
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00781-8
10.1016/j.psj.2024.104202
104202
METABOLISM AND NUTRITION
Dietary vitamin B6 supplementation alleviates heat stress-induced intestinal barrier impairment by regulating the gut microbiota and metabolites in broilers
Ouyang Jingxin *†
Zhang Chao *†
Deng Chenxi ‡
Wen Ai *†
Zhou Hua *†
You Jinming *†
Li Guanhong liguanhong@jxau.edu.cn
*†1
⁎ Jiangxi Province Key Laboratory of Animal Nutrition, College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang 330045, China
† Jiangxi Province Key Innovation Center of Integration in Production and Education for High-quality and Safe Livestock and Poultry, Nanchang 330045, China
‡ Department of Animal Science and Technology, Jiangxi Biotech Vocational College, Nanchang 330200, China
1 Corresponding author: liguanhong@jxau.edu.cn
16 8 2024
11 2024
16 8 2024
103 11 10420231 5 2024
6 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Heat stress (HS) brings great challenges to the poultry industry. Vitamin B6 (VB6) is an essential micro-nutrient for animals to maintain normal physiological functions and possesses antioxidant and anti-inflammatory properties. This study aimed to explore the effect of VB6 on alleviating HS-induced intestinal barrier impairment in broilers. A total of 250 broilers (609.76 ± 0.34 g) were randomly allocated to 5 groups with 5 replicate cages of 10 birds each. The broilers in thermoneutral (TN) group were raised in thermoneutral conditions (23 ± 1°C) and fed with a basal diet. The birds in other four groups were housed under cycle high temperature (34 ± 1°C for 8 h/d) from d 21 to 35 and fed with the basal diet (HS group) or basal diet supplemented with 6, 12, or 24 mg/kg VB6 (HB-6, HB-12, HB-24 groups). The results showed that HS reduced the growth performance, increased ileum inflammatory cytokines levels, and impaired the gut barrier function (P < 0.05). Compared to the HS group, final body weight, average daily gain, and average daily feed intake, and the feed conversion ratio were improved by VB6 supplementation. The diamine oxidase, interleukin (IL)-1β, tumor necrosis factor-α, IL-18, IL-10, and interferon-γ levels were reduced by VB6 supplementation (P < 0.05). Moreover, VB6 supplementation linearly or quadratically enhanced villus height and villus height-to-crypt depth ratio of duodenum and jejunum, and decreased crypt depth of duodenum and ileum. The mRNA expression of Occlaudin, ZO1, Mucin2, Mucin4, E-cadhein, and β-catenin were increased by VB6 treatment (P < 0.05). Furthermore, dietary VB6 altered the diversity and community of gut microbiota (P < 0.05). A total of 83 differential metabolites associated with the amelioration of VB6 were identified, which were primarily enriched in glycerophospholipid metabolism, caffeine metabolism, and glutathione metabolism pathway. Collectively, VB6 may improve the growth performance and intestinal barrier function of heat-stressed broilers by regulating the ileal microbiota and metabolic homeostasis.

Key words

heat stress
vitamin B6
gut barrier
gut microbiota
metabolite
==== Body
pmcINTRODUCTION

With the rising global temperature, heat stress (HS) has become one of the main environmental stressors that negatively affect the poultry industry. Additionally, broilers are more susceptible to HS due to their high metabolic rate and lack of sweat glands (Abbas, 2021). HS could lead to various physiological disturbances such as compromised intestinal health, acid-base imbalance, oxidative damage, and immune dysregulation (Saeed et al., 2019; Chen et al., 2022). The intestine is responsible for nutrient absorption and metabolism, as well as acting as a barrier against the entry of toxins and pathogens into the circulation. Accumulating studies have confirmed that HS damages intestinal health in broilers by impairing the intestinal barrier integrity, increasing intestinal permeability, disturbing the intestinal microflora homeostasis, and activating the oxidative stress and inflammatory cascade (Ahmad et al., 2022; Deng et al., 2023). These disturbances ultimately contribute to poor growth performance and considerable economic losses. Taken together, exploring easy, fast, and effective mitigation of HS on broilers has become an important research focus. Nutritional intervention is one of the promising approaches to alleviate the detrimental effects of HS including amino acids, vitamins, trace elements, electrolytes, etc (Naga Raja Kumari and Narendra Nath, 2018; Chen et al., 2022).

Vitamin B6 (VB6) is an essential micronutrient for animals to maintain healthy growth and normal physiological functions. VB6 acts as a cofactor in more than 140 biochemical reactions involved in amino acid, carbohydrate, lipid, and nucleic acid metabolism (Stover and Field, 2015). Furthermore, growing pieces of evidences have implied that VB6 has neuroprotective, antioxidant, anti-inflammatory, and immuno-modulatory properties (Farhan Aslam et al., 2017; Bargiela et al., 2022). Epidemiological studies have demonstrated that low plasma VB6 levels are closely associated with increased severity of multiple inflammatory diseases such as COVID-19, cardiovascular disease, and inflammatory bowel disease (Saibeni et al., 2003; Kumrungsee et al., 2020). Studies on mice and rabbits also have indicated that HS or disease challenges may increase the requirement of VB6 (Allen et al., 2019; Bai et al., 2022). Furthermore, VB6 supplementation inhibits NF-κB and NOD-like receptor protein 3 (NLRP3) inflammasome activation, thereby suppressing interleukin-1β production (Zhang et al., 2016), and suppressing colonic inflammation (Selhub et al., 2013). Previous study on laying hens has reported that 8 mg/kg VB6 supplementation could improve feed conversion and egg production (Kucuk et al., 2008). However, to the best of our knowledge, there are scarce studies about the effect of VB6 supplementation on growth performance and intestinal barrier function in heat-stressed broilers as well as the potential anti-inflammatory mechanisms. Therefore, the objective of this study was to investigate the effects of dietary VB6 supplementation on growth performance, gut barrier function as well as ileum microbiota and metabolites in heat-stressed broilers.

MATERIALS AND METHODS

Experimental Design and Diet

A total of 300 one-day-old male Arbor Acres broiler chicks were obtained from a commercial hatchery. The chicks were reared under a standard management program and fed with the starter diet for 20 d. The chicks were vaccinated routinely. At 21 d of age, a total of 250 broilers with similar body weight (609.76 ± 0.34 g) were randomly allocated to 5 groups with 5 replicate cages of 10 broilers each. The birds in thermoneutral (TN) group were raised in an environmentally controlled room under thermoneutral conditions (23 ± 1°C) and fed a basal diet. The birds subjected to cycle HS were housed under high temperature (34 ± 1°C) for 8 h per day (9:00–17:00) and 23 ± 1°C for the remaining time in another temperature-controlled room with dimensions completely identical to those of thermoneutral room, and were fed with the basal diets supplemented with 0, 6, 12, or 24 mg/kg VB6 (HS, HB-6, HB-12, HB-24 groups). The treatment lasted for 14 d. The relative humidity was maintained at 60 to 65% among all groups during the entire trial period. The corn-soybean meal basal diet (Table 1) was formulated to meet nutrient requirements of the Feeding Standard of Chicken, China. The chemical composition of the basal diets was analyzed according to AOAC (2005). All broilers were housed in stainless steel cages (120 cm × 70 cm × 40 cm) with a 24-h light regimen and free access to feed and water throughout the experimental period. The illumination was gradually reduced from 20 lux on d 0 to 5 lux. The temperature conditions were controlled by an automatic temperature control system and recorded twice daily at 10:00 and 15:00, respectively. The VB6 added to the experimental diet was pyridoxine hydrochloride (98∼101% purity, Xinfa Pharmaceutical Co., Ltd.). The VB6 content in the basal diet was determined by high performance liquid chromatography to be 3.86 mg/kg. All the experimental procedures were performed following the Laboratory Animal Welfare and Ethics Censorship and approved by the Laboratory Animals Ethics Committee of Jiangxi Agricultural University, Nanchang, China (No. JXAULL-2021-036).Table 1 Compositions and nutrient levels of basal diets.

