
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00802-2
10.1016/j.psj.2024.104223
104223
METABOLISM AND NUTRITION
Alterations in the gut microbiota of Eimeria infected broiler chickens fed diets supplemented with varying levels of dietary calcium and phosphorus, along with 25-hydroxycholecalciferol
Choi Janghan *†
Lee Jihwan *
Kim Woo Kyun wkkim@uga.edu
*1
⁎ Department of Poultry Science, University of Georgia, Athens, GA 30602, USA
† US National Poultry Research Center, USDA-ARS, Athens, GA 30605, USA
1 Corresponding author: wkkim@uga.edu
19 8 2024
11 2024
19 8 2024
103 11 1042233 6 2024
11 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
The purpose of the study was to investigate the effects of the reduced dietary calcium (Ca) and phosphorus (P) level and supplementation of 25-hydroxycholecalciferol (25-OHD3) on the expression of vitamin D receptor (VDR) and antimicrobial peptides and gut microbiota of broiler chickens with/without Eimeria challenge. A total of 576 fourteen-day-old broiler chicks were randomly allocated according to a 2 × 2 × 2 factorial design with main effects including Eimeria challenging (125,000 Eimeria acervulina, 25,000 Eimeria maxima, and 25,000 Eimeria tenella), dietary Ca and P levels (0.84% Ca and 0.42% available P or 0.64% Ca and 0.22% available P), and supplementation of 25-OHD3 (3,000 IU/kg) of 6 replicates. Three-way ANOVA was performed, and the effects of 3 main factors and their interactions were investigated. The reduced dietary Ca and P level downregulated cathelicidins 3 (CATH3) in the upper jejunum in the Eimeria challenging condition (interaction; P < 0.05). The reduced dietary Ca and P level decreased the relative mRNA expression of jejunal avian beta defensin 5 (AvBD5) in the Eimeria challenging condition (interaction; P < 0.05). The reduced dietary Ca and P level tended to decrease the relative mRNA expression of jejunal AvBD9 in the Eimeria challenging condition (interaction; P = 0.051). The reduced dietary Ca and P level decreased observed features (alpha diversity parameter for richness) in the upper jejunal microbiota in the Eimeria challenging condition (interaction; P < 0.05). The supplementation of 25-OHD3 decreased the relative abundance of the phylum Bacteroidetes (P < 0.05) and increased the relative abundance of the family Ruminococcaceae (P < 0.05) in the cecal digesta. The supplementation of 25-OHD3 decreased the serum endotoxin level in the Eimeria challenging condition (interaction; P < 0.05). Therefore, the reduced dietary Ca and P level modulated the upper jejunal microbiota via modulating the expression of antimicrobial peptides, and the supplementation of 25-OHD3 favorably modulated the cecal microbiota in broiler chickens with/without Eimeria challenge.

Key words

calcium
phosphorous
25-hydroxycholecalciferol
gut microbiota
antimicrobial peptide
==== Body
pmcINTRODUCTION

The microbiota in the gastrointestinal tract of broiler chickens plays important roles in hydrolyzing host-resistant nutrients (e.g., fibers, resistant starch, and polysaccharides), inhibiting the colonization of pathogenic bacteria, and producing host-benefiting metabolites such as amino acids and short chain fatty acids (SCFA) (Apajalahti, 2005). A stable gut microbiota provides protection against the colonization of pathogens and food-borne pathogens and facilitates the digestion and absorption of nutrients (Swaggerty et al., 2022). While the microbiota in the lower gastrointestinal tract (e.g., ceca) is considered as the major area for microbial activities with higher density of microbes, the microbiota in the upper gastrointestinal tract (e.g., duodenum and jejunum) could be also important because it is closely associated with gut ecosystem and gut inflammation in the upper gastrointestinal tract, which is the area for nutrient digestion and absorption in broiler chickens (El Aidy et al., 2015; Zhang et al., 2022). Therefore, it is important to maintain or improve the gut microbiota to augment production efficiency and ensure food safety issues in broiler production.

Many studies revealed that diverse challenges such as coccidiosis (Choi et al., 2023a), Salmonella infection (Choi et al., 2023b), necrotic enteritis (Goo et al., 2023), and heat stress (Shi et al., 2019) could negatively affect the gut microbiota in broiler chickens. Diverse nutritional interventions including probiotics (Wang et al., 2017), prebiotics (Shang et al., 2018; Kumar et al., 2019), and plant extracts (Choi et al., 2023a; Choi et al., 2022a; Choi et al., 2023b) modulated the gut microbiota of broiler chickens. Potentially, these bioactive compounds mainly modulate the microbiota by directly exhibiting antimicrobial effects against pathogenic bacteria or providing nutrients for commensal microbes. However, the gut microbiota can be modulated by components of innate and adaptive mucosal immunity such as toll like receptors (TLR), mucus, antimicrobial peptides, and secretory immunoglobulin A in broiler chickens (Choi and Kim, 2022). Kogut (2017) demonstrated that modulation of the gut microbiota by host immunity has a benefit in that it does not induce antimicrobial resistance of microbes.

While the major role of dietary calcium (Ca) and phosphorous (P) is bone development and maintenance, dietary Ca and P are also involved in numerous biological processes such as cell signaling, cell growth, protein synthesis, etc. (Veum, 2010). Many studies demonstrated that inadequate levels of dietary Ca and P compromised growth performance and gut health of broiler chickens (Shang et al., 2015; Xing et al., 2020; Wang et al., 2021; Shi et al., 2023; Shi et al., 2024), which may suggest that the different level of dietary Ca and P can affect the gut microbiota in broiler chickens. Because vitamin D regulates the homeostasis of dietary Ca and P, vitamin D is also related to bone development in broiler chickens (Heaney, 2008; Kim et al., 2011). However, a number of studies showed that vitamin D and its metabolites can influence immune system of broiler chickens mainly by altering the expression of vitamin D receptor (VDR) (Shojadoost et al., 2015; Zhang et al., 2016). The VDR is known to regulate components of immune system including macrophages (Shojadoost et al., 2015), TLRs (Arababadi et al., 2018), cytokines (Aggeletopoulou et al., 2022), and antimicrobial peptides (Zhang et al., 2016). 25-hydroxycholecalciferol (25-OHD3) formed via hepatic hydroxylation from cholecalciferol (vitamin D3) can partially and fully replace the most common form of vitamin D in animal feeds (cholecalciferol) (Lütke‐Dörhoff et al., 2022). The bioavailability of 25-OHD3 was higher than cholecalciferol, which indicates that 25-OHD3 can improve growth-promoting effects and bone mineralization in broiler chickens (Han et al., 2016; Oikeh et al., 2019; Chen et al., 2020). Different levels of dietary Ca and P and supplementation of 25-OHD3 could alter the gut microbiota by modulating gut immunity and development of broiler chickens. Moreover, coccidiosis, which is induced by the infection of Eimeria spp., can compromise gut ecosystem in broiler chickens (Blake et al., 2020; Teng et al., 2021a,b; Teng et al., 2020). The absorption and homeostasis of Ca, P, and Vitamin D can be affected by Eimeria challenging in broiler chickens (Oikeh et al., 2019). Therefore, the purpose of the study was to investigate the effects of the reduced dietary Ca and P level and supplementation of 25-OHD3 on the expression of VDR, antimicrobial peptides, and TLR, activities of brush border digestive enzymes, antioxidant capacity, and microbiota in the upper jejunum and ceca of broiler chickens in the general or Eimeria challenging condition.

MATERIALS AND METHODS

Animals and Experimental Design

The Institutional Animal Care and Use Committee of University of Georgia (Athens, GA) approved the animal use and procedure of the study (A2021 12-012). A total of 576 fourteen-day-old male broiler chicks (Cobb 500) were randomly allocated in cages according to a 2 × 2 × 2 factorial design with Eimeria spp. challenging (oral gavage of water or oral gavage of 125,000 Eimeria acervulina, 25,000 Eimeria maxima, and 25,000 Eimeria tenella on D 14), dietary Ca and P levels (0.84% Ca and 0.42% available P or 0.64% Ca and 0.24% available P), and supplementation of 25-OHD3 (3,000 IU/kg). Each experimental group had 6 replicates of 12 birds per pen. The experimental groups were described in Table 1. Diets were formulated to meet or exceed the nutrient requirement levels according to Cobb 500 nutritional guide (Cobb-Vantress, 2018) as shown in the companion study (Lopes et al., 2024). The vitamin premix, which was included in all diets, included 440,917 IU/kg of cholecalciferol (Vitamin D3)Table 1 Description for experimental groups.1

Table 1Experimental groups	Eimeria challenging	Ca (Ca) & phosphorous (P)	Supplementation of 25-hydroxycholecalciferol (25-OHD3)	
Treatment 1 (T1)	Oral gavage of PBS	0.84% Ca and 0.44% available P	0 IU/kg	
T2	Oral gavage of PBS	0.64% Ca and 0.24% available P	0 IU/kg	
T3	Oral gavage of PBS	0.84% Ca and 0.44% available P	3,000 IU/kg	
T4	Oral gavage of PBS	0.64% Ca and 0.24% available P	3,000 IU/kg	
T5	Oral gavage of 125,000 E. acervulina, 25,000 E. maxima, and 25,000 E. tenella	0.84% Ca and 0.44% available P	0 IU/kg	
T6	Oral gavage of 125,000 E. acervulina, 25,000 E. maxima, and 25,000 E. tenella	0.64% Ca and 0.24% available P	0 IU/kg	
T7	Oral gavage of 125,000 E. acervulina, 25,000 E. maxima, and 25,000 E. tenella	0.84% Ca and 0.44% available P	3,000 IU/kg	
T8	Oral gavage of 125,000 E. acervulina, 25,000 E. maxima, and 25,000 E. tenella	0.64% Ca and 0.24% available P	3,000 IU/kg	

Sampling

On 5 d post inoculation (dpi), one bird per pen was randomly selected and euthanized via cervical dislocation (Teng et al., 2021a). Blood was immediately drawn from the heart and collected with heparin-free vacutainers (Grainer Bio-One, Kremsmuenster, Austria). Collected blood samples were stood for 1 h to allow clotting and centrifuged at 1,000 × g for 10 min to recover serum. On 6 dpi, one bird per pen was randomly selected and euthanized via cervical dislocation. Both tissue and digesta samples were collected from the upper jejunum (10 cm below duodenum-jejunum junction) and ceca, and snap frozen. Collected serum, tissue, and digesta samples were stored at - 80°C for further analyses.

