
==== Front
Discov Oncol
Discov Oncol
Discover Oncology
2730-6011
Springer US New York

39278863
1317
10.1007/s12672-024-01317-1
Research
tRF-Leu reverse breast cancer cells chemoresistance by regulation of BIRC5
Sun Li 12
Jiao Yu-Wen 2
Cui Fu-Qi 3
Liu Jin 3
Xu Zhong-Ya xuzhya@njmu.edu.cn

4
Sun Dong-Lin 20225235066@stu.suda.edu.cn

1
1 grid.452253.7 0000 0004 1804 524X Hepatopancreatobiliary Surgery Department, The Third Affiliated Hospital of Soochow University, Changzhou First People’s Hospital, Changzhou, China
2 https://ror.org/04bkhy554 grid.430455.3 Department of General Surgery, The Affiliated Changzhou No. 2 People’s Hospital of Nanjing Medical University, Changzhou, China
3 https://ror.org/04c8eg608 grid.411971.b 0000 0000 9558 1426 Department Graduate School of Dalian Medical University, Dalian Medical University, Dalian, China
4 https://ror.org/04pge2a40 grid.452511.6 Children’s Hospital of Nanjing Medical University, Nanjing, China
15 9 2024
15 9 2024
12 2024
15 44926 2 2024
5 9 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
Objective

Accumulating studies reported the crucial roles of tRFs in tumorigenesis. However, their further mechanisms and clinical values remains unclear. This study aimed at the further investigation of tRF-Leu in breast cancer chemotherapy resistance.

Methods

The high-throughput sequencing was performed and identified the downregulation of tRF-Leu in MCF7/ADR cells. The function of tRF-Leu in breast cancer cells and breast cancer chemotherapy resistance was investigated in vitro and in vivo, including colony formation assay, CCK-8 assay, transwell assay and apoptosis assay. The binding site of tRF-Leu on BIRC5 was verified by dual-luciferase assay.

Results

tRF-Leu was downregulated in MCF7/ADR cells. Overexpression of tRF-Leu inhibited the migration of breast cancer cells. Furthermore, tRF-Leu could reverse the resistance of MCF7/ADR cells to Adriamycin both in vitro and in vivo. BIRC5 was a target of tRF-Leu, which might be involved in the chemotherapy resistance regulation.

Conclusion

We demonstrated that tRF-Leu could inhibit the chemotherapy resistance of breast cancer by targeting BIRC5. These findings might identify new biomarkers of breast cancer therapy and bring new strategies to reverse chemotherapy resistance.

Keywords

TRF
Chemotherapy resistance
BIRC5
Breast cancer
Changzhou Sci & Tech ProgramCJ20200058 Sun Li issue-copyright-statement© Springer Science+Business Media, LLC 2024
==== Body
pmcIntroduction

Breast cancer (BC) is the leading cause of cancer death for women around the world. According to the signature of gene expression pattern, breast cancer has been divided into different intrinsic subtypes, including luminal A, luminal B, HER2-enriched, basal-like and claudin-low [1, 2]. Regardless of the subtype, adjuvant systemic chemotherapy is commonly used in breast cancer treatments and has been shown to prolong survival in all subsets of patients [3, 4]. However, chemotherapy resistance is a major obstacle in the management of patients with breast cancer [5, 6]. Adriamycin, which is also known as doxorubicin, is one of the most common agents in breast cancer chemotherapy [7]. Recent studies have reported numbers of potential mechanisms in breast cancer doxorubicin resistance. Zhu et al. found that GATA3 is able to promote doxorubicin resistance by regulating iron metabolism and ferroptosis mediated by CYB5R2 [8]. Besides, in breast cancer, Zhao et al. reported that exosomal transfer of miR-181b-5p confers senescence-mediated doxorubicin resistance via modulating BCLAF1 [9]. Nevertheless, the mechanism of chemotherapy resistance is a complex multifactorial process, which still needs further investigation.

Transfer RNAs (tRNAs) are a major category of RNA molecules and performed essential functions in decoding messenger RNAs (mRNAs) sequences during protein synthesis [10, 11]. Recently, numbers of studies have demonstrated the close correlation between tRNAs and various physiological and pathological processes [12–14]. Nevertheless, accumulating evidence has reported tRNA-derived fragments (tRFs), which are produced by broken tRNAs, as an emerging class of possible biological marker and involve in tumor initiation and development [15]. Lu et al. has revealed that tRF-3022b modulates cell apoptosis and M2 macrophage polarization via binding to cytokines in colorectal cancer [16]. Besides, in cervical cancer, tRF-Glu49 was found to inhibit cell proliferation, migration and invasion by targeting FGL1 [17]. Zou et al. reported that tRF-3013b inhibited cell proliferation by targeting TPRG1L and repressed NF-κB in gallbladder cancer (GBC) [18]. Meanwhile, researchers also revealed the roles of tRFs in drug resistance. For example, Sun et al. found that tRF-30-JZOYJE22RR33 and tRF-27-ZDXPHO53KSN played essential roles in trastuzumab resistance [19]. However, the further mechanism is unclear.

