including regulation of the G1/S transition, the completion of cytokinesis, and chromatin condensation.34 However, AKAP2 has no reported role in cell-cycle regulation. To the best of our knowledge, no other AKAP has been shown to oscillate in abundance during cell-cycle progression. During interphase of the cell cycle, we also found that AKAP2 localizes to actin. Although expression of a non-degradable mutant of AKAP2 did not seem to affect overall proliferation, mitotic cells expressing non-degradable AKAP2 displayed reduced actin intensity as well as elongation/mis-orientation of the mitotic spindle. This suggests that PLK1-mediated degradation of AKAP2 helps to promote mitotic fidelity through proper positioning of the mitotic spindle. Interestingly, AKAP2 was recently reported to regulate actin dynamics through phosphorylation of the protein Cofilin.40 Cofilin is phosphorylated in mitosis,74,75 and preventing Cofilin phosphorylation causes defects in the mitotic spindle similar to those seen in our study. It will be interesting to test if AKAP2 degradation coordinates actin stability and mitotic spindle positioning through regulation of Cofilin phosphorylation or via an alternative mechanism. AKAP2 has also been shown to regulate actin dynamics through the GRB2/ERK1/WAVE2 signaling pathway.41 We identified GRB2 as an AKAP2 interactor in our IP-MS analysis; however, we did not detect any differences in ERK activity in our AKAP2WT vs. AKAP2DSG2 cells. Thus, it is likely that the mechanism by which AKAP2 regulates actin dynamics is cell-type specific.

Our data could have potential clinical implications, since PLK1 is overexpressed in various cancers76 and is the target of small-molecule inhibitors under investigation for clinical use.44,77 Sensitivity and resistance to targeted therapies can be driven by alterations in the phospho-proteome, transcriptome, or kinome. Our data suggest that remodeling of the proteome, through changes in protein degradation, could also contribute to therapeutic responses and perhaps resistance. The clinical use of PLK1 inhibitors underscores the importance of investigating this possibility. This is particularly significant since many of the proteins that we identified as being controlled by PLK1 are linked to tumorigenesis. The failure to degrade specific proteins in response to PLK1i could therefore provide unanticipated avenues by which cells adapt to therapy. Since the PLK1-regulated proteome could differ between cancer types, the response to therapy is likely to also differ. Knowledge of the PLK1-regulated proteome, and differences between cancer types, could nominate specific cancers in which PLK1 inhibitors are most beneficial or suggest co-targeting strategies that alleviate therapeutic resistance.

Limitations of the study

Our study has limitations that should be considered and may be addressed in future work. Our proteomics findings rely on small-molecule inhibition of PLK1, which carries the potential for off-target effects. While we have used orthogonal approaches to confirm the PLK1-specific effects for several selected proteins, we have not used these approaches at the proteome-wide level. However, since PLK1 inhibitors are being tested clinically, their effect on the proteome is of potential interest even if some of the effects prove to be off-target. In addition, our approach relies on synchronizing cells in mitosis using nocodazole. Nocodazole destabilizes microtubules and may cause confounding changes to protein levels that are not a direct result of cell-cycle synchronization. We acknowledge that our study was performed mostly in HCT116 cells, and thus the conclusions drawn from our PLK1i proteomics may not extend to every cell type. While many of the proteins have already been shown to be regulated by PLK1 across several cell types, it is possible that the PLK1-regulated proteome is unique across cell types. Future proteomics studies in different cell lines will be useful, especially in cancer types where PLK1i is therapeutically relevant.

STAR★METHODS

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Michael J. Emanuele (emanuele@email.unc.edu)

Materials availability

Plasmids and cell lines generated for this study are available upon request.

Data and code availability

Proteomics data, including raw files and search parameters, were uploaded to ProteomeXchange via PRIDE (Identifier PXD046039) and are available publicly.

This paper does not report original code.

Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Cell lines

Cell lines used in this study include: HCT116 (ATCC), HeLa (ATCC), RPE-1-hTERT (generously provided by Peter Jackson, Stanford University), HEK293T (ATCC), T47D (ATCC), MDA-MB-231 (ATCC), HeLa sgCntrl and HeLa sgCCNF78, and RPE-1 EGFP-PLK1 WT and RPE-1 EGFP-PLK1 AS (generously provided by Prasad Jallepalli, MSKCC)53. These cell lines were cultured in high glucose containing Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco; cat. #11995) supplemented with 10% fetal bovine serum (FBS; VWR) and 1% penicillin/streptomycin (Gibco). Additional cell lines generated and used in this study include: HCT116 pGenLenti AKAP2 WT, HCT116 pGenLenti AKAP2 DSG2, HCT116 pIND20 EV, HCT116 pIND20 AKAP2 WT, and HCT116 pIND20 AKAP2 DSG2. These cell lines were cultured in high glucose containing DMEM supplemented with 10% FBS without antibiotics. All cells were incubated at 37°C, 5.0% CO2. HCT116 cells are male. All other cell lines are female.

METHOD DETAILS

Cell culture, and drug treatments

DNA transfection experiments were performed in HEK293T or HCT116 cells. Transfections were performed using Polyjet (SignaGen; cat. #SL100688) transfection reagent according to the manufacturer’s protocol. Transfected cells were cultured for 24 hours prior to analysis. siRNA transfections were performed using RNAiMAX (Thermo Fisher Scientific; cat. #13778075) transfection reagent according to the manufacturer’s protocol. All siRNA transfections were performed at a final siRNA concentration of 20 nM. siRNA information is found in Table S7.

For the G1/S-block and release experiment performed in Figure 2, cells were synchronized using a double thymidine block and release protocol. Briefly, cells were treated with 2 mM thymidine for 16 hours. The cells were then extensively washed to remove thymidine and were cultured in thymidine-free media for 8 hours. After 8 hours, cells were treated with 2 mM thymidine for an additional 16 hours. After the 2nd thymidine block, cells were extensively washed and cultured in thymidine-free media for indicated amounts of time. The mitotic block and release experiment in Figure 2 was performed using a nocodazole block and release protocol. Briefly, cells were treated with 100 ng/mL nocodazole for 16 hours. After 16 hours, mitotic-arrested cells were isolated using mitotic “shake-off” procedure. These cells were extensively washed to remove nocodazole and cells were re-plated and cultured in nocodazole-free media for indicated amounts of time.

Information on all other drugs/compounds used in this study can be found in Table S7.

Cell lysis and immunoblotting

Cells were lysed on ice for 15 minutes in NETN lysis buffer (20 mM Tris pH 8.0, 100 mM NaCl, 0.5 mM EDTA, 0.5% NP40) supplemented with 10 μg/mL aprotinin, 10 μg/mL leupeptin, 10 μg/mL pepstatin A, 1 mM sodium orthovanadate, 1 mM sodium fluoride, and 1 mM AEBSF (4-[two aminoethyl] benzenesulfonyl fluoride). Following incubation, cell lysates were centrifuged at 20,000×g in a benchtop microcentrifuge at 4°C for 10 minutes. Protein concentration was determined by Bradford assay (Bio-Rad; cat. #5000006) and samples were normalized and prepared by boiling in Laemmli buffer (LB) at 95°C for 5 minutes on a dry water-bath. Equal amounts of protein were separated by electrophoresis on 4–15% TGX (Bio-Rad) stain-free gels at 150–230V and then transferred to nitrocellulose membranes at 0.2A for 80 minutes using the wet transfer method. After transfer, membranes were blocked in 5% non-fat dry milk (Biorad; cat. #1706404) diluted in 1x TBS-T (137 mM NaCl, 2.7 mM KCl, 25 mM Tris pH 7.6, 1% Tween-20). The majority of the primary antibody incubations were carried out overnight, while rocking, at 4°C. Primary antibody incubations for PLK1 and Cyclin B1 blots were carried out for 30 minutes, while rocking, at room temperature. All HRP-conjugated antibody incubations were carried out for 1 hr, while rocking, at room temperature. 1x TBS-T was used for all wash steps. Protein abundance was visualized by chemiluminescence using Pierce ECL (Thermo Fisher Scientific; cat. #32106). A detailed list of information for primary and secondary antibodies, including MW weights for all proteins analyzed, is provided in Table S7.

Sample preparation for PLK1i and siRNA mass spectrometry

For the PLK1 mass spectrometry screen, HCT116 cells were seeded in triplicate into 60 mm plates 24 Hr prior to cell treatments. The following day, cells were left un-treated (asynchronous), or co-treated with 100 ng/mL nocodazole plus DMSO (0.01%), BI2536 (100 nM), or BI6727 (100 nM). After 16 hours, cells were harvested using mitotic “shake-off” procedure. Isolated cells were pelleted by centrifugation at 200×g for 8 minutes at 4°C using a tabletop centrifuge. Prior to cell lysis, the cell pellets were washed 4x with 1x dPBS. Cells were lysed on ice for 20 minutes using urea lysis buffer (8M Urea, 50 mM Tris-HCl pH 8.0, 75 mM NaCl, 1 mM EDTA) supplemented with 10 μg/mL aprotinin, 10 μg/mL leupeptin, 10 μg/mL pepstatin A, 1 mM sodium orthovanadate, 1 mM sodium fluoride, and 1 mM AEBSF (4-[two aminoethyl] benzenesulfonyl fluoride). Samples were snap frozen 2x using liquid nitrogen and cell lysates were then clarified by centrifugation at maximum speed (20,0003g) for 15 minutes at 4°C using a benchtop microcentrifuge. Protein concentration was determined using Bradford Assay and lysates were analyzed by mass spectrometry, as described.

For the siRNA mass spectrometry, HCT116 cells were seeded in triplicate into 60 mm plates 24 Hr prior to cell treatments. The following day, cells were transfected with siRNAs targeting firefly luciferase (negative control), βTrCP1/2, or Cyclin F at a total concentration of 20 nM siRNA. Cells were cultured with siRNA for a total of 48 hours and were treated with 100 ng/mL nocodazole for the final 16 hours to arrest cells in mitosis. Cells were harvested using mitotic “shake-off” and lysed as described above for the PLK1i mass-spectrometry screen. Protein concentration was determined using BCA Assay (ThermoFisher; cat. PI-23227) and lysates were analyzed by mass spectrometry, as described below.

Mass spectrometry

MS sample preparation for global, quantitative proteomics

For each sample, 25ug of protein lysate was reduced with 5mM dithithreitol (DTT; Pierce) at 37°C for 45 min and alkylated with 15mM iodoacetamide (IAA; Pierce) for 45 min at room temperature. Samples were then precipitated by adding six volumes of ice-cold acetone and incubating at −20°C overnight. The following day, samples were centrifuged at 15000×g for 15 min at 4°C, supernatant was removed, and the pellet was washed with 100ul cold acetone. Pellets were air dried at room temperature for 10 min before being resuspended in 100ul 50mM ammonium bicarbonate, pH 8. Samples were then subjected to digestion with LysC (Wako) at 37°C for 2h and trypsin (Promega) overnight at 37°C at a 1:50 enzyme:protein ratio. The resulting peptides were acidified to 0.5% trifluoroacetic acid (TFA; Pierce) and desalted using Thermo desalting spin columns. Eluates were dried via vacuum centrifugation and peptide concentration was determined via Pierce Quantitative Fluorometric Assay and all samples were normalized to 0.25 ug/ul and subjected to LC-MS/MS analysis.

