
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00806-X
10.1016/j.psj.2024.104227
104227
MICROBIOLOGY AND FOOD SAFETY
Isolation and characterization of duck sewage source Salmonella phage P6 and antibacterial activity for recombinant endolysin LysP6
Wang Yanjun *†‡
Wu Jikun *†‡
Li Jie *†‡
Yu Changxu *†‡
Gao Jing *†‡
Song Fahui *†‡
Zhou Luyang *†‡
Zhang Ruihua *†‡
Jiang Shijin *†‡
Zhu Yanli ylz@sdau.edu.cn
*†‡1
⁎ Department of Preventive Veterinary Medicine, College of Veterinary Medicine, Shandong Agricultural University, Taian 271018, China
† Shandong Provincial Key Laboratory of Animal Biotechnology and Disease Control and Prevention, Shandong Agricultural University, Taian 271018, China
‡ Shandong Provincial Engineering Technology Research Center of Animal Disease Control and Prevention, Shandong Agricultural University, Taian 271018, China
1 Corresponding author: ylz@sdau.edu.cn
20 8 2024
11 2024
20 8 2024
103 11 10422729 5 2024
13 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Salmonella is a globally prevalent foodborne pathogen, and adverse events caused by S. Enteritidis and S. Typhimurium are extremely common. With the emergence of drug resistance, there is an urgent need for efficient and specific lytic bacteriophages as alternative to antibiotics in clinical practice. In this study, phage P6 was isolated and screened from effluent and fecal samples from duck farm environments to specifically lyse the duck sources S. Typhimurium and S. Enteritidis. Phage P6 belongs to the genus Lederbergvirus, unclassified Lederbergvirus species. The phage P6 genome did not contained non-coding RNA, virulence genes and drug resistance genes, indicating that phage P6 was biologically safe for clinical applications. Phage P6 lysed 77.78% (28/36) of multidrug-resistant Salmonella and reduced biofilms formed by S. Enteritidis CVCC 3377, 4, and 24, and S. Typhimurium 44 by 44% to 75% within 3 h, and decreased Salmonella in duckling feces by up to 1.64 orders of magnitude. Prokaryotic expression of endolysin LysP6 lysed the chloroform-treated bacterial outer membrane from different serotypes of duck-derived Salmonella and E. coli standard strain ATCC 25922. The host range was expanded compared to phage P6, and the growth of Salmonella was effectively inhibited by LysP6 in conjunction with the membrane permeabilizer EDTA within 24 h. Therefore, phage P6 and phage-derived endolysins LysP6 are suitable for application as potent biocontrol agents to improve poultry health and food safety.

Key words

Salmonella origined from ducks
phage
recombinant endolysin LysP6
bacterial inhibition
==== Body
pmcINTRODUCTION

Salmonella can cause infectious in humans and a broad range of animals, which is widespread in food, water and the environment (Kurtz et al., 2017; Andino et al., 2015; Jajere, 2019) and can be transmitted directly or indirectly, is one of the major global food safety and public health concerns. Salmonella enterica serovars Enteritidis and Typhimurium have been reported as the most common causes of salmonellosis outbreaks related to food contamination (García et al., 2018). Globally, there are an estimated 3 million deaths per year out of 1.3 billion cases of Salmonella-associated gastroenteritis (Khan et al., 2022), livestock and their products are the main routes of Salmonella transmission. Duck is an important host for Salmonella, as with other types of meat products, consumption of contaminated duck meat can result in Salmonella infection. In recent years, duck meat has been widely accepted by consumers for its organoleptic properties, high concentration of unsaturated fatty acids and other nutritional properties (Ljubojević et al., 2021). Previous epidemiological study showed that 2% of foodborne disease outbreaks were related to duck meat consumption (Ljubojević Pelić et al., 2021). About 1,116 environmental samples were taken from 31 duck farms in Jeollanam-do, South Korea, with Salmonella positivity ranging from 22.6% to 71% (Kim et al., 2021). A survey showed that the prevalence of Salmonella infections in ducks in Taiwan, China, ranged from 37.5% to 66.7% (Tsai et al., 2005; Yu et al., 2008). Serovars Enteritidis and Typhimurium are common in poultry (Cho et al., 2011), the overall prevalence of Salmonella in duck and goose flocks in the European Union (EU) was 8.4%, and the prevalence of S. Enteritidis and S. Typhimurium was 4.9% (Authority et al., 2015).