In this study, we sequenced the tRFs and tiRNAs(tRNA halves) in wild-type MCF7 cells and Adriamycin resistant MCF7 cells (MCF7/ADR), and screened tRF-Leu-CAG (tRF-Leu) as our main character. In a previous study, tRF-Leu has been reported to be a risk factor in lung cancer and promotes cell proliferation and cell cycle process [20]. However, there is no study reporting the role of tRF-Leu in breast cancer, especially in breast cancer chemotherapy resistance. Thus, we further investigated the role and potential mechanism of tRF-Leu in breast cancer chemotherapy resistance, which might provide emerging strategies for breast cancer therapy.

Materials and methods

Clinical specimens

The clinical specimens from 12 breast cancer patients were collected from Changzhou Second People's Hospital. All patients had received anthracycline-containing neoadjuvant chemotherapy and were classified according to the Response Evaluation Criteria in Solid Tumors 1.1 (RECIST 1.1) published by the European Journal of Cancer. The specific evaluation criteria were as follows: CR (Complete Remission): all target lesions disappeared; PR (Partial Response):the sum of the major diameters of the baseline lesions reduced by more than 30%; SD (Stable Disease): the sum of the long diameters of the baseline lesions decreased but did not reach PR or increased but did not reach PD; PD (Progressive Disease): the sum of the long diameters of baseline lesions increased by more than 20% or new lesions appeared. Drug resistance group was defined as SD + PD (3 cases), while non-drug resistance group was defined as CR + PR (9 cases). All patients have provided written informed consent and approved by the ethics committee of Changzhou Second People's Hospital.

Cells and infection

The wild type of normal epithelial breast cancer cells MCF10A and breast cancer cells MCF7, T47D, MDA-231 and SKBR3 were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). The Adriamycin resistant MCF7 cells (MCF7/ADR) was constructed by culturing for six months in gradually increasing concentration gradient of Adriamycin, which concentration ultimately maintained at 0.5 μg/ml. The IC50 was monitored regularly to determine its resistance. MCF10A cells were cultured by DMEM/F12(1:1); MCF7, MCF7/ADR and MDA-231 cells were cultured by DMEM, while T47D and SKBR3 cells were cultured by 1640 medium. All cells were cultured in a 37 ℃ incubator with 5% CO2 atmosphere and treated with corresponding medium added with 10% FBS (Ausbian, Australia) and 1% penicillin/streptomycin (Solarbio, China).

The 5ʹ half tRNA sequence of tRF-Leu-CAG was identified as GTCAGGATGGCCGAGCGGTCTAAGGCGCTGCGTT, and its lentivirus of mimic was purchased from RiboBio (Shanghai, China). The cells in the logarithmic phase of growth were treated with empty medium and lentivirus at 1:1 ratio, as well as 2 μl polybrene (MCE, USA) for transfection. After 48 h, the infected cells were screened by corresponding antibiotics and the stable tRF-Leu overexpressed cell lines were used for following experiments.

RNA extraction and RT-qPCR

The total RNA from cells and tissues were extracted according to the manufacturer’s instructions of SPARK easy RNA Extraction Kit (Spark Jade, China). The cDNA synthesis was performed with One-Step gDNA Removal and cDNA Synthesis SuperMix (Transgene, China). miRNA RT-qPCR Starter kit (RiboBio, China) was used for qPCR for miRNA analysis. The relative quantification data of tRF‐Leu‐CAG was normalized by U6 expression levels, which was calculated using the following formulae: ΔCt = CttRF‐Leu‐CAG–CtU6 and ΔΔCt = ΔCtcase–ΔCtcontrol. The forward primer of tRF-Leu was set as GTCAGGATGGCCGAGCGGTCTAAGGCGC; and the primers of U6 were set as follows: Forward: CTCGCTTCGGCAGCACA; Reverse: AACGCTTCACGAATTTGCGT.

Cell proliferation assays

As for colony formation assay, the cells were planted into 6-well plates with 2 ml corresponding medium as the total number of 800 cells per well. After an appropriate period of incubation (usually 10–14 days), the cells were washed with PBS and fixed by 4% polyformaldehyde (Solarbio, China). Then the colonies were stained with crystal violet and followed by capturing and counting.

As for CCK-8 assay, the cells were planted into 96-well plates with 200 μl corresponding medium as the total number of 2000 cells per well. The CCK-8 Assay Kit (Transgene, China) was used according to the manufacturer’s protocol. In brief, the cells were added with CCK-8 solution and incubated for another 2 h, then the absorbances were measured by a microplate reader (Bio‐Rad, USA). This process was repeated at the same time for 5 consecutive days, and the proliferation curves were plotted according to the data.

Transwell assay

The cells were planted into upper chambers with 400 μl corresponding normal medium as the total number of 4*104 cells per chamber, which were placed in 24-well plates with 600 μl 20% FBS medium. The systems were incubated for a suitable period of time (usually 14–16 h) until observed microscopically that there were cells passing to the lower chamber. Then the upper chambers were fixed and stained by 3-step Stain Kit (Thermo, USA). The images were captured and analyzed by a bright microscope (Olympus, Japan).

Apoptosis analysis

The cells were digested and washed by pre-cold PBS. Then the cells were incubated with FITC Annexin V in a buffer containing propidium iodide (PI) for 15 min in dark according to the manufacturer’s instructions of FITC Annexin V Apoptosis Detection Kit I (BD Pharmingen, USA) and analyzed by a flow cytometer (BD Biosciences, USA).