LC-MS/MS for global, quantitative proteomics

Samples were analyzed in a randomized order by LC-MS/MS using an Ultimate 3000 coupled to an Exploris 480 mass spectrometer (Thermo Scientific). The pooled sample was analyzed before and after the sample set. Samples were injected onto an IonOpticks Aurora series 2 C18 column (75 μm id × 15 cm, 1.6 μm particle size; IonOpticks) and separated over a 200 min method. The gradient for separation consisted of 3–41% mobile phase B at a 250 nl/min flow rate, where mobile phase A was 0.1% formic acid (Pierce) in LC-MS grade water (Fisher) and mobile phase B consisted of 0.1% formic acid in 80% acetonitrile (ACN). Exploris 480 was operated in product ion scan mode for Data Independent Acquisition (DIA).

A full MS scan (m/z 350–1650) was collected; resolution was set to 120,000 with a maximum injection time of 20 ms and automatic gain control (AGC) target of 300%. Following the full MS scan, a product ion scan was collected (30,000 resolution) and consisted of stepped higher collision dissociation (HCD) set to 25.5, 27, 30; AGC target set to 3000%; maximum injection time set to 55 ms; variable precursor isolation windows from 350–1650 m/z.

Data analysis for global quantitative proteomics

Raw data files were processed using Spectronaut (v15.7.220308.50606; Biognosys) and searched against the Uniprot reviewed human database (UP000005640, containing 20,396 entries, downloaded March 2021) and the MaxQuant common contaminants database (246 entries). The following settings were used: enzyme specificity set to trypsin, up to two missed cleavages allowed, cysteine carbamidomethylation set as a fixed modification, methionine oxidation and N-terminal acetylation set as variable modifications. Precision iRT calibration was enabled. A false discovery rate (FDR) of 1% was used to filter all data. For the Plk1 inhibitor/synchronized dataset, normalization was disabled. For the siRNA dataset, normalization was enabled. For both datasets imputation was disabled and single hit proteins were excluded. Un-paired student’s t-tests were conducted and corrected p-values (q-values) were calculated in Spectronaut.

AKAP2 in vitro kinase assay + MS analysis

Kinase assay:

FLAG-AKAP2 was transfected into 293T cells and immunoprecipitated using anti-FLAG affinity resin. Immunoprecipitated FLAG-AKAP2 was subjected to an in vitro kinase assay. Briefly, AKAP2 coupled to anti-FLAG resin was split into four reactions. One reaction was kept as a control. To the other three separate reactions, 1μg PLK1 was added from available sources (Promega, R&D Systems, or graciously provided from Dr. Arminja Kettenbach) before starting the reactions with 200μM Mg2+-ATP. After one hour with continuous rocking at 37C, reactions were quenched with 2x SDS-B.

Sample preparation for MS:

Protein samples (AKAP2 kinase reactions incubated with or without PLK1) were subjected to SDS-PAGE and stained with coomassie. The bands corresponding to AKAP2 were excised and the proteins were reduced, alkylated, and in-gel digested with trypsin overnight at 37°C. Peptides were extracted, desalted with C18 spin columns (Pierce) and dried via vacuum centrifugation. Peptide samples were stored at −80°C until further analysis.

LC-MS/MS analysis:

The peptide samples were analyzed in duplicate by LC/MS/MS using an Easy nLC 1200 coupled to a QEx-active HF mass spectrometer (Thermo Scientific). Samples were injected onto an IonOpticks Aurora Ultimate TS C18 column (75 μm id × 25 cm, 1.7 μm particle size) and separated over a 90 min method. The gradient for separation consisted of 5–45% mobile phase B at a 250 nl/min flow rate, where mobile phase A was 0.1% formic acid in water and mobile phase B consisted of 0.1% formic acid in 80% ACN. The QExactive HF was operated in data-dependent mode where the 15 most intense precursors were selected for subsequent fragmentation. Resolution for the precursor scan (m/z 350–1700) was set to 120,000 with a target value of 3 × 106 ions. MS/MS scans resolution was set to 15,000 with a target value of 1 × 105 ions. The normalized collision energy was set to 27% for HCD. Dynamic exclusion was set to 30 s, peptide match was set to preferred, and precursors with unknown charge or a charge state of 1 and ≥ 6 were excluded.

Data analysis:

Raw data files were processed using Proteome Discoverer version 3.1 (Thermo Scientific). Using Sequest, peak lists were searched against a reviewed Uniprot human database (downloaded in January 2024), appended with a custom FLAG-AKAP2 protein sequence and a common contaminants database. The following parameters were used to identify tryptic peptides for protein identification: 10 ppm precursor ion mass tolerance; 0.02 Da product ion mass tolerance; up to two missed trypsin cleavage sites; (C) carbamidomethylation was set as a fixed modification; (M) oxidation and (S/T/Y) phosphorylation were set as variable modifications. The ptmRS node was used to localize the phosphorylation sites. Peptide false discovery rates (FDR) were calculated by the Percolator node using a decoy database search and data were filtered using a 1% FDR cutoff. MS/MS spectrum was annotated using IPSA79. Peptide data used in the AKAP2 phosphorylation lollipop plot was first filtered to remove peptides with only a single PSM, and those that had less than a 2-fold change average abundance across all samples, compared to the controls.

Molecular biology

pDEST-Myc5-Cyclin F78, pDEST-FLAG-βTrCP151, and pDEST-FLAG-βTrCP251 were generated previously. WT PLK1, was obtained from the human ORFeome v5.1 and cloned into the indicated pDEST vectors using gateway recombination. AKAP2 vectors including N-Myc-AKAP2 WT (pcDNA 3.1+), N-Myc-AKAP2 DSG1 (pcDNA 3.1+), N-Myc-AKAP2 DSG2 (pcDNA 3.1+), N-Myc-AKAP2 DSG3 (pcDNA 3.1+), N-FLAG-AKAP2 WT (pGenLenti), N-FLAG-AKAP2 DSG2 (pGenLenti), AKAP2 WT (pGenDONR), and AKAP2 DSG2 (pGenDONR) were purchased from GenScript. An empty donor vector (attL1+2_pGenDONR) was also purchased from GenScript. AKAP2 WT and DSG2 pGenDONR plasmids were subcloned into pInducer20 (generously provided by Stephen Elledge; Addgene plasmid # 44012 ; http://n2t.net/addgene:44012 ; RRID:Addgene_44012)80 using gateway recombination. An empty pInducer20 vector (EV) suitable for lentivirus production + transduction was generated using gateway recombination with the empty attL1+2_pGen-DONR vector. AKAP2 WT pGenDONR plasmid was also cloned into the indicated pDEST vectors using gateway recombination. Site mutants including FLAG-PLK1 (T210A), FLAG-PLK1 (Pincer), FLAG-βTrCP1 (WD40Mut), FLAG-βTrCP2 (WD40Mut), Myc-AKAP2E477A, and Myc-AKAP2S479A were generated using the Q5 site-directed mutagenesis kit (NEB; Cat. #E0552S). The βTrCP1 WD40Mut changes amino acid 510 from R>A based on isoform 1 in uniprot (R474A when referring to isoform 2 in uniprot). Likewise, the βTrCP2 WD40Mut changes amino acid 413 from R>A based on isoform 2 in uniprot (R447A when referring to isoform 1 in uniprot). Primers used for mutagenesis are described in Table S7. Cyclin F truncation mutants (pcDNA 3.1+) used in Figure S4A46 were generously provided by Michele Pagano (NYU). 6HIS-FLAG-Ubiquitin81 has been described previously and was a generous gift from Philippe Soubeyran (Aix-Marseille Université).

Lentiviral particle production in 293T cells

To produce lentiviral particles for infection, HEK293T cells were co-transfected with a lentiviral plasmid (pGenLenti AKAP2 WT, pGenLenti AKAP2 DSG2, pInducer20 EV, pInducer20 AKAP2 WT, or pInducer20 AKAP2 DSG2) along with the lentiviral packaging plasmids VSV-G, Gag-pol, TAT, and Rev (packaging plasmids transfected at a 1:1:1:1 ratio). After 24 hours, cells were washed 1x with complete media and replaced with 10 mL fresh, complete media. After an additional 24 hours, the media was collected and centrifuged at 200×g for 3 minutes. Media was aliquoted and frozen at −80°C for at least 24 hours prior to transducing cells.

Cell line generation

HCT116 sgCCNF1 and HCT116 sgCCNF2 cell lines were generated by transducing parental HCT116 cells (ATCC) with previously described CCNF lentiCRISPRv.2 constructs78 and single cell populations, generated by serial dilution, were screen by immunoblot to confirm loss of cyclin F expression.

To produce HCT116 cells stably expressing FLAG-AKAP2 WT or FLAG-AKAP2 DSG2, cells were transduced with a 1:1 ratio of fresh complete media plus lentivirus-containing media with 8 μg/mL polybrene. 48 hours after transduction, cells were selected using 1 μg/mL puromycin for ~7 days. Cell lines transduced with pInducer20 constructs were generated in the same manner as above, except selected for using 600 μg/mL G418 Sulfate for ~7–10 days.

Immunoprecipitation

Exogenous IPs

For immunoprecipitation experiments, tagged protein constructs were expressed in HEK293T cells for 24 hours using transient transfection. After 24 hours, cells were washed once in 1x dPBS and harvested in PBS using a sterile cell lifter. Cells were then pelleted by centrifugation at 3,000×g for 3 minutes at 4C. Cell pellets were washed with 1x dPBS, lysed on ice for 15 minutes using NETN lysis buffer, and lysates were clarified by centrifugation at maximum speed (20,000×g) for 10 minutes at 4°C using a benchtop microcentrifuge. Protein concentration of samples was determined and normalized using Bradford Assay. Prior to IP, 10% of the total protein was removed as the input. The remaining lysate was then added to 30–50 μL of Anti-FLAG M2 (Sigma; cat. #F2426) affinity gel to isolate FLAG-tagged proteins (affinity gel was washed 3x using NETN lysis buffer prior to addition of cell lysate). Samples were immunoprecipitated for 2–4 Hrs at 4°C while rotating. After 2–4 Hrs, affinity gel was washed 3x at 4°C while rotating for 5 minutes each using NETN lysis buffer. After the final wash, affinity gel was suspended in 2x Laemmli sample buffer and boiled at 95°C for 10 minutes using a dry water-bath to elute proteins. Co-IP was assessed by immunoblotting, as described.

Endogenous IPs

For endogenous IP experiments, HCT116 cells were synchronized in mitosis for 16 hours with 100 ng/mL nocodazole. After 16 hours, cells were treated with 10 μM MLN4924 for 4 hours prior to harvesting to rescue AKAP2 protein expression. Mitotic cells were collected using “shake off” procedure as described above. Cells were washed, lysed, and protein was quantified as described above for exogenous IPs. A fraction of the whole cell extract was removed prior to IP. 2 mg lysate was added to normal rabbit IgG or AKAP2 antibody at a concentration of 6 mg antibody/mg lysate. Antibody: lysate mixture was incubated for 4.5 hours at 4C, while shaking. After 4.5 hours, ~30 μL (packed beads) of Protein A Agarose (Millipore Sigma; Cat. #16–125) was added to each IP. Samples were incubated for an additional 1 Hr at 4C, while shaking. Beads were washed multiple times in ice-cold NETN lysis buffer and centrifuged at 1,000 rpm for 1 min in between each wash. After the final wash, beads were suspended in 2x Laemmli sample buffer and boiled at 95°C for 10 minutes using a dry water-bath to elute proteins. Co-IP was assessed by immunoblotting, as described.

