
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00804-6
10.1016/j.psj.2024.104225
104225
IMMUNOLOGY, HEALTH AND DISEASE
The effect of Lonicerae flos and Rhizoma curcumae longae extract on the intestinal development and function of broilers
Xu Dahai ⁎†
Wang Xiao ⁎
Hou Xiaojiao ‡
Wang Xiumin ‡
Shi Wanyu shiwanyu2010@126.com
⁎2
Hu Yongfei huyongfei@cau.edu.cn
†1
⁎ College of Traditional Chinese Veterinary Medicine, Hebei Agricultural University, Baoding, 071000, China
† State Key Laboratory of Animal Nutrition and feeding, College of Animal Science and Technology, China Agricultural University, Beijing, 100193, China
‡ Beijing Centre Biology Co., Ltd., Beijing 102600, China
2 Corresponding author: shiwanyu2010@126.com
1 Co-corresponding author.

19 8 2024
11 2024
19 8 2024
103 11 10422516 5 2024
11 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
This study was conducted to explore effects of Lonicerae flos and Rhomoma curcumae longae extracts (LR) on intestinal function of broilers. Three hundred broiler chickens were randomly assigned to the following 5 groups. The control group were fed the basal diet; the antibiotic group were fed the basal diet supplemented with spectinomycin hydrochloride (50 million units/ton) + lincomycin hydrochloride (25 g/ton); the LRH, LRM and LRL groups were fed the basal diet supplemented with a high dose (750 g/ton of feed), normal dose (500 g/ton of feed), or low dose (250 g/ton of feed) of LR, respectively. The changes of intestinal structure, intestinal digestive enzyme activities, antioxidant enzyme activities, inflammatory cytokines, and bacterial abundances in the colon and cecum contents were determined. The results indicated that compared with the control group and the antibiotic group, LR significantly increased the villus length/crypt depth (VCR) of the intestine, and significantly inhibited oxidative stress and inflammatory responses in the broiler intestine. In addition, LR regulated intestinal function by increasing the abundance of the intestinal microorganisms in broilers. In conclusion, LR improved antioxidant capacity, intestinal morphology, and microorganisms, and inhibited inflammatory response. The effect of high and medium doses of LR was better than lower doses.

Key words

plant extract
broiler
intestinal function
intestinal structure
intestinal microorganism
==== Body
pmcINTRODUCTION

A healthy gut is a prerequisite to ensure the growth and production of poultry in breeding. A healthy intestinal system can improve the digestibility and absorption rate of feed nutrients, reduce the unnecessary waste of nutrients, improve the production efficiency of poultry, and reduce the adverse effects of excreted products and harmful gases on poultry and the environment during production (Tang et al., 2019; Xiao et al., 2017). In addition, the intestine also has an important immune function, which is vital in immune defense (Wells et al., 2010). The integrity and morphology of the intestine and the diversity of the intestinal microbiota are important in maintaining animal health and can prevent bacteria and viruses in the intestine from entering the blood and then moving throughout the body (Ng et al., 2013). The intestinal barriers of poultry mainly include the mechanical barrier, the immune barrier, and the microbial barrier. These barriers interact with one another to maintain intestinal health (Bedford and Apajalahti, 2022).

Oxidative stress damages the intestinal epithelial barrier mainly in 2 ways. One way is by increasing the intestinal permeability and affecting the distribution of intercellular tight junction proteins, which alters the normal structure and function of the intestinal epithelial barrier (Sies, 1991). The other way is by inducing the death of intestinal epithelial cells, which leads to pathogenic bacteria entering systemic circulation through gaps formed by dead cells in the intestine, causing damage to the body (Hybertson et al., 2011). Oxidative stress caused disordered intestinal structure and function (Jin et al., 2021). In addition, studies have found that oxidative stress decreased activities of superoxide dismutase (SOD) and glutathione peroxidase (GPx) and increased content of malondialdehyde (MDA) in the plasma of chickens (Zhang et al., 2020). Reactive oxygen species (ROS) generated by oxidation can act on tight junction proteins and adhesion proteins and destroy the tight junctions of the intestinal tract in a variety of ways, such as by disrupting the tertiary structure of tight junction-related proteins, generating protein cross-linking polymers, accelerating the breakdown and degradation of skin chains of related proteins, and oxidizing tryptophan sarcosine and methionine residues (Liguori et al., 2018; Wang et al., 2016).

Intestinal inflammation is an important factor to induce intestinal injury (Wei et al., 2022). Inflammatory factors play a key role in regulating physiological and pathological responses in terms of tight junction structure and the function of intestine. For example, TNF-α can down-regulate the expression of ZO-1 in Caco-2 cells, leading to increased tight junction permeability (Ma et al., 2004). TNF-α, IFN-γ, and IL-1 can increase the permeability of cells by reducing the expression of Occlusion, ZO-1, and claudins, which are key proteins of tight junctions in human colon cancer HT-29 epithelial cells (Nunes et al., 2019). Recent research on the effect of inflammatory factors on intestinal permeability shows that proinflammatory factors may increase the permeability of epithelial cells mainly through the following 2 ways: 1 is by altering the expression and distribution of key tight junction proteins; the other is by promoting the rearrangement of tight junction structures (Al-Sadi et al., 2009). The expression, structural depolymerization and rearrangement of key proteins of intestinal tight junctions changes the permeability of intestinal epithelial cells, leading to disrupted intestinal barrier function and leading to the invasion of bacteria and endotoxins.

