
==== Front
Heliyon
Heliyon
Heliyon
2405-8440
Elsevier

S2405-8440(24)13081-2
10.1016/j.heliyon.2024.e37050
e37050
Research Article
Development and evaluation of a duplex real-time multienzyme isothermal rapid amplification assay for the detection of hypervirulent Klebsiella pneumoniae in clinical spiked blood specimens
Duan Zhixiong ab
Wang Shan a
Xie Niqi a
Zhao Junying a
Dong Jian a
Li Jin jamly1110@163.com
a⁎
a Department of Laboratory Medicine, The Affiliated Dazu's Hospital of Chongqing Medical University, Chongqing, China
b Department of Laboratory Medicine, The Chen Jia qiao Hospital of Sha Ping Ba District, Chongqing, China
⁎ Corresponding author. Department of Laboratory Medicine, The Affiliated Dazu's Hospital of Chongqing Medical University, Chongqing, China. jamly1110@163.com
30 8 2024
15 9 2024
30 8 2024
10 17 e3705016 10 2023
25 8 2024
27 8 2024
© 2024 The Authors. Published by Elsevier Ltd.
2024

https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Objectives

Our objective was to establish a rapid and precise method for detecting hypervirulent Klebsiella pneumoniae (hvKP) by utilizing a duplex real-time multienzyme isothermal rapid amplification (real-time MIRA) and to evaluate its performance in clinical spiked blood specimens.

Methods

The research comprised two phases: an initial pilot study to establish the methodology and a clinical validation study to assess its effectiveness. In the pilot phase, we designed specific primers and probes targeting the hvKP pg344 and incA genes and subsequently developed a duplex real-time MIRA assay to evaluate its detection limits, specificity, and efficiency. In the clinical validation phase, we analyzed thirty-three spiked blood specimens using the duplex real-time MIRA assay.

Results

The duplex real-time MIRA assay demonstrated no cross-reactivity with other strains. Sensitivity experiments confirmed that the assay had a detection limit as low as 8 × 102 CFU per reaction for hvKP. The analysis of clinical spiked blood specimens indicated that the sensitivity and specificity of the duplex real-time MIRA assay were on par with those of duplex real-time PCR.

Conclusions

These findings confirm that the duplex real-time MIRA assay is a fast, straightforward, and dependable method for detecting hvKP.

Keywords

Hypervirulent Klebsiella pneumoniae
Duplex real-time MIRA
Duplex real-time PCR
pg344 and incA genes
==== Body
pmc1 Introduction

Klebsiella pneumoniae is a common pathogen responsible for both community- and hospital-acquired infections, characterized by its thick capsule polysaccharide that effectively hinders neutrophil phagocytosis and antibiotic activity, thereby increasing the susceptibility to pneumonia, bloodstream infection, and urinary tract infection [[1], [2], [3], [4]]. The presence of a robust capsular polysaccharide layer enables K. pneumoniae to evade neutrophil phagocytosis and antibiotic action efficiently, consequently enhancing the likelihood of developing lung inflammation, bloodstream infections, and urinary tract infections. Currently, due to variations in capsular polysaccharide species and alterations in bacterial virulence factors, there has been an escalating global prevalence of hypervirulent K. pneumoniae (hvKP) infections [5]. In comparison to nosocomial infections caused by classical K. pneumoniae (cKP), hvKP is associated with higher rates of severe complications and elevated mortality such as sepsis and metastatic infection [[6], [7], [8]]. Recently, the resistance patterns exhibited by hvKP strains have garnered significant attention worldwide due to their close association with bacterial virulence traits. Of particular concern is the emergence of carbapenem-resistant hvKP (CR-hvKP), which poses a formidable challenge for clinical management [[9], [10], [11]].

Advanced methods for detecting hvKP include colony morphology analysis, serum killing assays, mouse lethality tests, string tests, and real-time PCR [12] However, these traditional methods are time-intensive, often requiring several hours or even up to 2 days to produce results. In contrast, hvKP strains frequently carry virulence plasmids such as pK2044, pLVPK, and pVir-CR-hvKp4, which encode well-known virulence factors associated with hvKP [13].Importantly, plasmid-borne virulence genes can serve as specific biomarkers for detecting hvKP. Four such virulence genes namely peg344, iucA, iroB, and prmpA are considered molecular markers for detecting hvKP. Among these, peg344 stands out for its accuracy, sensitivity, and specificity in detecting hvKP, as it encodes a metabolic transporter of unknown function located on the inner membrane [14]. Furthermore, iucA is also regarded as a hvKP-specific gene owing to its involvement in the production of aerobactin siderophore biosynthesis and pathogenicity. Consequently, we have chosen peg344 and iucA as key genes for the rapid detection of hvKP.