RNA Extraction and Quantitative Real-Time Reverse Transcription PCR

Approximately 100 mg of upper jejunum and ceca tissues were homogenized in QIAzol lysis reagents (Qiagen, Valencia, CA) using a beads beater (Biospec Products, Bartlesville, OK) (Santos et al., 2020). RNA was isolated according to the manufacturer's procedure, and RNA quantity and quality were measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). One microgram of RNA was used to produce the first-strand cDNA using high-capacity cDNA synthesis kits (Applied Biosystems, Foster City, CA). Primers used in the study are shown in Table 2. Quantitative real-time reverse transcription PCR (qRT-PCR) was performed using SYBR Green Master Mix with a Step One thermocycler (Applied Biosystems, Foster City, CA). The final PCR volume (10 μL) was 5 μL of SYBR Green Master Mix, 1.5 μL of cDNA, 0.5 μL of forward and reverse primers (10 μM), and 2.5 μL of water. Thermal cycle conditions for all reactions were as follows: 95°C denature for 10 min, 40 cycles at 95°C for 15 s and 60°C for 1 min, 95°C for 15 s, 60°C for 1 min and 95°C for 15 s (Castro et al., 2020). The melting curve of each gene was checked to confirm the specificity of each PCR product. Several PCR products from each gene were stained with 6 × DNA loading dye (Thermo Fisher Scientific, Waltham, MA), electrophoresed on a 3% agarose gel in a Tris-acetate-EDTA buffer, and visualized by adding ethidium bromide to confirm the specificity of each PCR product. The geometric mean of Ct values of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and beta-actin were used as reference values to normalize all target genes’ mRNA abundance (Vandesompele et al., 2002). Relative mRNA abundance of target genes was determined by using the 2−∆∆Ct method (Livak and Schmittgen, 2001), and the T1 group (control) was selected as reference group. Each sample was analyzed in duplicate, and the negative control, containing water instead of cDNA, was included in each run.Table 2 Primers used in the study.1

Table 2	Forward (5′ to 3′)	Reverse (5′ to 3′)	Amplicon	Accession number	
VDR	ATGTTCACCTGTCCGTTCAA	TTCATCATCCCAATGTCCAC	104	NM_205098.2	
AvBD3	CCACCCAGTGCAGAATAAGA	GCTCTTCCACAGCAGGAAAT	106	NM_204650.2	
AvBD5	CTCTTTGCTGTCCTCCTCCT	CTGGAGGACATGACTTGTGG	118	NC_052534.1	
AvBD9	GCTGACACCTTAGCATGCAG	CATTTGCAGCATTTCAGCTT	113	KR136304.1	
CATH3	GCTGTGGACTCCTACAACCA	CCATGATGGTGAAGTTGAGG	124	NM_001311177.2	
LEAP2	TATTCTTCTCGCTGCTGCTC	AGGCTCCAACAGGTCTCAGT	123	NM_001001606.2	
TLR2	CGGTGGAAAGGGAGAAAG	CTTGCCACATCAGCTTCATT	103	NM_204278.1	
TLR3	GGCTAAACGACACTCAAGCA	CTTGCAGGCTGAGGTATCAA	113	NC_052535.1	
TLR4	CCTGGACTTGGACCTCAGTT	TTGTATGGATGTGGCACCTT	110	AY064697.1	
TLR5	CGTTAGTGAGAATGGCTGGA	TGAGCCCATTGTATGAGAGC	106	XM_040697311.1	
GAPDH	GCTAAGGCTGTGGGGAAAGT	TCAGCAGCAGCCTTCACTAC	161	NM_204305.2	
Beta actin	CAACACAGTGCTGTCTGGTGGTA	ATCGTACTCCTGCTTGCTGATCC	205	NM_205518.2	
1 VDR: vitamin D receptor; AvBD: avian beta defensin; CATH3: Cathelicidin 3; LEAP2: liver-expressed antimicrobial peptide 2; TLR: toll like receptor; GAPDH: glyceraldehyde 3-phosphate dehydrogenase.

Brush Border Digestive Enzyme Activities, Total Antioxidant Capacity, and Serum Endotoxin Level

Approximately 100 mg of upper jejunum and ceca tissues were homogenized in PBS using a beads beater (Biospec Products, Bartlesville, OK). The samples were centrifuged at 12,000 × g for 15 min at 4°C, and the protein concentrations of the supernatants were analyzed using Pierce BCA protein assay kits according to the manufacturer's procedure (Thermo Fisher Scientific, Waltham, MA). The activities of maltase and sucrase in the supernatants were analyzed according to the procedure of Lackeyram et al. (2010). Briefly, 100 μL supernatants were mixed with 400 μL maltose (75 mM) and sucrose solution (75 mM), separately and incubated at 41°C for 30 min. Afterwards, the concentrations of glucose were determined using a Glucose Oxidase Reagent Set (Pointe Scientific, Canton, MI) according to the manufacturer's procedure. The activities of lipase in the supernatants was determined according to the method of Elgharbawy et al. (2018), the 10-time diluted supernatants (60 μL) were incubated with 1 mg/mL p-nitrophenyl palmitate solution (Sigma-Aldrich Co., St Louis, MO; 140 μL) at 41°C for 30 min. The activities of leucine aminopeptidase (LAP) were assayed by incubating 100 μL supernatant with 100 μL 1 mg/mL l-leucine-p-nitroanilide solution (Sigma-Aldrich Co., St Louis, MO) at 41°C for 30 min according to Maroux et al. (1973). To determine activities of alkaline phosphatase in the tissue or in the serum, the 20 μl tissue supernatant (2-time dilution) and serum (10-time dilution) were incubated with 180 μL 10 mM p-nitrophenyl phosphate solution at 41°C for 60 min according to Lackeyram et al. (2010). The absorbance of the end products (p-nitrophenyl and p-nitroanilide) was determined at 400 nm by using a spectrophotometer (VICTOR Nivo, Perkin Elmer, Pontyclun, United Kingdom) and quantify using a prepared standard curve. The activities of the brush border digestive enzymes were expressed as their end-product level per mg protein per min. The activities of serum alkaline phosphatase were expressed as their end-product level per mL serum per min.

Total antioxidant capacity (TAC) of the upper jejunum and ceca tissues was measured in the collected supernatant by using a commercial kit (QuantiCromAntioxidant Assay Kit, BioAssay Systems, Hayward, CA) after 2-time sample dilution (Tompkins et al., 2023). Serum endotoxin concentrations were determined using a Pierce LAL Chromogenic Endotoxin Quantitation Kit (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer's protocol after 10-time sample dilution.

DNA Extraction and 16s rRNA Analysis

DNA was extracted from the contents of mid-ceca by using QIAamp DNA stool mini kits (Qiagen GmbH, Hilden, Germany) according to manufacturer procedure. The quality and quantity of extracted DNA was checked using a NanoDrop 2000spectrophotometer (Thermo Fisher Scientific). The 16s rRNA gene sequencing was conducted by LC sciences, LLC (Houston, TX) as described by Choi et al. (2022b), QIIME2 (version 2021.11) was used (Bolyen et al., 2019) for the 16s rRNA analysis. By using the QIIME2 demux emp-paired function and QIIME2 plugin DADA2, sequences were demultiplexed and denoised, respectively. A phylogenetic tree of ASV was created, and the taxonomy of each ASV was classified by using a pretrained classifier the reference SILVA database, and the phylum- and family-level composition was presented (Yilmaz et al., 2014). Alpha diversity was analyzed by QIIME2’s built-in functions.

Statistical Analysis

SAS (version 9.4; SAS Inst. Inc., Cary, NC) and GraphPad Prism (Version 9.1.0; GraphPad Software, San Diego, CA) were used for statistical analyses and graph construction. All groups were compared using PROC MIXED based on a 2 × 2 × 2 factorial design with main effects of Eimeria challenging (E), dietary Ca and P level (Ca&P), and 25-OHD3 supplementation (25-OHD3). The interactions (E × Ca&P, E × 25-OHD3, Ca&P × 25-OHD3, and E × Ca&P × 25-OHD3) among the main effects were investigated. Differences between means were compared using the Tukey's HSD (honestly significant difference) test. Statistical significance was set at P < 0.05, and trends (0.05 ≤ P ≤ 0.1) were also presented. Selected parameters with statistical differences (P < 0.10) in interactions are shown in figures.

RESULTS

Relative mRNA Expression of VDR, Antimicrobial Peptides, and TLR in the Jejunum and Ceca

Relative mRNA expression of VDR, antimicrobial peptides, and TLR in the jejunum of broiler chickens infected with Eimeria spp. and fed different levels of Ca, P, and 25-OHD3 are shown in Table 3 and Figure 1. While statistical differences were not observed, reduced dietary Ca and P numerically decreased relative mRNA expression of jejunal VDR (P = 0.106). The reduced dietary Ca and P level decreased the relative mRNA expression of jejunal avian beta defensin 5 (AvBD5) in the Eimeria challenging condition (interaction; P < 0.05). The reduced dietary Ca and P level tended to decrease the relative mRNA expression of jejunal AvBD9 in the Eimeria challenging condition (interaction; P = 0.051). Eimeria challenging significantly increased relative mRNA expression of jejunal cathelicidin 3 (CATH3), whereas the reduced dietary Ca and P level tended to decrease relative mRNA expression of jejunal CATH3 (P = 0.062). The reduced dietary Ca and P level decreased the relative mRNA expression of jejunal CATH3 in the Eimeria challenging condition (interaction; P < 0.05). Eimeria challenging significantly decreased relative mRNA expression of jejunal liver-expressed antimicrobial peptide 2 (LEAP2). The reduced dietary Ca and P level tended to decrease the relative mRNA expression of jejunal TLR3 in the Eimeria challenging condition (interaction; P = 0.067). The reduced dietary Ca and P level decreased the relative mRNA expression of jejunal TLR5 in the Eimeria challenging condition (interaction; P < 0.05).Table 3 Effects of the reduced dietary calcium (Ca) and phosphorous (P) level with the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the relative mRNA abundance of vitamin D receptor, antimicrobial peptides, and toll like receptors in the upper jejunum of broiler chickens in the general and Eimeria challenging condition.1