The gastrointestinal tract in poultry develops faster in the early stages, which provides good conditions for the colonization of bacteria (Diaz Carrasco et al., 2019). Meanwhile, the intestinal microorganisms also have a significant influence on intestinal development. The intestinal microbiota participates in metabolizing various nutrients, maintaining intestinal barrier function, regulating immune responses and resisting pathogen invasion (Yadav and Jha, 2019).

Recently, there is growing evidence that plant extracts can regulate the microecological balance in animal intestines, thereby preventing and treating diseases (Patra et al., 2019; Duskaev et al., 2021; Belali et al., 2024). The study showed that Lonicerae flos (Shanyinhua in Chinese) polysaccharides could treat the nonalcoholic fatty liver disease by reshaping composition of gut microbiota (Han et al., 2023). Curcumin is the main constituent of Rhizoma curcumae longae, and possesses anti-inflammatory, antioxidative, and antimicrobial properties (Buniowska-Olejnik et al., 2023). At the same time, the use of Chinese herbs does not lead to drug resistance and has the advantages of promoting animal growth and increasing immunity in broilers (Long et al., 2020). Chinese herbs bypass the adverse effects of antibiotics and have gradually replaced traditional antibiotic additives in application (Gao et al., 2022; Ibtisham et al., 2019).

Lonicerae flos mainly contains chlorogenic acid, while Rhizoma curcumae longae mainly contains curcumin (Kumar et al., 2017; Huang et al., 2019). A recent in vitro study has demonstrated that chlorogenic acid potentiates the anti-inflammatory activity of curcumin in LPS-stimulated THP-1 cells (Bisht et al., 2020), suggesting the combination of chlorogenic acid and curcumin may be potential alternatives to antibiotics. However, little information is available regarding the effects of co-administration of chlorogenic acid and curcumin in broiler chickens. we hypothesized that the combination of Lonicerae flos and Rhizoma curcumae longae extracts (LR) was effective as antibiotics in improving intestinal health of broilers. Therefore, the intestinal inflammatory reaction, antioxidant capacity and changes of the intestinal microorganisms in chickens were measured in this study. The results will provide theoretical support for the use of LR as a new feed additive and will contribute to reducing the amount of antibiotics added to feed.

MATERIALS AND METHODS

All experimental procedures were approved by the laboratory animal ethics committee of Hebei Agricultural University (No. 2022161).

Experimental Grouping and Treatment

Three hundred 1-day-old WOD168 broilers obtained from Beijing Huadu Yukou Poultry Industry Co., Ltd (Beijing, China) were randomly assigned to 5 groups. Each group contains 6 replicate cages, with 10 broilers per replicate. The control group were fed the basal diet; the antibiotic group were fed the basal diet supplemented with spectinomycin hydrochloride (50 million units/ton) + lincomycin hydrochloride (25 g/ton); the LRH, LRM and LRL groups were fed the basal diet supplemented with a high dose (750 g/ton of feed), normal dose (500 g/ton of feed), or low dose (250 g/ton of feed) of LR, respectively. The LR power consisted of extracts from Lonicera flos and Rhizoma curcumae longae in a ratio of 1:3. The final concentrations of chlorogenic acid and curcumin were 100 mg/kg and 20 g/kg, respectively. The diets were fed in mash. The composition and nutrient level of basal diet are presented in Table 1. The test period was 35 d.Table 1 The composition and nutrient level of basal diet.

Table 1Item	D l–21	D 22–35	
Composition, %			
Corn	54.32	57.28	
Soybean meal	37.35	33.68	
Soybean oil	3.99	5.15	
Lysine	0.17	0.08	
DL-Methionine	0.18	0.10	
Calcium hydrogen phosphate	1.59	1.39	
Stone powder	1.10	1.02	
Sodium chloride	0.30	0.30	
Premix1	1.00	1.00	
Total	100.00	100.00	
Calculated nutrient levels2			
Metabolizable energy, kcal/kg	2995.81	3096.14	
Crude protein	21.50	19.52	
Lysine	1.16	1.02	
Methionine	0.58	0.59	
Methionine + Cysteine	0.93	0.91	
Calcium	1.00	0.95	
Total phosphorus	0.69	0.65	
Available phosphorus	0.45	0.40	
Note:

1 Premix provided per kilogram of complete diet: VA 6141.5 IU, VD3 1789.2 IU, VE 7.99 mg, VK 1.82 mg, VB1 0.65 mg, VB2 3.93 mg, VB6 2.08 mg, VB12 0.01 mg, niacin 18.06 mg, calcium pantothenate 6.65 mg, Folate 0.59 mg, biotin 0.07 mg, choline 332.28 mg, Fe 60.91 mg, Cu 6.01 mg, Zn 65.75 mg, Mn 62.3 mg, I 0.90 mg, Se 0.21 mg.

2 Metabolic energy, available phosphorus, and amino acids were calculated values (refer to NY/T 33-2004), while the rest were measured values.

At 21 and 35 d of age, 5 birds (1 birds per replicate cage) from each treatment were selected after 12 h fasting. Blood samples were collected from the wing vein, and serum was separated by centrifuge and stored in the refrigerator. After the blood coagulated, the same broilers were euthanized via sodium pentobarbital injection, and the intestinal tissues were harvested. One part was kept in 4% formaldehyde solution, and the other was stored at −80°C.

Histological Analysis

The duodenal, jejunal and ileal tissues were fixed with 10% neutral formalin solution, embedded in paraffin, cut into 5 μm thick slices, and stained with hematoxylin and eosin (H&E). The villus length (from villus junction to the top of villus) and crypt depth (from villus junction to the base of intestinal gland) were determined with ImageJ analysis software. The ratio of villus length to crypt depth (VH/CD, VCR) was calculated.