Recently, the multienzyme isothermal rapid amplification (MIRA) has replaced traditional PCR approaches. Compared to conventional PCR technologies, MIRA technology offers several advantages, including enhanced speed and accuracy, reduced equipment dependency (even in the absence of equipment), simplified operation, minimized environmental and personnel requirements. Moreover, in comparison to existing isothermal amplification technologies, MIRA requires less sample material and eliminates the need for imported raw materials. It can efficiently amplify trace nucleic acid templates to detectable levels at 37–42 °C and can be combined with other detection technologies to broaden its application fields [15,16]. Real-time MIRA technology has garnered significant attention for its high sensitivity and specificity, rapid detection time, room-temperature isothermal reaction, versatility across various applications, and the use of freeze-dried reagents that are easy to transport and maintain stable enzyme activity. In this study, we assessed the efficacy of a duplex real-time MIRA assay targeting the peg344 and iucA genes for the rapid detection of hvKP in clinical spiked blood specimens.

2 Materials and methods

2.1 Bacterial strains and genomic DNA preparation

In the present study, we collected a detailed list of thirty-three clinical isolates from Daping Hospital for duplex real-time MIRA performance. The list includes hvKP pg344 and incA, hvKP pg344, hvKP incA, non-pg344/incA hvKP, cKP, E. coli, E. cloacae, K. oxyota, S. marcescens, and M. morganii as shown in Table 1. International standard strain stored in our laboratory included Klebsiella pneumoniae ATCC700603, Klebsiella oxyota ATCC700324, Escherichia coli ATCC25922, Enterobacter hoemaechei ATCC700323, Acinetobacter baumannii ATCC19666, Pseudomoas areuginosa ATCC27853, and Stenotrophomonas maltophilia ATCC17666 were chosen as the negative reference strains for specificity experiment as shown in Table 2. The hvKP pg344 and incA strains, which were isolated from clinical patients, were used as positive reference strains for sensitivity and specificity experiments. The primary method utilized for quantifying bacterial colony forming units (CFU) involved a continuous tenfold dilution of the bacterial solution with a 0.35 McFarland standard, followed by the deposition of 10 μL of the appropriate dilution onto an LB plate. Each concentration was replicated thrice, incubated in a 35 °C chamber for 24 h, and subsequently subjected to CFU enumeration. For blood specimens spiked with bacteria, 900 μL of whole blood was mixed with 100 μL of bacterial strains at different concentrations. The spiked blood samples were processed using the TIANamp Bacteria DNA Kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's instructions. The extracted DNA was then stored at −20 °C until needed.Table 1 Characteristics of the thirty-three isolates used for validation of the designed duplex real-time MIRA assay for the detection of hvKP.