Xenograft

The stable tRF-Leu-CAG overexpressed cells and its corresponding control cells were subcutaneously injected into 5-week-old severe immune deficiency (SCID) mice at the density of 8 × 106 cells. All mice were single loaded, and each group contains 5 mice. The tumor volumes were measured every 5 days. When the tumors reached appropriate size, the mice were euthanized by cervical dislocation after anesthetized (60 mg/kg ketamine and 5.0 mg/kg xylazine), and the final volume were determined. All animal experiments were conducted followed the principles of The International Council for Laboratory Animal Science (ICLAS). All tumor burdens were less than 5% of the mice’s body weight and had a maximum diameter of less than 1.5 cm, which has been approved by the ethics committee of Changzhou Second People's Hospital.

Western blot

The total protein was isolated from cells utilizing RIPA lysis buffer (Solarbio, China) with 1% PMSF (Solarbio, China). The proteins were separated by an SDS-PAGE gel synthesized by epizyme (Shanghai, China) and transferred onto a PVDF membrane (Millipore, USA). The separated proteins were treated with primary and secondary antibodies, and visualized by ECL reagent (Millipore, USA). All antibodies were purchased from Cell Signaling Technology (USA), including β-actin (#4967), Survivin (#2808), rabbit secondary antibody (#7074).

Dual-luciferase reporter assay

The wild-type and mutant-type of BRIC5 3ʹUTR regions were inserted into PGL3-basic plasmid (Promega, USA), following by co-transfected into control or tRF-Leu overexpressed breast cancer cells with PRL-TK plasmid (Promega, USA). After 48 h incubation, the cells were collected and the luciferase activities were detected according to the instruction of a dual-luciferase assay kit (Promega, USA), which results were normalized by the luciferase activity of Renilla and had been performed in triplicate.

Statistical analysis

The statistical analysis was performed by Prism v.8.0 (CA). All data were presented as mean ± standard deviation (SD) and conducted with Student’s t-test. The statistical significance was set as p < 0.05.

Results

tRF-Leu was downregulated in chemotherapy resistant breast cancer

To identify the differentially expressed tRFs and tiRNAs between MCF7 cells and MCF7/ADR cells, the high-throughput sequencing was performed and obtained 87 differentially expressed tRFs and tiRNAs (Fig. 1A). According to the comprehensive ranking results, tRF-34-SP5830MMUKLYHE (tRF-Leu-CAG) was the most significant difference in expression (Fig. 1B), among which, 24 were upregulated and 63 were downregulated (Fig. 1C). Then, the expression level of tRF-Leu was detected in normal breast cell line and breast cancer cell lines by RT-qPCR, which results showed that the expression of tRF-Leu had a slight decrease in MCF7 cells and T47D cells compared to MCF10A cells, while the expression differences with MDA-231 cells and SKBR3 cells were not statistically significant (Fig. 1D). However, compared with wild-type MCF7 cells, tRF-Leu was dramatically downregulated in MCF7/ADR cells (Fig. 1E). To evaluate this phenomenon clinically, the specimen from 12 breast cancer patients, who had received treatment with anthracycline-containing neoadjuvant chemotherapy, were collected and classified to chemotherapy resistant group (3 cases) and chemotherapy sensitive group (9 cases) according to the RECIST criteria. The expression levels of tRF-Leu from tissues were detected by RT-qPCR and showed that patients with chemotherapy resistance exhibited lower tRF-Leu expression (Fig. 1F). These findings indicated that tRF-Leu was significantly decreased in chemotherapy resistant cells and tissues.Fig. 1 tRF-Leu was downregulated in chemotherapy resistant breast cancer. A The Heatmap of high-throughput sequencing for tRFs and tiRNAs between MCF7 cells and MCF7/ADR cells. B The comprehensive ranking of high-throughput sequencing for tRFs and tiRNAs. C The difference of tsRNA profiles. D The expression levels of tRF-Leu in normal breast cells and breast cancer cell lines detected by RT-qPCR. E The expression levels of tRF-Leu in MCF7 cells and MCF7/ADR cells detected by RT-qPCR. F The expression levels of tRF-Leu in breast cancer tissues detected by RT-qPCR. *p < 0.05

tRF-Leu inhibit migration of breast cancer cells

For further investigate the functions of tRF-Leu in breast cancer, the mimic of tRF-Leu was infected into MCF7 cells and MDA-231 cells, which had been verified by RT-qPCR (Fig. 2A). Colony formation assay was performed and showed that the overexpression of tRF-Leu has no effect on the number of colonies (Fig. 2B) and cell viability (Fig. 2C). Furthermore, tRF-Leu overexpression did not affect the percentage of EdU-positive cells (Fig. 2D). However, the results of transwell assay showed that the number of migrated cells was dramatically decreased in tRF-Leu overexpressed MCF7 cells and MDA-231 cells compared to their corresponding control groups (Fig. 2E). These results indicated that tRF-Leu seems have no effect on cell proliferation but can inhibit migration of breast cancer cells.Fig. 2 tRF-Leu inhibit migration of breast cancer cells. A Construction of tRF-Leu overexpressed MCF7 cells and MDA-231 cells verified by RT-qPCR. B–D The effect of tRF-Leu overexpression on breast cancer cell proliferation were determined by colony formation (B), CCK-8 (C) and EdU (D) assays. E The migration of breast cancer cells with or without tRF-Leu overexpression was detected by transwell assay. *p < 0.05