Table 1Items	Starter
1-20 d	Grower
21-35 d	
Ingredient (%)			
Corn	56.50	59.20	
Soybean meal, 43%CP	21.00	17.20	
Corn gluten meal, 64%CP	8.50	8.20	
Extruded soybean, 34%CP	8.00	8.50	
Soybean oil	1.00	2.10	
NaCl	0.30	0.30	
Limestone	1.50	1.30	
Dicalcium phosphate	1.70	1.50	
Mineral premix1	0.20	0.20	
Vitamin premix2	0.045	0.03	
L-Lysine HCl	0.26	0.36	
DL-Methionine	0.15	0.04	
Choline chloride	0.10	0.10	
Zeolite powder	0.745	0.97	
Total	100.00	100.00	
Chemical composition			
Metabolizable energy (MJ/kg)	12.60	13.00	
Crude ash	5.80	5.57	
Crude fat	2.65	4.43	
Crude protein (%)	21.36	20.34	
Tryptophan (%)	0.22	0.20	
Lysine (%)	1.17	1.16	
Methionine (%)	0.54	0.41	
Threonine (%)	0.83	0.77	
Calcium (%)	1.00	0.92	
Available phosphorus (%)	0.46	0.41	
1 The mineral premix provided the following (per kg of diet): Fe (ferrous sulfate monohydrate) 80 mg; Se (sodium selenite) 0.30 mg; Cu (basic copper chloride) 8 mg; Mn (manganese sulfate monohydrate) 100 mg; Zn (zinc sulfate monohydrate) 80 mg; I (calcium iodate) 0.7 mg.

2 The vitamin premix provided the following per kg of the diet: Vitamin A 9,000 IU; Vitamin D3 3,000 IU; Vitamin E 24 IU; Vitamin K3 3 mg; Vitamin B1 3.18 mg; Vitamin B2 7.50 mg; Vitamin B6 3.00 mg; Vitamin B12 0.02 mg; D-biotin 0.12 mg; D-pantothenic acid 15 mg; Folic acid 1.50 mg; Niacinamide 30 mg.

Performance Measurement and Sample Collection

The initial and final body weight (FBW) of birds per cage were weighted on a cage basis at 21 and 35 d of age, respectively. Feed intake of birds per cage was recorded daily. The average daily body weight gain (ADG), average daily feed intake (ADFI), and the feed conversion ratio (feed-to-gain ratio, F/G) were calculated accordingly on a pen basis.

At d 35, after overnight fasting, 2 birds with similar body weight to the average BW from each cage were randomly selected and sampled. Blood samples (6 mL) were collected from the wing vein and collected into 10 mL vacuum tubes, then centrifuged at 3,000 g for 10 min at 4°C to obtain serum, and stored at −20°C for further assays. After blood collection, the broilers were euthanized by cervical dislocation and necropsied immediately. Approximately 2 cm segments of the duodenum, jejunum, and ileum were isolated, cleaned with ice-cold phosphate buffer saline, and then fixed in 4% paraformaldehyde and kept at 4°C for morphology analysis. The mucosa samples of each intestinal segment were scraped with glass slides, immediately frozen in liquid nitrogen, and then stored at −80°C for further analysis (Deng et al., 2023).

Serum Intestinal Permeability Biomarkers

The serum diamine oxidase (DAO) activity was measured by spectrophotometry method. The serum D-lactic acid (D-LA) and lipopolysaccharide (LPS) concentration were detected using commercial chicken ELISA Assay Kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China) according to the manufacturer's instructions.

Ileum Cytokines Levels

The concentrations of ileum interleukin (IL)-1β, IL-6, IL-10, IL-18, tumor necrosis factor (TNF)-α and interferon (IFN)-γ were determined using commercial ELISA kits (Shanghai Enzyme-linked Biotechnology Co., Ltd., Shanghai, China). All procedures were performed according to the manufacturer's instructions. Approximately 0.1 g of frozen ileum mucosa was homogenized with ice-cold phosphate buffer saline (1:9, weight/volume) and centrifuged at 5,000 g for 10 min at 4°C. Then the supernatant was collected for further assay. The cytokine content was standardized to the total protein in each sample. The total protein content in the ileum mucosa was detected by the bicinchoninic acid (BCA) method.

Intestinal Morphology Determination

The fixed intestinal tissues were dehydrated using graded ethanol and xylene baths and embedded in paraffin, and then 3 to 4 μm sections were stained with hematoxylin-eosin for morphological examination. Ten well-oriented and intact villi and adjacent crypts of each slice were randomly chosen to measure the villus height (VH) and crypt depth (CD) using Image-Pro Plus 6.0 software (Media Cybernetics, Inc., Bethesda, MD), and the villus height-to-crypt depth ratio (VH/CD) was calculated.

RNA Extraction and Real-Time Quantitative PCR

Total RNA was extracted from ileum mucosa using the TransZol Reagent (TransGen Biotech Co., Ltd, Beijing, China) according to the manufacturer's protocol. The RNA purity and concentration were determined by Nanodrop ND-1000 (Nanodrop Technologies, Thermo Scientific, Wilmington, DE) to make sure that the OD260/OD280 ratios were between 1.8 and 2.0. RNA was reverse-transcribed into cDNA using the Reverse-Transcription Kit (TransGen Biotech Co., Ltd., Beijing, China). Quantitative real-time PCR was performed on the CFX96 RT-PCR Detection System (Bio-Rad, Hercules, CA) using the Universal Blue SYBR Green qPCR Master Mix according to the manufacturer's instructions. The reaction was as follows: initial denaturation at 95°C for 30 s, then 42 cycles of denaturation at 95°C for 15 s and annealing at 60°C for 30 s. The primers (Table 2) were designed and synthesized by Gene-ray Biotech Co., Ltd (Shanghai, China). The fold change of the target genes was normalized to a housekeeping gene (β-actin) and calculated using the 2−ΔΔCT method as previously described (Livak and Schmittgen, 2001).Table 2 Primer sequences for real-time quantitative PCR analysis.

Table 2Gene	Accession no.	Primer sequence (5’–3’)	Product size (bp)	
Occludin	NM_205128.1	(F) CCTCATCGTCATCCTGCTCT
(R) GGTCCCAGTAGATGTTGGCT	95	
Claudin1	NM_001013611.2	(F) AGAAGATGCGGATGGCT
(R) AACGGGTGTGAAAGGGT	125	
Claudin2	NM_001277622.1	(F) GATACGTGTAGCAGCAGCAG
(R) AGCTGGGATTTCTGAGCAGT	167	
ZO1	XM_046925213.1	(F) TGGGCTTACTCGGTTGCATA
(R) AAAGTACGCCCTACCTGTCC	181	
Mucin2	XM_040673077.2	(F) TTTACCCTGTCCAGGCACAT
(R) CATCTGAGGAGCCACAAGGA	167	
Mucin4	XM_025153623.3	(F) GCAGAACTCCCTTCTCACCA
(R) GCTGGATGGTAACACTGCTG	103	
β-catenin	XM_046910392.1	(F) CGTGCCACAGTCTCTGAAAG
(R) TTGGGTTGCCATGTTCCTTG	68	
E-cadhein	NM_001039258.3	(F) TACATCGAGGAGAACGCGAA
(R) CCGGGTCAATGGTGAACATC	157	
β-actin	L08165.1	(F) GATTTCGAGCAGGAGATGGC
(R) GCCAATGGTGATGACCTGAC	90	
ZO1, zonula occludens1; F, forward; R, reverse.