Table 1NO	Bacterial strain	Source	Type	Real-time MIRA	Real-time PCR	
1	hvKP
peg344 and incA	Neurology	Sputum	Positive	Positive	
2	hvKP
peg344 and incA	ICU	Lung	Positive	Positive	
3	hvKP
peg344 and incA	Endocrinology	Secretion	Positive	Positive	
4	hvKP
peg344 and incA	Neurology	Lung	Positive	Positive	
5	hvKP
peg344 and incA	Cardiovascular medicine	Sputum	Positive	Positive	
6	hvKP
peg344 and incA	ICU	Lung	Positive	Positive	
7	hvKP
peg344 and incA	ICU	Sputum	Positive	Positive	
8	hvKP
peg344 and incA	RICU	Lung	Positive	Positive	
9	hvKP
peg344 and incA	ICU	Sputum	Positive	Positive	
10	hvKP
peg344 and incA	Endocrinology	Lung	Positive	Positive	
11	hvKP
peg344 and incA	Cardiovascular medicine	Sputum	Positive	Positive	
12	hvKP
peg344 and incA	ICU	Lung	Positive	Positive	
13	hvKP
peg344 and incA	ICU	Lung	Positive	Positive	
14	hvKP
peg344 and incA	Neurology	Sputum	Positive	Positive	
15	hvKP
peg344 and incA	ICU	Lung	Positive	Positive	
16	hvKP
peg344 and incA	Rehabilitation	Sputum	Positive	Positive	
17	hvKP
peg344 and incA	ICU	Lung	Positive	Positive	
18	hvKP peg344	Cardiovascular medicine	Urine	Negative	Negative	
19	hvKP incA	ICU	Lung	Negative	Negative	
20	non-peg344/incA
hvKP	ICU	Sputum	Negative	Negative	
21	non-peg344/incA
hvKP	Neurology	Urine	Negative	Negative	
22	cKP	Oncology department	Urine	Negative	Negative	
23	cKP	Endocrinology	Blood	Negative	Negative	
24	Escherichia coli	Rehabilitation	Urine	Negative	Negative	
25	Escherichia coli	Neurology	Blood	Negative	Negative	
26	Enterobacter cloacae	Maxillofacial	Secretion	Negative	Negative	
27	Enterobacter cloacae	Endocrinology	Urine	Negative	Negative	
28	Klebsiella oxytoca	Trauma Surgery	Pus	Negative	Negative	
29	Klebsiella oxytoca	Ophthalmology	Secretion	Negative	Negative	
30	Serratia marcescens	GICU	Lung	Negative	Negative	
31	Serratia marcescens	Trauma Surgery	Bile	Negative	Negative	
32	Morganella morganii	Endocrinology	Urine	Negative	Negative	
33	Morganella morganii	Trauma Surgery	Blood	Negative	Negative	
hvKP peg344 and incA: hypervirulent Klebsiella pneumoniae coharboring peg344 and incA genes.

hvKP peg344: hypervirulent Klebsiella pneumoniae coharboring peg344 gene.

hvKP incA: hypervirulent Klebsiella pneumoniae coharboring incA gene.

non-peg344/incA hvKP: hypervirulent Klebsiella pneumoniae coharboring non-peg344 and non-incA genes.

cKP: classical Klebsiella pneumoniae.

ICU: Intensive Care Unit.

GICU: Gastroenterology Intensive Care Unit.

RICU: Respiratory Intensive Care Unit.

Table 2 Specificity of duplex real-time MIRA assay for the detection of hvKP.

Table 2NO	Strain name	Source of strain	Real-time MIRA	
1	hvKP peg344 and incA	Laboratory collection	Positive	
2	Klebsiella pneumoniae	ATCC700603	Negative	
3	Klebsiella oxyota	ATCC700324	Negative	
4	Escherichia coli	ATCC25922	Negative	
5	Enterobacter hoemaechei	ATCC700323	Negative	
6	Acinetobacter baumannii	ATCC19666	Negative	
7	Pseudomoas areuginosa	ATCC27853	Negative	
8	Stenotrophomonas maltophilia	ATCC17666	Negative	
hvKP peg344 and incA: hypervirulent Klebsiella pneumoniae coharboring peg344 and incA genes.

2.2 Identification of hvKP peg344 and iucA strains by conventional PCR

All hvKP pg344 (Fig. S1a) and incA (Fig. S1b) strains in this study were verified using conventional PCR. The PCR products of the pg344 gene (508 bp) and incA gene (583 bp) were purified using a PCR product purification kit from Tiangen Biotech (Beijing, China). The purified sequences were then compared with those in the GenBank database using the BLAST algorithm for alignment.

2.3 Primer and probe design

In this study, the major virulence genes peg344 and iucA of hvKP were selected as target regions for designing primers and probes. These genes have been previously detected using real-time PCR-based assays [17]. Primers and probes were manually designed targeting the conserved regions of the peg344 and iucA genes, adhering to real-time MIRA primer and probe design principles. Their specificity was verified using NCBI's Primer-BLAST. The primers and probes were synthesized and purified by BGI Biotechnology Corporation (Beijing, China) through high-performance liquid chromatography (HPLC). Their sequences are provided in Table 3.Table 3 Sequences of primers and probes.

