
==== Front
Anim Nutr
Anim Nutr
Animal Nutrition
2405-6545
2405-6383
KeAi Publishing

S2405-6545(24)00087-8
10.1016/j.aninu.2024.06.002
Original Research Article
Influences of lauric acid addition on performance, nutrient digestibility and proteins related to mammary gland development in dairy cows
Zhang Jing
Bu Lijun
Liu Yapeng
Huo Wenjie
Xia Chengqiang
Pei Caixia
Liu Qiang liuqiangabc@sxau.edu.cn
⁎
College of Animal Science, Shanxi Agricultural University, Taigu 030801, Shanxi Province, China
⁎ Corresponding author. liuqiangabc@sxau.edu.cn
02 7 2024
9 2024
02 7 2024
18 272283
17 8 2023
6 5 2024
6 6 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Lauric acid (LA) has the possibility to improve milk production in dairy cows by improving mammary gland development, however, the mechanism by which it might regulate mammary gland development is unclear. The influence of LA on milk production, nutrient digestibility and the expression of proteins related to mammary gland development in dairy cows were evaluated. Forty primiparous Holstein dairy cows were divided into 4 groups in a randomized block design. Four treatments included the control (0 g/d LA per cow), low-LA (100 g/d LA per cow), medium-LA (200 g/d LA per cow), and high-LA (300 g/d LA per cow). Yields of milk, fat-corrected milk, and energy-corrected milk quadratically increased (P < 0.05), and yield and content of milk fat linearly increased (P < 0.05) with LA supplementation. Percentages of C12:0, C18:1 and C20:1 fatty acids in milk fat linearly increased (P < 0.05), but that of C16:0 fatty acid linearly decreased (P = 0.046). Supplementation of LA led to a linear and quadratical increase (P < 0.05) in digestibility of dry matter, organic matter, neutral detergent fibre and acid detergent fibre, and ruminal total volatile fatty acid concentration but a linear reduction (P = 0.018) in the ratio of acetate to propionate. The enzymatic activities of ruminal pectinase, xylanase, and α-amylase, and populations of total bacteria and anaerobic fungi increased linearly (P < 0.05), while populations of total protozoa and methanogens decreased linearly (P < 0.05) with increased LA addition. Following LA addition, blood glucose, triglyceride, estradiol, prolactin, and insulin-like growth factor 1 concentrations increased linearly (P < 0.05) and albumin and total protein concentrations increased quadratically (P < 0.05). Moreover, addition of 200 g/d LA promoted (P < 0.05) the expression of protein involved in mammary gland development and fatty acids synthesis. These results suggested that LA addition enhanced milk production and fatty acids synthesis by stimulating nutrient digestion, the expression of proteins associated with milk fat synthesis and mammary gland development.

Keywords

Lactation performance
Lauric acid
Mammary gland development
Milk fat synthesis
Nutrient digestibility
==== Body
pmc1 Introduction

The goal of the dairy cow industry is to provide large quantities of high-quality milk. As a medium-chain fatty acid (MCFA), lauric acid (C12:0, LA) can be extracted from coconut, palm kernel, and babassu seed oils (Dayrit, 2015). Although LA is a saturated fatty acid (SFA), it is related to a lower risk of cardiovascular disease than other SFA and has various beneficial impacts on health (Ong et al., 2019). Approximately two-thirds of coconut oil-derived LA is transported via the portal vein, whereas the remainder is carried to the lymph and stored in chylomicrons in rats (Dayrit, 2015; Yang et al., 2020). Previous researches found that dietary addition with 1% of LA increases the dilation of mammary ducts in pubertal mice and that 100 μmol/L LA stimulates the proliferation of HC11 mouse mammary epithelial cells (Meng et al., 2017, 2018). Furthermore, an in vivo study in lactating mice suggested that LA improved lactation function in breast-feeding mice reflected by the increased body weight of offspring mice, stimulated mammary gland development reflected by the number of alveoli, and increased the protein expression levels of β-casein and Elf5 (Yang et al., 2020). Therefore, LA is expected to be an additive to promote mammary gland development in dairy cows.

Varying influences of LA on milk yields, nutrient digestion, and ruminal fermentation have been reported, implying that only a suitable dose of LA could exert beneficial impacts on the performance of dairy cows. Several of these researches have demonstrated the potent antiprotozoal impacts of LA addition in dairy cows (Lee et al., 2011; Faciola and Broderick, 2013), which result in the decreased dry matter intake (DMI; Dohme et al., 2004; Faciola and Broderick, 2013; Külling et al., 2002), neutral detergent fibre (NDF) and acid detergent fibre (ADF) digestibility (Faciola and Broderick, 2013, 2014), total volatile fatty acid (VFA) concentration (Faciola and Broderick, 2014), acetate to propionate ratios (Faciola and Broderick, 2014), and milk yields and components (Hristov et al., 2011; Faciola and Broderick, 2014). In contrast, several other studies reported that LA supplementation in dairy cows has no influence on DMI (Faciola and Broderick, 2014), milk yields and components (Faciola et al., 2013; Hristov et al., 2009), and ruminal pH (Faciola and Broderick, 2013, 2014). Nevertheless, Kim et al. (2018) found that the addition of LA in steer diets decreased methanogen and Fibrobacter succinogenes populations, but increased ruminal Ruminococcus flavefaciens populations, total VFA, and propionate concentrations. The propionate produced by ruminal fermentation is transported to the liver and subsequently converted to glucose (Chan and Freedland, 1972), and will most likely result in an increase in glucose availability. Additionally, it has been demonstrated that peroxisome proliferator-activated receptor (PPAR) activated by several fatty acids, including LA in immortalized cell culture model of bovine liver, both when supplied individually and in combination (Busato and Bionaz, 2021). Moreover, PPAR regulates important metabolic processes in monogastric and ruminant animals, such as the metabolism of fatty acids and the production of milk fat (Busato and Bionaz, 2021; Ma and Corl, 2012). Therefore, we speculate that LA might promote fatty acid synthesis in the mammary gland of dairy cow.

Accordingly, we hypothesized that LA addition could enhance lactation performance and milk fatty acid synthesis by stimulating nutrient digestion of dairy cows and the expression of proteins associated with milk fatty acid synthesis and cell proliferation of mammary gland. Therefore, this study was to determine the influences of LA addition on lactation performance, nutrient digestion, and the expression of proteins related to milk fatty acid synthesis and cell proliferation of mammary gland in dairy cows.

2 Materials and methods

2.1 Animal ethics statement

The research proposal of this investigation was evaluated and authorized by the Animal Care and Use Committee of Shanxi Agriculture University, Taigu, China, prior to study commencement (IACUC Issue No. SXAU EAW-2021C.FU.00301413).

2.2 Holstein cows, design, and diets

The experiment was undertaken from August 2021 to December 2021 at a dairy farm (Datong Sifang Hi-Tech Dairy Farm, Datong, China). A randomized block design experiment was carried out with 40 primiparous Holstein dairy cows (662 ± 13.9 kg BW, 71.3 ± 6.82 DIM, 36.1 ± 1.32 kg/d milk yield) at the beginning of the study. The feeding experiment was conducted for 120 d, comprising a 15-d covariate period followed by a 15-d adaptation period and subsequent 90-d sampling period. The diet (Table 1) was formulated according to NRC (2001) recommendations for a 680 kg cow producing 35 kg/d of milk containing 35 g/kg of milk fat and 35 g/kg crude protein. Cows were blocked by DIM and milk yield together and were randomly divided into 1 of 4 groups in a randomized block design. Four treatments were control (0 g/d of LA per cow), low-LA (LLA; 100 g/d of LA per cow), medium-LA (MLA; 200 g/d of LA per cow) and high-LA (HLA; 300 g/d of LA per cow). The amount of LA added was based on previous study (Faciola and Broderick, 2014) who found that 1.3% of LA addition to the basal diet has no influence on DMI. The LA additive (feed grade, contained 996 g/kg of LA [C12:0], 1.5 g/kg of decanoic acid [C10:0], 0.8 g/kg of decanoic acid [C14:0] and 1.7 g/kg of others; Wuxi Odio Technology Development) was blended into the basal diet (Table 1). The basal diet and LA additive was mixed as total mixed ration (TMR) once daily. Cows were housed in a naturally ventilated, two-row, head-to-head, free-stall barn equipped with Calan gates Feeding System for monitoring individual intake. Cows were milked three times daily (at 05:30, 13:30, and 20:30); fed the corresponding TMR ad libitum; and had free access to water.Table 1 The ingredients of the basal diet and its nutritional content (%, DM basis).

Table 1Item	Contents	
Ingredients	
 Corn fodder silage	24.9	
 Alfalfa hay	12.1	
 Oat hay	13.0	
 Corn grain	25.5	
 Wheat bran	6.00	
 Soybean meal	9.20	
 Cottonseed cake	5.00	
 Rapeseed meal	2.50	
 Calcium carbonate	0.50	
 Salt	0.50	
 Dicalcium phosphate	0.30	
 Mineral and vitamin premix 1	0.50	
Nutrient levels	
 Organic matter	94.4	
 Crude protein	16.7	
 Ether extract	3.23	
 Neutral detergent fiber	31.1	
 Acid detergent fiber	19.2	
 Calcium	0.72	
 Phosphorus	0.45	
 NEL2, MJ/kg	6.57	
1 Per kilogram premix: 20,100 mg Fe, 1620 mg Cu, 8100 mg Mn, 7122 mg Zn, 1.20 mg I, 62 mg Se, 21 mg Co, 840,000 IU vitamin A, 320, 000 IU vitamin D, and 12, 000 IU vitamin E.