Determination of Digestive Enzyme Activity

To determine the enzyme activity, 0.1 g content in jejunum of 35-day-old broilers was weighed and collected at low temperature. Then, the supernatant was prepared. The activities of amylase (96 T, cat#C016-1-1) and lipase (96 T, cat#A054-2-1) were determined by commercial kits (Nanjing Jiancheng Bioengineering Research Institute).

ELISA Experiment

Levels of IgA (96 T, cat#ml002792), IgG (96 T, cat#ml042771), IgM (96 T, cat#ml0027781), IL-1β (96 T, cat#ml059835), IL-6 (96 T, cat#ml059839), IL-10 (96 T, cat#ml059830), TNF-α (96 T, cat#ml002790) in serum and sIgA (96 T, cat#ml002778) in jejunum and cecum were measured with chicken-specific ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd.).

Biochemical Index Measurement

At 21 and 35 day of age, 10 chickens per group were randomly selected, and the anterior segment of the cecum was collected, cut, and washed to make 10% intestinal tissue homogenate; following, the sample was centrifuged and the supernatant was collected. The MDA content and SOD activity in serum and intestinal tissue were determined by a kit (Nanjing Jiancheng Biotechnology Co., Ltd.) using an automatic biochemical analyzer.

Real-Time qPCR Experiment

Total RNA was extracted from jejunal and cecal samples by the Total RNA Extraction Kit (Promega Biotechnology Co., Ltd., Beijing, China). The RNA purity and concentration were measured with a spectrophotometer at 260/280 nm. Then RNA was reverse transcribed into cDNA using the PrimeScript™ RT Reagent Kit with gDNA Eraser (Perfect Real Time) (Takara Biotechnology Co., Ltd., Dalian, China). β-Actin was used as a reference gene. The primers for β-actin and target genes were designed and synthesized by Takara Biotechnology Co., Ltd. (Dalian, China) (Table 2). Then, real-time qPCR was used to measure the Ct values of the β-actin, NF-κB p65, and MUC2 genes using TB Green® Premix DimerEraser™ (Perfect Real Time) (Takara Biotechnology Co., Ltd., Dalian, China). The relative mRNA expression levels of target genes in the jejunum and cecum samples were determined by the 2−△△Ct method.Table 2 The primers for real-time PCR.

Table 2Gene	Primer sequence (5′–3′)	Size (bp)	Reference	
NF-κB p65	F: GGATACCTGGCTGTTGTCGAATACC	89	Wang et al. (2023)	
R: AAGTGTAGTGCTGTTCTCCCATTGC	
MUC2	F: GTGCCAGCAAACTTGTCGTTCC	81	Wang et al. (2023)	
R: CAGCCACAGCCATCCACAGG	
β-actin	F: CCAGCCATGTATGTAGCCATCCAG	93	Wang et al. (2023)	
R: GGTAACACCATCACCAGAGTCCATC	

Analysis of the Intestinal Microorganisms

Feces in cecum and colon of broilers were collected and stored at -80°C for microbial analysis. The QIAamp Rapid DNA Feces Mini Kit was used to extract total fecal DNA. The amplification of the V3-V4 region of the 16S rRNA gene was conducted by using universal primers for bacteria and the Illumina MiSeq PE300 platform at Meiji Biotechnology Co., Ltd. (Beijing, China) with 2 ×300 bp of end-to-end sequencing. QIIME 2.0 was used to merge, demultiplex and filter the quality of the original reads, and the obtained reads were clustered into operational taxonomic units (OTU) with 97% distance similarity in the Greengenes reference database. Alpha diversity (Chao 1 index, Shannon index and observed species) was determined by Mothur (version 1.30.1, http://mothur.org/). The R package (R version 4.0.5, http://www.r-project.org/) was used to perform principal coordinate analysis (PCA) and principal coordinate analysis based on the Bray Curtis distance (PCoA). Linear discriminant analysis (LDA) and effect quantity (LEfSe, http://huttenhower.sph.harvard.edu/galaxy) were used to determine the change in the GUNES level of the microorganisms following different interventions. LDA score ≥ 2.0 were regarded as significant.

Statistical Analysis

All data are expressed as mean ± standard deviation. Data was analyzed with 1-way ANOVA followed by Tukey's tests. P values are expressed as follows: compared with the control group, *P < 0.05, **P < 0.01; and compared with the antibiotic group, # P < 0.05, ## P < 0.01.

RESULTS

Effects of LR on Intestinal Structure and Digestive Enzyme Activities of Broilers

At 21 and 35 d of age, the VCR in the duodenum, jejunum, and ileum of the antibiotic group was lower compared with the control group and the LR groups. In addition, the VCR of the duodenum, jejunum, and ileum in the LRH and LRM groups was higher compared with the control group (Figures 1A–D).Figure 1 Effects of LR on intestinal structure and digestive enzyme activities of broilers. (A) The H&E staining results of broiler intestines at 21 days old. (B) The VCR results of broiler intestines at 21 days old. (C) The H&E staining results of broiler intestines at 35 days old. (D) The VCR results of broiler intestines at 35 days old. (E) The digestive enzyme activity in jejunum of broilers at 35 days old. Compared with the control group, * P < 0.05 and ** P < 0.01; and compared with the antibiotic group, # P < 0.05 and ## P < 0.01.

Figure 1

At 35 d of age, jejunal activities of amylase and lipase in LRH and LRM groups were significantly higher compared with the antibiotic group and the control group, while jejunal activities of lipase and amylase in the antibiotic group were significantly lower compared with the control group (Figure 1E).