Table 3Assay	Name	Sequence (5′-3′) and modification	Length (bp)	
Real-time MIRA	peg344-F1	CCCTCCAGTCTTTGCTACCGGGATGAGATT	30	
peg344-F2	TCCGCTCAATTATTAATCATTATCGCATGG	30	
peg344-F3	TCCTGTTGGCCAGCGTCTATTTCAACTTGC	30	
peg344-R1	ATTAGTCCAGTAATCTGTATTGAGTTTG	28	
peg344-R2	CCTCCGTGATGAGGATGAACGAAAGTGAAG	30	
peg344-R3	AAGAAAGGGCAATAACTCCCGTCCACTGG	29	
incA-F1	ATCAATGGCTATTCCCGCTGCACCCGTGGC	30	
incA-F2	TCTGTTGCAGCAGGAGTGGTGCCAGGAGCT	30	
incA-F3	CAATGGCTATTCCCGCTGCACCCGTGGCAG	30	
incA-R1	ATCAATGGCTATTCCCGCTGCACCCGTGGC	30	
incA-R2	CTTTCACTGACAGGGTACGGACGGAGTTGG	30	
incA-R3	ACGGAGTTGGTCAGGCGCACGCTCAGGGAG	30	
peg344-P1	TCCTTTCTCTCTAATGATTTATGGTGAGGT[FAM-dT]A[THF][BHQ1-dT]GTAAACCCAGGACTT-[C3spacer]	78	
incA-P1	TGGCTACCGACCACCTCTTCCCGCTCGCTC[VIC-dT]A[THF][BHQ1-dT]GCGCCACCAGCAGCG-[C3spacer]	78	
Real-time PCR	peg344-F	AGCTTCACTTTCGTTCATCCT	20	
peg344-R	CTGCAGAAGAAAGGGCAATAAC	22	
peg344-P	FAM-TCCACTGGCTTTCTGTCCTTTCCC-BHQ1	33	
incA-F	TTGTCGCTAAAGGGCTGATT	20	
incA-R	CACGCTCAGGGAGAATTTGA	20	
incA-P	VIC-ACCTCTTCCCGCTCGCTCTACT-BHQ1	31	
F: forward primer; R:reverse primer; P: probe; FAM-dT: thymidine nucleotide carrying fluorescein FAM; VIC-dT: thymidine nucleotide carrying fluorescein VIC; THF: tetra hydro furan spacer; BHQ1-dT: thymidine nucleotide carrying Black Hole Quencher 1, 3′-block.

2.4 Duplex real-time MIRA assay

Nine duplex real-time MIRA amplification groups were optimized using exo real-time MIRA kits (Amp-Future Biotech Co., Ltd., Weifang, China) and the CFX96 real-time PCR system (Bio-Rad, USA). The FAM and VIC two-channel method was employed with the primers and probes detailed in Table 3. Each reaction was conducted in a 50 μL final volume, containing 2 μL of DNA template, 29.4 μL of reaction buffer, 11.5 μL of water, 1 μL each of peg344-F and R primers (10 μM), 1 μL each of iucA-F and R primers (10 μM), 0.3 μL each of peg344 and iucA probes (10 μM), and 2.5 μL of 280 mM magnesium acetate. The mixture was vortexed briefly, centrifuged, and then analyzed in the CFX96 real-time PCR system to monitor fluorescence signals in real-time, with data collection every 30 s over 20 min (40 cycles).

2.5 Analytical sensitivity and specificity of the duplex real-time MIRA assay

The analytical sensitivity of the duplex real-time MIRA assay was assessed using a dilution series of purified DNA extracted from hvKP peg344 and iucA strains. Tenfold serial dilutions, ranging from 8 × 10⁶ to 8 × 102 CFU per reaction, served as templates for genomic DNA. To verify the specificity of the duplex real-time MIRA assay, genomic DNA samples (0.5–2.0 ng) from K. pneumoniae ATCC700603, Klebsiella oxyota ATCC700324, Escherichia coli ATCC25922, Enterobacter hoemaechei ATCC700323, Acinetobacter baumannii ATCC19666, Pseudomoas areuginosa ATCC27853, and Stenotrophomonas maltophilia ATCC17666 were tested for potential cross-reactivity. This experiment was repeated thrice.

2.6 Duplex real-time PCR assay

Duplex real-time PCR analysis was used as the reference standard for detecting hvKP, following established protocols with the specific primers and probes listed in Table 3. Sensitivity tests were conducted using diluted DNA samples subjected to a 40-cycle protocol, consisting of denaturation at 95 °C for 10 s and annealing/extension at 60 °C for 40 s. The reaction mixture included Tris-HCl buffer, hot start Taq enzyme, dNTPs, 18 μL of PCR mix, and 2 μL of DNA sample. A sample was considered positive if the threshold cycle (Ct value) was less than 35.