2 In accordance with NRC (2001), net energy for lactation (NEL) was calculated.

2.3 Data and sample collection

The cows were weighed on 2 consecutive days at 16:00 on d 1 of the covariate period, and d 1 and 90 of the sampling period. The provided and refused TMR were determined daily for each dairy cow during the entire experiment to estimate the DMI. Samples of TMR were collected every 5 d of the covariate period and every 10 d during the sampling period, and stored at −20 °C for subsequent analyses. Milk production was measured daily for each cow during the entire experiment. Milk samples were collected every 5 d of the covariate period and every 10 d during the sampling period from each milking on 3 consecutive milkings within a day. Concurrently, samples were collected and stored at 4 °C with antimicrobial agent 2-bromo-2-nitropropane-1, 3-diol for subsequent analyses. At 06:30 and 18:30 during d 1 to 15 of the covariate period and d 70 to 87 of the sampling period, all cows were dosed with 5 g of chromic oxide powder placed in a gelatin capsule to serve as a digestion marker. Approximately 250 g fecal samples were collected from each cow's rectum at 07:00, 13:00, 19:00, and 01:00 during d 8 to 15 of the covariate period and d 78 to 87 of the sampling period, and stored at −20 °C for subsequent analyses. During d 88 to 89, samples of TMR, refusals, and feces of each cow were composited, dried at 55 °C for 72 h, and mashed to pass through a 1 mm screen with a cutter mill.

At 06:30, 09:30, 12:30, and 15:30 on d 5 of the covariate period and d 44 and 89 of the sampling period, the ruminal fluid was collected from each animal via an oral stomach tube. The initial ruminal fluid of approximately 150 mL was discarded to minimize saliva contamination, whereafter the next 200 mL was preserved. The ruminal pH of each cow was determined once using a portable pH meter (5011B; Shanghai Shuo optoelectronic Technology Co., Ltd., China). The ruminal fluid samples were filtered through four layers of medical gauze. Thereafter, 5 mL of the filtrate was blended with 1 mL of 250 g/L meta-phosphoric acid before being stored at −20 °C for VFA determination. Furthermore, 5 mL filtrate was blended with 1 mL of 20 g/L sulfuric acid before being stored at −20 °C for the analysis of ammoniacal nitrogen. For microbial DNA extraction and enzymatic activity analyses, 50 mL filtrate was placed in liquid nitrogen and subsequently stored at −80 °C.

At 10:30 on d 15 of the covariate period and d 90 of the sampling period, blood samples from each dairy cow were collected into 10 mL evacuated tubes (Serum separation gel coagulant tube, Hunan Liuyang Medical Instrument Factory, Liuyang, China) via the coccygeal vessel. Blood samples were transported to the laboratory to separate the serum by centrifugation at 2000 × g and 4 °C for 12 min, whereafter the serum samples were stored at −20 °C.

For each cow in groups supplemented with 0 and 200 g/d LA per cow, mammary tissue biopsies were carried out from 16:00 to 20:00 on d 15 of the covariate period and d 90 of the sampling period. About 1 g of secretory tissues in the mammary gland of each cow was collected via surgical biopsy as described by Farr et al. (1996) from the midpoint section of the rear quarter. Tissue biopsy samples for total RNA extraction were rapidly frozen in liquid nitrogen and kept in a low temperature refrigerator at −80 °C for total RNA extraction.

2.4 Chemical analyses

The contents of DM (method 934.01), nitrogen (method 976.05), ether extract (EE; method 973.18), and crude ash (method 942.05) in TMR, refusal, and feces samples were determined according to the method of AOAC (2000). The organic matter (OM) content was calculated as the differences between the DM and crude ash contents. The NDF content was determined as elaborated by Van Soest et al. (1991), using heat-stable alpha-amylase and sodium sulfite, and expressed including residual ash. The ADF content was analyzed based on the method described in AOAC (2000, method 973.18). Calcium (Ca) and phosphorus (P) were determined via the disodium ethylenediaminetetraacetate complexometric titration method and ammonium vanadate molybdate colorimetric method according to the methods of National Standards of the People's Republic of China GB/T 6436-2018 (China National Standard, 2018a) and GB/T 6437-2018 (China National Standard, 2018b), respectively. The fat, true protein, and lactose contents of the milk were analyzed using a Milko Scan FT-120 unit (Foss Electric) based on the method described in AOAC (2000, method 972.16). An aliquot of milk was centrifuged to obtain the milk fat cake. The milk fat was then extracted using the procedure of (Hara and Radin, 1978), and transmethylation of the esterified fatty acids was performed according to the method of Chouinard et al. (1999). Fatty acid methyl esters (FAMEs) were used for gas chromatographic analysis of total fatty acids. According to the method of Liu et al. (2018), fatty acid composition was determined using gas chromatography (GC) on a CP SIL 88, 100 m × 0.25 mm × 0.25 μm capillary column (Agilent J&W Advanced Capillary GC Columns, the Netherlands) in an Agilent 7890 A (Agilent Technologies, Santa Clara, CA, USA) with an auto sampler, flame ionization detector and split injection. The standards were Supelco 37 Component FAME Mix C4–C24 Unsatures (Catalog No. Sigma, 18919-1AMP, Sigma–Aldrich, USA), Supelco PUFA No. 1 (Marine Source, Catalog No. 47033, Supelco Chemical, USA), Methyl trans-11C18:1 (Sigma 46905, Sigma–Aldrich, USA), Methyl cis-9, trans-11 CLA (catalog no. Matreya1255, Cayman Chemical, USA), and Methyl cis-5,8,11,14,17-eicosapentaenoic acid (catalog no. Supelco 44864, Supelco Chemical, USA). The FAME were identified by comparisons with the retention times of the standards. The chromium content of the feces was measured using atomic absorption spectrophotometry (AAA320N; Shanghai Yidian Instrument Co., Ltd., China) based on the method of Williams et al. (1962). Ruminal VFA conctent were determined using gas chromatography (GC-7890; Agilent Technologies, Santa Clara, CA, USA). According to the method of Weatherburn (1967), ammoniacal nitrogen content was analyzed by a colorimetric spectrophotometer (UV759; Qingdao Juchuang Instrument Co., Ltd., China). The samples of ruminal fluid for the measurement of enzymatic activity were immediately taken to the laboratory. Activities of cellobiose, carboxymethyl cellulase [CMCase], α-amylase, xylanase, pectinase, and protease were determined as described by Agarwal et al. (2002). Biochemical kits (Nanjing Jiancheng Bioengineering Institute) of glucose (no. A154-2-1), total protein (A045-3-1), albumin (no. A028-1-1), blood urea nitrogen (BUN; no. C013-2-1), triglyceride (no. A110-2-1) and non-esterified fatty acids (NEFA; no. A042-2-1) were used to analyze serum content of glucose, total protein, albumin, urea nitrogen, triglyceride) and NEFA by using an automatic biochemical analyzer (BS-400, Nanjing Badeng Co., Ltd. China), The ELISA kits (Beijing Biolide Biotechnology Co., Ltd. China) of estradiol (E2; bovine, no. BL-E28820M), prolactin (bovine, no. BL-E28845M), and insulin-like growth factor 1 (IGF-1; bovine, no. BL-E21687M) were used to analyze E2, prolactin, and IGF-1 by using a Konelab auto-analyzer (Thermo Fisher Scientific, USA).

2.5 Extraction of microbial DNA and real-time PCR

Exactly 1.5 mL of homogeneous ruminal fluid was used to extract microbial DNA using the repeated bead-beating plus column (RBB + C) as elaborated by (Yu and Morrison, 2004). The integrity and purity of the extracted DNA were evaluated via agarose gel electrophoresis and a NanoDrop 2000 Spectrophotometer (Thermo Scientific, NanoDrop Technologies), respectively. The target microbial population comprised total bacteria, protozoa, anaerobic fungi, methanogens, R. flavefaciens, Ruminococcus albus, Butyrivibrio fibrisolvens, F. succinogenes, Ruminobacter amylophilus, and Prevotella ruminicola. The target microbial primer set sequences are listed in Table 2. For absolute quantification of the gene copy numbers, 10 sample-derived standards were prepared from the microbial DNA treatment pool using conventional PCR. The PCR products were purified, using the PureLink Quick Gel Extraction and PCR Purification Combo Kit (Thermo Fisher Scientific, USA), and quantified using a spectrophotometer. The copy number of each standard was calculated using the mass concentration and length of the PCR products (Yu et al., 2004). The target DNA was quantified using 10-fold serial dilutions from 101 to 108 DNA copies. The real-time PCR amplification and detection was conducted in triplicate using a Chromo 4 system (Bio-Rad). The 20 μL reaction mixture contained 10 μL SYBR Premix Taq II (TaKaRa Bio), 2 μL DNA template, 0.8 μL forward primer (10 μmol/L), 0.8 μL reverse primer (10 μmol/L), 0.4 μL of ROX Reference Dye II (TaKaRa), and 6.0 μL dH2O. The PCR cycling conditions were detailed as follows: 1 cycle at 50 °C for 2 min and 95 °C for 2 min for the original denaturation step, followed by 40 cycles at 95 °C for 15 s, anneal at annealing temperature of each target microbial DNA for 30 s, and extension at 60 °C for 1 min.Table 2 Real-time PCR primers used for microbial DNA.