tRF-Leu enhanced the chemotherapy sensitivity of breast cancer

Based on our previous findings, tRF-Leu was downregulated in MCF7/ADR cells. To investigate the function of tRF-Leu on chemotherapy sensitivity, we infected tRF-Leu mimic into MCF7/ADR cells and verified by RT-qPCR (Fig. 3A). Cells were treated with effective concentration of Adriamycin. Colony formation assay showed that overexpression of tRF-Leu significantly decreased the colony numbers of MCF7/ADR cells (Fig. 3B). Compared to control group, tRF-Leu overexpressed MCF7/ADR group exhibited a flatter proliferation curve in CCK-8 assay (Fig. 3C). Besides, cell apoptosis analysis indicated that overexpression of tRF-Leu led to more apoptosis after treatment of Adriamycin (Fig. 3D). In addition, MCF7/ADR cells and tRF-Leu overexpressed MCF7/ADR cells were injected into the mammary fat pads of mice. When tumor volume reached ~ 80 mm3, the mice were subsequently treated with doxorubicin and harvested after 35 days of feeding, which result showed that tRF-Leu enhanced breast cancer cell chemosensitivity in vivo (Fig. 3E). These findings demonstrated that tRF-Leu could reverse the resistance of MCF7/ADR cells to Adriamycin.Fig. 3 tRF-Leu enhanced the chemotherapy sensitivity of breast cancer. A Construction of tRF-Leu overexpressed MCF7 cells and MCF7/ADR cells verified by RT-qPCR. B–D The effect of tRF-Leu expression on breast cancer chemosensitivity were determined by colony formation (B), CCK-8 (C) assays. D The cell apoptosis ratio was detected by cytometry analysis. E The representative images and tumor growh curve of orthotopic tumors in mice. *p < 0.05

BRIC5 was a direct target of tRF-Leu

Next, we further explored the mechanism of tRF-Leu in breast cancer chemotherapy resistance. The result of nuclear cytoplasmic separated RT-qPCR showed that tRF-Leu was mainly located at cytoplasmic (Fig. 4A). Then the Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis indicated that tRF-Leu related genes were primarily enriched in metabolic pathway (Fig. 4B). The mRNA sequencing was performed to screen upregulated and downregulated genes based on the mRNA of MCF7 and MCF7/ADR cells, which indicated that BRIC5 (Survivin) was involved in Adriamycin resistance (Fig. 4C). At the same time, the potential binding site of tRF-Leu on BRIC5 3ʹUTR region was predicted by Targer Scan website (Fig. 4D). Dual-luciferase reporter assay was conducted to verify the occupy of tRF-Leu on BIRC5 3ʹUTR region (Fig. 4E). Besides, RT-qPCR results showed that overexpression of tRF-Leu decreased the mRNA level of BIRC5 (Fig. 4F). The results of Western blot showed that BIRC5 was significantly downregulated in MCF7/ADR cells compared to MCF7 cells, while overexpression of tRF-Leu in MCF7/ADR cells decreased the expression of BRIC5 dramatically (Fig. 4G). These results showed that the chemotherapy resistance related gene BIRC5, was a direct target of tRF-Leu.Fig. 4 BRIC5 was a direct target of tRF-Leu. A The location of tRF-Leu was detected by nuclear cytoplasmic separated RT-qPCR. The KEGG analysis was performed to enrich tRF-Leu related pathways. B The volcano map of differentially expressed genes identified by mRNA sequencing. D The potential binding site of tRF-Leu on BIRC5 3ʹUTR region predicted by Target Scan website. E The regulation of tRF-Leu on BIRC5 was detected by dual-luciferase reporter assay. The expression correlation between tRF-Leu and BIRC5 was detected by F RT-qPCR and G Western blot. *p < 0.05

Discussion

Increasing evidence has demonstrated the essential roles of small non‐coding RNAs (sncRNAs) in multiple human diseases, especially in cancer process [21–23]. tRFs are a class of non-coding single stranded RNAs with 14–35 nt in length, which is used to be considered as one kind of special miRNAs [24]. However, after decades of research, tRFs are found to be a type of cleavage product from tRNAs, who behave differently from miRNAs [25, 26]. Nevertheless, the studies on tRFs are few and limited, and their function in cancer progression and drug resistance is still unknown.

In this study, we sequenced the differential expressed tRFs & tiRNAs in MCF7 cells and MCF7/ADR cells, which result showed that tRF-Leu-CAG was significantly downregulated in MCF7/ADR cells. Besides, the results of in vitro cell experiments and in vivo animal experiments showed that tRF-Leu-CAG could enhance the sensitivity of breast cancer cells to Adriamycin. Adriamycin is a DNA topoisomerase II inhibitor and is a family member of anthracycline anticancer drugs, which is considered as one of the most effective chemotherapeutic drugs in breast cancer therapy currently [27, 28]. However, growing resistance to Adriamycin could lead to treatment failure and poor outcome [29]. Thus, our study uncovered the molecular mechanisms between tRF-Leu-CAG and Adriamycin resistance, which was identified as a novel biomarker that can predict treatment response and overcome Adriamycin resistance.