Effects of LR on Immunoglobulin Contents in Broilers

At 21 d of age, serum contents of IgG and IgM in the antibiotic group were lower compared with the control group. Serum levels of IgA, IgG, and IgM in the LR groups were significantly higher compared with the control group and the antibiotic group. At 35 d of age, the content of IgG in the serum of broilers in the antibiotic group was significantly lower than that in the control group. The IgA, IgG, and IgM contents in the serum of broilers in the LR groups were significantly higher than those in the control group and the antibiotic group (Figures 2A–C).Figure 2 Effects of LR on the immunoglobulin contents in broilers. (A) The level of IgA in broiler serum. (B) The level of IgG in broiler serum. (C) The level of IgM in broiler serum. (D) The level of SIgA in the broiler jejunum and cecum of 21-day-old broilers. (E) The level of SIgA in the broiler jejunum and cecum of 35-day-old broilers. Compared with the control group, * P < 0.05, ** P < 0.01; compared with the antibiotic group, # P < 0.05, ## P < 0.01.

Figure 2

In addition, at 21 and 35 d of age, the SIgA content in the jejunum and cecum of broilers in the LR groups was significantly higher than that in the control group and the antibiotic group. The content of SIgA in the jejunum and cecum of broilers in the control group was significantly higher than that in the antibiotic group. The content of SIgA in the jejunum and cecum of the LR groups was dose-dependent (Figure 2, Figure 2).

Effects of LR on Inflammation in Broilers

At 21 d of age, serum contents of IL-6 and TNF-α in each LR group were significantly lower compared with the antibiotic group and the control group. Serum contents of IL-6 and TNF-αin the antibiotic group were significantly lower than that of those in the control group. Serum content of IL-10 in the LR groups was significantly higher than that in the antibiotic group and the control group. Serum content of IL-10 in the antibiotic group was significantly lower compared with the control group. Serum content of IL-1β in the LRH and LRM groups was significantly lower compared with the antibiotic group and the control group. The IL-1β content in the LRL group and the antibiotic group was significantly lower compared with the control group (Figures 3A–D).Figure 3 Effects of LR on inflammation in broilers. (A) The content of IL-1β in broiler serum. (B) The content of IL-6 in broiler serum. (C) The content of IL-10 in broiler serum. (D) The content of TNF-α in broiler serum. (E) The mRNA transcription level of NFκB-P65 in broiler cecum. (F) The mRNA transcription level of NFκB-P65 in broiler jejunum. (G) The mRNA transcription level of MUC2 in broiler cecum. (H) The mRNA transcription level of MUC2 in broiler jejunum. Compared with the control group, * P < 0.05 and ** P < 0.01; and compared with the antibiotic group, # P < 0.05 and # # P < 0.01.

Figure 3

At 35 d of age, the contents of IL-6, IL-1β and TNF-α in the LR groups were significantly lower compared with the antibiotic group and the control group. The content of IL-1β in the antibiotic group was significantly lower compared with the control group. The content of IL-6 in the antibiotic group was significantly higher than that in the control group. The content of IL-10 in the LR dose groups was significantly higher than that in the antibiotic group and the control group. The content of IL-10 in the antibiotic group was significantly lower than that in the control group (Figures 3A–D).

We also tested the changes in NF κB-P65 mRNA transcription. At 21 d of age, the mRNA transcription level of NFκB-P65 in the jejunum and cecum tissues of broilers in all LR groups was significantly lower compared with the antibiotic group and the control group. The mRNA transcription level of NF-κB p65 in the jejunum of the antibiotic group was significantly higher compared with the control group (Figure 3E).

At 35 d of age, the mRNA transcription level of NFκB-P65 in the jejunum and cecum tissues of broilers in all LR groups was also significantly lower compared with the antibiotic group and the control group. The mRNA transcription level of NFκB-P65 in the jejunum and cecum tissues of the antibiotic group was significantly higher compared with the control group (Figure 3F).

At 21 d of age, the mRNA transcription level of MUC2 in the jejunum and cecum tissues of broilers in all LR groups was significantly lower than that in the antibiotic group and the control group. The mRNA transcription level of MUC2 in the jejunum tissue of the antibiotic group was significantly higher compared with the control group (Figure 3G).

At 35 d of age, the mRNA transcription level of MUC2 in the jejunum and cecum tissues of broilers in all LR groups was significantly lower than that in the antibiotic group and the control group. Jejuanl mRNA transcription level of MUC2 in the antibiotic group was significantly higher compared with the control group (Figure 3H).

Effects of LR on Oxidative Stress in Broilers

At 21 d of age, the content of MDA in the serum and cecum in all LR groups was significantly lower compared with the antibiotic group and the control group. However, there was no significant difference in SOD activity in the serum and cecal tissues of broilers in each group (Figures 4A–D).Figure 4 Effects of LR on oxidative stress in broilers. (A) The level of MDA in broiler serum. (B) The level of SOD in broiler serum. (C) The level of MDA in broiler cecum. (D) The level of SOD in broiler cecum. Compared with the control group, * P < 0.05 and ** P < 0.01; and compared with the antibiotic group, # P < 0.05 and # # P < 0.01.

Figure 4

At 35 d of age, the content of MDA in the cecum of broilers in all LR groups was significantly lower compared with the antibiotic group and the control group. Cecal activity of SOD in the LRH and LRM groups was significantly higher compared with the antibiotic group and the control group. At the same time, cecal activity of SOD in the control group and the LRL group was significantly higher compared with the antibiotic group (Figures 4A–D).