Table 2Target species	Primer sequence (5′–3′)	GenBank accession no.	Annealing temperature, °C	Size, bp	
Total bacteria	F: CGGCAACGAGCGCAACCC
R: CCATTGTAGCACGTGTGTAGCC	CP058023.1	60.0	147	
Total fungi	F: GAGGAAGTAAAAGTCGTAACAAGGTTTC
R: CAAATTCACAAAGGGTAGGATGATT	GQ355327.1	57.5	120	
Total protozoa	F: GCTTTCGWTGGTAGTGTATT
R: CTTGCCCTCYAATCGTWCT	HM212038.1	59.0	234	
Total methanogens	F: TTCGGTGGATCDCARAGRGC
R: GBARGTCGWAWCCGTAGAATCC	GQ339873.1	60.0	160	
Ruminococcus albus	F: CCCTAAAAGCAGTCTTAGTTCG
R: CCTCCTTGCGGTTAGAACA	CP002403.1	60.0	176	
Ruminococcus flavefaciens	F: ATTGTCCCAGTTCAGATTGC
R: GGCGTCCTCATTGCTGTTAG	AB849343.1	60.0	173	
Butyrivibrio fibrisolvens	F: ACCGCATAAGCGCACGGA
R: CGGGTCCATCTTGTACCGATAAAT	HQ404372.1	61.0	65	
Fibrobacter succinogenes	F: GTTCGGAATTACTGGGCGTAAA
R: CGCCTGCCCCTGAACTATC	AB275512.1	61.0	121	
Ruminobacter amylophilus	F: CTGGGGAGCTGCCTGAATG
R: GCATCTGAATGCGACTGGTTG	MH708240.1	60.0	102	
Prevotella ruminicola	F: GAAAGTCGGATTAATGCTCTATGTTG
R: CATCCTATAGCGGTAAACCTTTGG	LT975683.1	58.5	74	

2.6 Western blot analysis

Six mammary tissue samples were selected randomly from the same block of two groups, from which total protein was extracted from 100 mg of ground bovine mammary tissue using radioimmunoprecipitation assay buffer (RIPA buffer) containing protease/phosphatase inhibitors (Roche Diagnostics, Shanghai, China). Protein content was analyzed using the Thermo Scientific Pierce BCA protein assay kit (23225; Thermo Fisher Scientific, USA) according to the manufacturer's instructions. Beta-actin was used as the loading control. Equal quantities of protein (20 μg) were separated on a 12% SDS-PAGE, whereafter the separated proteins were transferred onto nitrocellulose membranes (1704271; Bio-Rad). The membranes were blocked with 6% (wt/vol) BSA in tris-buffered saline plus Tween (TBST) for 2 h at 25 °C. Thereafter, the membranes were incubated overnight at 4 °C with the following primary antibodies diluted in TBST: mouse anti-cyclin A1 (1:2000; cat. no. NB100–2660; Novusbio Biologicals, USA), mouse anti-proliferating cell nuclear antigen (PCNA; 1:2000; cat. no. 2586; Cell Signaling Technology, USA), rabbit anti-Akt (1:2000; cat. no. 9272; Cell Signaling Technology, USA), rabbit anti-phosphorylated-AktSer473 (1:2000; cat. no. bs-0876R; Bios Antibodies, USA), rabbit anti-mTOR (1:2000; cat. no. bs-1992R; Bios Antibodies, USA), rabbit anti-phosphorylated-mTORSer2448 (1:2000; cat. no. bs-3495R; Bios Antibodies, USA), rabbit anti- G-protein-coupled receptor 84 (GPR84; 1:2000; cat. no. bs-13507R; Bios Antibodies, USA), rabbit anti-peroxisome proliferator-activated receptor gamma (PPARγ, 1:2000; cat. no. bs-4590R; Bios Antibodies, USA), rabbit anti-sterol regulatory element-binding protein 1 (SREBP1; 1:2000; cat. no. NB100–2215; Novus Biologicals, USA), rabbit anti-phosphorylated- acetyl-coenzyme A carboxylase-α (ACACA; 1:2000; cat. no. bs-12954R; Bios Antibodies, USA), rabbit anti-ACACA (1:2000; cat. no. bs-11912R; Bios Antibodies, USA), rabbit anti-fatty acid synthase (FASN, 1:2000; cat. no. bs-60347R; Bios Antibodies, USA), rabbit anti-stearoyl-CoA desaturase 1 (SCD1; 1:2000; cat. no. bs-3787R; Bios Antibodies, USA), and rabbit anti-β-actin (1:10,000; cat. no. 4970; Cell Signaling Technology, USA). In order to remove excess antibodies, membranes were washed five times with 1 × TBST for 5 min. Thereafter, the membranes were incubated at 25 °C for 2 h with either of the following secondary antibodies diluted in TBST: goat anti-rabbit (1:5000; cat. no. E-AB-1003; Elabscience, USA) or goat anti-mouse (1:5000; cat. no. RS0001; Immunoway, USA). SuperSignal West Pico Chemiluminescence Substrate (Thermo Fisher Scientific, USA) was used to visualize the western blots prior to being semi-quantified using the ImageJ software (version 1.4.3.67).

2.7 Calculation and statistical analysis

Dietary net energy for lactation was estimated by multiplying the NEL-3X density of the feed ingredient by its dietary content (NASEM, 2021). Energy-corrected milk (ECM) and fat-corrected milk (FCM) were estimated according to NRC (2001), where ECM = 0.327 × milk (kg/d) + 12.95 × fat (kg/d) + 7.65 × protein (kg/d), 4% FCM = 0.4 × milk (kg/d) + 15 × fat (kg/d). Feed efficiency was estimated for each animal as milk yield (actual milk and ECM yield) divided by dietary DM intake. Nutrient digestibility (%) was calculated by the following formula: (1 - bc/ad) × 100, where a was nutrient concentration in feed; b was nutrient concentration in feces; c was chromium concentration in feed; d was chromium concentration in feces (Salehi et al., 2023).

Data were analyzed as a randomized complete-block design via the mixed procedure of SAS (PROC MIXED; SAS, 2002). Data for DMI, milk production, feed efficiency and milk fatty acid composition were analyzed using the following statistic model:Yiklm = μ + βVk + Bi + Tj + Ck(i) + Ll + TLjl + Eijkl,

where Yiklm was the dependent variable; μ was the overall mean; β was regression coefficient; Vk was covariate measurement; Bi was the random effect of block i; Tj was the fixed effect of time j; Ck(i) was the random effect of cow k within block i; Ll was the fixed effect of LA treatment l; TLjl was interaction between time and LA treatment; Eijkl was residual error.

Data for rumen fermentation, microbial enzyme activity and microbiota were analyzed using the following statistic model which there were repeated measurements over time (pH, VFA, enzymatic activity and microbiota):Yiklm = μ + βVk + Bi + Dj + Ck(i) + Ll + DLjl + Eijkl + Tm + LTml + Sijklm,

where, Yiklm was the dependant variable; μ was the overall mean; β was regression coefficient; Vk was covariate measurement; Bi was the random effect of block i; Dj was the fixed effect of day j; Ck(i) was the random effect of cow k within block i; Ll was the fixed effect of LA treatment l; DLjl was interaction between day and LA treatment; Eijkl was whole plot error; Tm was effect of time m; LTml was interaction between LA treatment and time; Sijklm was subplot error. Original data was tested in SAS for homogeneity of variance and normality; moreover, rumen microbiota residuals were tested for normality. Log-transformed microbiota data only marginally improved normality; therefore, analysis was done using original data. The covariance structure for variables was first-order autoregressive. Mean separations using probability of difference tests (PDIFF in SAS) were conducted only for influences that were statistically significant (P < 0.05). Data for nutrient digestibility and blood parameters were analysed with the same model as suggested above, but time and the interaction between time and treatment were omitted. The CONTRAST statement of SAS was used to compute linear and quadratic orthogonal contrasts based on the LA application rates.

SigmaPlot version 12.5 statistical analysis package (Systat Software, Inc., San Jose, CA, USA) was used to analyze the western blotting results. Student's t-test (t-test) was used to analyze statistical differences between treatments. Effects of the factors were considered significant at P < 0.05 unless other trends were declared at P < 0.10.

3 Results

3.1 Lactation performance

The DMI decreased linearly (P = 0.042) with increased LA addition (Table 3). Conversely, the yields of actual milk (P = 0.036), 4% FCM (P = 0.037), and ECM (P = 0.042) increased quadratically with an increase in LA addition (Table 3). Milk fat content (P = 0.014) and production (P = 0.038) increased linearly with increased LA supplementation, whereas milk true protein content (P = 0.014) and production (P = 0.013) increased quadratically following LA supplementation. However, the production and content of milk lactose did not change with increased LA addition. Feed efficiency, described as milk yield to dietary DM intake ratio (P = 0.032) or ECM yield to dietary DM intake ratio (P = 0.019), also increased linearly with increased LA dose.Table 3 Impacts of lauric acid addition on lactation performance and feed efficiency.

Table 3
Item	Treatments1	SEM	P-value	
CON	LLA	MLA	HLA	Treatment	Linear	Quadratic	
DMI, kg/d	22.0a	21.5ab	21.2ab	20.7b	0.14	0.023	0.042	0.976	
Milk production, kg/d	
 Actual	34.6b	35.4ab	36.4a	35.4ab	0.24	0.042	0.615	0.036	
 4.0% FCM2	31.2b	32.5ab	34.0a	33.1ab	0.26	0.049	0.474	0.037	
 ECM3	34.3b	35.1ab	36.7a	36.1ab	0.24	0.038	0.523	0.042	
 Milk fat	1.16b	1.22ab	1.29a	1.26a	0.016	0.026	0.038	0.427	
 Milk true protein	1.09b	1.13ab	1.17a	1.12ab	0.011	0.023	0.755	0.013	
 Milk lactose	1.85	1.87	1.95	1.89	0.017	0.654	0.766	0.331	
Milk composition, g/kg	
 Fat	33.5b	34.5ab	35.4a	35.6a	0.04	0.043	0.014	0.928	
 True protein	31.6b	31.8ab	32.2a	31.5ab	0.03	0.037	0.962	0.014	
 Lactose	53.4	52.7	53.4	53.4	0.04	0.893	0.857	0.633	
Feed efficiency4, kg/kg	
 Milk yield to DMI ratio	1.58b	1.65ab	1.72a	1.71a	0.005	0.016	0.032	0.204	
 ECM to DM intake ratio	1.56b	1.64ab	1.73a	1.74a	0.006	0.023	0.019	0.507	
a,b Means with different superscripts in each row differ significantly (P < 0.05).

1 Control (CON), 0 g/d per cow lauric acid (LA); low-LA (LLA), 100 g/d per cow LA; medium-LA (MLA), 200 g/d per cow LA; high-LA (HLA), 300 g/d per cow LA.

2 Fat-corrected milk (FCM) was estimated as 4.0% FCM = 0.4 × milk (kg/d) + 15 × fat (kg/d).

3 Energy-corrected milk (ECM) was estimated as ECM = [0.327 × milk (kg/d)] + [12.95 × fat (kg/d)] + [7.65 × protein (kg/d)].