Gut Microbiome Analysis

The HB-12 group was selected to compare the differences between the TN and the HS groups for further analysis. Total genomic DNA from ileum mucosa microbiota was extracted by the cetyltrimethylammonium bromide (CTAB) method. After verifying the concentration and integrality of templates, the V3–V4 region of 16S rDNA was amplified using the following specific primers (314F: 5´-CCTAYGGGRBGCASCAG-3´; 806R: 5´-GGACTACNNGGGTATCTAAT-3´) as previously described (Zhu et al., 2023). The libraries were generated, assessed, and sequenced by the Illumina platform PE250 instrument (Novogene Co., Ltd, Beijing, China). Sequences with similarity ≥ 97% were clustered into the same operational taxonomic units (OTU). The top 10 taxa at the phylum and genus levels were selected to plot the distribution histogram of relative abundance in Perl through SVG function. Venn diagram was produced in R with Venn Diagram function. The α-diversity indices including Chao1, Shannon, and Simpson were calculated using QIIME2 software. Non-metric multidimensional scaling (NMDS) was used as a β-diversity index to evaluate the complexity of the community composition and compare the differences among treatments. The linear discriminant analysis effect size (LEfSe) (LDA > 2.5) and MetaStat analysis were conducted to compare the differences in the relative abundances of microbiota among groups.

Nontargeted Metabolomic Analysis

100 mg of frozen ileum sample was individually grounded with liquid nitrogen and re-suspended with prechilled 80% methanol. The samples were vortexed and incubated on ice for 5 min, then centrifuged at 15,000 g, 4°C for 20 min. Some of the supernatant was diluted to a final concentration containing 53% methanol by LC-MS grade water and then centrifuged at 15000 g, 4°C for 20 min. Finally, the supernatant was injected into the LC-MS/MS system analysis (Novogene Co., Ltd, Beijing, China). Multivariate statistical analyses were conducted with partial least squares-discriminant analysis (PLS-DA). These identified metabolites were annotated using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (https://www.genome.jp/kegg/pathway.html), Human Metabolome Database (HMDB) database (https://hmdb.ca/metabolites), and LIPID Maps database (http://www.lipidmaps.org/). The metabolites with variable importance projection (VIP) > 1, P value < 0.05 and fold change (FC) > 1.2 or FC < 0.833 were considered to be differential metabolites. Finally, the identified differential metabolites were enriched by the KEGG pathway analysis.

Statistical Analysis

The data are presented as means ± standard error of the mean (SEM). Differences among groups were determined to be significant with a value of P < 0.05 by one-way ANOVA followed by Duncan's post hoc test. Orthogonal polynomial contrasts were used to examine the linear and quadratic effects of vitamin B6 levels on the growth performance, intestinal barrier function and ileum cytokines levels of heat-stressed broilers. Spearman correlation analysis was used to analyze the relationships between gut microbiota and metabolites or host phenotype parameters.

RESULTS

Growth Performance

As shown in Table 3. In comparison to the TN group, HS significantly reduced the FBW, ADG, ADFI, and feed conversion ratio (FCR) (higher F/G) in heat-stressed broilers (P < 0.05). Compared to the HS group, the FBW, ADG, and ADFI of broilers increased linearly and the FCR increased both linearly and quadratically (P < 0.05) with increasing supplemental vitamin B6 levels.Table 3 Effect of vitamin B6 on the growth performance of heat-stressed broilers.

Table 3	Treatments			Effect of vitamin B6 under HS
P2-Value	
Items	TN	HS	HB-6	HB-12	HB-24		TN vs HS
P1-Value	
SEM	Main effect	Linear	Quadratic	
IBW	610.60	610.38	608.90	609.90	609.04	0.29	0.789	0.230	0.244	0.587	
FBW	1,591.20	1,416.14b	1,429.16b	1,528.40a	1,496.98a	13.68	<0.001	0.001	<0.001	0.250	
ADG	70.04	57.78b	58.99b	65.56a	63.65a	0.94	<0.001	0.001	0.001	0.237	
ADFI	117.44	102.06b	102.93b	113.19a	110.01a	1.32	<0.001	<0.001	<0.001	0.241	
F/G	1.68	1.81a	1.75b	1.71b	1.73b	0.01	0.011	0.012	0.007	0.035	
Mean values within the same row not sharing a common superscript letter differ significantly (P < 0.05).

Abbreviations: IBW, initial body weight; FBW, final body weight; ADG, average daily gain; ADFI, average daily feed intake; F/G, feed-to-gain ratio.

Treatments: TN, thermoneutral group; HS, heat stress group; HB-6, 12, 24, heat stress + 6, 12, 24 mg/kg vitamin B6 group (n = 5).

Serum Intestinal Permeability Biomarkers

As shown in Figure 1, Compared to the TN group, serum DAO concentration in the HS group was significantly increased (P < 0.05). Compared to the HS group, the concentration of serum DAO decreased quadratically with the addition of dietary VB6 (P < 0.05). While there were no significant differences in serum LPS and D-LA levels among treatments (P > 0.05).Figure 1 Effect of vitamin B6 on serum intestinal permeability biomarkers of heat-stressed broilers. Data are presented as mean ± SEM (n = 10). Mean values of the TN group and HS group with * differ significantly (P < 0.05). Mean values of the HS group, HS + 6 mg/kg VB6 group, HS + 12 mg/kg VB6 group and HS + 24 mg/kg VB6 group without common superscript letters differ significantly (P < 0.05). Abbreviations: DAO, diamine oxidase; LPS, lipopolysaccharide; D-LA, D-lactic acid. Treatments: TN, thermoneutral group; HS, heat stress group; HB-6, 12, 24, heat stress + 6, 12, 24 mg/kg vitamin B6 group.

Figure 1

Ileum Cytokines Levels

The levels of ileum IL-1β, IL-6, IL-10, IL-18, TNF-α, and IFN-γ are presented in Figure 2. The HS group exhibited higher levels of TNF-α, IL-18, IL-10, and IFN-γ in the ileum mucosa of broilers compared to the TN group (P < 0.05). In contrast to the HS group, the concentrations of IL-1β, TNF-α, IL-18, and IL-10 in the HS + 6 and 12 mg/kg groups were quadratically down-regulated (P < 0.05). Moreover, dietary supplementation with 6, 12, and 24 mg/kg VB6 significantly down-regulated the ileum IFN-γ level compared to the HS group (P < 0.05).Figure 2 Effect of vitamin B6 on ileum cytokines levels of heat-stressed broilers. Data are presented as mean ± SEM (n = 10). Mean values of the TN group and HS group with * differ significantly (P < 0.05). Mean values of the HS group, HS + 6 mg/kg VB6 group, HS + 12 mg/kg VB6 group and HS + 24 mg/kg VB6 group without common superscript letters differ significantly (P < 0.05). Abbreviations: IL, interleukin; TNF-α, tumor necrosis factor-α; IFN-γ, interferon-γ. Treatments: TN, thermoneutral group; HS, heat stress group; HB-6, 12, 24, heat stress + 6, 12, 24 mg/kg vitamin B6 group.

Figure 2

Intestinal Morphology

As shown in Table 4. The VH/CD of the 3 intestinal segments in the HS group had a significant decrease compared to the TN group (P < 0.05). Meanwhile, exposure to HS significantly decreased the VH of jejunum, but increased the CD of duodenum and ileum in heat-stressed broilers (P < 0.05). In comparison to the HS group, dietary supplementation with VB6 linearly and quadratically increased the VH/CD of the 3 intestinal segments and improved the VH of the duodenum and jejunum, but linearly decreased the CD of duodenum and ileum in heat-stressed broilers (P < 0.05).Table 4 Effect of vitamin B6 on the intestinal morphology of heat-stressed broilers.