Table 3	E	Ca&P	25-OHD3	VDR	AvBD3	AvBD5	AvBD9	CATH3	LEAP2	TLR2	TLR3	TLR4	TLR5	
T1	NC	N	NS	1.308	1.934	1.724	1.529	1.559b	1.529	1.187	1.458	1.379	1.186	
T2	NC	R	NS	0.959	4.244	2.571	9.767	1.519b	1.222	1.595	1.176	1.602	1.863	
T3	NC	N	S	1.325	1.858	1.778	2.462	1.228b	1.450	3.310	1.548	2.357	1.997	
T4	NC	R	S	1.429	2.947	2.602	4.951	1.500b	1.774	3.212	2.136	1.819	2.545	
T5	C	N	NS	1.283	13.02	3.173	15.85	4.400ab	0.456	4.492	3.477	2.293	1.933	
T6	C	R	NS	0.477	2.412	1.927	4.906	3.015ab	0.076	2.469	1.354	1.979	1.118	
T7	C	N	S	1.267	11.74	3.827	14.14	5.896a	0.520	5.734	3.303	2.785	2.117	
T8	C	R	S	0.419	2.381	1.598	3.391	2.624ab	0.141	2.064	1.403	1.616	0.925	
SEM2	0.994	12.29	2.021	0.994	1.994	1.107	3.182	1.992	1.751	1.327	
P value											
Treatments3	0.464	0.564	0.497	0.464	0.002	0.054	0.242	0.293	0.875	0.383	
E	0.178	0.198	0.433	0.231	<0.001	0.001	0.146	0.169	0.458	0.334	
Ca&P	0.106	0.250	0.445	0.500	0.062	0.564	0.151	0.114	0.379	0.613	
25-OHD3	0.720	0.851	0.861	0.661	0.744	0.640	0.220	0.689	0.517	0.339	
E × Ca&P	0.227	0.107	0.033	0.051	0.040	0.547	0.110	0.067	0.567	0.041	
E × 25-OHD3	0.628	0.996	0.919	0.968	0.531	0.789	0.434	0.612	0.600	0.333	
Ca&P × 25-OHD3	0.721	0.999	0.669	0.732	0.498	0.624	0.561	0.637	0.429	0.742	
E × Ca&P × 25-OHD3	0.668	0.863	0.683	0.714	0.345	0.626	0.758	0.780	0.963	0.873	
1 E: Eimeria challenging (oral gavage of water or oral gavage of 125,000 Eimeria acervulina, 25,000 Eimeria maxima, and 25,000 Eimeria tenella on D 14), NC: Eimeria non-challenged, C: Eimeria challenged, Ca&P: dietary calcium and phosphorus levels (0.84% Ca and 0.42% available P or 0.64% Ca and 0.24% available P), N: normal dietary Ca and P level, R: reduced dietary Ca and P level, 25-OHD3: supplementation of 25-OHD3 (3,000 IU/kg), NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented, T: treatment, VDR, vitamin D receptor; AvBD, avian beta defensin; CATH3, Cathelicidin 3; LEAP2, liver-expressed antimicrobial peptide 2; TLR, toll like receptor. All groups were compared using PROC MIXED based on a 2 × 2 × 2 factorial design with main effects of Eimeria challenging (E), dietary Ca and P level (Ca&P), and 25-OHD3 supplementation (25-OHD3). The interactions (E × Ca&P, E × 25-OHD3, Ca&P × 25-OHD3, and E × Ca&P × 25-OHD3) among the main effects were investigated. Different letters within the same column indicates significant differences according to the Tukey's HSD (honestly significant difference) test (P < 0.05).

2 SEM: Standard error of the mean.

3 P values for all treatments comparison.

Figure 1 Interactions between Eimeria challenging (E), the dietary calcium (Ca) and phosphorous (P) levels (Ca&P), and the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the relative mRNA abundance of antimicrobial peptides (AvBD5, AvBD9, and CaTH3) and toll like receptors (TLR3 and TLR5) in the upper jejunum and ceca of broiler chickens. Selected parameters with statistical differences (P < 0.10) in interactions are shown. Different letters indicate statistically significant differences (P < 0.05). NC: Eimeria non-challenged; C: Eimeria challenged; N: normal dietary Ca and P level; N: normal dietary Ca and P level; R: reduced dietary Ca and P level; NS: 25-OHD3 non-supplemented; S: 25-OHD3 supplemented; AvBD: avian beta defensin; CATH3, Cathelicidin 3; TLR: toll like receptors

Figure 1

Relative mRNA expression of VDR, antimicrobial peptides, and TLRs in the ceca of broiler chickens infected with Eimeria spp. and fed different levels of Ca, P, and 25-OHD3 is presented in Table 4. Eimeria challenging significantly upregulated mRNA expression of cecal VDR. Eimeria challenging significantly upregulated mRNA expression of cecal AvBD3, AvBD9, and CATH3. The relative mRNA expression of LEAP2 tended to be decreased by Eimeria challenging (P = 0.068). The relative mRNA expression of TLR3 was significantly downregulated by Eimeria challenging. The relative mRNA expression of TLR4 and TLR5 was significantly upregulated and downregulated, respectively, by Eimeria challenging. There were interactions between the dietary Ca and P level and supplementation of 25-OHD3 in the Eimeria challenging condition on cecal TLR4 (tendency; P = 0.063) and in cecal TLR5 (tendency; P = 0.069).Table 4 Effects of the reduced dietary calcium (Ca) and phosphorous (P) level with the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the relative mRNA abundance of vitamin D receptor, antimicrobial peptides, and toll like receptors in the ceca of broiler chickens in the general and Eimeria challenging condition.1

Table 4	E	Ca&P	25-OHD3	VDR	AvBD3	AvBD5	AvBD9	CATH3	LEAP2	TLR2	TLR3	TLR4	TLR5	
T1	NC	N	N	1.240	1.084	1.127	1.138	1.269	1.043	1.090	1.100	1.073bc	1.161ab	
T2	NC	L	N	1.233	1.131	2.044	1.196	1.320	1.637	0.788	1.412	0.802c	2.669a	
T3	NC	N	S	1.265	1.067	0.978	1.405	2.075	1.515	1.110	1.387	0.937bc	1.307ab	
T4	NC	L	S	1.243	0.837	0.863	1.077	1.427	1.883	1.063	1.448	1.276bc	1.006b	
T5	C	N	N	3.669	4.131	0.525	4.416	5.226	0.889	1.014	1.100	1.931ab	0.668b	
T6	C	L	N	4.505	3.894	1.596	3.711	4.322	1.309	1.011	0.650	2.432a	0.327b	
T7	C	N	S	2.799	2.420	0.834	3.483	5.937	1.003	1.548	0.763	1.757abc	0.614b	
T8	C	L	S	3.738	3.461	1.408	1.138	3.491	0.877	1.024	0.871	1.555abc	0.411b	
SEM2		2.921	1.485	2.077	3.699	0.925	0.508	0.639	0.594	0.892	
P value											
Treatments3	0.024	0.240	0.715	0.240	0.182	0.448	0.408	0.261	<0.001	0.002	
E	<0.001	0.006	0.708	0.002	0.004	0.068	0.357	0.012	<0.001	<0.001	
Ca&P	0.471	0.855	0.162	0.671	0.361	0.246	0.143	0.968	0.596	0.528	
25-OHD3	0.508	0.471	0.484	0.661	0.854	0.709	0.159	0.782	0.306	0.162	
E × Ca&P	0.456	0.771	0.625	0.808	0.523	0.536	0.763	0.344	0.737	0.101	
E × 25-OHD3	0.490	0.590	0.403	0.591	0.810	0.337	0.670	0.560	0.050	0.146	
Ca&P × 25-OHD3	0.971	0.769	0.378	0.991	0.603	0.474	0.653	0.683	0.892	0.117	
E × Ca&P × 25-OHD3	0.962	0.647	0.757	0.786	0.845	0.766	0.192	0.285	0.063	0.069	
1 E: Eimeria challenging (oral gavage of water or oral gavage of 125,000 Eimeria acervulina, 25,000 Eimeria maxima, and 25,000 Eimeria tenella on D 14), NC: Eimeria non-challenged, C: Eimeria challenged, Ca&P: dietary calcium and phosphorus levels (0.84% Ca and 0.42% available P or 0.64% Ca and 0.24% available P), N: normal dietary Ca and P level, R: reduced dietary Ca and P level, 25-OHD3: supplementation of 25-OHD3 (3,000 IU/kg), NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented, T: treatment, VDR, vitamin D receptor; AvBD, avian beta defensin; CATH3, Cathelicidin 3; LEAP2, liver-expressed antimicrobial peptide 2; TLR, toll like receptor. All groups were compared using PROC MIXED based on a 2 × 2 × 2 factorial design with main effects of Eimeria challenging (E), dietary Ca and P level (Ca&P), and 25-OHD3 supplementation (25-OHD3). The interactions (E × Ca&P, E × 25-OHD3, Ca&P × 25-OHD3, and E × Ca&P × 25-OHD3) among the main effects were investigated. Different letters within the same column indicates significant differences according to the Tukey's HSD (honestly significant difference) test (P < 0.05).

2 SEM: Standard error of the mean.

3 P values for all treatments comparison.

Brush Border Digestive Enzyme Activities and TAC in the Jejunum and Ceca

Brush border digestive enzyme activities and TAC in the jejunum and ceca of broiler chickens infected with Eimeria spp. and fed different levels of Ca, P, and 25-OHD3 are shown in Table 5 and Figure 2. Eimeria challenging significantly decreased activities of jejunal sucrase, maltase, and IAP and tended to decrease activities of jejunal lipase (P = 0.064). The activities of jejunal sucrase was increased when fed reduced dietary Ca and P level with the supplementation of 25-OHD3 (interaction; P < 0.05). The activities of jejunal maltase tended to be reduced in the Eimeria challenging condition (interaction; P = 0.060). The supplementation of 25-OHD3 tended to increase the activities of jejunal lipase (P = 0.096). Eimeria challenging significantly decreased the activities of cecal IAP. No significant difference was observed in TAC of the jejunum and ceca among the treatments (P > 0.10).Table 5 Effects of the reduced dietary calcium (Ca) and phosphorous (P) level with the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the activities of brush border digestive enzymes including sucrase (nmol glucose released/mg protein/min), maltase (nmol glucose released/mg protein/min), intestinal alkaline phosphatase (IAP; μmol p-nitrophenol liberated/mg protein/min), leucine aminopeptidase (LAP; μmol p-nitrophenol liberated/mg protein/min), and lipase (mmol p-nitrophenyl phosphate liberated/mg protein/min) in the upper jejunum and ceca of broiler chickens in the general and Eimeria challenging condition1

Table 5				Jejunum	Ceca	
	E	Ca&P	25-OHD3	Sucrase	Maltase	IAP	LAP	Lipase	IAP	
T1	NC	N	N	0.218a	0.734ab	0.259abc	31.94	0.473	0.225	
T2	NC	L	N	0.191ab	0.748ab	0.272ab	31.96	0.499	0.207	
T3	NC	N	S	0.129ab	0.629ab	0.241abcd	31.04	0.525	0.204	
T4	NC	L	S	0.227a	0.815a	0.293a	31.50	0.523	0.218	
T5	C	N	N	0.162ab	0.597ab	0.138d	33.98	0.452	0.178	
T6	C	L	N	0.075b	0.452b	0.145cb	32.19	0.478	0.165	
T7	C	N	S	0.141ab	0.570ab	0.134d	32.37	0.476	0.154	
T8	C	L	S	0.163ab	0.552ab	0.164bcd	31.54	0.489	0.172	
SEM2	0.077	0.162	0.064	4.67	0.056	0.042	
P value							
Treatments3	0.033	0.007	<0.001	0.982	0.334	0.042	
E	0.016	<0.001	<0.001	0.503	0.064	0.001	
Ca&P	0.956	0.843	0.177	0.693	0.343	0.975	
25-OHD3	0.889	0.854	0.798	0.505	0.096	0.564	
E × Ca&P	0.139	0.060	0.718	0.569	0.820	0.860	
E × 25-OHD3	0.187	0.553	0.875	0.867	0.534	0.886	
Ca&P × 25-OHD3	0.013	0.119	0.395	0.796	0.554	0.208	
E × Ca&P × 25-OHD3	0.868	0.814	0.830	0.925	0.817	0.984	
1 E: Eimeria challenging (oral gavage of water or oral gavage of 125,000 Eimeria acervulina, 25,000 Eimeria maxima, and 25,000 Eimeria tenella on D 14), NC: Eimeria non-challenged, C: Eimeria challenged, Ca&P: dietary calcium and phosphorus levels (0.84% Ca and 0.42% available P or 0.64% Ca and 0.24% available P), N: normal dietary Ca and P level, R: reduced dietary Ca and P level, 25-OHD3: supplementation of 25-OHD3 (3,000 IU/kg), NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented, T: treatment, IAP: intestinal alkaine phosphatase, LAP, leucine aminopeptidase. All groups were compared using PROC MIXED based on a 2 × 2 × 2 factorial design with main effects of Eimeria challenging (E), dietary Ca and P level (Ca&P), and 25-OHD3 supplementation (25-OHD3). The interactions (E × Ca&P, E × 25-OHD3, Ca&P × 25-OHD3, and E × Ca&P × 25-OHD3) among the main effects were investigated. Different letters within the same column indicates significant differences according to the Tukey's HSD (honestly significant difference) test (P < 0.05).