4 Estimated as milk yields (milk or ECM yields) divided by DMI for each cow.

3.2 Milk fatty acid composition

Supplementation of LA had an effect on de novo fatty acids (DN FA; Σ FA < 16C; P = 0.038) (Table 4). Most of the increase in DN FA was depend on an elevation in the proportion of C12:0 in milk (P = 0.018). However, supplementation of LA decreased (P = 0.045) the proportions of mixed sourced fatty acids (MSFA; Σ FA = 16C) in milk due to the linearly decreased proportion of C16:0 in milk (P = 0.046). Although supplementation of LA increased the proportions of C18:1 (P = 0.038) and C20:1 (P = 0.046) in milk, there were no difference in the proportions preformed fatty acids (PFA; Σ FA > 18C). Proportions of odd- and branched-chained fatty acids (OBCFA) was also not impacted by LA addition.Table 4 Impacts of lauric acid addition on milk fatty acid composition (g/100 g of total milk fatty acids).

Table 4
Item	Treatments1	SEM	P-value	
CON	LLA	MLA	HLA	Treatment	Linear	Quadratic	
C4:0	2.89	2.98	3.11	3.18	0.028	0.437	0.312	0.538	
C6:0	2.34	2.26	2.25	2.12	0.039	0.168	0.224	0.436	
C8:0	1.32	1.29	1.29	1.25	0.018	0.419	0.332	0.544	
C10:0	2.97	2.83	2.78	2.70	0.051	0.342	0.289	0.452	
C12:0	3.31c	4.47bc	5.56ab	6.69a	0.108	0.018	0.021	0.543	
C14:0	10.9	11.5	11.8	11.4	0.11	0.195	0.083	0.621	
C15:0	2.46	2.40	2.33	2.30	0.178	0.266	0.092	0.502	
C16:0	34.4a	32.8ab	30.9b	29.8b	0.19	0.027	0.046	0.468	
C17:0	2.01	1.97	1.99	2.04	0.041	0.428	0.342	0.493	
C18:0	7.08	6.94	6.97	6.89	0.227	0.603	0.163	0.776	
C20:0	0.53	0.51	0.51	0.48	0.013	0.594	0.371	0.613	
C21:0	0.08	0.07	0.08	0.09	0.005	0.782	0.453	0.912	
C22:0	0.14	0.13	0.14	0.14	0.006	0.541	0.542	0.673	
C23:0	0.06	0.06	0.06	0.07	0.005	0.687	0.571	0.764	
C24:0	0.12	0.14	0.13	0.14	0.006	0.543	0.493	0.381	
C14:1	0.41b	0.47ab	0.55a	0.62a	0.087	0.036	0.048	0.118	
C15:1	0.55	0.55	0.56	0.55	0.004	0.499	0.582	0.442	
C16:1	2.44	2.35	2.25	2.30	0.158	0.364	0.314	0.133	
C18:1	18.4b	18.7ab	19.4a	19.9a	0.73	0.038	0.027	0.932	
C20:1	0.14b	0.16ab	0.17a	0.18a	0.008	0.046	0.032	0.451	
C22:1	0.08	0.08	0.08	0.09	0.005	0.259	0.113	0.254	
C24:1	0.09	0.09	0.09	0.10	0.005	0.378	0.272	0.426	
C18:2, cis 9, cis12	1.61	1.57	1.50	1.53	0.226	0.206	0.108	0.243	
C18:2, trans 9, trans12	1.03	1.07	1.06	1.02	0.165	0.184	0.532	0.124	
C18:2, cis 9, cis 11	0.55	0.56	0.52	0.52	0.026	0.475	0.324	0.632	
C18:2, trans 10, cis 12	0.93	0.92	0.91	0.92	0.042	0.501	0.431	0.243	
C18:3, cis 6, cis 9, cis 12	0.16	0.14	0.17	0.15	0.007	0.372	0.742	0.921	
C18:3, cis 9, cis 12, cis 15	1.12	1.11	1.10	1.00	0.026	0.476	0.117	0.264	
C20:2	0.14	0.13	0.13	0.12	0.006	0.594	0.204	0.452	
C20:3, cis 8, cis 11, cis 14	0.66	0.64	0.60	0.57	0.016	0.713	0.262	0.528	
C20:3, cis 11, cis 14, cis 17	0.04	0.04	0.03	0.03	0.004	0.618	0.393	0.514	
C20:4	0.31	0.26	0.25	0.27	0.021	0.307	0.542	0.123	
C20:5	0.11	0.11	0.13	0.13	0.006	0.349	0.391	0.822	
C22:2	0.03	0.03	0.03	0.05	0.004	0.206	0.109	0.154	
C22:3	0.03	0.04	0.03	0.05	0.004	0.487	0.223	0.353	
C22:4	0.22	0.25	0.26	0.26	0.008	0.245	0.154	0.912	
C22:5	0.29	0.30	0.32	0.30	0.009	0.253	0.402	0.217	
C22:6	0.05	0.07	0.06	0.05	0.005	0.498	0.273	0.101	
Σ de novo FA2	24.2b	25.8ab	27.3a	28.0a	0.35	0.038	0.043	0.703	
Σ MSFA3	36.8a	35.1ab	33.1b	32.1b	0.51	0.045	0.034	0.682	
Σ PFA4	33.8	34.0	34.6	34.9	0.51	0.349	0.215	0.516	
Σ OBCFA5	5.15	5.06	5.02	5.05	0.134	0.563	0.393	0.204	
Σ SFA6	70.6	70.4	69.8	69.3	0.94	0.478	0.192	0.331	
Σ MUFA7	22.1	22.4	23.1	23.7	0.23	0.625	0.094	0.502	
Σ PUFA8	7.28	7.22	7.09	6.96	0.186	0.724	0.083	0.547	
a-c Means with different superscripts in each row differ significantly (P < 0.05).

1 Control (CON), 0 g/d per cow lauric acid (LA); low-LA (LLA), 100 g/d per cow LA; medium-LA (MLA), 200 g/d per cow LA; high-LA (HLA), 300 g/d per cow LA.

2 Σ de novo FA = sum of C4:0, C6:0, C8:0, C10:0, C12:0, C14:0, C14:1.

3 Σ mixed sourced fatty acids (MSFA) = sum of C16:0, C16:1.

4 Σ preformed fatty acids (PFA) = sum of C18:0, C20:0, C22:0, C24:0, C8:1, C20:1, C22:1, C24:1, C18:2, C18:3, C20:2, C20:3, C20:4, C20:5, C22:2, C22:3, C22:4, C22:5, C22:6.

5 Σ odd- and branched-chained fatty acids (OBCFA) = sum of C15:0, C15:1, C17:0, C21:0, C23:0.

6 SFA = saturated fatty acid.

7 MUFA = mono-unsaturated fatty acid.

8 PUFA = poly-unsaturated fatty acids.

3.3 Digestibility and rumen fermentation

The digestibility of dietary DM, OM, NDF and ADF, increased linearly and quadratically (P < 0.05), but that of CP (P = 0.018) and EE (P = 0.024) increased linearly with increasing LA dose (Table 5). Although ruminal pH did not decrease, ruminal total VFA content increased quadratically (P = 0.034) with increased LA dose. The molar proportion of acetate was unaffected by LA addition, whereas that of propionate increased linearly (P = 0.021) with increased LA addition. Moreover, the acetate to propionate ratio decreased linearly (P = 0.018) with an increase in LA addition. Conversely, the molar percentages of butyrate, valerate, isobutyrate and isovalerate were unaffected by LA addition. Rumen ammonia N content decreased linearly (P = 0.024) with increased LA addition.Table 5 Impacts of lauric acid addition on nutrient digestibility and ruminal fermentation.

Table 5
Item	Treatments1	SEM	P-value	
CON	LLA	MLA	HLA	Treatment	Linear	Quadratic	
Digestibility, %	
 Dry matter	67.9b	71.2ab	72.7a	72.2ab	0.52	0.034	0.013	0.021	
 Organic matter	68.9b	72.1ab	73.6a	73.2ab	0.51	0.041	0.031	0.033	
 Crude protein	71.8b	75.3ab	76.6a	77.8a	0.78	0.028	0.018	0.346	
 Ether extract	75.7b	78.2ab	79.5a	79.0a	0.53	0.034	0.024	0.287	
 Neutral detergent fiber	54.1b	59.3a	60.7a	59.2a	0.82	0.042	0.032	0.038	
 Acid detergent fiber	42.2b	47.8ab	50.5a	48.9ab	1.11	0.046	0.034	0.023	
Ruminal fermentation	
 pH	6.71	6.68	6.64	6.69	0.019	0.589	0.521	0.267	
 Total volatile fatty acids, mmol/L	85.6b	92.6ab	93.8a	92.7ab	4.02	0.043	0.038	0.034	
 Percentage of total VFA	
 Acetate	61.2	59.6	59.0	58.0	0.56	0.216	0.104	0.482	
 Propionate	20.7b	21.4ab	22.5a	22.2a	0.25	0.037	0.021	0.703	
 Butyrate	14.5	15.1	14.6	15.8	0.36	0.085	0.668	0.124	
 Valerate	1.72	1.72	1.85	2.02	0.093	0.716	0.262	0.672	
 Isobutyrate	0.28	0.34	0.33	0.33	0.012	0.512	0.207	0.331	
 Isovalerate	1.61	1.81	1.76	1.69	0.074	0.875	0.813	0.423	
 Acetate-to-propionate ratio	2.97a	2.79ab	2.63b	2.61b	0.087	0.026	0.018	0.706	
 Ammonia N, mg/dL	15.8a	14.7ab	13.0b	12.7b	0.10	0.041	0.024	0.231	
a,b Means with different superscripts in each row differ significantly (P < 0.05).

1 Control (CON), 0 g/d per cow lauric acid (LA); low-LA (LLA), 100 g/d per cow LA; medium-LA (MLA), 200 g/d per cow LA; high-LA (HLA), 300 g/d per cow LA.