AKAP2 IP-MS

For interactome analysis of AKAP2, Myc-EV or Myc-AKAP2 was transfected into HEK293T cells, in triplicate. Cells were collected and lysed in NETN lysis buffer, as described above. Lysates were snap frozen 2x using liquid nitrogen and then lysates were clarified by centrifugation at maximum speed (20,000×g) for 10 minutes at 4°C using a benchtop microcentrifuge. Protein concentration was determined and normalized using Bradford assay. Samples were immunoprecipitated using EZview c-Myc affinity gel (Sigma; cat. E6654). After IP, samples were washed 3x using NETN lysis buffer followed by 3 washes using 1x dPBS. Beads were covered in 1x dPBS and frozen at −80C until further analysis.

Immunoprecipitated protein samples were subjected to on-bead trypsin digestion as previously described82. Briefly, after the last wash step of the immunoprecipitation, beads were resuspended in 50μl of 50mM ammonium bicarbonate, pH 8. On-bead digestion was performed by adding 1μg trypsin and incubated with shaking, overnight at 37°C. The following day, 1ug trypsin was added to each sample and incubated shaking, at 37°C for 3 hours. Beads were pelleted and supernatants were transferred to fresh tubes. The beads were washed twice with 100μl LC-MS grade water, and washes were added to the original supernatants. Samples were acidified by adding TFA to final concentration of 2%, to pH ~2. Peptides were desalted using peptide desalting spin columns (Thermo), lyophilized, and stored at −80°C until further analysis.

Samples were analyzed by LC-MS/MS using an Easy nLC 1200 coupled to a QExactive HF mass spectrometer (Thermo). Samples were injected onto an Easy Spray PepMap C18 column (75 μm id × 25 cm, 2 μm particle size; Thermo) and separated over a 2 hour method. The gradient for separation consisted of 5–42% mobile phase B at a 250 nl/min flow rate, where mobile phase A was 0.1% formic acid in water and mobile phase B consisted of 0.1% formic acid in 80% ACN. The QExactive HF was operated in data-dependent mode where the 15 most intense precursors were selected for subsequent fragmentation. Resolution for the precursor scan (m/z 375–1700) was set to 60,000, while MS/MS scans resolution was set to 15,000. The normalized collision energy was set to 27% for HCD. Peptide match was set to preferred, and precursors with unknown charge or a charge state of 1 and ≥ 7 were excluded.

Data analysis for AKAP2 IP-MS

Raw data files were searched against the reviewed human database (containing 20,396 entries), appended with a contaminants database, using Andromeda within MaxQuant. Enzyme specificity was set to trypsin, up to two missed cleavage sites were allowed, and methionine oxidation and N-terminus acetylation were set as variable modifications. A 1% FDR was used to filter all data. Match between runs was enabled (5 min match time window, 20 min alignment window), and a minimum of two unique peptides was required for label-free quantitation using the LFQ intensities.

Perseus was used for further processing83. Only proteins with >1 unique+razor peptide were used for LFQ analysis. Proteins with 50% missing values were removed and missing values were imputed from normal distribution within Perseus. Log2 fold change (FC) ratios were calculated using the averaged Log2 LFQ intensities of sample compared to control, and students t-test performed for each pairwise comparison, with p-values calculated. Proteins with significant p-values (<0.05) and Log2 FC >1 were considered biological interactors.

In vivo ubiquitination assay

The in vivo ubiquitination assay was performed as described previously81. Briefly, HEK293T cells were transfected with the indicated plasmids and harvested in PBS 48 hours post-transfection using a sterile cell lifter. Cells were treated with 20 μM MG132 and 20 μM PR-619 for the final 4 hours prior to harvesting. 20% of the cell suspension was removed to prepare inputs using the cell lysis procedure as described above. The remaining 80% of the cell suspension was lysed in 6M guanidine-HCl buffer and His6-tagged proteins were captured on Ni2+-NTA resin (Qiagen; cat. #30210). Pull-down eluates and inputs were separated on SDS-PAGE gels and analyzed by immunoblot, as described above.

In vitro ubiquitination assay

Recombinant UBA1, Ub, UBE2R2, UBE2L3, ARIH1, and CUL1/RBX1 were expressed and purified as previously described84,85. Neddylation of CUL1/RBX1 (N8-CUL1/RBX1) was performed similar to86. In short, all proteins were transformed into BL21-Codon Plus (DE3)-RIL E. coli, grown at 37°C, and expressed overnight after the addition of 0.6mM IPTG. Proteins were purified at 4°C via affinity chromatography, tags were removed via treatment with protease where applicable, and proteins were further purified by size-exclusion chromatography into assay buffer (20mM Hepes pH 8.0, 200mM NaCl, 1mM DTT). Proteins were flash-frozen in small aliquots using liquid nitrogen and stored at −80°C.

p4489 Flag-βTrCP was a gift from Peter Howley (Addgene plasmid # 10865)87.A βTrCP truncation (amino acids 175-C, hereafter referred to as βTrCP) was cloned into a modified pRSF vector that contains an N-terminal his-MBP tag. Untagged SKP1 was likewise cloned into pET3a using Gibson Assembly. BL21-Codon Plus (DE3)-RIL E. coli were co-transformed with both plasmids and grown in LB containing 150μg/ml ampicillin, 50μg/ml kanamycin, and 30μg/ml chloramphenicol. Protein expression was induced with 0.6mM IPTG at 18°C overnight. Cells were isolated by centrifugation, resuspended in 50mM HEPES pH 7.5, 200mM NaCl, 5mM β-ME, and 10mM imidazole, lysed by sonication, and clarified by centrifugation. Lysate was passed over Ni-NTA resin and the complex was eluted with lysis buffer supplemented with 250mM imidazole. βTrCP/SKP1 was dialyzed overnight, concentrated, and subjected to size-exclusion chromatography over an SD200 into assay buffer.

Fluorescent substrate peptides were synthesized by Biomatik based on previous studies to 95% purity85. Peptides were dissolved to 1mM in 50mM HEPESpH 8.0, 50mM NaCl. Peptide sequences are as follows:

β -Catenin WT: Ac-KAAVSHWQQQSYLDSGIHSGATTAPRRASY-(PEG)2-KTAMRA

β -Catenin pSpS: Ac-KAAVSHWQQQSYLD(pS)GIH(pS)GATTAPRRASY-(PEG)2-KTAMRA

AKAP2 WT: Ac-KDDDHGILDQFSRSVNVSLTQEELDSGLDELSVRS-(PEG)2-KTAMRA

AKAP2 pS: Ac-KDDDHGILDQFSRSVNVSLTQEELD(pS)GLDELSVRS-(PEG)2-KTAMRA

For in vitro ubiquitination assays, proteins and peptides were diluted to 10x final concentration in assay buffer. Final reaction conditions are as follows: 0.1μM UBA1, 1μM UBE2R2, 0.75μM UBE2L3, 0.4μM MBP-βTrCP/SKP1, 0.5μM ARIH1, 0.5mM N8-CUL1/RBX1, 100μM Ub, and 0.25μM TAMRA-peptides. Reaction mixtures were moved to room temperature for 5 minutes before 5mM MgCl2 and 5mM ATP was added to start the reaction. Time points were quenched in 4x SDS-buffer, loaded onto 4–12% Bis-Tris SDS-PAGE gels, and scanned at the Cy3 channel on an Amersham Typhoon. Gel image is representative of 4 independent experiments.

Image acquisition

Imaging was performed using an inverted microscope (IX83-ZDC2; Evident/Olympus) with Cellsens software (Evident/Olympus), a cMOS camera (Orca-Fusion, Hamamatsu) with a 100× 1.50 NA TIRF objective. Images were acquired from the bottom of cell to top of cell using 0.21uM Z-step over 100uM with Z acquired before channel.

Immunostaining

Asynchronous HCT116 FLAG-AKAP2WT and FLAG-AKAP2DSG2 cells were plated on #1.5 German glass coverslips (25 mm, Electron Microscopy Services #72290–12) which were cleaned with a Harrick Plasma Cleaner (PDC-32G) and coated at 37C for one hour with 1 mg/mL PDL. Cells were fixed using 1x PHEM fix (20 mM PIPES, 50 mM HEPES, 20 mM EGTA, 4 mM MgSO4, and 0.24 M sucrose) at 37C for 10min. Coverslips were washed 3x with PBS. After fixation and washes, cells were permeabilized with 0.2% TritonX-100 for 10 minutes and blocked with 10% donkey serum (SouthernBiotech OB003001) for 30 min. Cells were incubated with 1:500 anti-tubulin (Santa Cruz 32293) and 1:250 anti-AKAP2 (Bethyl; Cat. #A301–363A) for 1 hour at 37C (in 1% donkey serum in PBS), washed 3 times for 5 minutes each with PBS, incubated with secondary antibodies AT 1:400 of Alexa Fluor anti-mouse 568 (Invitrogen; Cat. #A10037), Alexa Fluor anti-rabbit 647 (Invitrogen; Cat. #A32795), AlexaFluor 488 phalloidin (Invitrogen; Cat. #A12379) at 37C, and washed 3 times again 5 minutes each. Coverslips were incubated with DAPI (1:1000) for 1 minute then washed with 1x PBS. Coverslips were mounted in TRIS/glycerol/n-propyl-gallate-based mounting media and sealed with nail polish.

Image analysis

Mitotic phases were identified by DNA condensation via DAPI. Spindle pole distance was analyzed by acquiring spindle pole position (x,y,z) and calculated in Excel using 3D Pythagorean theorem. Spindle pole angles were determined by quantifying the angle between the spindle axis and basal surface (z). For quantifications of F-actin (by phalloidin intensity) and microtubules (by alpha-tubulin) intensity sum projections were created from Z-stacks in ImageJ and manually measured after background subtraction. Cell area was measured manually.

GO analysis

All GO analysis was performed using Metascape88.

Data processing

40% contrast was added to all immunoblot images. Contrast was applied uniformly to all images and does not alter the interpretation of the data.

BioRender images

Illustrations in Figure 1A and S6B were created using BioRender.com.

QUANTIFICATION AND STATISTICAL ANALYSIS

Quantification of western blots (when applicable) was performed in FIJI and data shown are mean +/− SEM for n = 3 experiments.

Supplementary Material

1

2

3

4

5

6

7

8

ACKNOWLEDGMENTS

We thank lab members and colleagues at UNC for helpful discussions throughout this project. We thank Prasad Jallepalli (Memorial Sloan Kettering) for generously providing the RPE1-PLK1WT and RPE1-PLK1AS cell lines, Arminja Kettenbach and Scott Gerber (Dartmouth) for providing purified PLK1, Michele Pagano (NYU) for Cyclin F expression plasmids, and Philippe Soubeyran (Aix-Marseille Université) for ubiquitin expression plasmids. The Emanuele lab is supported by the UNC University Cancer Research Fund (UCRF), the National Institutes of Health (R01GM120309, R01GM134231, and R35GM153250), and the American Cancer Society (Research Scholar grant RSG-18-220-01-TBG). R.D.M. was also supported by NCI T32 CA071341. D.L.B. was supported by NIH T32GM008570. The Brown lab is supported by NIH R35GM128855 and UCRF. The Gupton lab is supported by the National Institutes of Health (R35GM135160). K.L. was supported by an HHMI Gilliam Fellowship for Advanced Study (GT10886). This research is based in part upon work conducted using the UNC Proteomics Core Facility, which is supported in part by an NCI Center Core Support Grant (2P30CA016086-45) to the UNC Lineberger Comprehensive Cancer Center. We thank Thomas Webb, Scott Lyons, and Natalie Barker for their contributions to the proteomics work performed in this article.