2 SEM: Standard error of the mean.

3 P values for all treatments comparison.

Figure 2 Interactions between Eimeria challenging (E), the dietary calcium (Ca) and phosphorous (P) levels (Ca&P), and the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the activities of brush border digestive enzymes including jejunal sucrase (nmol glucose released/mg protein/min) and jejunal maltase (nmol glucose released/mg protein/min) and serum endotoxin level (EU/mL) in broiler chickens. Selected parameters with statistical differences (P < 0.10) in interactions are shown. Different letters indicate statistically significant differences (P < 0.05). NC: Eimeria non-challenged; C: Eimeria challenged; N: normal dietary Ca and P level; R: reduced dietary Ca and P level; NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented.

Figure 2

Activities of Serum Alkaline Phosphatase and Serum Endotoxin Level

Activities of serum alkaline phosphatase and serum endotoxin level in broiler chickens infected with Eimeria spp. and fed different levels of Ca, P, and 25-OHD3 are shown in Table 6. Eimeria challenging significantly decreased the activities of serum alkaline phosphatase and significantly increased serum endotoxin level. However, 25-OHD3 supplementation significantly decreased serum endotoxin level in the Eimeria challenging condition (interaction; P < 0.05).Table 6 Effects of the reduced dietary calcium (Ca) and phosphorous (P) level with the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the total antioxidant capacity (TAC; µM Trolox Equivalents/mg protein) in the upper jejunum and ceca, activities of serum alkaline phosphatase (μmol p-nitrophenol liberated/mL serum/min), and serum endotoxin level (EU/mL) in broiler chickens in the general and Eimeria challenging condition1

Table 6				TAC			
	E	Ca&P	25-OHD3	Jejunum	Ceca	Serum alkaline phosphatase	Serum endotoxin	
T1	NC	N	N	49.47	36.00	2.670	0.688b	
T2	NC	L	N	50.71	35.41	3.396	0.665b	
T3	NC	N	S	45.31	34.01	3.214	0.837ab	
T4	NC	L	S	45.29	33.35	3.214	1.190ab	
T5	C	N	N	53.23	35.49	2.891	1.445ab	
T6	C	L	N	47.37	36.87	2.696	1.770a	
T7	C	N	S	48.67	37.00	2.767	1.228ab	
T8	C	L	S	52.32	31.21	2.714	0.805ab	
SEM2	6.074	4.870	0.282	0.578	
P value					
Treatments3	0.215	0.465	0.242	0.017	
E	0.131	0.751	0.045	0.008	
Ca&P	0.890	0.321	0.492	0.730	
25-OHD3	0.198	0.152	0.712	0.451	
E × Ca&P	0.628	0.576	0.166	0.525	
E × 25-OHD3	0.163	0.987	0.500	0.008	
Ca&P × 25-OHD3	0.247	0.206	0.402	0.581	
E × Ca&P × 25-OHD3	0.133	0.215	0.216	0.100	
1 E: Eimeria challenging (oral gavage of water or oral gavage of 125,000 Eimeria acervulina, 25,000 Eimeria maxima, and 25,000 Eimeria tenella on D 14), NC: Eimeria non-challenged, C: Eimeria challenged, Ca&P: dietary calcium and phosphorus levels (0.84% Ca and 0.42% available P or 0.64% Ca and 0.24% available P), N: normal dietary Ca and P level, R: reduced dietary Ca and P level, 25-OHD3: supplementation of 25-OHD3 (3,000 IU/kg), NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented, T: treatment. All groups were compared using PROC MIXED based on a 2 × 2 × 2 factorial design with main effects of Eimeria challenging (E), dietary Ca and P level (Ca&P), and 25-OHD3 supplementation (25-OHD3). The interactions (E × Ca&P, E × 25-OHD3, Ca&P × 25-OHD3, and E × Ca&P × 25-OHD3) among the main effects were investigated. Different letters within the same column indicates significant differences according to the Tukey's HSD (honestly significant difference) test (P < 0.05).

2 SEM: Standard error of the mean.

3 P values for all treatments comparison.

Alpha and Beta Diversity of the Microbiota in the Jejunal and Cecal Digesta

Alpha diversity of the microbiota in the jejunal and cecal digesta of broiler chickens infected with Eimeria spp. and fed different levels of Ca, P, and 25-OHD3 are shown in Table 7 and Figure 3. Eimeria infection tended to decrease faith phylogenetic diversity (phylogenetic differences; P = 0.081) and significantly decreased observed features (richness) in the upper jejunal microbiota. Observed features of the microbiota in the jejunal digesta was reduced in the Eimeria challenging condition (interaction; P < 0.05). The reduced level of dietary Ca and P with the supplementation of 25-OHD3 tended to decrease pielou's evenness (P = 0.075) shannon entropy (richness and evenness; P = 0.082) of the microbiota in the jejunal digesta (interaction). In the cecal digesta, the alpha diversity parameters including pielou's evenness, faith phylogenetic diversity, observed features, and shannon entropy were significantly decreased due to Eimeria infection. However, different levels of Ca, P, and 25-OHD3 did not modulate the alpha diversity parameters in the cecal digesta (P > 0.10).Table 7 Effects of the reduced dietary calcium (Ca) and phosphorous (P) level with the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the alpha diversity of the jejunal and cecal microbiota in broiler chickens in the general and Eimeria challenging condition.1

Table 7				Jejunum	Ceca							
	E	Ca&P	25-OHD3	Pielou's evenness	Faith phylogenetic diversity	Observed features	Shannon entropy	Pielou's evenness	Faith phylogenetic diversity	Observed features	Shannon entropy	
T1	NC	N	N	0.445	18.35	207.2ab	3.432	0.647a	17.867ab	258.0abc	5.184a	
T2	NC	L	N	0.503	22.71	325.8a	4.221	0.612ab	18.927a	282.2a	4.991ab	
T3	NC	N	S	0.561	26.25	256.5ab	4.361	0.676a	19.243a	281.3a	5.501a	
T4	NC	L	S	0.450	22.32	275.7ab	3.639	0.692a	18.608a	277.7ab	5.609a	
T5	C	N	N	0.389	20.83	216.8ab	3.036	0.377c	15.473b	207.0c	2.911c	
T6	C	L	N	0.438	17.08	187.2b	3.279	0.411c	15.401b	220.5abc	3.211c	
T7	C	N	S	0.407	21.66	244.2ab	3.232	0.452bc	15.362b	203.8c	3.468bc	
T8	C	L	S	0.333	18.51	203.0ab	2.580	0.424bc	15.173b	214.7bc	3.289c	
SEM2	0.138	5.138	69.14	1.169	0.106	1.654	34.56	0.893				
P value												
Treatments3	0.189	0.081	0.024	0.181	<.0001	<.0001	<.0001	<.0001				
E	0.019	0.059	0.011	0.013	<.0001	<.0001	<.0001	<.0001				
Ca&P	0.632	0.281	0.406	0.802	0.915	0.933	0.268	0.971				
25-OHD3	0.884	0.108	0.599	0.909	0.117	0.709	0.807	0.136				
E × Ca&P	0.861	0.224	0.013	0.726	0.841	0.721	0.924	0.843				
E × 25-OHD3	0.350	0.381	0.585	0.532	0.863	0.469	0.490	0.773				
Ca&P × 25-OHD3	0.075	0.203	0.172	0.082	0.929	0.348	0.449	0.864				
E × Ca&P × 25-OHD3	0.774	0.142	0.277	0.650	0.360	0.414	0.532	0.453				
1 E: Eimeria challenging (oral gavage of water or oral gavage of 125,000 Eimeria acervulina, 25,000 Eimeria maxima, and 25,000 Eimeria tenella on D 14), NC: Eimeria non-challenged, C: Eimeria challenged, Ca&P: dietary calcium and phosphorus levels (0.84% Ca and 0.42% available P or 0.64% Ca and 0.24% available P), N: normal dietary Ca and P level, R: reduced dietary Ca and P level, 25-OHD3: supplementation of 25-OHD3 (3,000 IU/kg), NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented, T: treatment. All groups were compared using PROC MIXED based on a 2 × 2 × 2 factorial design with main effects of Eimeria challenging (E), dietary Ca and P level (Ca&P), and 25-OHD3 supplementation (25-OHD3). The interactions (E × Ca&P, E × 25-OHD3, Ca&P × 25-OHD3, and E × Ca&P × 25-OHD3) among the main effects were investigated. Different letters within the same column indicates significant differences according to the Tukey's HSD (honestly significant difference) test (P < 0.05).

2 SEM: Standard error of the mean.

3 P values for all treatments comparison.

Figure 3 Interactions between Eimeria challenging (E), the dietary calcium (Ca) and phosphorous (P) levels (Ca&P), and the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the alpha diversity of the jejunal microbiota in broiler chickens. Selected parameters with statistical differences (P < 0.10) in interactions are shown. Different letters indicate statistically significant differences (P < 0.05). NC: Eimeria non-challenged; C: Eimeria challenged; N: normal dietary Ca and P level; R: reduced dietary Ca and P level; NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented.