3.4 Microbial enzymatic activities and microbiota

Although the enzyme activities of CMCase and cellobiase were unaffected by LA addition, the activity of xylanase increased linearly (P = 0.012) with increased LA dose (Table 6). The activity of pectinase (P = 0.022) and α-amylase (P = 0.008) increased linearly with an increase in LA dosage. Populations of total anaerobic fungi (P = 0.043) and bacteria (P = 0.044) increased linearly with an increase in LA dosage. Nevertheless, populations of total protozoa (P = 0.019) and methanogens (P = 0.017) decreased linearly with an increase in LA dosage. Populations of R. flavefaciens (P = 0.024), R. albus (P = 0.015), and R. amylophilus (P = 0.047) increased quadratically with an increase in LA dosage. However, populations of F. succinogenes, B. fibrisolvens, and P. ruminicola were unaffected by LA addition.Table 6 Impacts of lauric acid addition on ruminal microbial enzymatic activities and microbiota in dairy cows.

Table 6
Item	Treatments1	SEM	P-value	
CON	LLA	MLA	HLA	Treatment	Linear	Quadratic	
Enzyme activity	
 Carboxymethyl-cellulase, μmol glucose/min per mL	0.167	0.219	0.223	0.228	0.0231	0.368	0.134	0.391	
 Cellobiase, μmol glucose/min per mL	0.173	0.198	0.205	0.194	0.0142	0.187	0.411	0.364	
 Xylanase, μmol xylose/min per mL	0.384b	0.598a	0.592a	0.616a	0.0301	0.023	0.012	0.035	
 Pectinase, μmol D-galacturonic acid/min per mL	0.445b	0.493b	0.556a	0.557a	0.0183	0.037	0.022	0.945	
 α-Amylase, μmol maltose/min per mL	0.517b	0.542ab	0.552a	0.587a	0.0132	0.045	0.008	0.370	
 Protease, μg hydrolyzed protein/min per mL	0.605	0.632	0.724	0.689	0.0415	0.264	0.473	0.030	
Microbiota, copies/mL	
 Total bacteria, × 1011	3.65c	4.73bc	5.71a	5.24ab	0.315	0.047	0.044	0.521	
 Total anaerobic fungi, × 107	1.70b	2.23ab	2.58a	2.51a	0.132	0.036	0.043	0.301	
 Total protozoa, × 105	7.12a	6.54ab	5.26b	4.95b	0.223	0.032	0.019	0.429	
 Total methanogens, × 109	8.64a	8.05ab	7.03bc	6.70c	0.294	0.041	0.017	0.823	
 Ruminococcus albus, × 108	3.42c	5.77b	7.75a	5.01b	0.253	0.029	0.508	0.015	
 Ruminococcus flavefaciens, × 109	2.17b	3.27ab	3.76a	3.38ab	0.193	0.032	0.268	0.024	
 Fibrobacter succinogenes, × 1010	1.77	2.40	3.99	2.74	0.527	0.579	0.372	0.402	
 Butyrivibrio fibrisolvens, × 109	4.22	4.80	5.46	4.57	0.321	0.313	0.380	0.106	
 Prevotella ruminicola, × 1010	2.30	3.88	4.41	4.05	0.427	0.396	0.148	0.268	
 Ruminobacter amylophilus, × 1010	2.08c	3.15b	3.62a	3.06b	0.081	0.046	0.180	0.047	
a-c Means with different superscripts in each row differ significantly (P < 0.05).

1 Control (CON), 0 g/d per cow lauric acid (LA); low-LA (LLA), 100 g/d per cow LA; medium-LA (MLA), 200 g/d per cow LA; high-LA (HLA), 300 g/d per cow LA.

3.5 Blood metabolites

The blood levels of glucose (P = 0.030), triglyceride (P = 0.014), E2 (P = 0.032), prolactin (P = 0.024), and IGF-1 (P = 0.018) increased linearly with an increase in LA addition (Table 7). Furthermore, blood albumin (P = 0.016) and total protein (P = 0.013) concentrations increased quadratically with increased LA dose. Conversely, blood UN content decreased quadratically (P = 0.013) with increased LA dose. Furthermore, blood NEFA concentration decreased linearly (P = 0.013) with increased LA addition.Table 7 Effects of lauric acid addition on blood parameters in lactating dairy cows.

Table 7
Item	Treatments1	SEM	P-value	
CON	LLA	MLA	HLA	Treatment	Linear	Quadratic	
Glucose, mmol/L	3.81b	4.24ab	4.51a	4.44a	0.113	0.045	0.030	0.125	
Total protein, g/L	70.2b	82.2ab	84.7a	81.8ab	1.95	0.016	0.496	0.023	
Albumin, g/L	28.5c	29.9bc	36.3a	34.5ab	0.86	0.027	0.342	0.016	
Urea nitrogen, mmol/L	7.47a	7.27ab	6.62b	6.90ab	0.213	0.049	0.225	0.013	
Triglyceride, mmol/L	1.97c	2.10bc	2.35ab	2.50a	0.081	0.028	0.014	0.394	
Non-esterified fatty acids, μmol/L	287a	281ab	271bc	257c	3.5	0.018	0.013	0.264	
Estradiol, pg/mL	48.4b	52.6ab	65.1a	66.4a	1.72	0.047	0.032	0.411	
Prolactin, mIU/L	569b	588ab	647a	675a	16.1	0.029	0.024	0.503	
Insulin-like growth factor 1, ng/mL	202b	216ab	238a	235a	3.9	0.032	0.018	0.682	
a-c Means with different superscripts in each row differ significantly (P < 0.05).

1 Control (CON), 0 g/d per cow lauric acid (LA); low-LA (LLA), 100 g/d per cow LA; medium-LA (MLA), 200 g/d per cow LA; high-LA (HLA), 300 g/d per cow LA.

3.6 Expression of proteins implicated in fatty acid synthesis

In regard to fatty acid synthesis, the protein levels of PPARγ (P < 0.01), SREBF1 (P < 0.01), FASN (P < 0.01), SCD1 (P < 0.05) and the phosphorylation ratio of ACACA were uniformly increased upon the addition of 200 g/d LA compared with the control (Fig. 1A and B).Fig. 1 Effects of medium lauric acid (MLA) addition on the expressions of proteins associated with fatty acid synthesis in the bovine mammary gland. (A) Western blot analysis of peroxisome proliferator activated receptor gamma (PPARγ), sterol-regulatory element binding proteins (SREBP1, the specific bands with an arrow), acetyl coenzyme A carboxylase-α (ACACA), phosphorylated ACACA (p-ACACA), fatty acid synthase (FASN), and stearoyl CoA desaturase 1 (SCD1) in the tissues of bovine mammary gland in response to 0 g/d LA (Control) and 200 g/d LA (MLA) addition. Beta-actin was used as an internal control. n = 6 per group, selected randomly from the same block of two groups. (B) Mean ± SEM of immunoblotting bands of PPARγ, SREBP1, ACACA, FASN and SCD1. ∗P < 0.05 and ∗∗P < 0.01 against the control group were used.

Fig. 1

3.7 Expression of proteins implicated in cell proliferation

The protein levels of cyclin A1 (P < 0.01) and PCNA (P < 0.05) were uniformly increased upon the addition of 200 g/d LA compared with those in the control (Fig. 2A and B). As a receptor for LA, the GPR84 regulates cell proliferation and apoptosis via the Akt/mTOR signalling pathway. The protein levels of GPR84 was increased (P < 0.01) following 200 g/d LA addition. The phosphorylation ratios of Akt and mTOR were also increased (P < 0.01) following 200 g/d LA addition (Fig. 3A and B).Fig. 2 Impacts of medium lauric acid (MLA) addition on proliferation-related mRNA and protein expression in the bovine mammary gland. (A) Western blot analysis of cyclin A1 and proliferating cell nuclear antigen (PCNA) in bovine mammary gland tissues in response to 0 g/d LA (Control) and 200 g/d LA (MLA) addition. Beta-actin was used as an internal control. n = 6 per group, selected randomly from the same block of two groups. (B) Mean ± SEM of immunoblotting bands for cyclin A1 and PCNA. ∗P < 0.05 and ∗∗P < 0.01 against the control group were used.

Fig. 2

Fig. 3 Effects of medium lauric acid (MLA) addition on the Akt-mTOR signaling pathway in the bovine mammary gland. (A) Western blot analysis of G-protein-coupled receptor 84 (GPR84), Akt, p-Akt, mTORl and p-mTOR in bovine mammary glands treated with 0 g/d LA (Control) and 200 g/d LA (MLA). Beta-actin was used as an internal control. n = 6 per group, selected randomly from the same block of two groups. (B) Mean ± SEM of the immunoblotting bands for p-Akt/Akt and p-mTOR/mTOR. ∗∗P < 0.01 against the control group were used.

Fig. 3

4 Discussion

4.1 Lactation performance

The linear reduction in the DMI of dairy cows is in consonance with the results obtained by Dohme et al. (2004), who found that LA (C12:0) addition reduces DMI to a greater extent than the C14:0 and C18:0 addition. In keeping with the current findings, Külling et al. (2002) also found a decrease in DMI with LA addition. Moreover, 1.3% of LA addition to the basal diet has no influence on DMI (Faciola and Broderick, 2014); however, larger doses of LA in the TMR (480 and 720 g/d) drastically reduce DMI (Faciola and Broderick, 2013). The decreased DMI upon LA supplementation may be ascribed either to the poor palatability of LA (Külling et al., 2002) or impaired rumen degradation of fibre (Dohme et al., 2004) and resultant increased ruminal retention time of feed (Klop et al., 2017a). Previous studies reported that yields of milk and milk components is either unimpacted (Faciola et al., 2013; Hristov et al., 2009) or decreased (Hristov et al., 2011; Faciola and Broderick, 2014; Klop et al., 2017b) following LA supplementation. Conversely, we found that LA addition quadratically increased milk production of actual, 4% FCM, and ECM, quadratically increased production and content of milk protein, and linearly increased production and content of milk fat. This is mainly ascribed to the chosen LA dose, since Faciola and Broderick (2014) used an LA dose of 1.3% of dietary DM, whereas that in our study was 0.46% (LLA), 0.94% (MLA), and 1.45% (HLA) of dietary DM. Furthermore, the quadratic respond to LA addition with no further elevation of milk production indicate that increasing LA dose from 0.94% to 1.45% of dietary DM was not conducive to improving lactation performance. The quadratic response in milk production following LA supplementation might be due to the linear and quadratic changes in the digestibility of DM, OM, NDF and ADF, further research is needed to verify this explanation.