Figure 1. PLK1 regulates a G2/M degradation program

(A) Schematic describing the workflow for the PLK1i proteomics experiment. HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM BI2536, or 100 nM BI6727 for 16 h. After 16 h, mitotic arrested cells were collected using the mitotic shake-off procedure. All samples were then prepared for label-free, quantitative liquid chromatography-tandem MS (LC-MS/MS) analysis using data-independent acquisition (DIA). Experiment was performed with three technical replicates per sample.

(B) Plot showing the log2 ratio of all proteins identified by MS when comparing samples from DMSO-treated mitotic cells to samples from asynchronously growing cells. Each dot along the x axis represents an individual protein. Proteins known to be upregulated or downregulated in mitosis are indicated.

(C) Plot showing the log2 ratio of all proteins identified by MS when comparing samples from BI2536-treated mitotic cells to samples from DMSO-treated mitotic cells (x axis) vs. the log2 ratio of all proteins identified by MS when comparing samples from BI6727-treated mitotic cells to samples from DMSO-treated mitotic cells (y axis).

(D) Volcano plot showing the log2 ratio (x axis) and −log10 (p value) (y axis) of all proteins identified by MS when comparing samples from BI2536-treated mitotic cells to samples from DMSO-treated mitotic cells. Significant fold-change cutoffs were set at log2 = −0.6 or log2 = 0.6, and statistical significance was set at −log10 (p value) = 2 (p = 0.01), which are denoted by the dashed lines. Positive controls are labeled and indicated as triangles.

(E) GO analysis highlighting top biological processes enriched among proteins upregulated in mitosis following PLK1i.

(F) Heatmap showing the log2 ratio of indicated proteins (left) identified by MS when comparing samples from DMSO-treated mitotic cells to samples from asynchronously growing cells (column 1), when comparing samples from BI2536-treated mitotic cells to samples from DMSO-treated mitotic cells (column 2), or when comparing samples from BI6727-treated mitotic cells to samples from DMSO-treated mitotic cells (column 3). Known substrates of βTrCP or Cyclin F are clustered together. The E3 ubiquitin ligases for DDX24, WWTR1 (TAZ), and YAP1 during mitosis are unknown and are also clustered together. TFAP4 is a known βTrCP substrate that is not dependent on PLK1 for degradation. CCNE2 and AURKA are cell-cycle-regulated proteins whose expression is not affected by PLK1i.

(G) Validation of MS data. HCT116 cells were treated and collected as in (A) and samples were prepared for and analyzed by immunoblot for the indicated proteins. n = 3.

Figure 2. AKAP2 is a cell-cycle-regulated protein

(A) Volcano plot showing the log2 ratio (x axis) and −log10 (p value) (y axis) of all proteins identified by MS when comparing samples from DMSO-treated mitotic cells to samples from asynchronously growing cells. Significant fold-change cutoffs were set at log2 = −0.6 or log2 = 0.6 and statistical significance was set at −log10 (p value) = 2 (p = 0.01), which are denoted by dashed lines. Claspin is identified as a positive control.

(B) Plot showing the log2 ratio of all proteins identified by MS when comparing samples from DMSO-treated mitotic cells to samples from asynchronously growing cells (x axis) and the log2 ratio of all proteins identified by MS when comparing samples from BI2536-treated mitotic cells to samples from DMSO-treated mitotic cells (y axis). Claspin is identified as a positive control.

(C) HCT116 cells were grown asynchronously or synchronized in mitosis by treatment with 100 ng/mL nocodazole for 16 h. Mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3.

(D) HCT116 cells were grown asynchronously, synchronized in S phase (2 mM thymidine), or synchronized in mitosis (100 ng/mL nocodazole) for 16 h. Mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3.

(E) RPE-1 cells were grown asynchronously or synchronized in G1 (1 mM palbociclib), S (2 mM thymidine), G2 (10 mM RO-3306), or mitosis (100 ng/mL nocodazole) for 20 h. Mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3.

(F) HeLa cells were grown asynchronously or synchronized at G1/S phase by performing a double thymidine block. Cells were then released synchronously back into the cell cycle upon addition of thymidine-free medium, and cells were collected at various time points following release. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2.

(G) HeLa cells were grown asynchronously or synchronized in mitosis by treatment with 100 ng/mL nocodazole for 16 h. Mitotic-arrested cells were collected using the mitotic shake-off procedure, washed stringently to removed nocodazole, and released synchronously back into the cell cycle upon addition of nocodazole-free medium. Cells were collected at various time points following release. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2.

Figure 3. PLK1 regulates AKAP2 abundance in mitosis

(A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM BI6727, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3.

(B) HCT116 cells were transfected with siRNA targeting PLK1 or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2.

(C) Wild-type or PLK1 analog-sensitive (AS) RPE-1 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 10 μM 3MB-PP1, or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3.

(D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a catalytically inactive version of FLAG-PLK1 (T210A; lane 3). Twenty-four hours post-transfection, the cells were collected, and all cell lysates were analyzed by immunoblot for the indicated proteins. n = 3.

(E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-PLK1 (lane 2), or a version of FLAG-PLK1 containing a mutation within the Polo-box domain (Pincer; lane 3). Twenty-four hours post-transfection, the cells were collected, and PLK1 was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2.

(F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. n = 2.

(G) Plot showing residues identified by MS on AKAP2 that were phosphorylated by PLK1 in an in vitro kinase assay. The x axis corresponds to amino acid residue numbers of AKAP2. PSM, peptide-spectrum match. Immunoprecipitated AKAP2 was incubated with three independent sources of recombinant PLK1. Each reaction was analyzed by MS with technical duplicates.

Figure 4. SCFβTrCP mediates the proteasomal degradation of AKAP2 during mitosis

(A) HCT116 cells were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO, 100 nM MLN4924, or 100 nM bortezomib for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 2.

(B) Plot showing the log2 ratio of all proteins identified by MS when comparing samples from BI2536-treated mitotic cells to samples from DMSO-treated mitotic cells (x axis) and the log2 ratio of all proteins identified by MS when comparing samples from siβTrCP-treated mitotic cells to samples from siFF-treated mitotic cells (y axis). Claspin and WEE1 are identified as a positive controls. Proteins indicated in red were increased by PLK1i and siβTrCP.

(C) HCT116 cells were transfected with siRNA targeting Cullin 1, βTrCP1/2, CCNF, or firefly luciferase (siFF) as a non-targeting control for 48 h. During the final 16 h, the cells were treated with 100 ng/mL nocodazole. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3.

(D) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP1 (lane 2), or wild-type FLAG-βTrCP2 (lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3.

(E) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 together with an empty vector control (lane 1), wild-type FLAG-βTrCP2 (lane 2), or a version of FLAG-βTrCP2 with a mutation in the substrate binding domain (WD40Mut; lane 3). Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 2.

(F) HCT116 cells were synchronized in mitosis using 100 ng/mL nocodazole for 16 h. Following synchronization, the cells were treated with 10 mM MLN4924 for 4 h prior to harvesting. Cells were then were collected using the mitotic shake-off procedure. Endogenous AKAP2 was immunoprecipitated and eluates were analyzed by immunoblot for the indicated proteins. WCE, whole-cell extract. Asterisk denotes the heavy chain. n = 2.

Figure 5. βTrCP utilizes a non-canonical degron to degrade AKAP2 during mitosis

(A) Schematic depicting AKAP2 showing the PKA binding domain and relative positions of the three putative βTrCP binding sites in AKAP2. The corresponding amino acids for each motif are 382–384 (DSG1), 472–474 (DSG2), and 502–504 (DSG3).

(B) Sequence alignment of the DSG2 motif in Homo sapiens, Mus musculus, and Xenopus laevis. The CDC25B degron sequence for βTrCP is also shown, demonstrating a known example that is divergent from the canonical DSGxxS sequence. The sequence of the AKAP2 DSG2-motif mutant used in future experiments is shown below.

(C) HEK293T cells were co-transfected with plasmids expressing Myc-AKAP2 (WT or DSG degron mutants) together with an empty vector control or FLAG-βTrCP2. Twenty-four hours post-transfection, the cells were collected, and βTrCP was immunoprecipitated using anti-FLAG affinity gel. Eluates were analyzed by immunoblot for the indicated proteins. n = 3.

(D) HCT116 cells stably expressing FLAG-AKAP2WT or FLAG-AKAP2DSG2 were grown asynchronously or were treated with 100 ng/mL nocodazole for 16 h to synchronize cells in mitosis. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3.

(E) HCT116 cells stably expressing FLAG-AKAP2WT or FLAG-AKAP2DSG2 were grown asynchronously or were co-treated with 100 ng/mL nocodazole plus DMSO or 100 nM BI2536 for 16 h. After 16 h, mitotic-arrested cells were collected using the mitotic shake-off procedure. All cell lysates were analyzed by immunoblot for the indicated proteins. n = 3.

(F) HEK293T cells were co-transfected with the indicated plasmids for 48 h. After 48 h, the cells were collected and lysed under denaturing conditions. Ubiquitinated proteins were captured using Ni-NTA pull-down. The ubiquitination status of AKAP2 was analyzed by immunoblot. Cells were treated with 20 μM MG132 and 20 μM PR619 for 4 h prior to collection. n = 2.

(G) In vitro ubiquitination reactions using TAMRA-labeled AKAP2 WT peptide or AKAP2 phospho-peptide (p-S473) as a substrate, monitored by fluorescence scanning of an SDS-PAGE gel. Representative of n = 4 independent experiments.

Figure 6. Interactome analysis reveals a role for AKAP2 in actin cytoskeleton dynamics

(A) AKAP2 IP-MS schematic. Myc-AKAP2 was transfected into HEK293T cells in triplicate. AKAP2 was immunoprecipitated using anti-Myc affinity gel and samples were analyzed by LC-MS/MS.

(B) AKAP2 interactome showing selected interactors and the biological processes they function in as identified by IP-MS.

(C) HEK293T cells were transfected with Myc-AKAP2 or an empty pInducer20 vector (EV) control for 24 h. After 24 h, AKAP2 was immunoprecipitated using anti-Myc affinity gel, and the eluates were analyzed by immunoblot for the indicated proteins. n = 2.

(D) Representative max projections of HCT116 FLAG-AKAP2WT cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2. White arrows indicate areas of co-localization.

Figure 7. AKAP2 degradation contributes to normal mitotic spindle formation

(A) Representative images of a single z plane of HCT116 FLAG-AKAP2WT and FLAG-AKAP2DSG2 cells that were immunolabeled for DAPI, F-actin (phalloidin), microtubules (α-tubulin), and AKAP2, which are quantified in (B)–(D).

(B) Quantification of F-actin via phalloidin immunostaining during metaphase. Phalloidin intensity was normalized to cell area. Statistical analysis was performed by two-tailed t test: *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2WT, 43; AKAP2DSG2, 33.

(C) Quantification of mitotic spindle length during metaphase. Statistical analysis was performed by two-tailed t test: *p % 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2WT, 37; AKAP2DSG2, 34.