Figure 3

Taxa Abundance

Relative abundance of microbial composition at the phylum level in the upper jejunal digesta of broiler chickens infected with Eimeria spp. and fed different levels of Ca, P, and 25-OHD3 is presented in Table 8 and Figure 4. The phylum Firmicutes, Cyanobacteria, Proteobacteria, Bacteroidetes, and Actinobacteria were the most abundant phylum groups in the upper jejunal digesta. Eimeria challenging significantly decreased the relative abundance of phylum Firmicutes, Cyanobacteria, and Actinobacteria in the microbiota of the upper jejunal digesta. In the microbiota of the upper jejunal digesta, the relative abundance of the phylum Bacteroidetes and Actinobacteria was decreased due to the reduced dietary Ca and P level with the supplementation of 25-OHD3 (interaction; P < 0.05).Table 8 Effects of the reduced dietary calcium (Ca) and phosphorous (P) level with the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the relative taxa abundance (%) at the phylum level in the jejunal microbiota in broiler chickens in the general and Eimeria challenging condition.1

Table 8	E	Ca&P	25-OHD3	Firmicutes	Cyanobacteria	Proteobacteria	Bacteroidetes	Actinobacteria	Unassigned	
T1	NC	N	N	57.08	30.72	8.56	1.084	0.766ab	1.784	
T2	NC	L	N	48.25	22.97	23.89	2.087	0.875ab	1.935	
T3	NC	N	S	67.31	8.97	17.15	1.688	1.436a	3.449	
T4	NC	L	S	56.75	29.47	10.52	1.255	0.433b	1.577	
T5	C	N	N	36.19	10.92	20.71	1.174	0.388b	30.62	
T6	C	L	N	54.86	7.82	4.80	2.092	0.447b	29.98	
T7	C	N	S	31.55	8.62	5.49	1.163	0.692ab	52.49	
T8	C	L	S	36.88	9.69	34.16	0.846	0.372b	18.05	
SEM2	27.41	17.71	22.56	0.912	0.469		
P value							
Treatments3	0.291	0.101	0.305	0.160	0.005		
E	0.033	0.010	0.848	0.431	0.005		
Ca&P	0.885	0.603	0.415	0.272	0.039		
25-OHD3	0.903	0.448	0.721	0.166	0.402		
E × Ca&P	0.178	0.474	0.877	0.976	0.248		
E × 25-OHD3	0.199	0.473	0.472	0.334	0.998		
Ca&P × 25-OHD3	0.637	0.121	0.391	0.015	0.009		
E × Ca&P × 25-OHD3	0.716	0.246	0.015	0.851	0.183		
1 E: Eimeria challenging (oral gavage of water or oral gavage of 125,000 Eimeria acervulina, 25,000 Eimeria maxima, and 25,000 Eimeria tenella on D 14), NC: Eimeria non-challenged, C: Eimeria challenged, Ca&P: dietary calcium and phosphorus levels (0.84% Ca and 0.42% available P or 0.64% Ca and 0.24% available P), N: normal dietary Ca and P level, R: reduced dietary Ca and P level, 25-OHD3: supplementation of 25-OHD3 (3,000 IU/kg), NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented, T: treatment. All groups were compared using PROC MIXED based on a 2 × 2 × 2 factorial design with main effects of Eimeria challenging (E), dietary Ca and P level (Ca&P), and 25-OHD3 supplementation (25-OHD3). The interactions (E × Ca&P, E × 25-OHD3, Ca&P × 25-OHD3, and E × Ca&P × 25-OHD3) among the main effects were investigated. Different letters within the same column indicates significant differences according to the Tukey's HSD (honestly significant difference) test (P < 0.05).

2 SEM: Standard error of the mean

3 P values for all treatments comparison

Figure 4 Interactions between Eimeria challenging (E), the dietary calcium (Ca) and phosphorous (P) levels (Ca&P), and the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the taxa abundance of the jejunal and cecal microbiota in broiler chickens. Selected parameters with statistical differences (P < 0.10) in interactions are shown. Different letters indicate statistically significant differences (P < 0.05). NC: Eimeria non-challenged; C: Eimeria challenged; N: normal dietary Ca and P level; R: reduced dietary Ca and P level; NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented.

Figure 4

Relative abundance of microbial composition at the family level in the upper jejunal digesta of broiler chickens infected with Eimeria spp. and fed different levels of Ca, P, and 25-OHD3 is shown in Table 9. Eimeria challenging significantly decreased the relative abundance of the family Peptostreptococcaceae, Burkholderiaceae, Bacillaceae, Lachnospiraceae, Christensenellaceae, Staphylococcaceae, and Ruminococcaceae in the microbiota of the upper jejunal digesta. There were interactions between the dietary Ca and P level and supplementation of 25-OHD3 in the Eimeria challenging condition in the relative abundance of family Enterobacteriaceae in the microbiota of the upper jejunal digesta (P < 0.05). The reduced level of dietary Ca and P significantly decreased the relative abundance of the family Burkholderiaceae in the upper jejunal microbiota. There tended to be interactions between the level of dietary Ca and P and Eimeria infection in the relative abundance of the family Burkholderiaceae in the upper jejunal microbiota (P = 0.084). The supplementation of 25-OHD3 tended to increase the relative abundance of the family Streptococcaceae in the non-challenging condition. The relative abundance of the family Ruminococcaceae tended to be increased due to the reduction in the dietary Ca and P level (P = 0.074). In the microbiota of the upper jejunal digesta, the relative abundance of the family Staphylococcus was decreased by the reduced dietary Ca and P level with the supplementation of 25-OHD3 (interaction; P < 0.05).Table 9 Effects of the reduced dietary calcium (Ca) and phosphorous (P) level with the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the relative taxa abundance (%) at the family level in the jejunal microbiota in broiler chickens in the general and Eimeria challenging condition.1

Table 9	E	Ca&P	25-OHD3	Enterobacteriaceae	Peptostreptococcaceae	Burkholderiaceae	Streptococcaceae	Bacillaceae	Lachnospiraceae	Christensenellaceae	Staphylococcaceae	Sphingomonadaceae	Ruminococcaceae	Unassigned	
T1	NC	N	N	2.74	12.448	3.422ab	1.193	1.779	4.049	3.727ab	0.581	0.282	0.868	68.91	
T2	NC	L	N	16.56	8.101	1.170ab	0.959	1.949	3.576	6.609a	0.542	0.296	2.080	58.15	
T3	NC	N	S	3.14	26.051	10.843a	2.368	1.770	5.579	4.424ab	0.718	0.847	1.381	42.89	
T4	NC	L	S	6.57	18.900	0.890ab	4.748	2.086	2.055	4.120ab	0.244	0.119	1.534	58.74	
T5	C	N	N	18.34	0.185	0.779ab	1.048	1.216	1.058	1.506b	0.062	0.477	0.697	74.63	
T6	C	L	N	3.20	0.087	0.587b	1.348	0.657	1.250	1.922ab	0.361	0.148	1.275	89.17	
T7	C	N	S	2.65	0.177	1.107ab	1.508	0.944	1.289	1.395b	0.196	0.388	0.792	89.56	
T8	C	L	S	32.04	0.222	0.387b	0.549	0.359	0.750	1.828ab	0.025	0.328	0.841	62.67	
SEM2	22.11	21.25	5.518	2.752	1.397	3.205	2.725	0.435	0.604	0.941		
P value												
Treatments3	0.226	0.255	0.033	0.208	0.287	0.117	0.020	0.075	0.547	0.185		
E	0.293	0.012	0.041	0.131	0.009	0.005	<0.001	0.007	0.772	0.044		
Ca&P	0.224	0.640	0.046	0.636	0.686	0.247	0.282	0.449	0.122	0.074		
25-OHD3	0.890	0.324	0.261	0.146	0.786	0.944	0.529	0.474	0.496	0.733		
E × Ca&P	0.907	0.644	0.084	0.374	0.319	0.330	0.586	0.209	0.645	0.501		
E × 25-OHD3	0.378	0.329	0.278	0.097	0.667	0.941	0.617	0.938	0.672	0.780		
Ca&P × 25-OHD3	0.189	0.914	0.204	0.666	0.941	0.313	0.320	0.079	0.502	0.152		
E × Ca&P × 25-OHD3	0.038	0.905	0.267	0.222	0.915	0.534	0.315	0.945	0.155	0.629		
1 E: Eimeria challenging (oral gavage of water or oral gavage of 125,000 Eimeria acervulina, 25,000 Eimeria maxima, and 25,000 Eimeria tenella on D 14), NC: Eimeria non-challenged, C: Eimeria challenged, Ca&P: dietary calcium and phosphorus levels (0.84% Ca and 0.42% available P or 0.64% Ca and 0.24% available P), N: normal dietary Ca and P level, R: reduced dietary Ca and P level, 25-OHD3: supplementation of 25-OHD3 (3,000 IU/kg), NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented, T: treatment. All groups were compared using PROC MIXED based on a 2 × 2 × 2 factorial design with main effects of Eimeria challenging (E), dietary Ca and P level (Ca&P), and 25-OHD3 supplementation (25-OHD3). The interactions (E × Ca&P, E × 25-OHD3, Ca&P × 25-OHD3, and E × Ca&P × 25-OHD3) among the main effects were investigated. Different letters within the same column indicates significant differences according to the Tukey's HSD (honestly significant difference) test (P < 0.05).

2 SEM: Standard error of the mean.

3 P values for all treatments comparison.

Relative abundance of microbial composition at the phylum level in the microbiota of the cecal digesta of broiler chickens infected with Eimeria spp. and fed different levels of Ca, P, and 25-OHD3 is shown in Table 10 and Figure 4. In the microbiota of the cecal digesta, the relative abundance of the phylum Proteobacteria was significantly increased by Eimeria challenging. In the microbiota of the cecal digesta, the relative abundance of the phylum Bacteroidetes tended to be increased by Eimeria challenging (P = 0.068). The supplementation of 25-OHD3 significantly decreased the relative abundance of Bacteroidetes in the microbiota of the cecal digesta. The Eimeria challenging tended to decrease the relative abundance of the phylum Cyanobacteria in the microbiota of the cecal digesta (P = 0.054).Table 10 Effects of the reduced dietary calcium (Ca) and phosphorous (P) level with the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the relative taxa abundance (%) at the phylum level in the cecal microbiota in broiler chickens in the general and Eimeria challenging condition1