Effects of LR on Cecal Microorganisms of Broilers

The results of α-diversity showed that there was no significant difference in α diversity among groups (Figure 5A). The pCOA and NMDS analysis were used to analyze the β-diversity (Figure 5, Figure 5). No significant difference was found among groups, indicating that microbial composition of 5 groups was similar. The results of the top 20 bacterial species at phyla and genus level showed that the species composition of each group was quite different (Figure 5, Figure 5). At the phyla level, Firmicutes, Bacteroidetes and Proteobacteria were dominant in all 5 groups. The abundance of Proteobacteria in group A, B, C and D was significantly lower than that in Group E, while the abundance of Actinobacteria in Group D was significantly higher than that in other groups. At the genus level, compared with Group E, LR supplementation significantly increased the abundance of Bacteroides, Barnesiella and Rikenella, and decreased the abundance of Parabacteroides and Butyricimonas; Group D significantly increased the abundance of Barnesiella, Bifidobacterium, Alistipes, and Odoribacter, and decreased the abundance of Bacteroides, Parabacteroides, and Butyricimonas. A further Lefse analysis at the genus level among groups showed that both groups A and B significantly increased the abundance of Rikenella and unclassified Bacteroidales and Group C significantly increased the abundance of unclassified Bacteroidales and Bacteroides compared with Group E; Group D significantly increased the abundance of Bifidobacterium and Odoribacter (Fig. 5F).Figure 5 Effects of LR on the cecal flora abundance of broilers. (A) The α diversity test results of cecal flora. (B) PCoA analysis of cecal flora. (C) NMDS analysis of cecal flora. (D) Microbial composition at the phylum level. (E) Microbial composition at the genus level. (F) LEfSe analysis of cecal flora. A is the control group, B is the antibiotic group, C is the LRH group, D is the LRM group and E is the LRL group. * P < 0.05 and ** P < 0.01.

Figure 5

Effects of LR on the Colonic Microorganisms of Broilers

The results of α-diversity showed that there was no significant difference in α diversity among groups (Figure 6A). The pCoA nd NMDS analysis were used to analyze the β-diversity (Figure 6, Figure 6). No significant difference was found among groups, indicating that microbial composition of 5 groups was similar. The results of the top 20 bacterial species at phyla and genus level showed that the species composition of each group was quite different (Figure 6, Figure 6). At the phylum level, there was no significant difference among the groups. But at the genus level, compared with group E, the abundance of Bacteroides, Parabacteroides and Barnesiella was significantly decreased in LR groups and group D, the unidentified Rikenellaceae abundance was significantly reduced in LR groups and the unclassified Barnesiellaceae abundance was significantly increased in LR groups. The Lefse analysis showed that the abundance of unclassified Flavobacteriaceae in group A and B was significantly higher than that in Group E. (Figure 6F).Figure 6 The effect of LR on the colonic flora abundance in broilers. (A) The α diversity test results of colonic flora. (B) PCoA analysis of colonic flora. (C) NMDS analysis of colonic flora. (D) Microbial composition at the phylum level. (E) Microbial composition at the genus level. (F) LEfSe analysis of colonic flora. A is the control group, B is the antibiotic group, C is the LRH group, D is the LRM group and E is the LRL group.

Figure 6

DISCUSSION

Structural integrity is a prerequisite for ensuring the normal digestion and absorption functions of the small intestine. Morphological changes in the villus length and crypt depth in the small intestine are also closely related to the intestinal digestion capacity. In addition, the intestinal epithelium acts as a barrier that separates the intestine from the outside world and improves the absorption of nutrients. The morphological and structural state of the intestinal epithelium is also used to evaluate the development of the intestine (Cao et al., 2019). The depth of the intestinal crypt represents the rate of cell generation. The shallower the crypt, the more mature the cells are, and the better their secretion function. The increase in VCR can increase the intestinal absorption area, which is more conducive to intestinal digestion (Xie et al., 2020). Liu et al., (2023) reported that dietary supplementation of chlorogenic acid increased the ratio between duodenal villus height and crypt depth and ileal villus height. Similarly, the current study found that LR improves the intestinal morphology and structure in broilers, which may be favorable for nutrient digestion. The positive effects of LR on intestinal morphology may be attributed to chlorogenic acid in LR.

In the breeding and production of livestock and poultry, pancreatic digestive enzymes, such as lipase, protease and amylase, play a very important role; these enzymes affect the digestion and absorption of nutrients such as fat, protein and starch in feed (Konkit and Kim, 2016). Mao et al. found that fulvic acid can increase the activity of protease, lipase and amylase in the intestinal tract of broilers and can effectively hydrolyze proteins, lipids and starch into smaller molecules, which can be better absorbed and utilized by the intestine (Mao, 2019). The results of the current study were the same as those of previous studies. After adding LR to the broiler diet, the amylase and lipase contents in the jejunum chyme were significantly increased compared with those in the control group, and the lipase content in the ileum chyme was also significantly increased. Therefore, the addition of LR promoted the secretion of digestive enzymes, improved the intestinal digestive capacity of broilers, and made better use of the nutrients in feed.