(D) Quantification of mitotic spindle orientation during metaphase. Statistical analysis was performed by two-tailed t test: *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001, ****p ≤ 0.0001; n = 3. Number of cells quantified: AKAP2WT, 37; AKAP2DSG2, 34.

KEY RESOURCES TABLE REAGENT or RESOURCE	SOURCE	IDENTIFIER	
	
Antibodies			
	
Cyclin F (C-20)	Santa Cruz Biotechnology	Cat# sc-952; RRID:AB_2071212	
AKAP2	Fortis Life Sciences	Cat# A301-363A; RRID:AB_937707	
AKAP2	Fortis Life Sciences	Cat# A301-364A; RRID:AB_937703	
PLK1, clone 35-206	Millipore	Cat# 05-844; RRID:AB_310836	
Cyclin E1	CST	Cat# 4129; RRID:AB_2071200	
RRM2	Abcam	Cat# ab172476; RRID: N/A	
Phospho-Histone H3 (Ser10)	CST	Cat# 3377; RRID:AB_1549592	
Phospho-Rb (Ser807/811)	CST	Cat# 9308; RRID:AB_331472	
Cul1	Fortis Life Sciences	Cat# A303-372A; RRID:AB_10951941	
HA-HRP	Abcam	Cat# ab1190; RRID:AB_298683	
FLAG-HRP	Sigma-Aldrich	Cat# A8592; RRID:AB_439702	
Myc-HRP	Abcam	Cat# ab62928; RRID:AB_955371	
GAPDH	Santa Cruz Biotechnology	Cat# sc-47724; RRID:AB_627678	
Claspin	Santa Cruz Biotechnology	Cat# sc-376773; RRID: N/A	
Anti-HA.11 Epitope Tag	BioLegend	Cat# 901502; RRID:AB_2565007	
Cyclin A	Santa Cruz Biotechnology	Cat# sc-271682; RRID:AB_10709300	
Phospho-PLK1 (Thr210)	CST	Cat# 5472; RRID:AB_10698594	
Phospho-TCTP (Ser46)	CST	Cat# 5251; RRID:AB_10547143	
Cyclin B1	Abcam	Cat# ab32053; RRID:AB_731779	
SLBP	Abcam	Cat# ab181972; RRID: N/A	
CP110	Proteintech Group	Cat# 12780-1-AP; RRID:AB_10638480	
Cdc6	Santa Cruz Biotechnology	Cat# sc-9964; RRID:AB_627236	
E2F1	CST	Cat# 3742; RRID:AB_2096936	
DDX24	Fortis Life Sciences	Cat# A300-698A; RRID:AB_533388)	
TAZ	CST	Cat# 72804; RRID:AB_2904134	
YAP1	CST	Cat# 14074; RRID:AB_2650491	
GFP	CST	Cat# 2555; RRID:AB_10692764	
Myc	Santa Cruz Biotechnology	Cat# sc-40; RRID:AB_627268	
bTrCP	CST	Cat# 4394; RRID:AB_10545763	
bTrCP	Santa Cruz Biotechnology	Cat# SC-390629; RRID: N/A	
Tubulin	Santa Cruz Biotechnology	Cat# sc-32293; RRID:AB_628412	
CCM3/PDCD10	Proteintech Group	Cat# 10294-2-AP; RRID:AB_2162153	
MST3 (STK24)	CST	Cat# 3723; RRID:AB_2198777	
MST4 (STK26)	CST	Cat# 3822; RRID:AB_330254	
Grb2	CST	Cat# 3972; RRID:AB_10693935	
SirT1	CST	Cat# 9475; RRID:AB_2617130	
PKA C-α	CST	Cat# 4782; RRID:AB_2170170	
PRKAR2A	ProteinTech Group	Cat# 67751 -1-Ig; RRID:AB_2918520	
RBL2 (p130)	CST	(Cell Signaling Technology Cat# 13610; RRID:AB_2798274)	
Cdh1 (Clone DH01)	ThermoFisher	(Lab Vision Cat# MS-1116-P0; RRID:AB_64161)	
Goat anti-mouse IgG HRP-conjugated	Jackson ImmunoResearch	Cat# 115-035-003; RRID:AB_10015289	
Goat anti-rabbit IgG HRP-conjugated	Jackson ImmunoResearch	Cat# 111-035-003; RRID:AB_2313567	
Proxidase AffiniPure Goat Anti-Mouse IgG, light chain specific (min X Bov, Gt, Hrs, Hu, Rb, Rat, Shp Ig)	Jackson ImmunoResearch	Cat# 115-035-174; RRID:AB_2338512	
Alexa Flour 488 Phalloidin	Invitrogen	Cat# A12379; RRID:N/A	
Donkey anti-Mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ 568	Invitrogen	Cat# A10037; RRID:N/A	
Donkey anti-Rabbit IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor™ Plus 647	Invitrogen	Cat# A32795; RRID:N/A	
	
Bacterial and virus strains			
	
NEB® 5-alpha Competent E. coli (High Efficiency)	NEB	C2987H	
One Shot® ccdB Survival™ 2 T1R Competent Cells	ThermoFisher	A10460	
BL21 (DE3) + RIL	Agilent	230245	
	
Biological samples			
	
Chemicals, peptides, and recombinant proteins			
	
BI2536	Selleck Chemicals	S1109	
BI6727	Selleck Chemicals	S2235	
NMS-P937	Selleck Chemicals	S7255	
CYC140	MedChem Express	HY-147298	
GSK461364	MedChem Express	HY-50877	
ON1231320	Selleck Chemicals	S8342	
Palbociclib	Selleck Chemicals	S1116	
Thymidine	Sigma-Aldrich	T9250	
RO-3306	Selleck Chemicals	S7747	
Nocodazole	UBPBio	F6120	
Paclitaxel (Taxol)	Sigma-Aldrich	T7191	
3MB-PP1	Cayman Chemical	17860	
MLN4924	Active Biochem	A-1139	
Bortezomib	Selleck Chemicals	S1013	
Doxycycline	Sigma-Aldrich	D9891	
Polybrene Infection / Transfection Reagent	Sigma-Aldrich	TR-1003	
G418 Sulfate	Corning	30-234-CR	
MG132	UBPBio	F1101	
PR-619	UBPBio	F2110	
Cycloheximide	Sigma-Aldrich	C7698	
Clarity ECL Western Blotting Substrate	Bio-Rad	1705060	
Ni2+-NTA resin	Qiagen	30210	
Lipofectamine RNAiMAX	Thermo Fisher	13778150	
Bio-Rad Protein Assay Dye Reagent Concentrate	Bio-Rad	5000006	
EZView Red Anti-FLAG M2 Affinity Gel	MilliporeSigma	F2426	
EZview Red Anti-c-Myc Affinity Gel	MilliporeSigma	E6654	
Protein A Agarose Beads	MilliporeSigma	16-125	
PolyJet Transfection Reagent	SignaGen	SL100688	
DMEM, high glucose, pyruvate	Thermo Fisher Scientific	11995065	
Trypsin EDTA (0.05 percent), phenol red	Gibco	25300054	
Dulbecco's phosphate-buffered saline (DPBS)	Gibco	14190-144	
Pepstatin A	MilliporeSigma	P5318	
Leupeptin	MilliporeSigma	L2884	
Aprotinin	MilliporeSigma	10981532001	
Sodium orthovanadate	MilliporeSigma	S6508	
Sodium fluoride	MilliporeSigma	S7920	
Bovine Serum Albumin	MilliporeSigma	A9647	
IPTG	GoldBio	I2481C100	
PLK1 Kinase Enzyme System	Promega	V2841	
Recombinant Human Active PLK1 Protein, CF	R&D Systems	3804-KS	
Recombinant PLK1	Kettenbach Lab (Dartmouth University)	N/A	
β-Catenin WT Peptide: Ac-KAAVSHWQQQSYLDSGIHSGATTAPRRASY-(PEG)2-KTAMRA	Biomatik	N/A	
β-Catenin pSpS Peptide: Ac-KAAVSHWQQQSYLD(pS)GIH(pS)GATTAPRRASY-(PEG)2-KTAMRA	Biomatik	N/A	
AKAP2 WT Peptide: Ac-KDDDHGILDQFSRSVNVSLTQEELDSGLDELSVRS-(PEG)2-KTAMRA	Biomatik	N/A	
AKAP2 pS Peptide: Ac-KDDDHGILDQFSRSVNVSLTQEELD(pS)GLDELSVRS-(PEG)2-KTAMRA	Biomatik	N/A	
Sequencing grade Trypsin	Promega	V5117	
Thermo Scientific Pierce DTT (Dithiothreitol) No-Weigh	Fisher Scientific	PIA39255	
Thermo Scientific Pierce Iodoacetamide No-Weigh	Fisher Scientific	PIA39271	
Ammonium Bicarbonate	Sigma Aldrich	09830-500G	
Acetonitrile, Optima LC/MS Grade, Fisher Chemical	Fisher Scientific	A955-1	
Pierce Peptide Desalting Spin Columns	VWR	PIER89851	
Thermo Scientific Formic Acid, LC-MS Grade	Fisher Scientific	PI28905	
Pierce Trifluoroacetic Acid (TFA), sequencing grade	Fisher Scientific	PI28904	
Wako LysC EndoProteinase MS Grade	Fisher Scientific	90051	
iRT peptides	Biognosys	Ki-3002-1	
SouthernBiotech™ Normal Donkey Serum	SouthernBiotech	Cat# OB003001;	
Thermo Scientific™ Pierce™ 16% Formaldehyde (w/v), Methanol-free	Fisher Scientific	PI28908	
	
Critical commercial assays			
	
GeneJET Plasmid Miniprep Kit	Thermo Fisher Scientific	K0503	
Q5 Site-Directed Mutagenesis Kit (without competent cells)	NEB	E0552S	
Pierce BCA Protein Assay Kit	Thermo Fisher Scientific	23227	
4-15% Mini-PROTEAN TGX Stain-free precast gels	BioRad	4568086	
Pierce Quantitative Fluorometric Peptide Assay	Thermo Scientific	23290	
	
Deposited data			
	
Proteomics Data	PRIDE/ProteomeXchange	PXD046039	
	
Experimental models: Cell lines			
	
HCT116	ATCC	ATCC Cat# CCL-247; RRID:CVCL_0291	
HeLa	ATCC	ATCC Cat# CCL-2; RRID:CVCL 0030	
RPE-1-hTERT	Jackson Lab (Stanford University)	N/A	
HEK293T	ATCC	ATCC Cat# CRL-3216; RRID:CVCL_0063	
T-47D	ATCC	ATCC Cat# HTB-133; RRID:CVCL_0553	
MDA-MB-231	ATCC	ATCC Cat #HTB-26; RRID:CVCL_0062	
HeLa sgCntrl	PMID: 27653696	N/A	
HeLa sgCCNF	PMID: 27653696	N/A	
HCT116 sgCCNF 1	This Study	N/A	
HCT116 sgCCNF 2	This Study	N/A	
RPE-1 EGFP-PLK1 WT	PMID: 17360533	N/A	
RPE-1 EGFP-PLK1 AS	PMID: 17360533	N/A	
HCT116 pIND20 EV	This Study	N/A	
HCT116 pIND20 AKAP2WT	This Study	N/A	
HCT116 pIND20 AKAP2DSG2	This Study	N/A	
HCT116 pGenLenti AKAP2WT	This Study	N/A	
HCT116 pGenLenti AKAP2DSG2	This Study	N/A	
	