4.2 Milk fat composition

As expected, elevating the supply of C12:0 in the cow diet elevates the proportion of C12:0 which is inflating the proportions of DN FA. Similarly, Dohme et al. (2004) found a greater proportion of C12:0 in milk fat of cows following LA addition compared to C14:0 and C18:0. The decreased proportions of MSFA was mainly resulted from the decreased proportion of C16:0 in milk fat and was due to the decreased DMI. Other previous studies also observed the increased proportion of C12:0 in milk fat and the decreased proportion of C16:0 upon LA addition (Hristov et al., 2011; Klop et al., 2017a, Klop et al., 2017b). The PFA are mostly coming from the diet and from the biohydrogenation of dietary FA. In the current study, the increased proportions of C18:1 and C20:1 in milk fat of cows following LA addition was due to an increase in the apparent digestibility of ether extract and an increase in stearoyl-CoA desaturase. Similarly, Klop et al. (2017a) found that proportions of several C18:1 fatty acids in milk fat of cows were increased with 65 g/kg DM of LA. The unchanged proportions of PFA, OBCFA, SFA, monounsaturated fatty acid (MUFA) or polyunsaturated fatty acids (PUFA) upon LA addition was in keeping with Klop et al. (2017a) and might be due to the comprehensive effect of the decreased DMI and increased nutrient digestibility following LA addition.

4.3 Nutrient digestibility and ruminal fermentation

Previous researches demonstrated digestibility of dietary DM, OM, and CP was not impacted, and both the total-tract and ruminal apparent digestibility of dietary NDF and ADF was reduced upon LA supplementation (Faciola et al., 2013; Faciola and Broderick, 2013, 2014) and after coconut oil feeding (Lee et al., 2011) in dairy cows. However, in the current study the increased nutrient digestibility following LA addition was possibly depend on the increased ruminal bacterial populations and enzymatic activity with an increasing LA dosage (Liu et al., 2018), and resulted in the increased ruminal VFA concentrations, supporting the quadratically improved milk production. Furthermore, the quadratic effect of LA on dietary DM, OM, NDF and ADF digestibility might be depend on the quadratic response of populations of R. albus, R. flavefaciens and Rb. amylophilus to LA addition.

We demonstrated that ruminal pH was unaffected by an increase in LA addition, which concurs with previous observations (Faciola and Broderick, 2013, 2014). Similarly, Kim et al. (2018) demonstrated that LA addition did not impact ruminal pH in Hanwoo steers. Possible explanation for an increase in total VFA and a decrease in ammonia with no change in pH in the current study is an increased absorption of VFA (Suárez et al., 2006) or a net increase of VFA flus (Rémond et al., 2003). Since the VFA flus and production were not measured in this study, it is not possible to tell whether an increase in VFA flow is equivalent to absorption, which was also a limitation of this study. The increased total VFA content was in line with the increased dietary DM digestibility and suggested that ruminal bacterial populations and enzymatic activity were increased following LA addition. Moreover, the linearly decreased ratio of acetate to propionate was depend on the unaltered acetate and linearly increased propionate molar percentages. This implied that the ruminal fermentation pattern tended towards propionate formation under increased LA addition conditions. Correspondingly, Kim et al. (2018) demonstrated that total VFA and propionate content in LA-supplemented Hanwoo steers were greater than those of the control group 6 h after feeding. For glucose and lactose to be synthesized, propionate is an essential substrate (Wang et al., 2009a; Li et al., 2016); therefore, it is possible that LA supplementation enhanced milk production via this mechanism. Nevertheless, Faciola and Broderick (2014) demonstrated that 1.3% LA, based on the dietary DM of dairy cows, caused a small reduction in total VFA concentrations, although the ratio of acetate to propionate was decreased. The linearly decreased rumen ammonia nitrogen content is possibly ascribed to the increased bacterial protein synthesis with LA addition (Cummins and Papas, 1985).

4.4 Microbial enzyme activities and microbiota

In cows, dietary fiber is degraded to acetate by the ruminal bacteria, protozoa, and fungi that secrete cellulolytic enzymes (Orpin, 1984). Feed lignocellulosic tissues can be degraded by ruminal fungi, and approximately 30% of fiber digestion and 10% of VFA production could be due to ruminal protozoa (Wang and McAllister, 2002). Therefore, the linear increase in ruminal xylanase activity with an increasing LA dosage was a consequence of the increased populations of total anaerobic fungi, total bacteria, R. flavefaciens, and R. albus. Moreover, this result supported the increased rumen total VFA and increased digestibility of dietary NDF and ADF.

The increased populations of total anaerobic fungi, total bacteria, R. flavefaciens, and R. albus might be mainly due to the supply of energy from the degradable LA, since the effective degradability of rumen by-pass fat was about 86% (Soren et al., 2022). The linear reduction in populations of total methanogens and protozoa suggested that LA addition suppressed ruminal CH4 production (Soliva et al., 2003). Correspondingly, Kim et al. (2018) observed that LA supplementation decreased methanogen and F. succinogenes populations and significantly increased R. flavefaciens populations. The LA elicits potent antiprotozoal effects (Lee et al., 2011; Faciola and Broderick, 2013) and 160 g/d of LA provided via ruminal cannula reduces ruminal protozoa proportion by 90% within 2 d of treatment (Faciola et al., 2013). The reduction of protozoa population resulted in the decreased protozoa's ability to phagocytose bacteria, thus changing the structure of microflora (Hristov et al., 2012), increasing the populations of total bacteria, total anaerobic fungi, and promoting ruminal fermentation (Wang et al., 2009b). The linear increase in the activity of α-amylase and pectinase was in agreement with the observed elevation in the R. amylophilus population, indicating that LA addition promoted ruminal starch degradation. These results further confirm the increased molar percentage of propionate with an increasing LA dosage. The unaltered ruminal protease activity was mainly associated with the unchanged P. ruminicola population.

4.5 Blood metabolites

The propionate produced by ruminal fermentation is transported to the liver and subsequently converted to glucose (Chan and Freedland, 1972). Therefore, the linear increase in blood glucose following LA addition, which is in keeping with the results of previous researches (Li et al., 2016; Wang et al., 2009a), may be ascribed to an increase in ruminal propionate output (Foley et al., 2009). The linear reduce in NEFA concentration and the linear increase in triglyceride concentration following LA supplementation indicated that body fat mobilization was suppressed and fatty acid synthesis was promoted (Coleman et al., 2021). The increase in glucose and the decrease in NEFA following LA supplementation might suggest an increase in insulin resistance, although some literature in monogastric animals appears to support a reverse effect (Tham et al., 2020), while others indicate an increase in insulin resistance in the adipose tissue (Saraswathi et al., 2020) and liver (Kamoshita et al., 2022). Total protein, albumin, and BUN concentrations are indicators of the protein utilization efficiency (Nousiainen et al., 2004). Although we observed the increased albumin and total protein levels and decreased BUN concentrations following LA supplementation, the ability of LA to improve protein utilization needed to be further studied. It is well-known that IGF-1, prolactin, and E2 are vital for mammary duct development (Rosen, 2012). Moreover, ovary-derived IGF-1, prolactin, and E2 stimulate epithelial cell proliferation (Mallepell et al., 2006). Additionally, the PI3K/Akt signaling pathway was activated by IGF-1 through its receptor and promotes the proliferation of epithelial cells (Zhou et al., 2017). Therefore, our results showing LA addition-induced increased serum IGF-1, prolactin, and E2 concentration can provide some support for a possible mechanism of the effect of LA on mammary epithelium. However, further research on the expression of gene and protein related to the above hormone and its receptor are needed to confirm the effect of LA on mammary epithelium.

Based on the quadratic increase of LA in promoting milk yield and ruminal total volatile fatty acid concentration of dairy cows, and the better effect of the MLA group was selected to compare the difference of proteins implicated in fatty acid synthesis and cell proliferation with the control group.

4.6 Expressions of proteins implicated in fatty acid synthesis

Both PPARγ and SREBP1 regulate the expression of ACACA, FASN, SCD, and fatty acid-binding protein 3 (FABP3) in the mammary gland (Ma and Corl, 2012). Moreover, both FASN and ACACA are involved in fatty acids synthesis from acetate and β-hydroxybutyric acid in the mammary gland (Bionaz and Loor, 2008) and are positively correlated with the secretion of C4-16 fatty acids (Bernard et al., 2008). The SCD protein catalyzes MUFA synthesis from SFA (Lehner and Kuksis, 1996; Zhang et al., 2023). The increased protein levels of FASN, ACACA, PPARγ and SREBP1 following LA supplementation indicated that the proteins implicated in the synthesis of de novo FA and MCFA were upregulated, supporting the elevation in milk fat yield. Similarly, Busato and Bionaz (2021) demonstrated that PPARγ activated by LA in immortalized cell culture model of bovine liver.

4.7 Expressions of proteins implicated in cell proliferation

Stimulating cell proliferation in the mammary gland should be the core control point that promotes lactation persistence in dairy cows. The Cyclin A is regarded as indispensable for initiating and completing DNA replication in the S phase (Lim and Kaldis, 2013). Additionally, PCNA is an essential component of both DNA replication and repair (Park et al., 2016). Moreover, previous researches have certificated the involvement of Cyclin D3 and PCNA in modulating mammary epithelial cell proliferation (Zhang et al., 2018). We demonstrated that LA addition increased the protein expressions of cyclin A1 and PCNA, implying that LA stimulates the proliferation of mammary epithelial cells. Traditionally, most of mammary development and cell growth and differentiation occurs before parturition and then net growth during lactation is expected to be minimal. In view of the results of the current experiment, it could provide a way to promote the research of mammary gland development of perinatal cows in the future.