The antioxidant-mediated effects of traditional Chinese medicines on intestinal barrier function have been extensively studied in pigs and mice, but research in chickens is relatively lacking. Therefore, in this study, we focused on the effect of traditional Chinese medicine extracts on the antioxidant capacity of broilers. Therefore, the oxidation products in the serum and intestine and the activity of important antioxidant enzymes were measured. Lipid peroxidation can cause cell membrane damage, and MDA is an important lipid peroxidation product (Wang et al., 2021). As the first line of defense against oxidative stress, the intestinal mucosa contains a wide range of antioxidant defense systems, including enzymes (CAT, SOD, and GPx) and nonenzymatic endogenous and exogenous scavengers. SOD is a metal enzyme and one of the most effective antioxidant enzymes in the body, and can effectively balance the level of oxidation and antioxidation in the body (Amir Aslani and Ghobadi, 2016). SOD is considered the first line of defense for living cells against reactive oxygen species. SOD promotes the decomposition of superoxide anions into O2 and H2O2, and the generated H2O2 can be removed by CAT or GPx (Amir Aslani and Ghobadi, 2016). Therefore, we measured the expression of the above indicators in the intestinal mucosa of broilers at 21 and 35 d of age to further determine the antioxidant effect of LR. At 21 d of age, the results showed that the MDA content in the cecum and serum in the LR-supplemented group was significantly reduced, while the SOD content was significantly increased, which showed the good antioxidant capacity of LR. Both chlorogenic acid and curcumin have been reported to possess potent antioxidant capacity (Zhang et al., 2019; Bai et al., 2022), which may be responsible for the improved antioxidant capacity in the current study.

The innate immune system is the host's first line of defense against pathogens. In the intestinal tract, it is mainly mediated by macrophages, DCs, and other phagocytes (Kawai and Akira, 2011). Macrophages play a key role in the initiation, maintenance, and regression of the inflammatory response (Watanabe et al., 2019). In the inflammatory response, macrophages mainly perform the following 3 functions by secreting various cytokines and growth factors: antigen presentation, phagocytosis, and immune regulation (Bain and Mowat, 2014). Their activation and inactivation in the process of inflammatory reactions can reflect the occurrence and disappearance of inflammation. Cytokines (IFN-γ, granulocyte monocyte colony-stimulating factor G-CSF and TNF-α), LPS, extracellular matrix proteins, and other chemical mediators can be activation signals. For example, LPS can be recognized by TLR4 receptors on the surface of the macrophage membrane and then pass through the NF-κB signaling pathway, thereby activating the expression of the 3 key proinflammatory genes TNF-α, IL-1β, and IL-6 (Takeuchi and Akira, 2010). It has been shown that chlorogenic acid ameliorated LPS-induced inflammatory responses by attenuating TLR4/MyD88-mediated NF-κB signaling pathways in HGF-1 cells (Park et al., 2022). Yu et al., (2018) demonstrated that anti-inflammatory effect of curcumin occurred mainly through inhibiting the NF-κB and MAPKs signaling. Consistent with previous studies, our results showed that LR significantly inhibited the expression of proinflammatory genes via inhibiting the expression of NF-κB in the intestine and simultaneously increased the expression of anti-inflammatory genes. These results indicate that LR significantly inhibits intestinal inflammation. In summary, LR may inhibit the inflammatory reaction in the chicken intestinal tract that is induced by macrophages.

The intestinal microorganisms are closely related to the health of the broiler intestine (Rubio, 2019). Proteobacteria includes many pathogenic bacteria such as escherichia, salmonella, and Vibrio, which are associated with intestinal inflammation (Cuesta et al., 2022). Bacteroides is considered as a probiotic with the ability of degrading a variety of complex carbohydrates. Parabacteroides, a member of the Subtangiaceae family of Bacteroidetes, is involved in the intervention of hyperlipidemia (Gargari et al., 2018) and has been found to be associated with inflammatory bowel diseases (Zhou et al., 2023). Barnesiella, a member of the family Bacteroidetes, can produce short chain fatty acids that provide nutrients and energy to the host. Rikenella is a potential probiotic and plays an important role in maintaining metabolic balance, immune homeostasis and intestinal health. Butyricimonas is a beneficial bacterium that produces short chain fatty acids to reduce inflammation (Lu et al., 2021). The present study showed that LR had no significant difference in α-diversity in colon and cecum. However, at the phylum level, LR significantly decreased the abundance of Proteobacteria in cecum. At genus level, LR significantly decreased the abundance of Bacteroides, Parabacteroides, Barnesiella in colon, increased the abundance of Bacteroides, Barnesiella, Rikenella in cecum, and decreased the abundance of Parabacteroides, Butyricimonas in cecum, indicating that LR can increase the abundance of beneficial bacteria and improve intestinal health.

CONCLUSION

LR improved antioxidant capacity, intestinal morphology, and microorganisms, and inhibited inflammatory response. The effect of high and medium doses of LR was better than lower doses.

DISCLOSURES

The authors declare no conflicts of interest.

ACKNOWLEDGMENTS

This study was supported by National Key R&D Program of China (No. 2022YFD1801104 ), Key Research and Development Plan Project of Hebei Province (No. 22326622D ), and Hebei Modern Agricultural Industry Technology System Innovation Team Construction Project (HBCT2024110202 ).
==== Refs
REFERENCES