Survivin, which is also known as BIRC5, belongs to the family of the inhibitor-of-apoptosis proteins (IAPs) [30]. IAPs are discovered firstly in 1997 and are found to be involved in tumor cell differentiation, proliferation, invasion, and metastasis [31]. Currently, Survivin is commonly considered as a dual cellular functions protein that directly regulates both apoptosis and mitosis in embryonic cells during embryogenesis and in cancer cells during tumorigenesis and tumor metastasis [32]. Recently, increasing studies have reported the role of Survivin in chemotherapy resistance [33]. Gabriela et al. reported that overexpression of Survivin contributes to the development of drug-resistance and is associated with poor clinical outcome in breast cancer patients [34]. Oh et al. demonstrated that silencing of glucose transporter (Glut) protein 1 induces chemoresistance via modulation of Akt/GSK-3β/β-catenin/survivin signaling pathway in breast cancer cells [35]. Recently, BIRC5 was served the target of miR-494, and HIF-1α inhibitor PX-478 increased the sensitivity of triple-negative breast cancer to Docetaxel by suppressing the HIF-1α/miR-494/Survivin signaling pathway in vivo [36]. In our study, we identified BIRC5 as the direct target of tRF-Leu and verified using dual-luciferase reporter assay. Besides, BIRC5 was upregulated in MCF7/ADR cells, while overexpression of tRF-Leu significantly decreased the expression level of BIRC5. Thus, we speculated that tRF-Leu inhibited breast cancer chemotherapy resistance by targeting BIRC5. However, the further mechanism still needs investigation and verification.

Conclusion

In summary, we demonstrated the role and potential mechanism of tRF-Leu in breast cancer chemotherapy resistance, which might serve as an emerging biomarker for breast cancer therapy.

Acknowledgements

None.

Author contributions

SL, XZY and SDL designed the study; SL, JYW, CFQ, and LJ performed the experiments and statistical analysis; SL, XZY and SDL wrote and revised the manuscript. All authors read and approved the final manuscript.

Funding

This study was supported by the Changzhou Sci & Tech Program (CJ20200058).

Data availability 

Data is provided within the manuscript or supplementary information files.

Declarations

Ethics approval and consent to participate

All methods were carried out in accordance with relevant guidelines and regulations. All patients have provided written informed consent and approved by the ethics committee of Changzhou Second People's Hospital. All animal experiments were conducted followed the principles of The International Council for Laboratory Animal Science (ICLAS). All tumor burdens were less than 5% of the mice’s body weight and had a maximum diameter of less than 1.5 cm, which has been approved by the ethics committee of Changzhou Second People's Hospital.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Li Sun and Yu-Wen Jiao are contributed equally to this work.
==== Refs
References