Table 4	Treatments			Effect of vitamin B6 under HS P2-value	
Items	TN	HS	HB-6	HB-12	HB-24		TN vs HS
P1-Value	
SEM	Main effect	Linear	Quadratic	
Duodenum											
 VH (μm)	1,895.75	1,746.06b	1,991.40a	1,956.17a	2,092.38a	42.06	0.090	0.011	0.003	0.373	
 CD (μm)	170.67	234.03a	226.86a	184.73b	207.17ab	6.06	0.010	0.005	0.006	0.111	
 VH/CD	10.17	7.89b	9.39a	10.33a	10.27a	0.28	0.025	<0.001	<0.001	0.028	
Jejunum											
 VH (μm)	1,823.89	1,541.41b	1,798.39a	1,839.62a	1,887.13a	40.00	<0.001	<0.001	<0.001	0.030	
 CD (μm)	195.93	217.93	206.55	184.89	196.08	6.24	0.211	0.291	0.128	0.366	
 VH/CD	9.92	7.03b	8.17b	9.68a	9.77a	0.34	0.006	0.002	<0.001	0.293	
Ileum											
 VH (μm)	1,253.67	1,194.12	1,282.15	1,347.13	1,347.40	24.51	0.102	0.090	0.021	0.326	
 CD (μm)	148.47	196.16a	171.21ab	139.66b	147.75b	7.40	0.021	0.010	0.002	0.159	
 VH/CD	9.01	6.86b	7.35b	9.32a	9.00a	0.27	0.006	<0.001	<0.001	0.180	
Mean values within the same row not sharing a common superscript letter differ significantly (P < 0.05).

Abbreviations: VH, villus height; CD, crypt depth.

Treatments: TN, thermoneutral group; HS, heat stress group; HB-6, 12, 24, heat stress + 6, 12, 24 mg/kg vitamin B6 group (n = 10).

Intestinal Barrier Function

As shown in Figure 3, HS exposure significantly decreased the mRNA expression of ZO1, Mucin2, and E-cadhein in ileum mucosa compared to the TN group (P < 0.05). The HS + 6 mg/kg VB6 group showed increased Occlaudin, ZO1, and β-catenin expressions in ileum mucosa (P < 0.05); The mRNA expression of Mucin2 and E-cadhein were quadratically enhanced with VB6 supplementation (P < 0.05). The mRNA expression of Mucin4 was enhanced with 24 mg/kg VB6 supplementation compared to the HS group (P < 0.05).Figure 3 Effect of vitamin B6 on the mRNA expression of intestinal barrier function of heat-stressed broilers. Data are presented as mean ± SEM (n = 10). Mean values of the TN group and HS group with * differ significantly (P < 0.05). Mean values of the HS group, HS + 6 mg/kg VB6 group, HS + 12 mg/kg VB6 group and HS + 24 mg/kg VB6 group without common superscript letters differ significantly (P < 0.05). Abbreviations: ZO1, zonula occludens1. Treatments: TN, thermoneutral group; HS, heat stress group; HB-6, 12, 24, heat stress + 6, 12, 24 mg/kg vitamin B6 group.

Figure 3

Ileum Microbiota

The α-diversity indexes of ileum microbiota are shown in Figure 4A. The Chao1 of ileum microbiota in the HS group was lower than that in the TN group. But there were no significant differences in the Shannon and Simpson indexes among groups. The NMDS based on unweighted unifrac was performed to evaluate the similarities differences of ileum microbial community structure among the 3 groups. As shown in Figure 4B, most of the samples of TN group and HS group were separated, and the sample points of the HB-12 group were distributed between the samples of the TN group and HS group. There were significant differences in microbial communities, indicating that heat exposure and dietary supplementation with VB6 had different effects on ileal microbial composition. As shown in Figure 4C, a total of 616 OTUs were shared by the TN group and the HS group, while 593 OTUs were shared by the HS group and the HB-12 group. In particular, there were 1715 unique OTUs in the TN group, 573 in the HS group, and 1271 in the HB-12 group.Figure 4 Effect of vitamin B6 on the composition of gut microbiota in the ileum mucosa of heat-stressed broilers. (A) α diversity indices (Chao1, Shannon, Simpson). (B) Non-metric multidimensional scaling (NMDS) plot. (C) Venn plot. * Represents significant difference between TN and HS, HS and HB-12 (P < 0.05). Treatments: TN, thermoneutral group; HS, heat stress group; HB-12, heat stress + 12 mg/kg vitamin B6 group.

Figure 4

The MetaStat analysis was performed to test the significant differences between groups. At the phylum level, Firmicutes was the dominant bacteria in the ileum, followed by Proteobacteria and Bacteroidota (Figures 5A–5B). The relative abundance of Proteobacteria, Actinobacteriota, and Acidobacteriota of ileum mucosa in the HS group were significantly decreased than those in the TN group. Compared to the HS group, supplementation with VB6 significantly enhanced the relative abundance of Proteobacteria (Figure 5C). At the genus level, in contrast to the TN group, the relative abundance of Pseudomonas, Gardnerella, Vibrio, Ralstonia, unidentified_Chloroplast, Pseudoalteromonas, Aeromonas, Stenotrophomonas in ileum mucosa were all reduced in the HS group. Compared to the HS group, the relative abundance of Vibrio, unidentified_Chloroplast, and Pseudoalteromonas were enhanced by dietary 12 mg/kg VB6 supplementation (Figure 5D).Figure 5 Differences in the bacterial communities of ileum mucosa determined by LEfSe analysis and MetaStat analysis. (A) The microbial community at the phylum level. (B) The microbial community at the genus level. (C) The significant differential microbiota at the phylum level by MetaStat analysis. (D) The significant differential microbiota at the Top 30 genus level by MetaStat analysis. (E) The LEfSe analysis (LDA score ≥ 2.5). * Represents significant difference between TN and HS, HS and HB-12 (P < 0.05). Treatments: TN, thermoneutral group; HS, heat stress group; HB-12, heat stress + 12 mg/kg vitamin B6 group.

Figure 5

The differences in taxonomic abundance among treatments were identified by further LEfSe (LDA > 2.5) and MetaStat analysis (Zhu et al., 2023). There were 26 discriminative species identified among the 3 treatments in the ileum mucosa of broilers. Romboutsia (genus), Prevotella (genus), Microbacterium (genus), and Marinomonas (genus) were dominant in the TN group. Furthermore, Campylobacteraceae (family), Campylobacter (genus), Pasteurellaceae (family), Pseudoalteromonas (genus), Pseudoalteromonadaceae (family), Cyanobacteria (class), Vibrionaceae (family), Vibrio (genus), Enterobacterales (order) were abundant in the HB-12 group (Figure 5E).

Ileum Nontargeted Metabolomics

PLS-DA is a supervised differential discriminant analysis method that could reflect the differences between groups. As shown in Figures 6A–6D. There were reliable and significant separation between the TN and HS groups (R2 = 0.84, Q2 = −0.57), as well as between the HS and HB-12 groups (R2 = 0.79, Q2 = −0.70). According to replacement test of the PLS-DA model, the data of R2 were larger than Q2 and the intercept between the Q2 regression line and Y-axis was less than 0, indicating that there is no overfitting and the results of the PLS-DA model are reliable.Figure 6 Effect of vitamin B6 on the ileum mucosa metabolites of heat-stressed broilers. (A-B) Partial least squares-discriminant analysis (PLS-DA) score plot. (C-D) PLS-DA valid plot. (E) Pie chart of identified metabolites classification. (F) Venn plot. (G) KEGG pathway enrichment analysis of differential metabolites. Treatments: TN, thermoneutral group; HS, heat stress group; HB-12, heat stress + 12 mg/kg vitamin B6 group.

Figure 6

After rigorous quality screening and identification, a total of 1265 metabolites in ileum mucosa from the 3 groups were identified (Table S1). According to the classification and statistics of metabolites (Figure 6E), the metabolites of lipids and lipid molecules accounted for the largest proportion of 41.23%, followed by organic acids and their derivatives, accounting for 20.79%, in addition, to organic heterocyclic compounds, nucleotides and their analogs, organic oxygen compounds, phenyl and polyketones were also identified.