Experimental models: Organisms/strains			
	
Trichoplusia ni (Tni) insect cell line	Expression Systems	94-002S	
	
Oligonucleotides			
	
siRNA Firefly Luciferase: CGUACGCGGAAUACUUCGAUU	Sigma-Aldrich	N/A	
siRNA Cullin 1: CAACGAAGAGUUCAGGUUU	Horizon Discovery	N/A	
siRNA βTrCP1/2: GAUCAAGUGGAAUUUGUGGAACAUC	Sigma-Aldrich	N/A	
siRNA Cyclin F (#3): UAGCCUACCUCUACAAUGAUU	Sigma-Aldrich	N/A	
siRNA Cyclin F (#4): GCACCCGGUUUAUCAGUAAUU	Sigma-Aldrich	N/A	
siRNA PLK1: AAAGAUUGUGCCUAAGUCUCU	Sigma-Aldrich	N/A	
PLK1 (T210A) Mutagenesis Primer – Forward: GAGGAAGAAGGCCCTGTGTGG	Eton Bioscience	N/A	
PLK1 (T210A) Mutagenesis Primer – Reverse: TCCCCGTCATATTCGACTTTG	Eton Bioscience	N/A	
PLK1 "Pincer" (H538A/K540M) Mutagenesis Primer – Forward: CATGCTCATCTTGTGCCCACTG	Eton Bioscience	N/A	
PLK1 "Pincer" (H538A/K540M) Mutagenesis Primer – Reverse: GTGGCATCCTGGAAGAAGTTGATC	Eton Bioscience	N/A	
βTrCP1 (WD40Mut) Mutagenesis Primer – Forward: GGAATTGGTGGCTTGTATTCGATTTGATAACAAG	Eton Bioscience	N/A	
βTrCP1 (WD40Mut) Mutagenesis Primer – Reverse: TCATGGCCTTCTAACACTC	Eton Bioscience	N/A	
βTrCP2 (WD40Mut) Mutagenesis Primer – Forward: AGAATTGGTCGCATGCATCCGGTTTG	Eton Bioscience	N/A	
PTrCP2 (WD40Mut) Mutagenesis Primer – Reverse: TCATGTCCCTCTAGGACTC	Eton Bioscience	N/A	
AKAP2 (E477A) Mutagenesis Primer – Forward: TGGTCTGGACGCATTGTCGGTGA	Eton Bioscience	N/A	
AKAP2 (E477A) Mutagenesis Primer – Reverse: GAGTCAAGCTCCTCTTGGG	Eton Bioscience	N/A	
AKAP2 (S479A) Mutagenesis Primer – Forward: GGACGAATTGGCGGTGAGGTCTC	Eton Bioscience	N/A	
AKAP2 (S479A) Mutagenesis Primer – Forward: AGACCAGAGTCAAGCTCCTC	Eton Bioscience	N/A	
	
Recombinant DNA			
	
pDEST-Myc5-Cyclin F	PMID: 27653696	N/A	
pDEST-FLAG-PLK1	This Study	N/A	
pDEST-HA3-PLK1	This Study	N/A	
pcDNA3.1(+) FLAG-Cyclin F FL	PMID: 22632967	N/A	
pcDNA3.1(+) FLAG-Cyclin F 1-600	PMID: 22632967	N/A	
pcDNA3.1(+) FLAG-Cyclin F 1-640	PMID: 22632967	N/A	
pcDNA3.1(+) FLAG-Cyclin F 1-750	PMID: 22632967	N/A	
pcDNA3.1(+) FLAG-Cyclin F 270-786	PMID: 22632967	N/A	
pDEST-FLAG-Cyclin F 281-786	This Study	N/A	
pDEST-FLAG-PLK1 (T210A)	This Study	N/A	
pDEST-FLAG-PLK1 (H538A, K540M)	This Study	N/A	
pDEST-FLAG-βTrCP1	PMID: 34851822	N/A	
pDEST-FLAG-βTrCP2	PMID: 34851822	N/A	
pDEST-FLAG-βTrCP1 (WD40Mut)	This Study	N/A	
pDEST-FLAG-βTrCP2 (WD40Mut)	This Study	N/A	
pcDNA3.1(+) Myc-AKAP2 WT	GenScript	N/A	
pcDNA3.1(+) Myc-AKAP2 DSG1	GenScript	N/A	
pcDNA3.1(+) Myc-AKAP2 DSG2	GenScript	N/A	
pcDNA3.1(+) Myc-AKAP2 DSG3	GenScript	N/A	
pGenLenti FLAG-AKAP2 WT	GenScript	N/A	
pGenLenti FLAG-AKAP2 DSG2	GenScript	N/A	
attL1+2_pGenDONR	GenScript	N/A	
pGenDONR AKAP2 WT	GenScript	N/A	
pGenDONR AKAP2 DSG2	GenScript	N/A	
pINDUCER20	PMID: 21307310 (Gift from Stephen Elledge)	Addgene #44012; RRID:Addgene_44012	
pINDUCER20 EV	This Study	N/A	
pINDUCER20 AKAP2 WT	This Study	N/A	
pINDUCER20 AKAP2 DSG2	This Study	N/A	
6HIS-FLAG-Ubiquitin	PMID: 24654937 (Gift from Philippe Soubeyran)	???	
pDEST-Myc5-AKAP2 WT	This Study	N/A	
pDEST-Myc5-AKAP2 DSG2	This Study	N/A	
pDEST-Myc5-AKAP2 E477A	This Study	N/A	
pDEST-Myc5-AKAP2 S479A	This Study	N/A	
pDEST-FLAG-AKAP2 WT	This Study	N/A	
p4489 Flag-βTrCP	PMID: 11030355 (Gift from Peter Howley)	Addgene: #10865	
pRSF1b His6-MBP TEV βTrCP	This Study	N/A	
pET3a Skp1	This Study	N/A	
pGEX4T1 – UBE2R2	Scott 2016 from methods	N/A	
pGEX4T1 – UBE2L3	Scott 2016 from methods	N/A	
pGEX4T1 – RBX1/Cul1-CTD	Scott 2016 from methods	N/A	
pAL – Cul1-NTD	Scott 2016 from methods	N/A	
pGEX4T1 – NEDD8	Scott 2016 from methods	N/A	
pGEX4T1 -ARIH1	Scott 2016 from methods	N/A	
	
Software and algorithms			
	
ImageJ (FIJI)	https://imagej.net/software/fiji/;	RRID:SCR_002285	
GraphPad Prism 9	GraphPad Prism (https://graphpad.com)	RRID:SCR_002798	
Metascape	https://metascape.org/gp/index.html#/main/step1	RRID:SCR_016620	
ProteomeDiscoverer v3.1	Thermo	RRID:SCR_014477	
R Project for Statistical Computing	The R Foundation	RRID:SCR_001905	
TidyVerse package for R		RRID:SCR_019186	
Spectronaut (v15.7.220308.50606)	Biognosys		
MaxQuant v1.6.15.0		RRID:SCR_014485	
Perseus v1.6.14.0		RRID:SCR_015753	
	
Other			
	
Thermo Easy nLC 1200	Thermo		
Thermo QExactive HF Mass Spectrometer	Thermo		
Aurora Ultimate TS 25 C18 Column (75um id × 25 cm, 1.7 um particle size)	IonOpticks	AUR3-25075C18-TS	
IonOpticks Column Heater	IonOpticks	HTS 902720000	
IonOpticks Heater Controller	IonOpticks	HTS 9032896040	
Thermo Ultimate3000 LC	Thermo		
Thermo Exploris480 Mass Spectrometer	Thermo		
IonOpticks Aurora Series 2 C18 column (75um id × 15cm, 1.6 um particle size)	IonOpticks		
OLYMPUS IX83 P2ZF (100 X objective, 1.51 NA objective)	Olympus		
OLYMPUS cellSens Dimension 3.2 (Build 23706)	Olympus		
Hamamatsu ORCA-Fusion	Hamamatsu		

Highlights

PLK1 promotes a widespread program of protein degradation at G2/M phase of the cell cycle

PLK1-mediated degradation is coordinated through at least two SCF-family E3 ligases

AKAP2, a PKA-anchoring protein, is regulated by the PLK1/βTrCP signaling axis

AKAP2 degradation coordinates cytoskeletal dynamics in mitosis

DECLARATION OF INTERESTS

The authors declare no competing interests.

SUPPLEMENTAL INFORMATION

Supplemental information can be found online at https://doi.org/10.1016/j.celrep.2024.114510.
==== Refs
REFERENCES