2.7 Evaluation of the duplex real-time MIRA assay using clinical spiked blood specimens

The duplex real-time MIRA assay's effectiveness in detecting hvKP was assessed using thirty-three clinical blood specimens spiked with pathogens, and its performance was compared to that of a duplex real-time PCR assay for hvKP detection.

3 Results

3.1 Optimal condition of duplex real-time MIRA

Selecting appropriate primers and probes is crucial for effective duplex real-time MIRA in pathogen detection. In this study, we tested nine primer pairs and one probe targeting the conserved regions of peg344 and iucA genes in hvKP. All combinations yielded positive signals, but primer pairs peg344-F1/R1 (Fig. S2a) and iucA-F3/R2 (Fig. S2b) exhibited the best performance in terms of amplification time and signal intensity. Therefore, peg344-F1/R1/P1 and iucA-F3/R2/P1 were chosen as the optimal sets for hvKP detection.

3.2 Specificity and sensitivity of duplex MIRA primers

The specificity of the duplex real-time MIRA assay was assessed using a panel of bacterial pathogens. Positive results were obtained exclusively with the hvKP peg344 and iucA strains, with no positives for non-hvKP peg344/iucA strains (Fig. 1). This confirms the assay's reliable specificity.Fig. 1 Specificity of the duplex real-time MIRA assay for the detection of hvKP. Partial results display that only the hvKP peg344 and iucA strain (NO. 1) produced amplification signals, whereas the other non-peg344/iucA strains and the negative control (NO. 2–9) did not produce any amplification signals. This experiment was repeated three times with consistent results.

Fig. 1

For sensitivity testing, genome copy dilutions ranging from approximately 8 × 10⁶ CFU to 8 × 102 CFU were used as templates for amplification with both duplex real-time MIRA (Fig. 2a) and duplex real-time PCR (Fig. 2b). The amplification curves demonstrated that the lowest detectable concentration of hvKP peg344 and iucA strain DNA for duplex real-time MIRA matched that of duplex real-time PCR, reaching 8 × 102 CFU per reaction.Fig. 2 Sensitivity of the duplex real-time MIRA and duplex real-time PCR. The analytical sensitivity of the duplex real-time MIRA assay was evaluated based on the quantity of genomic DNA from hvKP peg344 and iucA strains. Serial dilutions of targeted bacteria (at concentrations of 8 × 106 CFU, 8 × 105 CFU, 8 × 104 CFU, 8 × 103 CFU and 8 × 102 CFU per reaction) were tested using both duplex real-time MIRA at 39 °C with a setting of one cycle per 30 s for 20 min (40 cycles) for real-time monitoring of fluorescence signals (a) and duplex real-time PCR at 95 °C for 5 min followed by forty cycles of amplification at temperatures of 95 °C for 10 s and then at a temperature of 60 °C for 30 s (b). This experiment was repeated three times with identical conditions.

Fig. 2

3.3 Evaluation of duplex real-time MIRA assay using clinical specimens and comparison with duplex real-time PCR

We evaluated thirty-three clinical spiked blood specimens using the duplex real-time MIRA assay and compared the results with those from the reference duplex real-time PCR method. Seventeen specimens spiked with clinical hvKP peg344 and iucA were positive for hvKP, showing complete agreement with the duplex real-time PCR assay (Table 1). There were no significant differences between the detection results of the duplex real-time MIRA and duplex real-time PCR assays.

4 Discussion

Traditional molecular epidemiology methods are often inadequate for controlling the rapid spread of nosocomial infections during an hvKP outbreak. This highlights the need for a rapid, specific, and convenient diagnostic tool capable of detecting both hvKP and other bacterial species. Real-time MIRA, an emerging isothermal amplification method, offers advantages in time efficiency and cost reduction compared to other techniques [18,19]. Based on these findings, we anticipate that real-time MIRA can accurately identify hvKP as well as other non-hvKP bacterial species.

The genome sequences of hvKP obtained from NCBI exhibited significant genetic diversity despite their overall similarity [20]. Specific primers play a crucial role in molecular diagnostic methods, and previous studies have identified peg344 and iucA genes as suitable targets for hvKP detection. In this study, nine sets of duplex real-time MIRA primers and probes targeting peg344 and iucA genes were designed, respectively. After rigorous testing, the primer pairs peg344-F1/R1 and iucA-F3/R2 were selected for the duplex real-time MIRA assay due to their high specificity towards hvKP strains coharboring peg344 and iucA genes, without any cross-reactivity with non-peg344/iucA strains.