Differential metabolites were screened according to VIP > 1.0, FC > 1.2 or FC < 0.833 and P value < 0.05. As shown in Figure 6F, compared to the TN group, a total of 208 differential metabolites were screened in the HS group. Moreover, in contrast to the HS group, 186 differential metabolites were detected in the HB-12 group. In addition, there were 83 different metabolites both existing in the 2 comparison pairs. (Figure 6F and Table S2).

The KEGG was used to analyze the pathway enrichment of these 83 differential metabolites. The analysis showed that VB6 regulated 23 metabolic pathways in heat-stressed broilers, including caffeine metabolism, ether lipid metabolism, fatty acid biosynthesis, glycerophospholipid metabolism, glutathione metabolism, and so on (Figure 6G and Table S3).

Spearman Correlation With Ileal Microbiota and Metabolite or Host Phenotype Parameters

To further assess the correlation between gut microbiota, differential metabolites, and gut health, the differential microbiota at the phylum and genus levels, and ileal differential metabolites with FC > 2 were selected for correlation analysis. As shown in Figure 7, the abundances of Proteobacteria and Psedoalteromonas, whose abundances were remarkably increased by VB6 supplementation, were positively correlated with most of the lysophosphatidylcholine (LPC) and lysophosphatidylethanolamine (LPE) metabolites in ileum mucosa. The abundances of Acidobacteriota and Psedomonas were positively correlated with most of the LPC and LPE metabolite. The levels of IL-10 and IFN-γ also had positive correlations with the concentrations of Cholesteryl ester (CE) 18:2 and Ceramide (Cer) 18:1. Moreover, the expression of Mucin4 was positively correlated with the concentrations of LPC, Ceramide metabolites and glycerophosphocholine.Figure 7 Spearman correlation among ileal differential metabolites with FC > 2, differential microbiota at the phylum and genus levels, differential gut barrier parameters and inflammatory cytokines. The red circle represents a positive correlation and blue circle represents a negative correlation. * Represents significant difference (P < 0.05).

Figure 7

DISCUSSION

HS is one of the most important stressors in the poultry industry that would cause metabolic disturbance, poor performance, and even lead to disease or mortality (Chen et al., 2021). Multiple studies have confirmed that HS induced adverse effects on growth performance of broilers (El-Deep et al., 2019; Tang et al., 2022; Deng et al., 2023). Consistently, our study suggested that HS significantly decreased the ADG, AGFI, and FCR of broilers, dietary supplementation with 12 and 24 mg/kg VB6 improved growth performance by increasing ADG, ADFI, and FCR of the heat-stressed broilers. As reported, under normal condition, laying hens fed with a purified diet deficient in VB6 showed slow growth, depressed appetite, and significent decrease in egg production compared with hens fed with VB6-supplemental diet (Weber, 2009). Tsiagbe et al. (1987) indicated that addition of 3 mg/kg VB6 completely prevented growth suppression and depressed immune responses of broiler chicks. Thus, the beneficial effect of VB6 on growth performance in broilers might be partially related to the regulation of appetite and enhancement of the immune system.

The normal intestinal morphology and integrated intestinal barrier are responsible for animal growth and health. In response to the high temperature, the surface blood flow increases for heat dissipation, in turn leading to a decreased blood supply in the gut. This may induce the ischemia and hypoxia of gut, subsequently resulting in intestinal damage and mucosal barrier disorder (Abbas, 2017; Rostagno, 2020). The present study found that HS damaged the gut morphology of broilers in terms of the shortened VH and increased CD, but dietary VB6 supplementation improved these. In addition, DAO is an intracellular enzyme synthesized by intestinal epithelia which could be released into the blood as a result of intestinal mucosal impairment (Nieto et al., 2000). In the current study, 6 and 12 mg/kg VB6 supplementation reversed the increased serum DAO activity in the heat-stress broilers, which indicated that the intestinal barrier permeability was somewhat restored. Mucin is secreted by goblet cells to form the mucus layer, which is the first line of defense barrier (Duangnumsawang et al., 2021). Tight junction (occlaudin, claudin, and zonula occludens) and adhesion junction (E-cadherin and β-catenin) proteins are essential components of gut physical barrier (Slifer and Blikslager, 2020). Increasing evidence indicates that HS down-regulated the expression of junction proteins and impaired intestinal integrity and morphology (Zhang et al., 2017; Chen et al., 2021). Consistently, this study found that the barrier function was destroyed by HS, as reflected by the decreased mRNA expression of ZO1, E-cadherin, and Mucin2. Numerous studies have illustrated the beneficial effect of VB6 on intestinal health and development (Jiménez et al., 2013; Huang et al., 2019). Moreover, VB6 supplementation could improve the intestinal morphology by increasing villus height and villus width in the ileum of weaned piglets fed high-protein diet (Li et al., 2019b). Consistently, our results showed that the VH (duodenum and jejunum) and VH/CD (duodenum, jejunum, and ileum) were markedly increased and the CD (duodenum and ileum) was decreased by VB6 treatment. That mutually coincides with the decreasing release of DAO which is released by the villus tip cells or the mucosal surface. VB6 is considered uniquely critical to mucin formation because of its extensive involvement with the synthesis of the protein as well as the formation of component oligosaccharides (Moran, 2017), which may explain the enhancement of Mucin2 and Mucin4 expression by VB6 supplementation in the present study. Therefore, these results suggest that dietary supplementation of VB6 could attenuate the degree of intestinal injury caused by HS and improve intestinal integrity and morphology under HS conditions.

The dysfunction of intestinal barrier may enable the translocation of endotoxins and pathogens into circulation, subsequently stimulating system inflammatory response, cytokines production, and tissue damage (Koch et al., 2019). As generally accepted, cytokines are the critical modulators of intestinal inflammation (Borish and Steinke, 2003). The abnormal inflammatory cytokine profile in heat-stressed broilers have been observed (Wu et al., 2018; Ouyang et al., 2023). Our study also found that HS elevated the serum pro-inflammatory cytokines levels of TNF-α and IL-18 as well as the anti-inflammatory cytokines level of IL-10 and IFN-γ. VB6 was reported to inhibit inflammation via suppressing the inflammatory gene expressions including IL-1β, IL-6, and TNF-α in LPS-induced acute pneumonia mice (Shan et al., 2020). In patients with rheumatoid arthritis, high-dose VB6 supplementation suppresses plasma IL-6 and TNF-α levels (Huang et al., 2010). In the present study, the heat-stressed broilers supplemented with 6 and 12 mg/kg VB6 have showed significant reduction of IL-1β, TNF-α, IL-18, IL-10, and IFN-γ in the ileum mucosa, suggesting that VB6 could efficiently alleviate the systemic inflammatory response caused by HS, possibly via reducing the expression of inflammatory mediators. However, further studies are needed to reveal the potential anti-inflammatory mechanism of VB6 on the intestinal inflammatory response.