Al-Sadi R. Boivin M. Ma T. Mechanism of cytokine modulation of epithelial tight junction barrier Front. Biosci. (Landmark Ed) 14 2009 2765 2778 19273235
Amir Aslani B. Ghobadi S. Studies on oxidants and antioxidants with a brief glance at their relevance to the immune system Life. Sci. 146 2016 163 173 26792059
Bai D. Liu K. He X. Tan H. Liu Y. Li Y. Zhang Y. Zhen W. Zhang C. Ma Y. Effect of dietary chlorogenic acid on growth performance, antioxidant function, and immune response of broiler breeders under immune stress and stocking density stress Vet. Sci. 9 2022 582 36288195
Bain C.C. Mowat A.M. Macrophages in intestinal homeostasis and inflammation Immunolog. Rev. 260 2014 102 117
Bedford M.R. Apajalahti J.H. The role of feed enzymes in maintaining poultry intestinal health J. Sci. Food Agric. 102 2022 1759 1770 34802157
Belali M. Seidavi A. Bouyeh M. Gorlov I.F. Slozhenkina M.I. Mosolov A.A. Ramirez L.S. Tirado‑Gonzalez D.L. Cuevas‑Barragan C.E. Cipriano‑Salazar M. Substantiable bioconversion of the aromatic plant extracts biomass as feed additives in broiler performance: effects and prefeasibility comparison of thyme (Thymus vulgaris) Biomass. Convers. Bior. 14 2024 6097 6109
Bisht A. Dickens M. Rutherfurd-Markwick K. Thota R. Mutukumira A.N. Singh H. Chlorogenic acid potentiates the anti-inflammatory activity of curcumin in LPS-stimulated THP-1 cells Nutrients 12 2020 2706 32899726
Buniowska-Olejnik M. Urbański J. Mykhalevych A. Bieganowski P. Znamirowska-Piotrowska A. Kačániová M. Banach M. The influence of curcumin additives on the viability of probiotic bacteria, antibacterial activity against pathogenic microorganisms, and quality indicators of low-fat yogurt Front. Nutr. 10 2023 1118752
Cao G. Tao F. Hu Y. Li Z. Zhang Y. Deng B. Zhan X. Positive effects of a Clostridium butyricum-based compound probiotic on growth performance, immune responses, intestinal morphology, hypothalamic neurotransmitters, and colonic microbiota in weaned piglets Food. Funct. 10 2019 2926 2934 31070611
Cuesta S. Burdisso P. Segev A. Kourrich S. Sperandio V. Gut colonization by Proteobacteria alters host metabolism and modulates cocaine neurobehavioral responses Cell. Host Microbe. 30 2022 1615 1629 36323315
Diaz Carrasco J.M. Casanova N.A. Fernández Miyakawa M.E. Microbiota, gut health and chicken productivity: What is the connection? Microorganisms 7 2019 374 31547108
Duskaev G. Kvan O. Vershinina I. Rakhmatullin S. Assessment of lipid metabolism in broilers against plant extract and probiotic substance or their combined use Iran. J. Appl. Anim. Sci. 11 2021 161 168
Gao J. Wang R. Liu J. Wang W. Chen Y. Cai W. Effects of novel microecologics combined with traditional Chinese medicine and probiotics on growth performance and health of broilers Poult. Sci. 101 2022 101412
Gargari G. Deon V. Taverniti V. Gardana C. Denina M. Riso P. Guardamagna O. Guglielmetti S. Evidence of dysbiosis in the intestinal microbial ecosystem of children and adolescents with primary hyperlipidemia and the potential role of regular hazelnut intake FEMS Microbiol. Ecol. 94 2018 10.1093/femsec/fiy045
Han C. Li Z. Liu R. Zhao Z. Wang Y. Zuo X. Zhang Y. Geng Z. Huang H. Pan X. Li W. Lonicerae flos polysaccharides improve nonalcoholic fatty liver disease by activating the adenosine 5′-monophosphate-activated protein kinase pathway and reshaping gut microbiota J. Sci. Food Agric. 103 2023 7721 7738 37439182
Huang S. Wang L. Xue N. Li C. Guo H. Ren T. Zhan Y. Li W. Zhang J. Chen X. Han Y. Zhang J. Jiang J. Chlorogenic acid effectively treats cancers through induction of cancer cell differentiation Theranostics 9 2019 6745 6763 31660066
Hybertson B.M. Gao B. Bose S.K. McCord J.M. Oxidative stress in health and disease: the therapeutic potential of Nrf2 activation Mol. Aspects. Med. 32 2011 234 246 22020111
Ibtisham F. Nawab A. Niu Y. Wang Z. Wu J. Xiao M. An L. The effect of ginger powder and Chinese herbal medicine on production performance, serum metabolites and antioxidant status of laying hens under heat-stress condition J. Therm. Biol. 81 2019 20 24 30975419
Jin Y. Zhai Z. Jia H. Lai J. Si X. Wu Z. Kaempferol attenuates diquat-induced oxidative damage and apoptosis in intestinal porcine epithelial cells Food Funct. 12 2021 6889 6899 34338265
Kawai T. Akira S. Toll-like receptors and their crosstalk with other innate receptors in infection and immunity Immunity 34 2011 637 650 21616434
Konkit M. Kim W. Activities of amylase, proteinase, and lipase enzymes from Lactococcus chungangensis and its application in dairy products J. Dairy. Sci. 99 2016 4999 5007 27108177
Kumar A. Singh A.K. Kaushik M.S. Mishra S.K. Raj P. Singh P.K. Pandey K.D. Interaction of turmeric (Curcuma longa L.) with beneficial microbes: a review 3 Biotech 7 2017
Liguori I. Russo G. Curcio F. Bulli G. Aran L. Della-Morte D. Gargiulo G. Testa G. Cacciatore F. Bonaduce D. Abete P. Oxidative stress, aging, and diseases Clin. Interv. Aging. 13 2018 757 772 29731617