1. Prat A Pineda E Adamo B Galvan P Fernandez A Gaba L Clinical implications of the intrinsic molecular subtypes of breast cancer Breast 2015 24 Suppl 2 S26 S35 10.1016/j.breast.2015.07.008 26253814
Prat A, Pineda E, Adamo B, Galvan P, Fernandez A, Gaba L, et al. Clinical implications of the intrinsic molecular subtypes of breast cancer. Breast. 2015;24(Suppl 2):S26–35.26253814 10.1016/j.breast.2015.07.008
2. Yu F Quan F Xu J Zhang Y Xie Y Zhang J Breast cancer prognosis signature: linking risk stratification to disease subtypes Brief Bioinform 2019 20 6 2130 2140 10.1093/bib/bby073 30184043
Yu F, Quan F, Xu J, Zhang Y, Xie Y, Zhang J, et al. Breast cancer prognosis signature: linking risk stratification to disease subtypes. Brief Bioinform. 2019;20(6):2130–40.30184043 10.1093/bib/bby073
3. Waks AG Winer EP Breast cancer treatment: a review JAMA 2019 321 3 288 300 10.1001/jama.2018.19323 30667505
Waks AG, Winer EP. Breast cancer treatment: a review. JAMA. 2019;321(3):288–300.30667505 10.1001/jama.2018.19323
4. Ponde NF Zardavas D Piccart M Progress in adjuvant systemic therapy for breast cancer Nat Rev Clin Oncol 2019 16 1 27 44 10.1038/s41571-018-0089-9 30206303
Ponde NF, Zardavas D, Piccart M. Progress in adjuvant systemic therapy for breast cancer. Nat Rev Clin Oncol. 2019;16(1):27–44.30206303 10.1038/s41571-018-0089-9
5. Rivera E Gomez H Chemotherapy resistance in metastatic breast cancer: the evolving role of ixabepilone Breast Cancer Res 2010 12 Suppl2 2 10.1186/bcr2573
Rivera E, Gomez H. Chemotherapy resistance in metastatic breast cancer: the evolving role of ixabepilone. Breast Cancer Res. 2010;12(Suppl2):2.10.1186/bcr2573
6. Coley HM Mechanisms and strategies to overcome chemotherapy resistance in metastatic breast cancer Cancer Treat Rev 2008 34 4 378 390 10.1016/j.ctrv.2008.01.007 18367336
Coley HM. Mechanisms and strategies to overcome chemotherapy resistance in metastatic breast cancer. Cancer Treat Rev. 2008;34(4):378–90.18367336 10.1016/j.ctrv.2008.01.007
7. Monteran L Ershaid N Doron H Zait Y Scharff Y Ben-Yosef S Chemotherapy-induced complement signaling modulates immunosuppression and metastatic relapse in breast cancer Nat Commun 2022 13 1 5797 10.1038/s41467-022-33598-x 36184683
Monteran L, Ershaid N, Doron H, Zait Y, Scharff Y, Ben-Yosef S, et al. Chemotherapy-induced complement signaling modulates immunosuppression and metastatic relapse in breast cancer. Nat Commun. 2022;13(1):5797.36184683 10.1038/s41467-022-33598-x
8. Zhu Z Shen H Xu J Fang Z Wo G Ma Y GATA3 mediates doxorubicin resistance by inhibiting CYB5R2-catalyzed iron reduction in breast cancer cells Drug Resist Updat 2023 69 100974 10.1016/j.drup.2023.100974 37230023
Zhu Z, Shen H, Xu J, Fang Z, Wo G, Ma Y, et al. GATA3 mediates doxorubicin resistance by inhibiting CYB5R2-catalyzed iron reduction in breast cancer cells. Drug Resist Updat. 2023;69: 100974.37230023 10.1016/j.drup.2023.100974
9. Zhao S Pan T Deng J Cao L Vicencio JM Liu J Exosomal transfer of miR-181b-5p confers senescence-mediated doxorubicin resistance via modulating BCLAF1 in breast cancer Br J Cancer 2023 128 4 665 677 10.1038/s41416-022-02077-x 36522479
Zhao S, Pan T, Deng J, Cao L, Vicencio JM, Liu J, et al. Exosomal transfer of miR-181b-5p confers senescence-mediated doxorubicin resistance via modulating BCLAF1 in breast cancer. Br J Cancer. 2023;128(4):665–77.36522479 10.1038/s41416-022-02077-x
10. Chery M Drouard L Plant tRNA functions beyond their major role in translation J Exp Bot 2023 74 7 2352 2363 10.1093/jxb/erac483 36480695
Chery M, Drouard L. Plant tRNA functions beyond their major role in translation. J Exp Bot. 2023;74(7):2352–63.36480695 10.1093/jxb/erac483
11. Phizicky EM Hopper AK tRNA biology charges to the front Genes Dev 2010 24 17 1832 1860 10.1101/gad.1956510 20810645
Phizicky EM, Hopper AK. tRNA biology charges to the front. Genes Dev. 2010;24(17):1832–60.20810645 10.1101/gad.1956510
12. Wang L Lin S Emerging functions of tRNA modifications in mRNA translation and diseases J Genet Genomics 2023 50 4 223 232 10.1016/j.jgg.2022.10.002 36309201
Wang L, Lin S. Emerging functions of tRNA modifications in mRNA translation and diseases. J Genet Genomics. 2023;50(4):223–32.36309201 10.1016/j.jgg.2022.10.002
13. Nie A Sun B Fu Z Yu D Roles of aminoacyl-tRNA synthetases in immune regulation and immune diseases Cell Death Dis 2019 10 12 901 10.1038/s41419-019-2145-5 31780718
Nie A, Sun B, Fu Z, Yu D. Roles of aminoacyl-tRNA synthetases in immune regulation and immune diseases. Cell Death Dis. 2019;10(12):901.31780718 10.1038/s41419-019-2145-5