Because the beneficial effects of VB6 supplementation were mainly presented in the HB-12 group, the modulating effect of VB6 on gut microbiota was assessed in the TN, HS, and HB-12 groups. Gut microbiota plays fundamental roles in intestinal development, nutrient digestion, pathogen defense, and immune system of the host (Stanley et al., 2014). Herein, HS decreased the community richness of bacteria in the ileum as reflected by the decreased Chao1 index as previously reported (Li et al., 2022b). However, there were no differences in the α-diversity of the ileum microbiota between the HS and HB-12 groups, whereas the β-diversity plots showed distinct clustering among the different treatments, suggesting that the ileal microbiota community was altered by HS and VB6 supplementation. Then, further analysis was performed on the alteration of microbiota composition and specific taxa. Consistent with the previous study (Li et al., 2019a), Firmicutes was dominant in the ileum microbiota of broilers at the phylum level, followed by Proteobacteria and Bacteroides. Additionally, we observed that the abundance of Proteobacteria, Actinobacteriota, and Acidobacteriota in the HS group were decreased. Actinobacteria was considered as keystone taxa to modulate the functionality of gut microbiota and characterized by the production of bacteriocins and other secondary metabolites, which were beneficial to the maintenance of overall microbial structure, as well as host growth and intestinal health (Barka et al., 2016; Ma et al., 2018). Furthermore, Actinobacteria was characterized by the capacity to decompose undigested components in feeds by secreting endogenous enzymes (cellulases, chitinases, xylanases, and pectinase) which was related to the animal feed utilization (Pinnell et al., 2014). Although, the Proteobacteria phylum generally includes many pathogenic bacteria. Thiam et al. (2022) suggested that Proteobacteria could contribute to the resistance against Salmonella infection through oxygen competition and enhance immune responses. Notably, Bacteroidetes, Actinobacteria, and Proteobacteria have been reported to possess a vitamin B6 biosynthesis pathway (Yoshii et al., 2019). These results indicated that HS may weaken the denovo synthesis of VB6 by disturbing the microbiota composition and result in VB6 deficiency. VB6 supplementation increased the abundance of Proteobacteria including Proteobacteria_Vibrio and Proteobacteria_Pseudoalteromonas in HS exposed broilers. Pseudoalteromonas strains could produce extracellular degrading enzymes and a wide variety of bioactive substances with ecological and pharmaceutical significance (Chau et al., 2021). A previous study has confirmed that Pseudoalteromonas ruthenica possesses remarkable probiotic properties including antibacterial, anti-inflammatory and modulation of gut microbiota composition, which enhances host defense against diseases and thermal stress (Wasana et al., 2022). Therefore, we speculated that dietary VB6 supplementation may promote growth and gut health by altering the gut microbiota composition.

In this study, there were 83 interacted with differential metabolites in the 2 comparison pairs, among which lipids and lipid molecules accounted for the most dominant proportion, indicating that they may play a major role in alleviating gut injury caused by HS. Glycerophospholipids including phosphatidylcholine (PC) and phosphatidylethanolamine (PE), as the major structural and functional component of gastrointestinal cell membrane, plays a crucial role in regulating the structure, fluidity, protein recognition, and signal transduction of the cell membrane (Casares et al., 2019). Similarly, studies on fish or broilers have found that massive glycerophospholipid metabolites changed significantly along with HS (Guo et al., 2021; Li et al., 2022a). The integrity of the intestinal mucus barrier is primarily maintained through the interaction of glycoprotein, mucin, and lipids to establish a hydrophobic surface of intestinal mucosa to prevent the penetration of toxins and pathogens (Braun et al., 2009). PC, known as anti-inflammatory or antioxidant phospholipids, is mainly focused on the regulation of cell signaling transduction, epithelial cell apoptosis, and intestinal mucosa protection (Li et al., 2022d). Lysophosphatidylcholine (LPC) is generated by the hydrolysis of oxidized PC by phospholipase A2, which have controversial pro-inflammatory and anti-inflammatory effects (Engel et al., 2021). The reduction of LPC were reported in the cattle suffered from HS or transport stress, which may be attributed to the inhibited formation of choline or phosphocholine (Liu et al., 2017; Li et al., 2023). Consistently, the reduction of PCs and LPCs levels in the ileum mucosa of heat-stressed broilers may reflect the damage of intestinal epithelial cells and permeability of cell membranes, as well as the loss of barrier function, in turn inevitably leading to mucosal barrier dysfunction and intestinal inflammation. The enrichment of glycerophospholipid metabolic pathway and ether lipid metabolic pathway by KEGG pathway enrichment analysis further demonstrated the important role of glycerophospholipid metabolites in alleviating intestinal barrier function damage caused by HS. Moreover, in this study, the level of ileum glycerphosphocholine (GPC) decreased under HS. GPC, a water-soluble deacetylated PC derivative, can be used in the resynthesis of PC and may also have a similar function as PC. Exogenous GPC administration decreased the xanthine oxidoreductase activity, the intestinal superoxide production and ameliorated inflammation caused by ischemia re-perfusion stress (Tőkés et al., 2015). Further Spearman correlation analysis showed that the concentration of LPC and GPC in the ileum were positively correlated with the expression of Mucin4. Moreover, the abundance of Proteobacteria and Pseudoalteromonas, which increased after supplementation with VB6, were positively correlated with most of the LPC and LPE metabolites. In the present study, we observed the deceased levels of PC, LPC, and GPC were recovered by VB6 supplementation. We speculated that these metabolites have a recovery-promoting effect on HS. VB6 is associated with alterations in lipid and phospholipid metabolism. Previous studies have found that VB6 deficiency may alter the methylation of PE, resulting in a reduction in the synthesis of PC in the liver, thereby causing liver lipid deposition (She et al., 1995; Kitagawa et al., 2015). In short, these results suggested that VB6 may alleviate the barrier function impairment caused by HS by restoring the disorder of glycerophospholipids metabolism, thus LPC and its metabolic pathways might be potential targets for the treatment of inflammatory diseases. However, the underlying mechanism should be further explored.

In addition, we also found that the protective effect of VB6 on HS may involve the regulation of other metabolic pathways, such as caffeine metabolism and glutathione metabolism. Theophylline is one of the 3 main by-products of caffeine. Theophylline is an antagonist of VB6 to inhibit the activity of pyridoxal kinase, which is a key enzyme in the conversion of VB6 to the active form - pyridoxal-5′-phosphate (Shiraishi et al., 2014) and could reduce circulating VB6 levels. In this study, compared to the TN group, theophylline was significantly elevated in the HS group, which may be an explanation for the alteration of VB6 status. In this study, the content of 1-methyluric acid in the ileum mucosa of broilers was increased by HS but decreased by VB6 supplementation. 1-methyluric acid is transformed from 1-methylxanthine by xanthine oxidase. Additionally, xanthine oxidase is considered to be an important source of oxidants, which can cause endothelial damage directly or by triggering the accumulation of inflammatory cells (Németh and Boda, 2001). In the previous paragraph, we mentioned that GPC has been reported to reduce the activity of xanthine oxidase activity. The alteration of 1-methyluric acid was in line with GPC described in above section. It is speculated that HS may stimulate xanthine oxidase activity, VB6 may exert a positive effect on alleviating intestinal barrier damage by regulating the activity of enzymes in caffeine metabolism. The results of this study showed HS increased the precursors of GSH such as γ-Glutamylcysteine and L-Glutamate levels, VB6 supplementation reduces γ-Glutamylcysteine level, which suggested that the body itself may accelerate the synthesis of glutathione to resist oxidative damage under HS conditions. Similarly, in yellow catfish, the role of VB6 in ameliorating the antioxidant capacity has been reported (Li et al., 2022c). Thus, the results suggested that VB6 may promote antioxidant capacity and gut health by regulating gut metabolites.

CONCLUSIONS

In conclusion, VB6 supplementation was beneficial to growth performance and intestinal health of heat-stressed broilers. Moreover, the optimal supplementation of VB6 for heat-stressed broilers was 12 mg/kg. The beneficial effects of VB6 might be closely related to the modulation of ileum microbiota and metabolic homeostasis. Notably, the mechanisms of VB6 and its interactions with the differential metabolites under HS condition should be further explored.

DISCLOSURES

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Appendix Supplementary materials

Image, application 1

Image, application 2

Image, application 3

ACKNOWLEDGMENTS

This study was financially supported by the National Natural Science Foundation of China (Grant No. 32260851 ), Jiangxi Provincial Natural Science Foundation (20224ACB205008 ), and Jiangxi Province Postgraduate Innovation Special Fund Project (no. YC2023-B138 ).

Author Contributions: Conceptualization, Guanhong Li; Data curation, Jingxin Ouyang, Chao Zhang, Chenxi Deng and Ai Wen; Formal analysis, Jingxin Ouyang and Chao Zhang; Funding acquisition, Guanhong Li; Methodology, Jingxin Ouyang, Chao Zhang, Chenxi Deng, Ai Wen, and Hua Zhou; Supervision, Guanhong Li; Writing—original draft, Jingxin Ouyang; Writing—review and editing, Guanhong Li. All authors have read and approved the submitted version.