Table 10	E	Ca&P	25-OHD3	Proteobacteria	Bacteroidetes	Firmicutes	Cyanobacteria	Actinobacteria	Unassigned	
T1	NC	N	N	12.20ab	18.92	65.30a	0.092	0.813	2.673	
T2	NC	L	N	18.15ab	18.02	59.98a	0.064	1.000	2.793	
T3	NC	N	S	8.56b	16.05	69.00a	0.127	0.996	5.268	
T4	NC	L	S	6.67b	12.78	75.79a	0.104	0.924	3.735	
T5	C	N	N	44.20ab	29.31	24.21b	0.054	0.456	1.778	
T6	C	L	N	32.08ab	34.60	31.02b	0.087	0.579	1.622	
T7	C	N	S	45.50ab	18.23	32.18b	0.062	0.759	3.272	
T8	C	L	S	50.66a	16.82	29.42b	0.049	0.913	2.137	
SEM2	21.22	15.31	14.15	0.448	0.934	1.667	
P value							
Treatments3	<0.001	0.232	<0.001	0.050	0.338		
E	<.0001	0.068	<.0001	0.054	0.290		
Ca&P	0.907	0.987	0.737	0.453	0.356		
25-OHD3	0.847	0.043	0.121	0.157	0.340		
E × Ca&P	0.656	0.651	0.875	0.757	0.367		
E × 25-OHD3	0.161	0.247	0.426	0.312	0.329		
Ca&P × 25-OHD3	0.702	0.611	0.878	0.662	0.313		
E × Ca&P × 25-OHD3	0.312	0.808	0.192	0.581	0.304		
1 E: Eimeria challenging (oral gavage of water or oral gavage of 125,000 Eimeria acervulina, 25,000 Eimeria maxima, and 25,000 Eimeria tenella on D 14), NC: Eimeria non-challenged, C: Eimeria challenged, Ca&P: dietary calcium and phosphorus levels (0.84% Ca and 0.42% available P or 0.64% Ca and 0.24% available P), N: normal dietary Ca and P level, R: reduced dietary Ca and P level, 25-OHD3: supplementation of 25-OHD3 (3,000 IU/kg), NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented, T: treatment. All groups were compared using PROC MIXED based on a 2 × 2 × 2 factorial design with main effects of Eimeria challenging (E), dietary Ca and P level (Ca&P), and 25-OHD3 supplementation (25-OHD3). The interactions (E × Ca&P, E × 25-OHD3, Ca&P × 25-OHD3, and E × Ca&P × 25-OHD3) among the main effects were investigated. Different letters within the same column indicates significant differences according to the Tukey's HSD (honestly significant difference) test (P < 0.05).

2 SEM: Standard error of the mean

3 P values for all treatments comparison

Relative abundance of microbial composition at the family level in the upper jejunal digesta of broiler chickens infected with Eimeria spp. and fed different levels of Ca, P, and 25-OHD3 is presented in Table 11. Eimeria challenging significantly increased the relative abundance of the family Enterobacteriaceae in the microbiota of the cecal digesta. Eimeria challenging significantly decreased the relative abundance of the family Ruminococcaceae, Christensenellaceae, Lachnospiraceae, and Erysipelotrichaceae in the microbiota of the cecal digesta. The supplementation of 25-OHD3 significantly increased the relative abundance of the family Ruminococcaceae in the microbiota of the cecal digesta. The supplementation of 25-OHD3 increased the relative abundance of the family Ruminococcaceae more dramatically in the non-challenging condition compared to the Eimeria challenging condition (interaction; P < 0.05)Table 11 Effects of the reduced dietary calcium (Ca) and phosphorous (P) level with the supplementation of 25-hydroxycholecalciferol (25-OHD3) on the relative taxa abundance (%) at the family level in the cecal microbiota in broiler chickens in the general and Eimeria challenging condition.1

Table 11	E	Ca&P	25-OHD3	Enterobacteriaceae	Ruminococcaceae	Christensenellaceae	Lachnospiraceae	Bacillaceae	Streptococcaceae	Peptostreptococcaceae	Erysipelotrichaceae	Sphingomonadaceae	Planococcaceae	Unassigned	
T1	NC	N	N	11.04ab	14.70ab	21.71ab	6.337	1.339	0.680	0.378	0.204	0.118	0.039	43.44	
T2	NC	L	N	16.71ab	10.55b	20.49abc	8.726	1.134	0.693	0.309	0.487	0.210	0.111	40.58	
T3	NC	N	S	6.61b	15.60ab	25.96a	5.489	1.555	1.036	0.458	0.400	0.246	0.127	42.53	
T4	NC	L	S	5.11b	26.16a	19.86abc	7.524	0.681	1.456	0.197	0.312	0.239	0.073	38.39	
T5	C	N	N	43.47ab	5.25b	8.59c	1.717	0.867	1.573	0.336	0.171	0.054	0.357	37.61	
T6	C	L	N	31.17ab	7.76b	9.93bc	1.397	1.024	1.211	0.236	0.170	0.267	0.078	46.76	
T7	C	N	S	42.16ab	9.34b	10.04bc	2.883	1.270	1.345	0.292	0.150	0.217	0.013	32.29	
T8	C	L	S	48.80a	3.93b	9.98bc	3.099	0.730	0.801	0.658	0.252	0.287	0.038	31.42	
SEM2	20.95	6.652	6.711	4.017	1.261	1.005	0.394	0.200	0.299	0.321		
P value												
Treatments3	0.001	<0.001	<0.001	0.017	0.922	0.649	0.575	0.051	0.884	0.677		
E	<0.001	<0.001	<0.001	<0.001	0.577	0.364	0.696	0.007	0.969	0.718		
Ca&P	0.951	0.650	0.440	0.357	0.321	0.685	0.888	0.207	0.294	0.529		
25-OHD3	0.990	0.035	0.514	0.861	0.931	0.681	0.452	0.721	0.332	0.373		
E × Ca&P	0.686	0.233	0.274	0.335	0.636	0.256	0.198	0.684	0.568	0.466		
E × 25-OHD3	0.188	0.041	0.786	0.295	0.814	0.138	0.373	0.865	0.941	0.248		
Ca&P × 25-OHD3	0.628	0.382	0.424	0.969	0.354	0.848	0.549	0.254	0.489	0.632		
E × Ca&P × 25-OHD3	0.286	0.005	0.656	0.849	0.985	0.614	0.155	0.046	0.899	0.251		
1 E: Eimeria challenging (oral gavage of water or oral gavage of 125,000 Eimeria acervulina, 25,000 Eimeria maxima, and 25,000 Eimeria tenella on D 14), NC: Eimeria non-challenged, C: Eimeria challenged, Ca&P: dietary calcium and phosphorus levels (0.84% Ca and 0.42% available P or 0.64% Ca and 0.24% available P), N: normal dietary Ca and P level, R: reduced dietary Ca and P level, 25-OHD3: supplementation of 25-OHD3 (3,000 IU/kg), NS: 25-OHD3 non-supplemented, S: 25-OHD3 supplemented, T: treatment. All groups were compared using PROC MIXED based on a 2 × 2 × 2 factorial design with main effects of Eimeria challenging (E), dietary Ca and P level (Ca&P), and 25-OHD3 supplementation (25-OHD3). The interactions (E × Ca&P, E × 25-OHD3, Ca&P × 25-OHD3, and E × Ca&P × 25-OHD3) among the main effects were investigated. Different letters within the same column indicates significant differences according to the Tukey's HSD (honestly significant difference) test (P < 0.05).

2 SEM: Standard error of the mean

3 P values for all treatments comparison

DISCUSSION

The purpose of the study was to investigate the effects of the reduced dietary Ca and P level and supplementation of 25-OHD3 on the expression of VDR, antimicrobial peptides, and TLRs, activities of brush border digestive enzymes, antioxidant capacity, and microbiota in the upper jejunum and ceca of broiler chickens with/without Eimeria challenge. In the current study, Eimeria challenging increased the expression of antimicrobial peptides including AvBD3, AvBD9, and CATH3 in the jejunum and ceca, whereas the expression of LEAP2 was reduced in the jejunum and ceca. These results are consistent with previous studies indicating that Eimeria challenging modulated the expression of antimicrobial peptides in the gastrointestinal tract (Choi and Kim, 2022; Goo et al., 2023). However, there were variations in the trends, with some showing an increase and others reporting a decrease in the expression of antimicrobial peptides under the Eimeria challenging condition. These findings suggest that Eimeria challenging can lead to a decrease in the expression of antimicrobial peptides, while simultaneously inducing overexpression of antimicrobial peptides as a defensive mechanism in birds (Su et al., 2017). Interestingly, the mRNA expression of VDR in the ceca was upregulated by Eimeria challenging in the current study. Several studies showed that the decreased expression of VDR is closely associated with intestinal diseases and inflammation in the large intestine in human models (Kong et al., 2008; Kim et al., 2013; Li et al., 2015). These results potentially suggest that VDR may play an important role in regulating immune systems in the ceca of broiler chickens. In the current study, Eimeria challenging negatively affected the cecal microbiota, which is consistent with our previous studies (Choi et al., 2023a). Potentially, the increased relative abundance of the phylum Proteobacteria and the decreased activities of serum alkaline phosphatase activities would result in an increase on serum endotoxin level in broiler infected with Eimeria spp. in the present study. This is because alkaline phosphatase, which is activated by short chain fatty acids, has an important role in detoxifying endotoxins (Koyama and Ono, 1976; Chen et al., 2010).

In the current study, the upper jejunum was selected for analysis because most of vitamins, Ca, and phosphate are absorbed in the upper gastrointestinal tract in birds (Hurwitz and Bar, 1971; Favus, 1985). It was hypothesized that the major alterations on gut ecosystems by 25-OHD3, Ca, and P should be observed in the upper gastrointestinal tract rather than the lower gastrointestinal tract in broiler chickens, which is supported by a previous by Bashir et al. (2016). Although the upper jejunum is not the main area for microbial activities, the upper jejunal microbiota would be closely associated to gut ecosystem and gut inflammation in the upper gastrointestinal tract, which is the area for nutrient digestion and absorption in broiler chickens (El Aidy et al., 2015; Zhang et al., 2022). Furthermore, alteration of the microbiota in the upper small intestine can influence the microbiota in the large intestine. The ceca, the main area for microbial fermentation with the higher density of microbes, was also analyzed in the current study.

In the current study, the reduced dietary Ca and P level decreased the relative abundance of TLRs including TLR3 and TLR5 and antimicrobial peptides including AvBD5, AvBD9, and CATH3 in the Eimeria challenging condition. Downregulated antimicrobial peptides and TLRs in the Eimeria challenging condition may indicate that defensive mechanisms against Eimeria challenging were not properly activated. In consistent, a previous study by Hofmann et al. (2021) showed that the reduction of dietary Ca and P could compromise the immune system of birds. In the present study, although statistical differences were not obtained, the reduced levels of dietary Ca and P numerically downregulated VDR in the upper jejunum, which is consistent with a previous study by Rodriguez-Lecompte et al. (2016). VDR is known to regulate diverse functions of immune system of animals (Shojadoost et al., 2015; Battistini et al., 2020) and the expression of antimicrobial peptides (Gombart, 2009), which can modulate the microbiota of broiler chickens (Zong et al., 2020). Potentially, the lack of defensive mechanisms in the gut due to the reduced dietary Ca and P level in the Eimeria challenging condition resulted in a decrease observed features in the current study, which is considered as unfavorable for the gut microbiota (Aruwa et al., 2021). In the present study, the activities of upper jejunal maltase were decreased due to the reduced dietary Ca and P level in the Eimeria challenging condition. Eimeria challenging condition negatively altered the absorption and metabolism of dietary Ca and P (Tompkins et al., 2023), which would explain that compromised gut ecosystem by the reduced dietary Ca and P level were mainly observed in the Eimeria challenging condition in the current study. Nevertheless, the reduced level of dietary Ca and P decreased the relative abundance of the family Burkholderiaceae, a potential pathogenic family group (Proszkowiec-Weglarz et al., 2020), in the jejunal microbiota in the non-challenging condition and increased the relative abundance of the family Ruminococcaceae, an important group for producing SCFA (Acharya et al., 2022). These results showed that the reduced level of dietary Ca and P could inhibit or augment the growth of specific microbes. Nonetheless, these differences by the reduced dietary Ca and P level did not result in the modulation of the cecal microbiota in the current study. Overall, the reduced dietary Ca and P level modulated mucosal immunity and microbiota in the upper jejunum of broiler chickens in the non-challenging and Eimeria challenging condition.