The analytical sensitivity of the hvKP peg344 and iucA assay was 8 × 102 CFU per reaction, consistent with that of the duplex real-time PCR assay. However, the novel duplex real-time MIRA assay offers fewer steps and faster processing while maintaining comparable sensitivity. We tested thirty-three clinical specimens with known pathogen concentrations using both assays, showing 100 % agreement between our duplex real-time MIRA and duplex real-time PCR, indicating its suitability for diagnosing hvKP in spiked blood specimens.

A limitation of this study is the small number and limited variety of clinical hvKP strains with peg344 or iucA used for validation. Increasing both the number and diversity of validation strains is crucial for ensuring accurate and reliable identification.

In conclusion, the duplex real-time MIRA assay demonstrates excellent specificity and sensitivity, making it a fast, straightforward, and dependable method for detecting hvKP, particularly in diagnostic laboratories with limited resources.

Funding

This study was financially supported by grants from the Chongqing Medical Scientific Research Project (Joint Project of Chongqing Health Commission and Science and Technology Bureau) (No.2024MSXM045 ) and the Chongqing Medical Scientific Research Project (Joint Project of Chongqing Health Commission and Science and Technology Bureau) (No.2022QNXM034 ).

Data availability statement

The data that support the findings of the study is available from the corresponding author on reasonable request.

Ethics tatement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the ethics committee of the Affiliated Dazu's Hospital of Chongqing Medical University (Approval No. 2023LLSC074).

Consent for publication

Not applicable.

CRediT authorship contribution statement

Zhixiong Duan: Software, Methodology, Formal analysis, Data curation, Conceptualization. Shan Wang: Project administration, Formal analysis. Niqi Xie: Project administration, Investigation. Junying Zhao: Resources, Project administration. Jian Dong: Validation, Supervision. Jin Li: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Methodology, Funding acquisition, Formal analysis, Data curation, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix A Supplementary data

The following is the Supplementary data to this article:Multimedia component 1

Multimedia component 1

Acknowledgements

We are grateful to the Department of Laboratory Medicine, Daping Hospital for providing the thirty-three clinical isolates.

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.heliyon.2024.e37050.
==== Refs
References