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.104202.
==== Refs
REFERENCES

Abbas G. Effect of dietary inclusion of sodium bicarbonate on blood profile of caged layers during summer Pak. J. Agr. Sci. 54 2017 443 450
Abbas G. Combating heat stress in laying hens a review Pak. J. Sci. 73 2021 4
Ahmad R. Yu Y. Hsiao F.S. Su C. Liu H. Tobin I. Zhang G. Cheng Y. Influence of heat stress on poultry growth performance, intestinal inflammation, and immune function and potential mitigation by probiotics Animals 12 2022 2297 36078017
Allen J.M. Jaggers R.M. Solden L.M. Loman B.R. Davies R.H. Mackos A.R. Ladaika C.A. Berg B.M. Chichlowski M. Bailey M.T. Dietary oligosaccharides attenuate stress-induced disruptions in immune reactivity and microbial b-vitamin metabolism Front. Immunol. 10 2019 1774 31417554
AOAC Official methods of analysis 18th ed. 2005 Association of Official Analytical Chemists Washington, DC
Bai X. Shi Y. Tang L. Chen L. Fan H. Wang H. Wang J. Jia X. Chen S. Lai S. Heat stress affects faecal microbial and metabolic alterations of rabbits Front. Microbiol. 12 2022 817615
Bargiela D. Cunha P.P. Veliça P. Foskolou I.P. Barbieri L. Rundqvist H. Johnson R.S Vitamin b6 metabolism determines t cell anti-tumor responses Front. Immunol. 13 2022 837669
Barka E.A. Vatsa P. Sanchez L. Gaveau-Vaillant N. Jacquard C. Meier-Kolthoff J.P. Klenk H. Clément C. Ouhdouch Y. van Wezel G.P. Taxonomy, physiology, and natural products of actinobacteria Microbiol. Mol. Biol. R. 80 2016 1 43
Borish L.C. Steinke J.W. 2. Cytokines and chemokines J. Allergy Clin. Immun. 111 2003 S460 S475 12592293
Braun A. Treede I. Gotthardt D. Tietje A. Zahn A. Ruhwald R. Schoenfeld U. Welsch T. Kienle P. Erben G. Lehmann W. Fuellekrug J. Stremmel W. Ehehalt R. Alterations of phospholipid concentration and species composition of the intestinal mucus barrier in ulcerative colitis: a clue to pathogenesis Inflamm. Bowel Dis. 15 2009 1705 1720 19504612
Casares D. Escribá P.V. Rosselló C.A. Membrane lipid composition: effect on membrane and organelle structure, function and compartmentalization and therapeutic avenues Int. J. Mol. Sci. 20 2019 2167 31052427
Chau R. Pearson L.A. Cain J. Kalaitzis J.A. Neilan B.A. A pseudoalteromonas clade with remarkable biosynthetic potential Appl. Environ. Microbiol. 87 2021 e02604 33397702
Chen S. Yong Y. Ju X. Effect of heat stress on growth and production performance of livestock and poultry: mechanism to prevention J. Therm. Biol. 99 2021 103019
Chen X. Liu W. Li H. Zhang J. Hu C. Liu X. The adverse effect of heat stress and potential nutritional interventions Food Funct 13 2022 9195 9207 36040720
Deng C. Zheng J. Zhou H. You J. Li G. Dietary glycine supplementation prevents heat stress-induced impairment of antioxidant status and intestinal barrier function in broilers Poult. Sci. 102 2023 102408
Duangnumsawang Y. Zentek J. Goodarzi B.F. Development and functional properties of intestinal mucus layer in poultry Front. Immunol. 12 2021 745849
El-Deep M.H. Dawood M.A.O. Assar M.H. Ijiri D. Ohtsuka A. Dietary moringa oleifera improves growth performance, oxidative status, and immune related gene expression in broilers under normal and high temperature conditions J. Therm. Biol. 82 2019 157 163 31128643
Engel K.M. Schiller J. Galuska C.E. Fuchs B. Phospholipases and reactive oxygen species derived lipid biomarkers in healthy and diseased humans and animals – a focus on lysophosphatidylcholine Front. Physiol. 12 2021 732319
Farhan Aslam M. Majeed S. Aslam S. Irfan J.A. Vitamins: key role players in boosting up immune response-a mini review Vitamins & minerals 2017 6
Guo Y. Liao J.H. Liang Z.L. Balasubramanian B. Liu W.C. Hepatic lipid metabolomics in response to heat stress in local broiler chickens breed (huaixiang chickens) Vet. Med. Sci. 7 2021 1369 1378 33639042
Huang Q. Lin H. Wang R. Huang Z. Zhou C. Yu W. Xun P. Tan L. Wang Y. Wang J. Effect of dietary vitamin b6 supplementation on growth and intestinal microflora of juvenile golden pompano (trachinotus ovatus) Aquac. Res. 50 2019 2359 2370
Huang S.C. Wei J.C. Wu D.J. Huang Y.C. Vitamin b6 supplementation improves pro-inflammatory responses in patients with rheumatoid arthritis Eur. J. Clin. Nutr. 64 2010 1007 1013 20571496
Jiménez P. Cordoba-Diaz D. Cabrero P. Aracil M. Gayoso M.J. Garrosa M. Cordoba-Diaz M. Girbés T. Plasma accumulations of vitamin b6 from an oral dose in a new reversible model for mouse gut injury and regeneration Food Nutr. Sci. 04 2013 908 917
Kitagawa E. Yamamoto T. Yamamoto K. Nakagawa T. Hayakawa T. Accumulation of lipid in rat liver was induced by vitamin b6 deficiency and was ameliorated by supplemental phosphatidylcholine in the diet Biosci. Biotechnol. Biochem. 79 2015 1320 1326 25775923
Koch F. Thom U. Albrecht E. Weikard R. Nolte W. Kuhla B. Kuehn C. Heat stress directly impairs gut integrity and recruits distinct immune cell populations into the bovine intestine Proc. Natl. Acad. Sci 116 2019 10333 10338 31064871
Kucuk O. Kahraman A. Kurt I. Yildiz N. Onmaz A.C. A combination of zinc and pyridoxine supplementation to the diet of laying hens improves performance and egg quality Biol. Trace Elem. Res. 126 2008 165 175 18719859
Kumrungsee T. Zhang P. Chartkul M. Yanaka N. Kato N. Potential role of vitamin b6 in ameliorating the severity of covid-19 and its complications Front. Nutr. 7 2020 562051
Li C. Wang J. Zhang H. Wu S. Hui Q. Yang C. Fang R. Qi G. Intestinal morphologic and microbiota responses to dietary bacillus spp. In a broiler chicken model Front. Physiol. 9 2019 1968 30705639
Li J. Yin L. Wang L. Li J. Huang P. Yang H. Yin Y. Effects of vitamin b6 on growth, diarrhea rate, intestinal morphology, function, and inflammatory factors expression in a high-protein diet fed to weaned piglets1 J. Anim. Sci. 97 2019 4865 4874 31679024
Li S. Liu Y. Li B. Ding L. Wei X. Wang P. Chen Z. Han S. Huang T. Wang B. Sun Y. Physiological responses to heat stress in the liver of rainbow trout (oncorhynchus mykiss) revealed by uplc-qtof-ms metabolomics and biochemical assays Ecotox. Environ. Safe. 242 2022 113949
Li Q. Ouyang J. Zhou H. You J. Li G. Effect of probiotic supplementation on the expression of tight junction proteins, innate immunity-associated genes, and microbiota composition of broilers subjected to cyclic heat stress Anim. Sci. J. 93 2022 e13719 35384158
Li P. Hou D. Zhao H. Huang W. Peng K. Cao J. Dietary pyridoxine effect on growth performance, physiological metabolic parameters, intestinal enzymatic activities and antioxidant status of juvenile yellow catfish (pelteobagrus fulvidraco) Aquac. Rep. 24 2022 101153