14. Zhou Z Sun B Yu D Bian M Roles of tRNA metabolism in aging and lifespan Cell Death Dis 2021 12 6 548 10.1038/s41419-021-03838-x 34039958
Zhou Z, Sun B, Yu D, Bian M. Roles of tRNA metabolism in aging and lifespan. Cell Death Dis. 2021;12(6):548.34039958 10.1038/s41419-021-03838-x
15. Gu X Zhang Y Qin X Ma S Huang Y Ju S Transfer RNA-derived small RNA: an emerging small non-coding RNA with key roles in cancer Exp Hematol Oncol 2022 11 1 35 10.1186/s40164-022-00290-1 35658952
Gu X, Zhang Y, Qin X, Ma S, Huang Y, Ju S. Transfer RNA-derived small RNA: an emerging small non-coding RNA with key roles in cancer. Exp Hematol Oncol. 2022;11(1):35.35658952 10.1186/s40164-022-00290-1
16. Lu S Wei X Tao L Dong D Hu W Zhang Q A novel tRNA-derived fragment tRF-3022b modulates cell apoptosis and M2 macrophage polarization via binding to cytokines in colorectal cancer J Hematol Oncol 2022 15 1 176 10.1186/s13045-022-01388-z 36527118
Lu S, Wei X, Tao L, Dong D, Hu W, Zhang Q, et al. A novel tRNA-derived fragment tRF-3022b modulates cell apoptosis and M2 macrophage polarization via binding to cytokines in colorectal cancer. J Hematol Oncol. 2022;15(1):176.36527118 10.1186/s13045-022-01388-z
17. Wang Y Xia W Shen F Zhou J Gu Y Chen Y tRNA-derived fragment tRF-Glu49 inhibits cell proliferation, migration and invasion in cervical cancer by targeting FGL1 Oncol Lett 2022 24 4 334 10.3892/ol.2022.13455 36039056
Wang Y, Xia W, Shen F, Zhou J, Gu Y, Chen Y. tRNA-derived fragment tRF-Glu49 inhibits cell proliferation, migration and invasion in cervical cancer by targeting FGL1. Oncol Lett. 2022;24(4):334.36039056 10.3892/ol.2022.13455
18. Zou L Yang Y Zhou B Li W Liu K Li G tRF-3013b inhibits gallbladder cancer proliferation by targeting TPRG1L Cell Mol Biol Lett 2022 27 1 99 10.1186/s11658-022-00398-6 36401185
Zou L, Yang Y, Zhou B, Li W, Liu K, Li G, et al. tRF-3013b inhibits gallbladder cancer proliferation by targeting TPRG1L. Cell Mol Biol Lett. 2022;27(1):99.36401185 10.1186/s11658-022-00398-6
19. Sun C Yang F Zhang Y Chu J Wang J Wang Y tRNA-derived fragments as novel predictive biomarkers for trastuzumab-resistant breast cancer Cell Physiol Biochem 2018 49 2 419 431 10.1159/000492977 30153663
Sun C, Yang F, Zhang Y, Chu J, Wang J, Wang Y, et al. tRNA-derived fragments as novel predictive biomarkers for trastuzumab-resistant breast cancer. Cell Physiol Biochem. 2018;49(2):419–31.30153663 10.1159/000492977
20. Shao Y Sun Q Liu X Wang P Wu R Ma Z tRF-Leu-CAG promotes cell proliferation and cell cycle in non-small cell lung cancer Chem Biol Drug Des 2017 90 5 730 738 10.1111/cbdd.12994 28378898
Shao Y, Sun Q, Liu X, Wang P, Wu R, Ma Z. tRF-Leu-CAG promotes cell proliferation and cell cycle in non-small cell lung cancer. Chem Biol Drug Des. 2017;90(5):730–8.28378898 10.1111/cbdd.12994
21. Toden S Zumwalt TJ Goel A Non-coding RNAs and potential therapeutic targeting in cancer Biochim Biophys Acta Rev Cancer 2021 1875 1 188491 10.1016/j.bbcan.2020.188491 33316377
Toden S, Zumwalt TJ, Goel A. Non-coding RNAs and potential therapeutic targeting in cancer. Biochim Biophys Acta Rev Cancer. 2021;1875(1): 188491.33316377 10.1016/j.bbcan.2020.188491
22. Balatti V Nigita G Veneziano D Drusco A Stein GS Messier TL tsRNA signatures in cancer Proc Natl Acad Sci USA 2017 114 30 8071 8076 10.1073/pnas.1706908114 28696308
Balatti V, Nigita G, Veneziano D, Drusco A, Stein GS, Messier TL, et al. tsRNA signatures in cancer. Proc Natl Acad Sci USA. 2017;114(30):8071–6.28696308 10.1073/pnas.1706908114
23. Saw PE Xu X Chen J Song EW Non-coding RNAs: the new central dogma of cancer biology Sci China Life Sci 2021 64 1 22 50 10.1007/s11427-020-1700-9 32930921
Saw PE, Xu X, Chen J, Song EW. Non-coding RNAs: the new central dogma of cancer biology. Sci China Life Sci. 2021;64(1):22–50.32930921 10.1007/s11427-020-1700-9
24. Giege R Frugier M Rudinger J tRNA mimics Curr Opin Struct Biol 1998 8 3 286 293 10.1016/S0959-440X(98)80060-2 9666323
Giege R, Frugier M, Rudinger J. tRNA mimics. Curr Opin Struct Biol. 1998;8(3):286–93.9666323 10.1016/S0959-440X(98)80060-2
25. Pekarsky Y Balatti V Croce CM tRNA-derived fragments (tRFs) in cancer J Cell Commun Signal 2023 17 1 47 54 10.1007/s12079-022-00690-2 36036848
Pekarsky Y, Balatti V, Croce CM. tRNA-derived fragments (tRFs) in cancer. J Cell Commun Signal. 2023;17(1):47–54.36036848 10.1007/s12079-022-00690-2
26. Venkatesh T Suresh PS Tsutsumi R tRFs: miRNAs in disguise Gene 2016 579 2 133 138 10.1016/j.gene.2015.12.058 26743126