Liu W. Zha P. Guo L. Chen Y. Zhou Y. Effects of different levels of dietary chlorogenic acid supplementation on growth performance, intestinal integrity, and antioxidant status of broiler chickens at an early age Anim. Feed. Sci. Tech. 297 2023 115570
Long L.N. Kang B.J. Jiang Q. Chen J.S. Effects of dietary Lycium barbarum polysaccharides on growth performance, digestive enzyme activities, antioxidant status, and immunity of broiler chickens Poult. Sci. 99 2020 744 751 32029159
Lu H. You Y. Zhou X. Citrus reticulatae pericarpium extract decreases the susceptibility to HFD-induced glycolipid metabolism disorder in mice exposed to azithromycin in early life Front. Immunol. 12 2021 774433
Ma T.Y. Iwamoto G.K. Hoa N.T. Akotia V. Pedram A. Boivin M.A. Said H.M. TNF-alpha-induced increase in intestinal epithelial tight junction permeability requires NF-kappa B activation Am. J. Physiol. Gastrointest. Liver. Physiol. 286 2004 G367 G376 14766535
Mao Y. Modulation of the growth performance, meat composition, oxidative status, and immunity of broilers by dietary fulvic acids Poult. Sci. 98 2019 4509 4513 31115462
Ng K.M. Ferreyra J.A. Higginbottom S.K. Lynch J.B. Kashyap P.C. Gopinath S. Naidu N. Choudhury B. Weimer B.C. Monack D.M. Sonnenburg J.L. Microbiota-liberated host sugars facilitate post-antibiotic expansion of enteric pathogens Nature 502 2013 96 99 23995682
Nunes C. Freitas V. Almeida L. Laranjinha J. Red wine extract preserves tight junctions in intestinal epithelial cells under inflammatory conditions: implications for intestinal inflammation Food Funct. 10 2019 1364 1374 30735221
Park C.M. Yoon H.S. Chlorogenic acid as a positive regulator in LPS-PG-induced inflammation via TLR4/MyD88-mediated NF-κB and PI3K/MAPK signaling cascades in human gingival fibroblasts Mediat. Inflamm. 2022 2022 2127642
Patra A.K. Amasheh S. Aschenbach J.R. Modulation of gastrointestinal barrier and nutrient transport function in farm animals by natural plant bioactive compounds—a comprehensive review Crit. Rev. Food Sci. Nutr. 59 2019 3237 3266 29889546
Rubio L.A. Possibilities of early life programming in broiler chickens via intestinal microbiota modulation Poult. Sci. 98 2019 695 706 30247675
Sies H. Oxidative stress: from basic research to clinical application Am J Med 91 1991 31s 38s
Takeuchi O. Akira S. Pattern recognition receptors and inflammation Cell 140 2010 805 820 20303872
Tang D. Wu J. Jiao H. Wang X. Zhao J. Lin H. The development of antioxidant system in the intestinal tract of broiler chickens Poult Sci 98 2019 664 678 30289502
Wang N. Han Q. Wang G. Ma W.P. Wang J. Wu W.X. Guo Y. Liu L. Jiang X.Y. Xie X.L. Jiang H.Q. Resveratrol protects oxidative stress-induced intestinal epithelial barrier dysfunction by upregulating heme oxygenase-1 expression Dig. Dis. Sci. 61 2016 2522 2534 27146412
Wang X. Yu J.Y. Sun Y. Wang H. Shan H. Wang S. Baicalin protects LPS-induced blood-brain barrier damage and activates Nrf2-mediated antioxidant stress pathway Int. Immunopharmacol. 96 2021 107725
Wang X. Liu W. Zhang D. Jiao Y. Zhao Q. Liu Y. Shi W. Bao Y. Salvia miltiorrhiza polysaccharides alleviate florfenicol-induced inflammation and oxidative stress in chick livers by regulating phagosome signaling pathway Ecotox. Environ. Safe 249 2023 114428
Watanabe S. Alexander M. Misharin A.V. Budinger G.R.S. The role of macrophages in the resolution of inflammation J. Clin. Invest. 129 2019 2619 2628 31107246
Wei L.Y. Zhang J.K. Zheng L. Chen Y. The functional role of sulforaphane in intestinal inflammation: a review Food Funct. 13 2022 514 529 34935814
Wells J.M. Loonen L.M. Karczewski J.M. The role of innate signaling in the homeostasis of tolerance and immunity in the intestine Int. J. Med. Microbiol. 300 2010 41 48 19783476
Xiao Y. Xiang Y. Zhou W. Chen J. Li K. Yang H. Microbial community mapping in intestinal tract of broiler chicken Poult. Sci. 96 2017 1387 1393 28339527
Xie J. Wang Z. Cui H. Nie H. Zhang T. Gao X. Qiao Y. Effects of enzymatic hydrolysate of locust bean gum on digestibility, intestinal morphology and microflora of broilers J. Anim. Physiol. Anim. Nutr. (Berl.) 104 2020 230 236 31762097
Yadav S. Jha R. Strategies to modulate the intestinal microbiota and their effects on nutrient utilization, performance, and health of poultry J. Anim. Sci. Biotechnol. 10 2019 2 30651986
Yu Y. Shen Q. Lai Y. Park S.Y. Ou X. Lin D. Jin M. Zhang W. Anti-inflammatory effects of curcumin in microglial cells Front. Pharmacol. 9 2018 386 29731715
Zhang J. Han H. Shen M. Zhang L. Wang T. Comparative studies on the antioxidant profiles of curcumin and bisdemethoxycurcumin in erythrocytes and broiler chickens Animals 9 2019 953 31718006
Zhang Q. Zhang C. Ge J. Lv M.W. Talukder M. Guo K. Li Y.H. Li J.L. Ameliorative effects of resveratrol against cadmium-induced nephrotoxicity via modulating nuclear xenobiotic receptor response and PINK1/Parkin-mediated Mitophagy Food Funct. 11 2020 1856 1868 32068207
Zhou Z. Wang D. Xu X. Dai J. Lao G. Zhang S. Xu X. Dinnyés A. Xiong Y. Sun Q. Myofibrillar protein-chlorogenic acid complexes ameliorate glucose metabolism via modulating gut microbiota in a type 2 diabetic rat model Food Chem. 409 2023 135195