1. Dang F , Nie L , and Wei W (2021). Ubiquitin signaling in cell cycle control and tumorigenesis. Cell Death Differ. 28 , 427–438. 10.1038/s41418-020-00648-0.33130827
2. Hershko A , and Ciechanover A (1998). THE UBIQUITIN SYSTEM. Annu. Rev. Biochem. 67 , 425–479. 10.1146/annurev.biochem.67.1.425.9759494
3. Spencer SL , Cappell SD , Tsai F-C , Overton KW , Wang CL , and Meyer T (2013). The Proliferation-Quiescence Decision Is Controlled by a Bifurcation in CDK2 Activity at Mitotic Exit. Cell 155 , 369–383. 10.1016/j.cell.2013.08.062.24075009
4. Naetar N , Soundarapandian V , Litovchick L , Goguen KL , Sablina A. a , Bowman-Colin C , Sicinski P , Hahn WC , DeCaprio J. a , and Livingston DM (2014). PP2A-Mediated Regulation of Ras Signaling in G2 Is Essential for Stable Quiescence and Normal G1 Length. Mol. Cell 54 , 932–945. 10.1016/j.molcel.2014.04.023.24857551
5. Min M , Rong Y , Tian C , and Spencer SL (2020). Temporal integration of mitogen history in mother cells controls proliferation of daughter cells. Science 368 , 1261–1265. 10.1126/science.aay8241.32241885
6. Yang HW , Chung M , Kudo T , and Meyer T (2017). Competing memories of mitogen and p53 signalling control cell-cycle entry. Nature 549 , 404–408. 10.1038/nature23880.28869970
7. Jang S-M , Redon CE , Thakur BL , Bahta MK , and Aladjem MI (2020). Regulation of cell cycle drivers by Cullin-RING ubiquitin ligases. Exp. Mol. Med. 52 , 1637–1651. 10.1038/s12276-020-00508-4.33005013
8. Cardozo T , and Pagano M (2004). The SCF ubiquitin ligase: insights into a molecular machine. Nat. Rev. Mol. Cell Biol. 5 , 739–751. 10.1038/nrm1471.15340381
9. Nguyen KM , and Busino L (2020). In The Biology of F-Box Proteins: The SCF Family of E3 Ubiquitin Ligases BT-Cullin-RING Ligases and Protein Neddylation: Biology and Therapeutics, Sun Y , Wei W , and Jin J , eds. (Springer Singapore), pp. 111–122. 10.1007/978-981-15-1025-0_8.
10. Bai C , Sen P , Hofmann K , Ma L , Goebl M , Haper JW , and Elledge SJ (1996). SKP1 Connects Cell Cycle Regulators to the Ubiquitin Proteolysis Machinery through a Novel Motif, the F-Box. Cell 86 , 263–274.8706131
11. Zheng N , Wang Z , and Wei W (2016). Ubiquitination-mediated degradation of cell cycle-related proteins by F-box proteins. Int. J. Biochem. Cell Biol. 73 , 99–110.26860958
12. Paul D , Kales SC , Cornwell JA , Afifi MM , Rai G , Zakharov A , Simeonov A , and Cappell SD (2022). Revealing β-TrCP activity dynamics in live cells with a genetically encoded biosensor. Nat. Commun. 13 , 6364. 10.1038/s41467-022-33762-3.36289220
13. Winston JT , Strack P , Beer-Romero P , Chu CY , Elledge SJ , and Harper JW (1999). The SCFbeta-TRCP-ubiquitin ligase complex associates specifically with phosphorylated destruction motifs in IkappaBalpha and beta-catenin and stimulates IkappaBalpha ubiquitination in vitro. Genes Dev. 13 , 270–283.9990852
14. Hunter T (2007). The age of crosstalk: phosphorylation, ubiquitination, and beyond. Mol. Cell 28 , 730–738. 10.1016/j.molcel.2007.11.019.18082598
15. Bai C , Richman R , and Elledge SJ (1994). Human cyclin F. EMBO J. 13 , 6087–6098.7813445
16. D’Angiolella V , Esencay M , and Pagano M (2013). A cyclin without cyclin-dependent kinases: cyclin F controls genome stability through ubiquitin-mediated proteolysis. Trends Cell Biol. 23 , 135–140. 10.016/j.tcb.2012.10.011.23182110
17. Van Vugt MATM , Brás A , and Medema RH (2004). Polo-like kinase-1 controls recovery from a G2 DNA damage-induced arrest in mammalian cells. Mol. Cell 15 , 799–811. 10.1016/j.molcel.2004.07.015.15350223
18. Macůrek L , Lindqvist A , Lim D , Lampson MA , Klompmaker R , Freire R , Clouin C , Taylor SS , Yaffe MB , and Medema RH (2008). Polo-like kinase-1 is activated by aurora A to promote checkpoint recovery. Nature 455 , 119–123. 10.1038/nature07185.18615013
19. Bruinsma W , Raaijmakers JA , and Medema RH (2012). Switching Polo-like kinase-1 on and off in time and space. Trends Biochem. Sci. 37 , 534–542.23141205
20. Gheghiani L , Loew D , Lombard B , Mansfeld J , and Gavet O (2017). PLK1 Activation in Late G2 Sets Up Commitment to Mitosis. Cell Rep. 19 , 2060–2073. 10.1016/j.celrep.2017.05.031.28591578
21. Petronczki M , Lénárt P , and Peters J-M (2008). Polo on the Rise—from Mitotic Entry to Cytokinesis with Plk1. Dev. Cell 14 , 646–659.18477449
22. Hansen DV , Loktev AV , Ban KH , and Jackson PK (2004). Plk1 regulates activation of the anaphase promoting complex by phosphorylating and triggering SCFbetaTrCP-dependent destruction of the APC Inhibitor Emi1. Mol. Biol. Cell 15 , 5623–5634. 10.1091/mbc.e04-07-0598.15469984
23. Moshe Y , Boulaire J , Pagano M , and Hershko A (2004). Role of Polo-like kinase in the degradation of early mitotic inhibitor 1, a regulator of the anaphase promoting complex/cyclosome. Proc. Natl. Acad. Sci. USA 101 , 7937–7942. 10.1073/pnas.0402442101.15148369
24. Burrows AC , Prokop J , and Summers MK (2012). Skp1-Cul1-F-box Ubiquitin Ligase (SCFβTrCP)-mediated Destruction of the Ubiquitin-specific Protease USP37 during G2-phase Promotes Mitotic Entry. J. Biol. Chem. 287 , 39021–39029.23027877
25. Watanabe N , Arai H , Nishihara Y , Taniguchi M , Watanabe N , Hunter T , and Osada H (2004). M-phase kinases induce phospho-dependent ubiquitination of somatic Wee1 by SCFbeta-TrCP. Proc. Natl. Acad. Sci. 101 , 4419–4424. 10.1073/pnas.0307700101.15070733
26. Peschiaroli A , Dorrello NV , Guardavaccaro D , Venere M , Halazonetis T , Sherman NE , and Pagano M (2006). SCFbetaTrCP-mediated degradation of Claspin regulates recovery from the DNA replication checkpoint response. Mol. Cell 23 , 319–329.16885022
27. Mailand N , Bekker-Jensen S , Bartek J , and Lukas J (2006). Destruction of Claspin by SCFbetaTrCP restrains Chk1 activation and facilitates recovery from genotoxic stress. Mol. Cell 23 , 307–318.16885021
28. Mamely I , van Vugt MATM , Smits VAJ , Semple JI , Lemmens B , Perrakis A , Medema RH , and Freire R (2006). Polo-like Kinase-1 Controls Proteasome-Dependent Degradation of Claspin during Check-point Recovery. Curr. Biol. 16 , 1950–1955.16934469
29. Seki A , Coppinger JA , Du H , Jang C-Y , Yates JR III , and Fang G (2008). Plk1- and β-TrCP–dependent degradation of Bora controls mitotic progression. J. Cell Biol. 181 , 65–78. 10.1083/jcb.200712027.18378770
30. Chan EHY , Santamaria A , Silljé HHW , and Nigg EA (2008). Plk1 regulates mitotic Aurora A function through betaTrCP-dependent degradation of hBora. Chromosoma 117 , 457–469. 10.1007/s00412-008-0165-5.18521620
31. Golsteyn RM , Mundt KE , Fry AM , and Nigg EA (1995). Cell cycle regulation of the activity and subcellular localization of Plk1, a human protein kinase implicated in mitotic spindle function. J. Cell Biol. 129 , 1617–1628. 10.1083/jcb.129.6.1617.7790358
32. Akopyan K , SilvaCascales H , Hukasova E , Saurin AT , Müllers E , Jaiswal H , Hollman DAA , Kops GJPL , Medema R , and Lindqvist A (2014). Assessing kinetics from fixed cells reveals activation of the mitotic entry network at the S/G2 transition. Mol. Cell 53 , 843–853. 10.1016/j.molcel.2014.01.031.24582498
33. Omar MH , and Scott JD (2020). AKAP Signaling Islands: Venues for Precision Pharmacology. Trends Pharmacol. Sci. 41 , 933–946. 10.1016/j.tips.2020.09.007.33082006
34. Han B , Poppinga WJ , and Schmidt M (2015). Scaffolding during the cell cycle by A-kinase anchoring proteins. Pflugers Arch. 467 , 2401–2411. 10.1007/s00424-015-1718-0.26202611
35. Wang B , Jiang B , Li Y , Dai Y , Li P , Li L , Xu J , Li L , and Wu P (2021). AKAP2 overexpression modulates growth plate chondrocyte functions through ERK1/2 signaling. Bone 146 , 115875. 10.1016/j.bone.2021.115875.33571699
36. Maric D , Paterek A , Delaunay M , López IP , Arambasic M , and Diviani D (2021). A-Kinase Anchoring Protein 2 Promotes Protection against Myocardial Infarction. Cells 10 , 2861. 10.3390/cells10112861.34831084
37. Gold MG , Reichow SL , O’Neill SE , Weisbrod CR , Langeberg LK , Bruce JE , Gonen T , and Scott JD (2012). AKAP2 anchors PKA with aquaporin-0 to support ocular lens transparency. EMBO Mol. Med 4 , 15–26.22095752
38. Li X , Wang C , Zhang G , Liang M , and Zhang B (2017). AKAP2 is upregulated in ovarian cancer, and promotes growth and migration of cancer cells. Mol. Med. Rep. 16 , 5151–5156. 10.3892/mmr.2017.7286.28849175
39. Thakkar A , Aljameeli A , Thomas S , and Shah GV (2016). A-kinase anchoring protein 2 is required for calcitonin-mediated invasion of cancer cells. Endocr. Relat. Cancer 23 , 1–14. 10.1530/ERC-15-0425.
40. Reggi E , Kaiser S , Sahnane N , Uccella S , La Rosa S , and Diviani D (2024). AKAP2-anchored protein phosphatase 1 controls prostatic neuroendocrine carcinoma cell migration and invasion. Biochim. Biophys. acta. Mol. basis Dis 1870 , 166916. 10.1016/j.bbadis.2023.166916.37827203
41. Delaunay M , Paterek A , Gautschi I , Scherler G , and Diviani D (2024). AKAP2-anchored extracellular signal-regulated kinase 1 (ERK1) regulates cardiac myofibroblast migration. Biochim. Biophys. acta. Mol. cell Res 1871 , 119674. 10.1016/j.bbamcr.2024.119674.38242328
42. Luo J , Emanuele MJ , Li D , Creighton CJ , Schlabach MR , Westbrook TF , Wong K-K , and Elledge SJ (2009). A genome-wide RNAi screen identifies multiple synthetic lethal interactions with the Ras oncogene. Cell 137 , 835–848. 10.1016/j.cell.2009.05.006.19490893
43. Chiappa M , Petrella S , Damia G , Broggini M , Guffanti F , and Ricci F (2022). Present and Future Perspective on PLK1 Inhibition in Cancer Treatment. Front. Oncol. 12 , 903016.35719948
44. Iliaki S , Beyaert R , and Afonina IS (2021). Polo-like kinase 1 (PLK1) signaling in cancer and beyond. Biochem. Pharmacol. 193 , 114747. 10.1016/j.bcp.2021.114747.34454931
45. Dankert JF , Rona G , Clijsters L , Geter P , Skaar JR , Bermudez-Hernandez K , Sassani E , Fenyö D , Ueberheide B , Schneider R , and Pagano M (2016). Cyclin F-Mediated Degradation of SLBP Limits H2A.X Accumulation and Apoptosis upon Genotoxic Stress in G2. Mol. Cell 64 , 507–519. 10.1016/j.molcel.2016.09.010.27773672
46. D’Angiolella V , Donato V , Forrester FM , Jeong YT , Pellacani C , Kudo Y , Saraf A , Florens L , Washburn MP , and Pagano M (2012). Cyclin F-mediated degradation of ribonucleotide reductase M2 controls genome integrity and DNA repair. Cell 149 , 1023–1034. 10.1016/j.cell.2012.03.043.22632967