Previous researches have implicated the Akt signaling pathway in modulation of the proliferation and apoptosis of various cells (Huang et al., 2021; Meng et al., 2017). Moreover, the mTOR signaling pathway is concerned with modulating the proliferation of various cells (Li et al., 2017). Existing research has shown that GPR84, which is strongly activated by LA (Miyamoto et al., 2016; Wang et al., 2006), regulates immune responses (Alvarez-Curto and Milligan, 2016) and MCFA taste transduction (Liu, 2016). Furthermore, LA addition increases GPR84 and Cyclin D1 expression and activates the PI3K/Akt signaling pathway of the mammary glands of pubertal (Meng et al., 2017) and lactating (Yang et al., 2020) mice. The addition of LA increased GPR84 expression and subsequently stimulated Akt and mTOR phosphorylation via GPR84 activation. The results suggest that activating the Akt-mTOR signaling pathway might stimulate proliferative markers to be expressed. Considering that the net growth of mammary gland during lactation is expected to be minimal, the activation of AKT and mTOR with LA addition would be likely more in metabolic regulation, especially the regulation of milk synthesis.

5 Conclusions

Supplementation with LA in cow diets improved the milk yields and feed efficiency in the dose-dependent effect by promoting nutrient digestion, ruminal fermentation, and mammary gland fatty acid synthesis. Moreover, addition of LA activated the GPR84-Akt/mTOR pathway and promoted the protein expressions of cyclin A1 and PCNA.

6 Limitations of the study

Although supplementation of LA improved the milk yields and feed efficiency by promoting nutrient digestion, ruminal fermentation, and expressions of protein implicated in fatty acid synthesis and cell proliferation of mammary gland, the results found in the current study could partly also be due to the increase in energy of the diet because of the lack of isocaloric diet between groups. Further study is needed to verify the effect of LA by balancing of the ration with another fatty acid which would not affect the mammary gland development.

Author contributions

Jing Zhang and Qiang Liu designed the research; Lijun Bu, Yapeng Liu and Wenjie Huo conducted the research; Chengqiang Xia and Caixia Pei analyzed the data; Jing Zhang, Lijun Bu and Yapeng Liu wrote the original draft; Jing Zhang and Qiang Liu had primary responsibility for the final content. All authors read and approved the final manuscript.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements

This study was funded by the Education Department of Shanxi Province, Excellent Doctor Work Award Fund Research Project [SXYBKY2018036 ] and Modern Agro-industry Technology Research System of Shanxi Province (2023CYJSTX13 ).

Peer review under responsibility of Chinese Association of Animal Science and Veterinary Medicine.
==== Refs
References