1 Brizendine K.D. Richter S.S. Cober E.D. van Duin D. Carbapenem-resistant Klebsiella pneumoniae urinary tract infection following solid organ transplantation Antimicrob. Agents Chemother. 59 1 2015 553 557 10.1128/AAC.04284-14 25385105
2 Clegg S. Murphy C.N. Epidemiology and virulence of Klebsiella pneumoniae Microbiol. Spectr. 4 1 2016 10.1128/microbiolspec.UTI-0005-2012
3 Hussain I. Ishrat S. Ho D. Khan S.R. Veeraraghavan M.A. Palraj B.R. Molton J.S. Abid M.B. Endogenous endophthalmitis in Klebsiella pneumoniae pyogenic liver abscess: systematic review and meta-analysis Int. J. Infect. Dis. 101 2020 259 268 10.1016/j.ijid.2020.09.1485 33035676
4 Siu L.K. Yeh K.M. Lin J.C. Fung C.P. Chang F.Y. Klebsiella pneumoniae liver abscess: a new invasive syndrome Lancet Infect. Dis. 12 11 2012 881 887 10.1016/S1473-3099(12)70205-0 23099082
5 Russo T.A. Marr C.M. Hypervirulent Klebsiella pneumoniae Clin. Microbiol. Rev. 32 3 2019 10.1128/CMR.00001-19
6 Chen D. Zhang Y. Wu J. Li J. Chen H. Zhang X. Hu X. Chen F. Yu R. Analysis of hypervirulent Klebsiella pneumoniae and classic Klebsiella pneumoniae infections in a Chinese hospital J. Appl. Microbiol. 132 5 2022 3883 3890 10.1111/jam.15476 35129244
7 Chew K.L. Lin R. Teo J. Klebsiella pneumoniae in Singapore: hypervirulent infections and the carbapenemase threat Front. Cell. Infect. Microbiol. 7 2017 515 10.3389/fcimb.2017.00515 29312894
8 Cubero M. Grau I. Tubau F. Pallarés R. Dominguez M.A. Liñares J. Ardanuy C. Hypervirulent Klebsiella pneumoniae clones causing bacteraemia in adults in a teaching hospital in Barcelona, Spain (2007-2013) Clin. Microbiol. Infect. 22 2 2016 154 160 10.1016/j.cmi.2015.09.025 26454059
9 Jin X. Chen Q. Shen F. Jiang Y. Wu X. Hua X. Fu Y. Yu Y. Resistance evolution of hypervirulent carbapenem-resistant Klebsiella pneumoniae ST11 during treatment with tigecycline and polymyxin Emerg. Microb. Infect. 10 1 2021 1129 1136 10.1080/22221751.2021.1937327
10 Lan P. Jiang Y. Zhou J. Yu Y. A global perspective on the convergence of hypervirulence and carbapenem resistance in Klebsiella pneumoniae J Glob Antimicrob Resist 25 2021 26 34 10.1016/j.jgar.2021.02.020 33667703
11 Tian D. Liu X. Chen W. Zhou Y. Hu D. Wang W. Wu J. Mu Q. Jiang X. Prevalence of hypervirulent and carbapenem-resistant Klebsiella pneumoniae under divergent evolutionary patterns Emerg. Microb. Infect. 11 1 2022 1936 1949 10.1080/22221751.2022.2103454
12 Alharbi M.T. Almuhayawi M.S. Nagshabandi M.K. Tarabulsi M.K. Alruhaili M.H. Gattan H.S. Al Jaouni S.K. Selim S. Alanazi A. Alruwaili Y. Antimicrobial resistance pattern, pathogenicity and molecular properties of hypervirulent Klebsiella pneumonia (hvKp) among hospital-acquired infections in the intensive Care unit (ICU) Microorganisms 11 3 2023 10.3390/microorganisms11030661
13 Du F.L. Huang Q.S. Wei D.D. Mei Y.F. Long D. Liao W.J. Wan L.G. Liu Y. Zhang W. Prevalence of carbapenem-resistant Klebsiella pneumoniae Co-harboring blaKPC-carrying plasmid and pLVPK-like virulence plasmid in bloodstream infections Front. Cell. Infect. Microbiol. 10 2020 556654 10.3389/fcimb.2020.556654
14 Liao W. Long D. Huang Q. Wei D. Liu X. Wan L. Feng Y. Zhang W. Liu Y. Rapid detection to differentiate hypervirulent Klebsiella pneumoniae (hvKp) from classical K. pneumoniae by identifying peg-344 with loop-mediated isothermal amplication (LAMP) Front. Microbiol. 11 2020 1189 10.3389/fmicb.2020.01189 32655515
15 Heng P. Liu J. Song Z. Wu C. Yu X. He Y. Rapid detection of Staphylococcus aureus using a novel multienzyme isothermal rapid amplification technique Front. Microbiol. 13 2022 1027785 10.3389/fmicb.2022.1027785
16 Lai J. Huang Z. Xiao Y. Yu K. Bai X. Gao H. Dai H. Liu X. Wang D. Development and evaluation of duplex MIRA-qPCR assay for simultaneous detection of Staphylococcus aureus and non-aureus staphylococci Microorganisms 10 9 2022 10.3390/microorganisms10091734
17 Russo T.A. Olson R. Fang C.T. Stoesser N. Miller M. MacDonald U. Hutson A. Barker J.H. La Hoz R.M. Johnson J.R. Identification of biomarkers for differentiation of hypervirulent Klebsiella pneumoniae from classical K. pneumoniae J. Clin. Microbiol. 56 9 2018 10.1128/JCM.00776-18
18 Hu W.W. He J.W. Guo S.L. Li J. Development and evaluation of a rapid and sensitive multienzyme isothermal rapid amplification with a lateral flow dipstick assay for detection of Acinetobacter baumannii in spiked blood specimens Front. Cell. Infect. Microbiol. 12 2022 1010201 10.3389/fcimb.2022.1010201
19 Tu F. Yang X. Xu S. Chen D. Zhou L. Ge X. Han J. Zhang Y. Guo X. Yang H. Development of a fluorescent probe-based real-time reverse transcription recombinase-aided amplification assay for the rapid detection of classical swine fever virus Transbound Emerg Dis 68 4 2021 2017 2027 10.1111/tbed.13849 32979245
20 Yan C. Zhou Y. Du S. Du B. Zhao H. Feng Y. Xue G. Cui J. Gan L. Feng J. Recombinase-Aided amplification assay for rapid detection of hypervirulent Klebsiella pneumoniae (hvKp) and characterization of the hvKp pathotype Microbiol. Spectr. 11 2 2023 e0398422 10.1128/spectrum.03984-22