47. Dangiolella V , Donato V , Vijayakumar S , Saraf A , Florens L , Washburn MP , Dynlacht B , and Pagano M (2010). SCF Cyclin F controls centrosome homeostasis and mitotic fidelity through CP110 degradation. Nature 466 , 138–142. 10.1038/nature09140.20596027
48. Walter D , Hoffmann S , Komseli E-S , Rappsilber J , Gorgoulis V , and Sørensen CS (2016). SCF(Cyclin F)-dependent degradation of CDC6 suppresses DNA re-replication. Nat. Commun. 7 , 10530. 10.1038/ncomms10530.26818844
49. Clijsters L , Hoencamp C , Calis JJA , Marzio A , Handgraaf SM , Cuitino MC , Rosenberg BR , Leone G , and Pagano M (2019). Cyclin F Controls Cell-Cycle Transcriptional Outputs by Directing the Degradation of the Three Activator E2Fs. Mol. Cell 74 , 1264–1277.e7. 10.1016/j.molcel.2019.04.010.31130363
50. Burdova K , Yang H , Faedda R , Hume S , Chauhan J , Ebner D , Kessler BM , Vendrell I , Drewry DH , Wells CI , (2019). E2F1 proteolysis via SCF-cyclin F underlies synthetic lethality between cyclin F loss and Chk1 inhibition. EMBO J. 38 , e101443. 10.15252/embj.2018101443.31424118
51. Enrico TP , Stallaert W , Wick ET , Ngoi P , Wang X , Rubin SM , Brown NG , Purvis JE , and Emanuele MJ (2021). Cyclin F drives proliferation through SCF-dependent degradation of the retinoblastoma-like tumor suppressor p130/RBL2. Elife 10 , e70691. 10.7554/eLife.70691.34851822
52. Fung TK , Siu WY , Yam CH , Lau A , and Poon RYC (2002). Cyclin F is degraded during G2-M by mechanisms fundamentally different from other cyclins. J. Biol. Chem. 277 , 35140–35149. 10.1074/jbc.M205503200.12122006
53. Burkard ME , Randall CL , Larochelle S , Zhang C , Shokat KM , Fisher RP , and Jallepalli PV (2007). Chemical genetics reveals the requirement for Polo-like kinase 1 activity in positioning RhoA and triggering cytokinesis in human cells. Proc. Natl. Acad. Sci. USA 104 , 4383–4388. 10.1073/pnas.0701140104.17360533
54. Burkard ME , Santamaria A , and Jallepalli PV (2012). Enabling and Disabling Polo-like Kinase 1 Inhibition through Chemical Genetics. ACS Chem. Biol. 7 , 978–981. 10.1021/cb200551p.22422077
55. Elia AEH , Cantley LC , and Yaffe MB (2003). Proteomic screen finds pSer/pThr-binding domain localizing Plk1 to mitotic substrates. Science 299 , 1228–1231. 10.1126/science.1079079.12595692
56. Soucy T. a , Smith PG , Milhollen M. a , Berger AJ , Gavin JM , Adhikari S , Brownell JE , Burke KE , Cardin DP , Critchley S , (2009). An inhibitor of NEDD8-activating enzyme as a new approach to treat cancer. Nature 458 , 732–736. 10.1038/nature07884.19360080
57. Wu G , Xu G , Schulman BA , Jeffrey PD , Harper JW , and Pavletich NP (2003). Structure of a beta-TrCP1-Skp1-beta-catenin complex: destruction motif binding and lysine specificity of the SCF(beta-TrCP1) ubiquitin ligase. Mol. Cell 11 , 1445–1456.12820959
58. Kruiswijk F , Yuniati L , Magliozzi R , Low TY , Lim R , Bolder R , Mohammed S , Proud CG , Heck AJR , Pagano M , and Guardavaccaro D (2012). Coupled Activation and Degradation of eEF2K Regulates Protein Synthesis in Response to Genotoxic Stress. Sci. Signal. 5 , ra40. 10.1126/scisignal.2002718.22669845
59. Kanemori Y , Uto K , and Sagata N (2005). Beta-TrCP recognizes a previously undescribed nonphosphorylated destruction motif in Cdc25A and Cdc25B phosphatases. Proc. Natl. Acad. Sci. 102 , 6279–6284. 10.1073/pnas.0501873102.15845771
60. Davey NE , and Morgan DO (2016). Building a Regulatory Network with Short Linear Sequence Motifs: Lessons from the Degrons of the Anaphase-Promoting Complex. Mol. Cell 64 , 12–23. 10.1016/j.molcel.2016.09.006.27716480
61. Franks JL , Martinez-Chacin RC , Wang X , Tiedemann RL , Bonacci T , Choudhury R , Bolhuis DL , Enrico TP , Mouery RD , Damrauer JS , (2020). In silico APC/C substrate discovery reveals cell cycle-dependent degradation of UHRF1 and other chromatin regulators. PLoS Biol. 18 , e3000975. 10.1371/journal.pbio.3000975.33306668
62. Schwob E , Böhm T , Mendenhall MD , and Nasmyth K (1994). The B-type cyclin kinase inhibitor p40SIC1 controls the G1 to S transition in S. cerevisiae. Cell 79 , 233–244. 10.1016/0092-8674(94)90193-7.7954792
63. Carrano AC , Eytan E , Hershko A , and Pagano M (1999). SKP2 is required for ubiquitin-mediated degradation of the CDK inhibitor p27. Nat. Cell Biol. 1 , 193–199. 10.1038/12013.10559916
64. Kossatz U , Dietrich N , Zender L , Buer J , Manns MP , and Malek NP (2004). Skp2-dependent degradation of p27kip1 is essential for cell cycle progression. Genes Dev. 18 , 2602–2607. 10.1101/gad.321004.15520280
65. Palozola KC , Donahue G , Liu H , Grant GR , Becker JS , Cote A , Yu H , Raj A , and Zaret KS (2017). Mitotic transcription and waves of gene reactivation during mitotic exit. Science 358 , 119–122. 10.1126/science.aal4671.28912132
66. Tanenbaum ME , Stern-Ginossar N , Weissman JS , and Vale RD (2015). Regulation of mRNA translation during mitosis. Elife 4 , e07957. 10.7554/eLife.07957.26305499
67. Skowyra D , Craig KL , Tyers M , Elledge SJ , and Harper JW (1997). F-Box Proteins Are Receptors that Recruit Phosphorylated Substrates to the SCF Ubiquitin-Ligase Complex. Cell 91 , 209–219. 10.1016/S0092-8674(00)80403-1.9346238
68. Ang XL , and Wade Harper J (2005). SCF-mediated protein degradation and cell cycle control. Oncogene 24 , 2860–2870. 10.1038/sj.onc.1208614.15838520
69. Choudhury R , Bonacci T , Wang X , Truong A , Arceci A , Zhang Y , Mills CA , Kernan JL , Liu P , and Emanuele MJ (2017). The E3 Ubiquitin Ligase SCF(Cyclin F) Transmits AKT Signaling to the Cell-Cycle Machinery. Cell Rep. 20 , 3212–3222. 10.1016/j.cel-rep.2017.08.099.28954236
70. Greenwald EC , and Saucerman JJ (2011). Bigger, Better, Faster: Principles and Models of AKAP Anchoring Protein Signaling. J. Cardiovasc. Pharmacol. 58 , 462–469.21562426
71. Dong F , Feldmesser M , Casadevall A , and Rubin CS (1998). Molecular Characterization of a cDNA That Encodes Six Isoforms of a Novel Murine A Kinase Anchor Protein. J. Biol. Chem. 273 , 6533–6541.9497389
72. Grieco D , Porcellini A , Avvedimento EV , and Gottesman ME (1996). Requirement for cAMP-PKA Pathway Activation by M Phase-Promoting Factor in the Transition from Mitosis to Interphase. Science 271 , 1718–1723. 10.1126/science.271.5256.1718.8596931
73. Maller JL , and Krebs EG (1977). Progesterone-stimulated meiotic cell division in Xenopus oocytes. Induction by regulatory subunit and inhibition by catalytic subunit of adenosine 3’:5’-monophosphate-dependent protein kinase. J. Biol. Chem. 252 , 1712–1718.190238
74. Kaji N , Muramoto A , and Mizuno K (2008). LIM kinase-mediated cofilin phosphorylation during mitosis is required for precise spindle positioning. J. Biol. Chem. 283 , 4983–4992. 10.1074/jbc.M708644200.18079118
75. Amano T , Kaji N , Ohashi K , and Mizuno K (2002). Mitosis-specific activation of LIM motif-containing protein kinase and roles of cofilin phosphorylation and dephosphorylation in mitosis. J. Biol. Chem. 277 , 22093–22102. 10.1074/jbc.M201444200.11925442
76. Liu Z , Sun Q , and Wang X (2017). PLK1, A Potential Target for Cancer Therapy. Transl. Oncol. 10 , 22–32. 10.1016/j.tranon.2016.10.003.27888710
77. Lenz H , Ridinger M , Samuelsz E , Smeal T , and Ahn D (2022). Early Decreases in KRAS Mutant Allele Frequency (MAF) Predict Clinical Benefit to the PLK1 Inhibitor Onvansertib in Combination with FOLFIRI/bev in 2L Treatment of Metastatic Colorectal Carcinoma (mCRC) (European Society for Molecular Oncology).
78. Choudhury R , Bonacci T , Arceci A , Lahiri D , Mills CA , Kernan JL , Branigan TB , DeCaprio JA , Burke DJ , and Emanuele MJ (2016). APC/C and SCFcyclin F Constitute a Reciprocal Feedback Circuit Controlling S-Phase Entry. Cell Rep. 16 , 3359–3372. 10.1016/j.celrep.2016.08.058.27653696
79. Brademan DR , Riley NM , Kwiecien NW , and Coon JJ (2019). Interactive Peptide Spectral Annotator: A Versatile Web-based Tool for Proteomic Applications. Mol. Cell. Proteomics 18 , S193–S201. 10.1074/mcp.TIR118.001209.31088857
80. Meerbrey KL , Hu G , Kessler JD , Roarty K , Li MZ , Fang JE , Herschkowitz JI , Burrows AE , Ciccia A , Sun T , (2011). The pIN-DUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo. Proc. Natl. Acad. Sci. USA 108 , 3665–3670. 10.1073/pnas.1019736108.21307310
81. Bonacci T , Audebert S , Camoin L , Baudelet E , Bidaut G , Garcia M , Witzel II , Perkins ND , Borg JP , Iovanna JL , and Soubeyran P (2014). Identification of new mechanisms of cellular response to chemotherapy by tracking changes in post-translational modifications by ubiquitin and ubiquitin-like proteins. J. Proteome Res. 13 , 2478–2494. 10.1021/pr401258d.24654937
82. Rank L , Herring LE , and Braunstein M (2021). Evidence for the Mycobacterial Mce4 Transporter Being a Multiprotein Complex. J. Bacteriol. 203 , e00685–20. 10.1128/JB.00685-20.33649150
83. Tyanova S , Temu T , Sinitcyn P , Carlson A , Hein MY , Geiger T , Mann M , and Cox J (2016). The Perseus computational platform for comprehensive analysis of (prote)omics data. Nat. Methods 13 , 731–740. 10.1038/nmeth.3901.27348712
84. Kamadurai HB , Qiu Y , Deng A , Harrison JS , Macdonald C , Actis M , Rodrigues P , Miller DJ , Souphron J , Lewis SM , (2013). Mechanism of ubiquitin ligation and lysine prioritization by a HECT E3. Elife 2 , e00828. 10.7554/eLife.00828.001.23936628
85. Scott DC , Rhee DY , Duda DM , Kelsall IR , Olszewski JL , Paulo JA , de Jong A , Ovaa H , Alpi AF , Harper JW , and Schulman BA (2016). Two Distinct Types of E3 Ligases Work in Unison to Regulate Substrate Ubiquitylation. Cell 166 , 1198–1214.e24. 10.1016/j.cell.2016.07.027.27565346
86. Duda DM , Borg LA , Scott DC , Hunt HW , Hammel M , and Schulman BA (2008). Structural insights into NEDD8 activation of cullin-RING ligases: conformational control of conjugation. Cell 134 , 995–1006. 10.1016/j.cell.2008.07.022.18805092
87. Zhou P , Bogacki R , McReynolds L , and Howley PM (2000). Harnessing the ubiquitination machinery to target the degradation of specific cellular proteins. Mol. Cell 6 , 751–756. 10.1016/s1097-2765(00)00074-5.11030355
88. Zhou Y , Zhou B , Pache L , Chang M , Khodabakhshi AH , Tanaseichuk O , Benner C , and Chanda SK (2019). Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 10 , 1523. 10.1038/s41467-019-09234-6.30944313