Agarwal N. Kamra D.N. Chaudhary L.C. Agarwal I. Sahoo A. Microbial status and rumen enzyme profile of crossbred calves fed on different microbial feed additives Lett Appl Microbiol 34 5 2002 329 336 10.1046/j.1472-765X.2002.01092.x 11967054
Alvarez-Curto E. Milligan G. Metabolism meets immunity: the role of free fatty acid receptors in the immune system Biochem Pharmacol 114 SI 2016 3 13 10.1016/j.bcp.2016.03.017 27002183
AOAC Official methods of analysis 17th ed. 2000 Association of Official Analytical Chemists Arlington, VA
Bernard L. Leroux C. Chilliard Y. Expression and nutritional regulation of lipogenic genes in the ruminant lactating mammary gland Adv Exp Med Biol 606 2008 67 108 https://link.springer.com/chapter/10.1007/978-0-387-74087-4 18183925
Bionaz M. Loor J. Gene networks driving bovine milk fat synthesis during the lactation cycle BMC Genom 9 2008 366 10.1186/1471-2164-9-366
Busato S. Bionaz M. When two plus two is more than four: evidence for a synergistic effect of fatty acids on peroxisome proliferator-activated receptor activity in a bovine hepatic model Genes 12 8 2021 1283 10.3390/genes12081283 34440457
Chan T.M. Freedland R.A. The effect of propionate on the metabolism of pyruvate and lactate in the perfused rat liver Biochem J 127 3 1972 539 543 10.1042/bj1270539 5076196
China National Standard Determination of calcium in feeds. GB/T 6436-2018 2018 Standards Press of China Beijing
China National Standard Determination of phosphorus in feeds. GB/T 6437-2018 2018 Standards Press of China Beijing
Chouinard P.Y. Corneau L. Barbano D.M. Metzger L.E. Bauman D.E. Conjugated linoleic acids alter milk fatty acid composition and inhibit milk fat secretion in dairy cows J Nutr 129 8 1999 1579 1584 10.1093/jn/129.8.1579 10419994
Coleman D.N. Alharthi A.S. Liang Y.S. Lopes M.G. Lopreiato V. Vailati-Riboni M. Multifaceted role of one-carbon metabolism on immunometabolic control and growth during pregnancy, lactation and the neonatal period in dairy cattle J Anim Sci Biotechnol 12 1 2021 82 109 10.1186/s40104-021-00547-5 34140038
Cummins K.A. Papas A.H. Effect of isocarbon 4 and isocarbon 5 volatile fatty acids on microbial protein synthesis and dry matter digestibility in vitro J Dairy Sci 68 10 1985 2588 2595 10.3168/jds.S0022-0302(85)81141-3
Dayrit F.M. The properties of lauric acid and their significance in coconut oil J Am Oil Chem Soc 92 1 2015 1 15 10.1007/s11746-014-2562-7
Dohme F. Machmüller A. Sutter F. Kreuzer M. Digestive and metabolic utilization of lauric, myristic and stearic acid in cows, and associated effects on milk fat quality Arch Anim Nutr 58 2 2004 99 116 10.1080/00039420410001667485 15195905
Faciola A.P. Broderick G.A. Broderick. Effects of feeding lauric acid or coconut oil on ruminal protozoa numbers, fermentation pattern, digestion, omasal nutrient flow, and milk production in dairy cows J Dairy Sci 97 8 2014 5088 5100 10.3168/jds.2013-7653 24931520
Faciola A.P. Broderick G.A. Effects of feeding lauric acid on ruminal protozoa numbers, fermentation, digestion, and on milk production in dairy cows J Anim Sci 91 5 2013 2243 2253 10.2527/jas.2012-5169 23463566
Faciola A.P. Broderick G.A. Hristov A. Leão M.I. Effects of lauric acid on ruminal protozoal numbers and fermentation pattern and milk production in lactating dairy cows J Anim Sci 91 1 2013 363 373 10.2527/jas.2012-5168 23097406
Farr V.C. Stelwagen K. Cate L.R. Molenaar A.J. McFadden T.B. Davis S.R. An improved method for the routine biopsy of bovine mammary tissue J Dairy Sci 79 4 1996 543 549 10.3168/jds.S0022-0302(96)76398-1 8744218
Foley P.A. Kenny D.A. Lovett D.K. Callan J.J. Boland T.M.O. Mara F.P. Effect of dl-malic acid supplementation on feed intake, methane emissions, and performance of lactating dairy cows at pasture J Dairy Sci 92 7 2009 3258 3264 10.3168/jds.2008-1633 19528602
Hara A. Radin N.S. Lipid extraction of tissues with a low-toxicity solvent Anal Biochem 90 1 1978 420 426 10.1016/0003-2697(78)90046-5 727482
Hristov A.N. Vander Pol M. Agle M. Zaman S. Schneider C. Ndegwa P. Effect of lauric acid and coconut oil on ruminal fermentation, digestion, ammonia losses from manure, and milk fatty acid composition in lactating cows J Dairy Sci 92 11 2009 5561 5582 10.3168/jds.2009-2383 19841218
Hristov A.N. Lee C. Cassidy T. Long M. Heyler K. Corl B. Effects of lauric and myristic acids on ruminal fermentation, production, and milk fatty acid composition in lactating dairy cows J Dairy Sci 94 1 2011 382 395 10.3168/jds.2010-3508 21183049
Hristov A.N. Callaway T.R. Lee C. Dowd S.E. Rumen bacterial, archaeal, and fungal diversity of dairy cows in response to ingestion of lauric or myristic acid J Anim Sci 90 12 2012 4449 4457 10.2527/jas2011-4624 22952367
Huang J. Qin Y.Y. Lin C.F. Huang X.G. Zhang F.R. MTHFD2 facilitates breast cancer cell proliferation via the AKT signaling pathway Exp Ther Med 22 1 2021 703 10.3892/etm.2021.10135 34007312
Kamoshita K. Tsugane H. Ishii K.A. Takayama H. Yao X.Y. Abuduwaili H. Lauric acid impairs insulin-induced Akt phosphorylation by upregulating SELENOP expression via HNF4α induction Am J Physiol Endocrinol Metab 322 2022 E556 E568 10.1152/ajpendo.00163.2021
Kim S.H. Mamuad L.L. Choi Y.J. Sung H.G. Cho K.K. Lee S.S. Effects of reductive acetogenic bacteria and lauric acid on in vivo ruminal fermentation, microbial populations, and methane mitigation in Hanwoo steers in South Korea J Anim Sci 96 10 2018 4360 4367 10.1093/jas/sky266 30060161
Klop G. Dijkstra J. Dieho K. Hendriks W.H. Bannink A. Enteric methane production in lactating dairy cows with continuous feeding of essential oils or rotational feeding of essential oils and lauric acid J Dairy Sci 100 5 2017 3563 3575 10.3168/jds.2016-12033 28237592
Klop G. van Laar-van Schuppen S. Pellikaan W.F. Hendriks W.H. Bannink A. Dijkstra J. Changes in in vitro gas and methane production from rumen fluid from dairy cows during adaptation to feed additives in vivo Animal 11 4 2017 591 599 10.1017/S1751731116002019 27748233
Külling D.R. Dohme F. Menzi H. Sutter F. Lischer P. Kreuzer M. Methane emissions of differently fed dairy cows and corresponding methane and nitrogen emissions from their manure during storage Environ Monit Assess 79 2 2002 129 150 10.1023/A:1020248700255 12413300
Lee C. Hristov A.N. Heyler K.S. Cassidy T.W. Long M. Corl B.A. Karnati S.K.R. Effects of dietary protein concentration and coconut oil supplementation on nitrogen utilization and production in dairy cows J Dairy Sci 94 11 2011 5544 5557 10.3168/jds.2010-3889 22032378
Lehner R. Kuksis A. Biosynthesis of triacylglycerols Lipid Res 35 1996 169 201 10.1016/0163-7827(96)00005-7
Li L. Liu L. Qu B. Li X. Gao X. Zhang M. Twinfilin 1 enhances milk biosynthesis and proliferation of bovine mammary epithelial cells via the mTOR signaling pathway Biochem Bioph Res Co 492 3 2017 289 294 10.1016/j.bbrc.2017.08.130
Li X.Z. Choi S.H. Yan C.G. Shin J.S. Smith S.B. Dietary linseed oil with or without malate increases conjugated linoleic acid and oleic acid in milk fat and gene expression in mammary gland and milk somatic cells of lactating goats J Anim Sci 94 8 2016 3572 3583 10.2527/jas.2016-0291 27695785
Lim S. Kaldis P. Cdks, cyclins and CKIs: roles beyond cell cycle regulation Development 140 15 2013 3079 3093 10.1242/dev.091744 23861057
Liu Q. Wang C. Guo G. Huo W.J. Zhang S.L. Pei C.X. Effects of branched-chain volatile fatty acids on lactation performance and mRNA expression of genes related to fatty acid synthesis in mammary gland of dairy cows Animal 12 10 2018 2071 2079 10.1017/S1751731118000113 29428005
Liu Y. The role of GPR84 in medium-chain saturated fatty acid taste transduction Dissertation 2016 Utah State University
Ma L. Corl B.A. Transcriptional regulation of lipid synthesis in bovine mammary epithelial cells by sterol regulatory element binding protein-1 J Dairy Sci 95 7 2012 3743 3755 10.3168/jds.2011-5083 22720931
Mallepell S. Krust A. Chambon P. Brisken C. Paracrine signaling through the epithelial estrogen receptor α is required for proliferation and morphogenesis in the mammary gland Proc Natl Acad Sci USA 103 2006 2196 2201 10.1073/pnas.0510974103 16452162
Meng Y. Zhang J. Zhang F. Wei A. Zhu X. Gang S. Lauric acid stimulates mammary gland development of pubertal mice through activation of GPR84 and PI3K/Akt signaling pathway J Agric Food Chem 65 2017 95 103 10.1021/acs.jafc.6b04878 27978622
Meng Y.Y. Zhang J. Cong Y. Zhang F. Wang S. Oleic acid stimulates HC11 mammary epithelial cells proliferation and mammary gland development in peripubertal mice through activation of CD36-Ca2+ and PI3K/Akt signaling pathway Oncotarget 9 16 2018 12982 12994 10.18632/oncotarget.24204 29560125
Miyamoto J. Hasegawa S. Kasubuchi M. Ichimura A. Nakajima A. Kimura I. Nutritional signaling via free fatty acid receptors Int J Mol Sci 17 4 2016 450 10.3390/ijms17040450 27023530
NASEM (National Academies of Sciences, Engineering, and Medicine) Nutrient requirements of dairy cattle 8th ed. 2021 National Academies Press Washington, DC, USA 10.17226/25806
NRC (National Research Council) Nutrient requirements of dairy cattle Subcommittee on dairy cattle nutrition, committee on animal nutrition, and board on agriculture and natural resources 7th revised edition 2001 National Academy of Sciences Washington, DC, USA 214 233
Nousiainen J. Shingfield K.J. Huhtanen P. Evaluation of milk urea nitrogen as a diagnostic of protein feeding J Dairy Sci 87 2 2004 386 398 10.3168/jds.S0022-0302(04)73178-1 14762082
Ong M.H.L. Wong H.K. Tengku-Muhammad T. Choo Q.C. Chew C.H. Pro-atherogenic proteoglycanase ADAMTS-1 is down-regulated by lauric acid through PI3K and JNK signaling pathways in THP-1 derived macrophages Mol Biol Rep 46 3 2019 2631 2641 10.1007/s11033-019-04661-6 30989556
Orpin C.G. The role of ciliate protozoa and fungi in the rumen digestion of plant cell walls Anim Feed Sci Technol 10 1984 121 143 10.1016/0377-8401(84)90003-8
Park S.Y. Mi S.J. Chang W.H. Yu H.S. Jang S.B. Structural and functional insight into proliferating cell nuclear antigen J Microbiol Biotechnol 26 4 2016 637 647 10.4014/jmb.1509.09051 26699741
Rémond D. Bernard L. Chauveau B. Nozière P. Poncet C. Digestion and nutrient net fluxes across the rumen, and the mesenteric- and portal-drained viscera in sheep fed with fresh forage twice daily: net balance and dynamic aspects Br J Nutr 89 5 2003 649 666 10.1079/BJN2003832 12720585
Rosen J.M. On hormone action in the mammary gland CSH Perspect Biol 4 2012 a013086 10.1101/cshperspect.a003178
Salehi H. Reiser S. Focken U. Nutrient digestibility and retention of potential feed ingredients for Rainbow Trout (Oncorhynchus mykiss W.) aquaculture in Iran Aquacult Nutr 2023 2023 8910005 10.1155/2023/8910005
Saraswathi V. Kumar N. Gopal T. Bhatt S. Ai W.L. Ma C. Lauric acid versus palmitic acid: effects on adipose tissue inflammation, insulin resistance, and non-alcoholic fatty liver disease in obesity Biology 9 11 2020 346 10.3390/biology9110346 33105887
SAS User's guide: statistics Version 9 Edition 2002 Statistical Analysis Systems Institute Cary, NC, USA
Soliva C.R. Hindrichsen I.K. Meile L. Kreuzer M. Machmüller A. Effects of mixtures of lauric and myristic acid on rumen methanogens and methanogenesis in vitro Lett Appl Microbiol 37 2003 35 39 10.1046/j.1472-765X.2003.01343.x 12803553
Soren N.M. Chandrasekharaiah M. Rao S.B.N. Ruminal degradability of bypass fat and protein of certain commonly used feedstuffs in dairy rations Indian J Anim Sci 92 4 2022 471 475 10.56093/ijans.v92i4.124171
Suárez B.J. Van Reenen C.G. Beldman G. van Delen J. Dijkstra J. Gerrits W.J.J. Effects of supplementing concentrates differing in carbohydrate composition in veal calf diets: I. Animal performance and rumen fermentation characteristics J Dairy Sci 89 11 2006 4365 4375 10.3168/jds.S0022-0302(06)72483-3 17033024
Tham Y.Y. Choo Q.C. Muhammad T.S.T. Chew C.H. Lauric acid alleviates insulin resistance by improving mitochondrial biogenesis in THP-1 macrophages Mol Biol Rep 47 2020 9595 9607 10.1007/s11033-020-06019-9 33259010
Van Soest P.J. Robertson J.B. Lewis B.A. Methods for dietary fiber, neutral detergent fiber and non-starch polysaccharides in relation to animal nutrition J Dairy Sci 74 10 1991 3583 3597 10.3168/jds.S0022-0302(91)78551-2 1660498
Wang J.H. Wu X.S. Simonavicius N. Tian H. Ling L. Medium-chain fatty acids as ligands for orphan G protein-coupled receptor GPR84 J Biol Chem 281 45 2006 34457 34464 10.1074/jbc.M608019200 16966319
Wang C. Liu Q. Yang W.Z. Dong Q. He D.C. Dong K.H. Huang Y.X. Effects of malic acid on feed intake, milk yield, milk components and metabolites in early lactation Holstein dairy cows Livest Sci 124 1–3 2009 182 188 10.1016/j.livsci.2009.01.016
Wang M.Z. Wang H.R. Yu L.H. Effects of NDF content on protozoal community and grazing rate in rumen J Anim Vet Adv 8 9 2009 1746 1752 10.1016/j.fsi.2009.06.017
Wang Y. McAllister T.A. Rumen microbes, enzymes, and feed digestion-a review Asian-Australas J Anim Sci 15 11 2002 1659 1676 10.5713/ajas.2002.1659
Weatherburn M. Phenol-hypochlorite reaction for determination of ammonia Anal Chem 39 1967 971 974 10.1021/ac60252a045
Williams C.H. David D.J. Iismaa O. The determination of chromic oxide in faeces samples by atomic absorption spectrophotometry J Agric Sci 59 3 1962 381 385 10.1017/S002185960001546X
Yang L. Yang Q. Li F. Yi W.Z. Liu F.F. Wang S.B. Jiang Q.Y. Effects of dietary supplementation of lauric acid on lactation function, mammary gland development, and serum lipid metabolites in lactating mice Animals 10 3 2020 529 10.3390/ani10030529 32235692
Yu Z. Morrison M. Improved extraction of PCR-quality community DNA from digesta and fecal sample Biotechniques 36 5 2004 808 812 10.2144/04365ST04 15152600
Zhang J. Ye J. Yuan C. Fu Q. Zhang F.L. Zhu X.T. Exogenous H2S exerts biphasic effects on porcine mammary epithelial cells proliferation through PI3K/Akt-mTOR signaling pathway J Cell Physiol 233 10 2018 7071 7081 10.1002/jcp.26630 29744857
Zhang J. Liu Y.P. Bu L.J. Liu Q. Pei C.X. Guo G. Milk yields and milk fat composition promoted by pantothenate and thiamine via stimulating nutrient digestion and fatty acid synthesis in dairy cows Animals 13 15 2023 2526 10.3390/ani13152526 37570334
Zhou Y. Li S. Li J. Wang D. Li Q. Effect of microRNA-135a on cell proliferation, migration, invasion, apoptosis and tumor angiogenesis through the IGF-1/PI3K/Akt signaling pathway in non-small cell lung cancer Cell Physiol Biochem 42 4 2017 1431 1446 10.1159/000479207 28715819