Li Q. Chen G. Zhu D. Zhang W. Qi S. Xue X. Wang K. Wu L. Effects of dietary phosphatidylcholine and sphingomyelin on dss-induced colitis by regulating metabolism and gut microbiota in mice J. Nutr. Biochem. 105 2022 109004
Li Y. Mao K. Zang Y. Lu G. Qiu Q. Ouyang K. Zhao X. Song X. Xu L. Liang H. Qu M. Revealing the developmental characterization of rumen microbiome and its host in newly received cattle during receiving period contributes to formulating precise nutritional strategies Microbiome 11 2023 238 37924150
Liu Z. Ezernieks V. Wang J. Arachchillage N.W. Garner J.B. Wales W.J. Cocks B.G. Rochfort S. Heat stress in dairy cattle alters lipid composition of milk Sci. Rep. 7 2017 961 28424507
Livak K.J. Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2−delta delta ct method Methods 25 2001 402 408 11846609
Ma Y. Wang W. Zhang H. Wang J. Zhang W. Gao J. Wu S. Qi G. Supplemental bacillus subtilis dsm 32315 manipulates intestinal structure and microbial composition in broiler chickens Sci. Rep. 8 2018 15358 30337568
Moran E.J. Nutrients central to maintaining intestinal absorptive efficiency and barrier integrity with fowl Poult. Sci. 96 2017 1348 1363 27665014
Naga Raja Kumari K. Narendra Nath D. Ameliorative measures to counter heat stress in poultry Worlds Poul. Sci. J. 74 2018 117 130
Németh I. Boda D. Xanthine oxidase activity and blood glutathione redox ratio in infants and children with septic shock syndrome Intens. Care Med. 27 2001 216 221
Nieto N. Torres M.I. Fernández M.I. Girón M.D. Ríos A. Suárez M.D. Gil A. Experimental ulcerative colitis impairs antioxidant defense system in rat intestine Dig. Dis. Sci. 45 2000 1820 1827 11052326
Ouyang J. Li Q. Zhou H. Li G. Wu Y. Yang L. Li G. Tryptophan alleviates chronic heat stress–induced impairment of antioxidant capacities, inflammatory response, and mitochondrial function in broilers Trop. Anim. Health Pro. 55 2023 425
Pinnell L.J. Dunford E. Ronan P. Hausner M. Neufeld J.D. Recovering glycoside hydrolase genes from active tundra cellulolytic bacteria Can. J. Microbiol. 60 2014 469 476 24983351
Rostagno M.H. Effects of heat stress on the gut health of poultry J. Anim. Sci. 98 2020 90
Saeed M. Abbas G. Alagawany M. Kamboh A.A. Abd El-Hack M.E. Khafaga A.F. Chao S. Heat stress management in poultry farms: a comprehensive overview J. Therm. Biol. 84 2019 414 425 31466781
Saibeni S. Cattaneo M. Vecchi M. Zighetti M.L. Lecchi A. Lombardi R. Meucci G. Spina L. De Franchis R. Low vitamin b6 plasma levels, a risk factor for thrombosis, in inflammatory bowel disease: role of inflammation and correlation with acute phase reactants Am. J. Gastroenterol. 98 2003 112 117 12526945
Selhub J. Byun A. Liu Z. Mason J.B. Bronson R.T. Crott J.W. Dietary vitamin b6 intake modulates colonic inflammation in the il10−/− model of inflammatory bowel disease J. Nutr. Biochem. 24 2013 2138 2143 24183308
Shan M.R. Zhou S.N. Fu C.N. Song J.W. Wang X.Q. Bai W.W. Li P. Song P. Zhu M.L. Ma Z.M. Liu Z. Xu J. Dong B. Liu C. Guo T. Zhang C. Wang S.X. Vitamin b6 inhibits macrophage activation to prevent lipopolysaccharide-induced acute pneumonia in mice J. Cell. Mol. Med. 24 2020 3139 3148 31970902
She Q.B. Hayakawa T. Tsuge H. Alteration in the phosphatidylcholine biosynthesis of rat liver microsomes caused by vitamin b6 deficiency Biosci. Biotechnol. Biochem. 59 1995 163 167 7766014
Shiraishi M. Haruna M. Matsuzaki M. Ota E. Murayama R. Sasaki S. Yeo S. Murashima S. Relationship between plasma total homocysteine level and dietary caffeine and vitamin b6 intakes in pregnant women Nurs. Health Sci. 16 2014 164 170 23855730
Slifer Z.M. Blikslager A.T. The integral role of tight junction proteins in the repair of injured intestinal epithelium Int. J. Mol. Sci. 21 2020
Stanley D. Hughes R.J. Moore R.J. Microbiota of the chicken gastrointestinal tract: influence on health, productivity and disease Appl. Microbiol. Biot. 98 2014 4301 4310
Stover P.J. Field M.S. Vitamin b-6 Adv. Nutr. 6 2015 132 133 25593152
Tang L. Liu Y. Zhang J. Ding K. Lu M. He Y. Heat stress in broilers of liver injury effects of heat stress on oxidative stress and autophagy in liver of broilers Poul. Sci. 101 2022 102085
Thiam M. Wang Q. Barreto Sánchez A.L. Zhang J. Ding J. Wang H. Zhang Q. Zhang N. Wang J. Li Q. Wen J. Zhao G. Heterophil/lymphocyte ratio level modulates salmonella resistance, cecal microbiota composition and functional capacity in infected chicken Front. Immunol. 13 2022 816689
Tőkés T. Tuboly E. Varga G. Major L. Ghyczy M. Kaszaki J. Boros M. Protective effects of l-alpha-glycerylphosphorylcholine on ischaemia–reperfusion-induced inflammatory reactions Eur. J. Nutr. 54 2015 109 118 24682350
Tsiagbe V.K. Straub R.J. Cook M.E. Harper A.E. Sunde M.L. Critical vitamin supplementation of broiler diets high in alfalfa juice protein Poult. Sci. 66 1987 1771 1778 3447136
Wasana W.P. Senevirathne A. Nikapitiya C. Lee J. Kang D. Kwon K.K. Oh C. De Zoysa M. Probiotic effects of pseudoalteromonas ruthenica: antibacterial, immune stimulation and modulation of gut microbiota composition Fish Shellfish Immun 131 2022 229 243
Weber G.M. Improvement of flock productivity through supply of vitamins for higher laying performance and better egg quality. World's Poultry Science Journal 65 2009 443 458
Wu Q.J. Liu N. Wu X.H. Wang G.Y. Lin L. Glutamine alleviates heat stress-induced impairment of intestinal morphology, intestinal inflammatory response, and barrier integrity in broilers Poult Sci 97 2018 2675 2683 29788452
Yoshii K. Hosomi K. Sawane K. Kunisawa J. Metabolism of dietary and microbial vitamin b family in the regulation of host immunity Front. Nutr. 6 2019 48 31058161
Zhang C. Zhao X.H. Yang L. Chen X.Y. Jiang R.S. Jin S.H. Geng Z.Y. Resveratrol alleviates heat stress-induced impairment of intestinal morphology, microflora, and barrier integrity in broilers Poult. Sci. 96 2017 4325 4332 29053872
Zhang P. Tsuchiya K. Kinoshita T. Kushiyama H. Suidasari S. Hatakeyama M. Imura H. Kato N. Suda T. Vitamin b6 prevents il-1β protein production by inhibiting nlrp3 inflammasome activation J. Biol. Chem. 291 2016 24517 24527 27733681
Zhu C. Le M. He Z. Bai Y. Yang J. Ye J. Chen Z. Jiang Z. Dietary berberine supplementation improves growth performance and alleviates gut injury in weaned piglets by modulating ileal microbiota and metabolites Food Funct. 14 2023 4143 4162 37060117