Venkatesh T, Suresh PS, Tsutsumi R. tRFs: miRNAs in disguise. Gene. 2016;579(2):133–8.26743126 10.1016/j.gene.2015.12.058
27. Chen Y Jia Y Mao M Gu Y Xu C Yang J PLAC8 promotes adriamycin resistance via blocking autophagy in breast cancer J Cell Mol Med 2021 25 14 6948 6962 10.1111/jcmm.16706 34117724
Chen Y, Jia Y, Mao M, Gu Y, Xu C, Yang J, et al. PLAC8 promotes adriamycin resistance via blocking autophagy in breast cancer. J Cell Mol Med. 2021;25(14):6948–62.34117724 10.1111/jcmm.16706
28. Gundersen S Kvinnsland S Klepp O Lund E Host H Weekly Adriamycin vs. 4-epidoxorubicin every second week in advanced breast cancer. A randomized trial. The Norwegian Breast Cancer Group Eur J Cancer 1990 26 1 45 48 10.1016/0277-5379(90)90255-R 2138477
Gundersen S, Kvinnsland S, Klepp O, Lund E, Host H. Weekly Adriamycin vs. 4-epidoxorubicin every second week in advanced breast cancer. A randomized trial. The Norwegian Breast Cancer Group. Eur J Cancer. 1990;26(1):45–8.2138477 10.1016/0277-5379(90)90255-R
29. Fu S Li G Zang W Zhou X Shi K Zhai Y Pure drug nano-assemblies: a facile carrier-free nanoplatform for efficient cancer therapy Acta Pharm Sin B 2022 12 1 92 106 10.1016/j.apsb.2021.08.012 35127374
Fu S, Li G, Zang W, Zhou X, Shi K, Zhai Y. Pure drug nano-assemblies: a facile carrier-free nanoplatform for efficient cancer therapy. Acta Pharm Sin B. 2022;12(1):92–106.35127374 10.1016/j.apsb.2021.08.012
30. Li F Aljahdali I Ling X Cancer therapeutics using survivin BIRC5 as a target: what can we do after over two decades of study? J Exp Clin Cancer Res 2019 38 1 368 10.1186/s13046-019-1362-1 31439015
Li F, Aljahdali I, Ling X. Cancer therapeutics using survivin BIRC5 as a target: what can we do after over two decades of study? J Exp Clin Cancer Res. 2019;38(1):368.31439015 10.1186/s13046-019-1362-1
31. Martinez-Sifuentes MA Bassol-Mayagoitia S Nava-Hernandez MP Ruiz-Flores P Ramos-Trevino J Haro-Santa CJ Survivin in breast cancer: a review Genet Test Mol Biomarkers 2022 26 9 411 421 10.1089/gtmb.2021.0286 36166738
Martinez-Sifuentes MA, Bassol-Mayagoitia S, Nava-Hernandez MP, Ruiz-Flores P, Ramos-Trevino J, Haro-Santa CJ, et al. Survivin in breast cancer: a review. Genet Test Mol Biomarkers. 2022;26(9):411–21.36166738 10.1089/gtmb.2021.0286
32. Lin TY Chan HH Chen SH Sarvagalla S Chen PS Coumar MS BIRC5/survivin is a novel ATG12-ATG5 conjugate interactor and an autophagy-induced DNA damage suppressor in human cancer and mouse embryonic fibroblast cells Autophagy 2020 16 7 1296 1313 10.1080/15548627.2019.1671643 31612776
Lin TY, Chan HH, Chen SH, Sarvagalla S, Chen PS, Coumar MS, et al. BIRC5/survivin is a novel ATG12-ATG5 conjugate interactor and an autophagy-induced DNA damage suppressor in human cancer and mouse embryonic fibroblast cells. Autophagy. 2020;16(7):1296–313.31612776 10.1080/15548627.2019.1671643
33. Albadari N Li W Survivin small molecules inhibitors: recent advances and challenges Molecules 2023 28 3 1376 10.3390/molecules28031376 36771042
Albadari N, Li W. Survivin small molecules inhibitors: recent advances and challenges. Molecules. 2023;28(3):1376.36771042 10.3390/molecules28031376
34. Nestal DMG Delbue D Silva KL Robaina MC Khongkow P Gomes AR FOXM1 targets XIAP and survivin to modulate breast cancer survival and chemoresistance Cell Signal 2015 27 12 2496 2505 10.1016/j.cellsig.2015.09.013 26404623
Nestal DMG, Delbue D, Silva KL, Robaina MC, Khongkow P, Gomes AR, et al. FOXM1 targets XIAP and survivin to modulate breast cancer survival and chemoresistance. Cell Signal. 2015;27(12):2496–505.26404623 10.1016/j.cellsig.2015.09.013
35. Oh S Kim H Nam K Shin I Silencing of Glut1 induces chemoresistance via modulation of Akt/GSK-3beta/beta-catenin/survivin signaling pathway in breast cancer cells Arch Biochem Biophys 2017 636 110 122 10.1016/j.abb.2017.08.009 28803837
Oh S, Kim H, Nam K, Shin I. Silencing of Glut1 induces chemoresistance via modulation of Akt/GSK-3beta/beta-catenin/survivin signaling pathway in breast cancer cells. Arch Biochem Biophys. 2017;636:110–22.28803837 10.1016/j.abb.2017.08.009
36. Li H Sun X Li J Liu W Pan G Mao A Hypoxia induces docetaxel resistance in triple-negative breast cancer via the HIF-1alpha/miR-494/Survivin signaling pathway Neoplasia 2022 32 100821 10.1016/j.neo.2022.100821 35985176
Li H, Sun X, Li J, Liu W, Pan G, Mao A, et al. Hypoxia induces docetaxel resistance in triple-negative breast cancer via the HIF-1alpha/miR-494/Survivin signaling pathway. Neoplasia. 2022;32: 100821.35985176 10.1016/j.neo.2022.100821