Whereas the level of dietary Ca and P is thought to modulate gut ecosystem mainly via altering the expression of VDR in the current study, the supplementation of 25-OHD3 did not alter the expression of VDR and antimicrobial peptides in the upper jejunum and ceca in the current study. A previous study by Capiati et al. (2002) demonstrated that 25-OHD3 can regulate gene expression at the cellular level. However, no studies have shown that feed supplementation of 25-OHD3 can regulate the expression of VDR in the gastrointestinal tract of broiler chickens. A previous study by Rodriguez-Lecompte et al. (2016) showed the supplementation of 25-OHD3 ranging from 200 to 9,800 IU/kg modulated expression of TLRs, cytokines, and antimicrobial peptides in broiler chickens. Based on the results, the supplementation of 5,000 IU/kg 25-OHD3 may not be enough to regulate the gene expression of antimicrobial peptides and TLRs. Nonetheless, the supplementation of 25-OHD3 beneficially modulated the cecal microbiota by decreasing the relative abundance of the phylum Bacteroidetes and increasing the relative abundance of the family Ruminococcaceae. A previous study by Choi et al. (2022a) showed that higher relative abundance of the phylum Bacteroidetes are associated with lower growth performance in broiler chickens. The higher relative abundance of the family Ruminococcaceae, an important group for producing SCFA (e.g., important energy sources for hosts), can be beneficial to improve growth performance broiler chickens (Diaz Carrasco et al., 2018; Choi et al., 2021). Along with this, the supplementation of 25-OHD3 improved activities of lipase in the upper jejunum, and the supplementation of 25-OHD3 decreased the serum endotoxin level in the Eimeria challenging condition in the current study. These results would be associated beneficially modulated gut mucosa layer and gut integrity due to the supplementation of 25-OHD3. Akimbekov et al. (2020) demonstrated that vitamin D has an important role in thickening gut mucosa layer. Potentially, the supplementation of 25-OHD3 thickened the mucosa layer, which increased the relative abundance of the beneficial bacterial group (e.g., family Ruminococcaceae), trapped more lipase (pancreatic enzyme), and improved gut barrier integrity to decrease the permeation of endotoxin into blood circulation. Therefore, the supplementation of 25-OHD3 improved the gut microbiota and gut barrier integrity in broiler chickens in general or under Eimeria challenging condition without influencing the mRNA expression of VDR and antimicrobial peptides. Further studies are needed to elucidate the mode of actions.

The interactions between dietary Ca and P level and 25-OHD3 are well documented in terms of absorption and their effects. However, their interactive effects on the gut microbiota were not well documented yet. In the current study, the reduced level of dietary Ca and P with the supplementation of 25-OHD3 decreased shannon entropy (richness and evenness) of the upper jejunal microbiota. Moreover, in the present study, unfavorable jejunal bacterial groups including the phylum Bacteroidetes and family Staphylococcus was increased by the reduced dietary Ca and P level without the 25-OHD3 supplementation but was decreased by the reduced dietary Ca and P level with the 25-OHD3 supplementation. While the activities of sucrase in the upper jejunum, one of the parameters for gut development, were decreased due to the normal level of dietary Ca and P with 25-OHD3 supplementation, they were increased due to the reduced level of dietary Ca and P level with 25-OHD3 supplementation. These results suggest that the effects of the reduced dietary Ca and P level on the microbiota and gut development in the upper intestine can be modulated by the supplementation of 25-OHD3 while it is hard to determine whether it is beneficial or detrimental effects on broiler chickens.

In conclusion, the reduced dietary Ca and P level affected jejunal microbiota potentially via modulating mucosal immunity in the upper jejunum of broiler chickens in the Eimeria challenging condition. The supplementation of 25-OHD3 improved the gut microbiota and gut barrier integrity in broiler chickens with/without Eimeria challenge. The dietary Ca and P level and 25-OHD3 level can exhibit interactive effects on the gut development and gut microbiota in broiler chickens. Therefore, optimizing dietary Ca, P, and 25-OHD3 levels is crucial for maintaining gut microbiota and health in broiler chickens, especially when combating Eimeria infection.

DISCLOSURES

The authors declare no conflicts of interest.
==== Refs
REFERENCES

Acharya K.D. Parakoyi A.E. Tetel M.J. Endocrine disruption and the gut microbiome Pages 355–376 in Endocrine Disruption and Human Health 2022 Elsevier Amsterdam, Netherlands
Aggeletopoulou I. Thomopoulos K. Mouzaki A. Triantos C. Vitamin D–VDR novel anti-inflammatory molecules—new insights into their effects on liver diseases Int. J. Mol. Sci. 23 2022 8465 35955597
Akimbekov N.S. Digel I. Sherelkhan D.K. Lutfor A.B. Razzaque M.S. Vitamin D and the host-gut microbiome: a brief overview Acta Histochem. Cytochem. 53 2020 33 42 32624628
Apajalahti J. Comparative gut microflora, metabolic challenges, and potential opportunities J. Appl. Poult. Res. 14 2005 444 453
Arababadi M.K. Nosratabadi R. Asadikaram G. Vitamin D and toll like receptors Life Sci 203 2018 105 111 29596922
Aruwa C.E. Pillay C. Nyaga M.M. Sabiu S. Poultry gut health–microbiome functions, environmental impacts, microbiome engineering and advancements in characterization technologies J. Anim. Sci. Biotechnol. 12 2021 1 15 33397465
Bashir M. Prietl B. Tauschmann M. Mautner S.I. Kump P.K. Treiber G. Wurm P. Gorkiewicz G. Högenauer C. Pieber T.R. Effects of high doses of vitamin D 3 on mucosa-associated gut microbiome vary between regions of the human gastrointestinal tract Eur. J. Nutr. 55 2016 1479 1489 26130323
Battistini C. Ballan R. Herkenhoff M.E. Saad S.M.I. Sun J. Vitamin D modulates intestinal microbiota in inflammatory bowel diseases Int. J. Mol. Sci. 22 2020 362 33396382
Blake D.P. Knox J. Dehaeck B. Huntington B. Rathinam T. Ravipati V. Ayoade S. Gilbert W. Adebambo A.O. Jatau I.D. Re-calculating the cost of coccidiosis in chickens Vet. Res. 51 2020 1 14 31924264
Bolyen E. Rideout J.R. Dillon M.R. Bokulich N.A. Abnet C.C. Al-Ghalith G.A. Alexander H. Alm E.J. Arumugam M. Asnicar F. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2 Nat. Biotechnol. 37 2019 852 857 31341288
Capiati D. Benassati S. Boland R.L. 1, 25 (OH) 2-vitamin D3 induces translocation of the vitamin D receptor (VDR) to the plasma membrane in skeletal muscle cells J. Cell. Biochem. 86 2002 128 135 12112023
Castro F.L.S. Teng P.-Y. Yadav S. Gould R.L. Craig S. Pazdro R. Kim W.K. The effects of L-Arginine supplementation on growth performance and intestinal health of broiler chickens challenged with Eimeria spp Poult. Sci. 99 2020 5844 5857 33142502
Chen C. Turner B. Applegate T. Litta G. Kim W. Role of long-term supplementation of 25-hydroxyvitamin D3 on laying hen bone 3-dimensional structural development Poult. Sci. 99 2020 5771 5782 33142495
Chen K.T. Malo M.S. Moss A.K. Zeller S. Johnson P. Ebrahimi F. Mostafa G. Alam S.N. Ramasamy S. Warren H.S. Identification of specific targets for the gut mucosal defense factor intestinal alkaline phosphatase Am. J. Physiol. Gastrointest. 299 2010 G467 G475
Choi J. Goo D. Sharma M.K. Ko H. Liu G. Paneru D. Choppa V.S.R. Lee J. Kim W.K. Effects of different Eimeria inoculation doses on growth performance, daily feed intake, gut health, gut microbiota, foot pad dermatitis, and Eimeria gene expression in broilers raised in floor pens for 35 days Animals 13 2023 2237 37444035
Choi J. Kim W. Interactions of microbiota and mucosal immunity in the ceca of broiler chickens infected with Eimeria tenella Vaccines 10 2022 1941 36423036
Choi J. Ko H. Tompkins Y.H. Teng P.-Y. Lourenco J.M. Callaway T.R. Kim W.K. Effects of eimeria tenella infection on key parameters for feed efficiency in broiler chickens Animals 11 2021 3428 34944205
Choi J. Liu G. Goo D. Wang J. Bowker B. Zhuang H. Kim W.K. Effects of tannic acid supplementation on growth performance, gut health, and meat production and quality of broiler chickens raised in floor pens for 42 days Front. Physiol. 13 2022 1082009
Choi J. Yadav S. Vaddu S. Thippareddi H. Kim W.K. In vitro and in vivo evaluation of tannic acid as an antibacterial agent in broilers infected with Salmonella Typhimurium Poult. Sci. 102 2023 102987
Choi J. Yadav S. Wang J. Lorentz B.J. Lourenco J.M. Callaway T.R. Kim W.K. Effects of supplemental tannic acid on growth performance, gut health, microbiota, and fat accumulation and optimal dosages of tannic acid in broilers Front. Physiol. 13 2022 912797
Cobb-Vantress. 2018. Cobb500 Broiler Performance & Nutrition Supplement, https://www.cobb-vantress.com/assets/5a88f2e793/Broiler-Performance-Nutrition-Supplement.pdf. Accessed July 2022.
Diaz Carrasco J.M. Redondo E.A. Pin Viso N.D. Redondo L.M. Farber M.D. Fernandez Miyakawa M.E. Tannins and bacitracin differentially modulate gut microbiota of broiler chickens Biomed Res. Int 2018 2018 1879168
El Aidy S. Van Den Bogert B. Kleerebezem M. The small intestine microbiota, nutritional modulation and relevance for health Curr. Opin. Biotechnol. 32 2015 14 20 25308830
Elgharbawy A.A. Hayyan A. Hayyan M. Rashid S.N. Nor M.R.M. Zulkifli M.Y. Alias Y. Mirghani M.E.S. Shedding light on lipase stability in natural deep eutectic solvents Chem. Biochem. Eng. Q. 32 2018 359 370
Favus M. Factors that influence absorption and secretion of calcium in the small intestine and colon Am. J. Physiol.-Gastrointest Liver Physiol 248 1985 G147 G157
Gombart A.F. The vitamin D–antimicrobial peptide pathway and its role in protection against infection Future Microbiol 4 2009 1151 1165 19895218
Goo D. Choi J. Ko H. Choppa V.S.R. Liu G. Lillehoj H.S. Kim W.K. Effects of Eimeria maxima infection doses on growth performance and gut health in dual-infection model of necrotic enteritis in broiler chickens Front. Physiol. 14 2023 1269398
Han J. Chen G. Wang J. Zhang J. Qu H. Zhang C. Yan Y. Cheng Y. Evaluation of relative bioavailability of 25-hydroxycholecalciferol to cholecalciferol for broiler chickens Asian-Australas J. Anim. Sci. 29 2016 1145 26954155
Heaney R.P. Vitamin D and calcium interactions: functional outcomes Am. J. Clin. Nutr. 88 2008 541S 544S 18689398
Hofmann T. Schmucker S. Sommerfeld V. Huber K. Rodehutscord M. Stefanski V. Immunomodulatory effects of dietary phosphorus and calcium in two strains of laying hens Animals 11 2021 129 33430096
Hurwitz S. Bar A. Calcium and phosphorus interrelationships in the intestine of the fowl J. Nutr. 101 1971 677 685 5577902
Kim J.-H. Yamaori S. Tanabe T. Johnson C.H. Krausz K.W. Kato S. Gonzalez F.J. Implication of intestinal VDR deficiency in inflammatory bowel disease Biochimica et biophysica acta.-General Sub. 1830 2013 2118 2128
Kim W. Bloomfield S. Ricke S. Effects of age, vitamin D3, and fructooligosaccharides on bone growth and skeletal integrity of broiler chicks Poult. Sci. 90 2011 2425 2432 22010225
Kogut M. Issues and consequences of using nutrition to modulate the avian immune response J. Appl. Poult. Res. 26 2017 605 612
Kong J. Zhang Z. Musch M.W. Ning G. Sun J. Hart J. Bissonnette M. Li Y.C. Novel role of the vitamin D receptor in maintaining the integrity of the intestinal mucosal barrier Am. J. Physiol. Gastrointest. 294 2008 G208 G216
Koyama H. Ono T. Induction by short-chain fatty acids of alkaline phosphatase activity in cultured mammalian cells J. Cell. Physiol. 88 1976 49 56 177433
Kumar S. Shang Y. Kim W.K. Insight into dynamics of gut microbial community of broilers fed with fructooligosaccharides supplemented low calcium and phosphorus diets Front. Vet. Sci. 6 2019 95 30984773
Lackeyram D. Yang C. Archbold T. Swanson K.C. Fan M.Z. Early weaning reduces small intestinal alkaline phosphatase expression in pigs J. Nutr. 140 2010 461 468 20089775
Li Y.C. Chen Y. Du J. Critical roles of intestinal epithelial vitamin D receptor signaling in controlling gut mucosal inflammation J. Steroid Biochem. Mol. Biol. 148 2015 179 183 25603468
Livak K.J. Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method methods 25 2001 402 408 11846609
Lopes T. Shi H. White D. Araújo I. Kim W. Effects of 25-hydroxycholecalciferol on performance, gut health, and bone quality of broilers fed with reduced calcium and phosphorus diet during Eimeria challenge Poult. Sci. 103 2024 103267
Lütke-Dörhoff M. Schulz J. Westendarp H. Visscher C. Wilkens M.R. Dietary supplementation of 25-hydroxycholecalciferol as an alternative to cholecalciferol in swine diets: a review J. Anim. Physiol. Anim. Nutr. 106 2022 1288 1305
Maroux S. Louvard D. Barath J. The aminopeptidase from hog intestinal brush border Biochim. Biophys. Acta, Enzymol. 321 1973 282 295
Oikeh I. Sakkas P. Blake D.P. Kyriazakis I. Interactions between dietary calcium and phosphorus level, and vitamin D source on bone mineralization, performance, and intestinal morphology of coccidia-infected broilers Poult. Sci. 98 2019 5679 5690 31222321
Proszkowiec-Weglarz M. Miska K.B. Schreier L.L. Grim C.J. Jarvis K.G. Shao J. Vaessen S. Sygall R. Jenkins M.C. Kahl S. Research Note: Effect of butyric acid glycerol esters on ileal and cecal mucosal and luminal microbiota in chickens challenged with Eimeria maxima Poult. Sci. 99 2020 5143 5148 32988553
Rodriguez-Lecompte J. Yitbarek A. Cuperus T. Echeverry H. Van Dijk A. The immunomodulatory effect of vitamin D in chickens is dose-dependent and influenced by calcium and phosphorus levels Poult. Sci. 95 2016 2547 2556 27252374
Santos T.S.D. Teng P.-Y. Yadav S. Castro F.L.D.S. Gould R.L. Craig S.W. Chen C. Fuller A.L. Pazdro R. Sartori J.R. Kim W.K. Effects of inorganic Zn and Cu supplementation on gut health in broiler chickens challenged with Eimeria spp Front. Vet. Sci. 7 2020 230 32426385
Shang Y. Kumar S. Thippareddi H. Kim W.K. Effect of dietary fructooligosaccharide (FOS) supplementation on ileal microbiota in broiler chickens Poult. Sci. 97 2018 3622 3634 30016495
Shang Y. Rogiewicz A. Patterson R. Slominski B. Kim W. The effect of phytase and fructooligosaccharide supplementation on growth performance, bone quality, and phosphorus utilization in broiler chickens Poult. Sci. 94 2015 955 964 25701208
Shi D. Bai L. Qu Q. Zhou S. Yang M. Guo S. Li Q. Liu C. Impact of gut microbiota structure in heat-stressed broilers Poult. Sci. 98 2019 2405 2413 30715508
Shi H. Lopes T. Tompkins Y.H. Liu G. Choi J. Sharma M.K. Kim W.K. Effects of phytase supplementation on broilers fed with calcium and phosphorus-reduced diets, challenged with Eimeria maxima and Eimeria acervulina: influence on growth performance, body composition, bone health, and intestinal integrity Poult. Sci. 103 2024 103511
Shi H. Wang J. White D. Martinez O.J.T. Kim W.K. Impacts of phytase and coccidial vaccine on growth performance, nutrient digestibility, bone development, and intestinal gene expression of broilers fed a nutrient reduced diet Poult. Sci. 102 2023 103062
Shojadoost B. Behboudi S. Villanueva A. Brisbin J. Ashkar A. Sharif S. Vitamin D3 modulates the function of chicken macrophages Res. Vet. Sci. 100 2015 45 51 25814176
Su S. Dwyer D. Miska K.B. Fetterer R.H. Jenkins M.C. Wong E.A. Expression of host defense peptides in the intestine of Eimeria-challenged chickens Poult. Sci. 96 2017 2421 2427 28521031
Swaggerty C.L. Bortoluzzi C. Lee A. Eyng C. Pont G.D. Kogut M.H. Potential replacements for antibiotic growth promoters in poultry: interactions at the gut level and their impact on host immunity Recent Advances in Animal Nutrition and Metabolism 2022 Springer Newyork, USA 145 159
Teng P.-Y. Choi J. Yadav S. Tompkins Y.H. Kim W.K. Effects of low-crude protein diets supplemented with arginine, glutamine, threonine, and methionine on regulating nutrient absorption, intestinal health, and growth performance of Eimeria-infected chickens Poult. Sci. 100 2021 101427
Teng P.-Y. Choi J. Tompkins Y. Lillehoj H. Kim W. Impacts of increasing challenge with Eimeria maxima on the growth performance and gene expression of biomarkers associated with intestinal integrity and nutrient transporters Vet. Res. 52 2021 81 34108017
Teng P.-Y. Yadav S. de Souza Castro F.L. Tompkins Y.H. Fuller A.L. Kim W.K. Graded Eimeria challenge linearly regulated growth performance, dynamic change of gastrointestinal permeability, apparent ileal digestibility, intestinal morphology, and tight junctions of broiler chickens Poult. Sci. 99 2020 4203 4216 32867964
Tompkins Y.H. Choi J. Teng P.-Y. Yamada M. Sugiyama T. Kim W.K. Reduced bone formation and increased bone resorption drive bone loss in Eimeria infected broilers Sci. Rep. 13 2023 616 36635321
Vandesompele J. De Preter K. Pattyn F. Poppe B. Van Roy N. De Paepe A. Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes Genome Biol 3 2002 1 12
Veum T. Phosphorus and calcium nutrition and metabolism Pages 94–111 in Phosphorus and Calcium Utilization and Requirements in Farm Animals 2010 CABI Wallingford UK
Wang J. Patterson R. Kim W. Effects of phytase and multicarbohydrase on growth performance, bone mineralization, and nutrient digestibility in broilers fed a nutritionally reduced diet J. Appl. Poult. Res. 30 2021 100146
Wang Y. Sun J. Zhong H. Li N. Xu H. Zhu Q. Liu Y. Effect of probiotics on the meat flavour and gut microbiota of chicken Sci. Rep. 7 2017 6400 28743928
Xing R. Yang H. Wang X. Yu H. Liu S. Li P. Effects of calcium source and calcium level on growth performance, immune organ indexes, serum components, intestinal microbiota, and intestinal morphology of broiler chickens J. Appl. Poult. Res. 29 2020 106 120
Yilmaz P. Parfrey L.W. Yarza P. Gerken J. Pruesse E. Quast C. Schweer T. Peplies J. Ludwig W. Glöckner F.O. The SILVA and “all-species living tree project (LTP)” taxonomic frameworks Nucleic Acids Res 42 2014 D643 D648 24293649
Zhang L. Lu L. Li S. Zhang G. Ouyang L. Robinson K. Tang Y. Zhu Q. Li D. Hu Y. 1, 25-Dihydroxyvitamin-D3 induces avian β-defensin gene expression in chickens PloS one 11 2016 e0154546
Zhang X. Akhtar M. Chen Y. Ma Z. Liang Y. Shi D. Cheng R. Cui L. Hu Y. Nafady A.A. Chicken jejunal microbiota improves growth performance by mitigating intestinal inflammation Microbiome 10 2022 1 19 34980280
Zong X. Fu J. Xu B. Wang Y. Jin M. Interplay between gut microbiota and antimicrobial peptides Anim. Nutr. 6 2020 389 396 33364454