Since many countries allow the use of antibiotics for the treatment and growth promotion (Roth et al., 2019), seriously increasing antibiotic resistance. The rapid spread of multi-drug resistant bacteria has severely impacted the effectiveness of clinical antibiotic therapy and caused serious public health problems (Rincon-Gamboa et al., 2021). Biofilms are membrane-like structures formed on solid surfaces by multicellular bacterial communities and extracellular polymers (Liu et al., 2021; Raas et al., 2021). The extracellular polymers self-produced by microorganisms in biofilms increases their resistance to antimicrobial drugs, making biofilm inhibition or eradication difficult (Yuksel et al., 2018) because of removal or killing of biofilm in the food industry, clinical and animal husbandry particularly important (Jiang et al., 2021; Kumari et al., 2016). Phage, a virus that specifically infect bacteria, is widely found in nature, especially in sewage and feces, and is more than 10 times the total number of bacteria, with about 1031 phages on earth (Kwiatek et al., 2020). Lytic phages are ideally considered as the best candidates for biofilm eradication or reduction and targeting multidrug resistant bacteria (Sadekuzzaman et al., 2018). Several recent studies have reported that phages are highly effective in reducing and controlling Pseudomonas aeruginosa, Listeria monocytogenes, Salmonella and E. coli biofilms (Ahn et al., 2013; Ge et al., 2022; Jiang et al., 2021; Knezevic et al., 2008). A detailed explanation suggested that the layer-by-layer 3-dimensional structure of biofilms facilitates phage acquirement in a central region leading to increased overall adsorption efficiency (Abraham et al., 2021). People use phages to combat bacterial contamination in chicken, pig skin, sprouted seeds and vegetables. The US Food Safety and Inspection Service allows the use of Salmonella-specific phages to combat bacterial contamination before processing live poultry (Zhang et al., 2019). Endolysin producing by phage at the end of phage life cycle to lyse the bacterial cell wall from within, while the endolysin directly lyse the bacterial cell wall from without. Different from the phage, the endolysin shows broader lytic range over species or genus borders (Na et al., 2016). Therefore, phage and phage encoding endolysin are thought as novel antimicrobial agents in controlling pathogenic bacteria for their specific lytic activities (Cooper et al., 2016).

Salmonella contamination and increased antibiotic resistance have undoubtedly brought great challenges to the prevention and control of Salmonella infections in duck breeding, so there is an urgent need to explore new antimicrobial agents to resist Salmonella infections, and phages have received widespread attention because of their host-specific, cost-effective, and environmentally friendly properties. In addition, the safety and efficacy of phages in controlling Salmonella infection in poultry have been confirmed by experimental studies (Khan et al., 2022), but there is a lack of research on Salmonella phages originate from ducks. Therefore, in this study, we isolated and identified Salmonella duck-derived phages, analyzed the biological functions and physicochemical properties of phages and the endolysin encoded by the phage, screened phages with strong lytic properties, broad host range, high temperature resistance, acid and base resistance, and provided theoretical basis and technical support for the application of clinical phages.

MATERIALS AND METHODS

Ethics Statement

All animal experiments were reviewed and approved by the Institutional Animal Care and Use Committee of Shandong Agricultural University and performed in accordance with the ‘‘Guidelines for Experimental Animals’’ of the Ministry of Science and Technology (Beijing, China).

Bacterial Strains and Plasmid Expression Vector

We selected 105 different strains including 100 Salmonella belonging to 8 different serotypes (S. Typhimurium, S. Enteritidis, S. Kottbus, S. Newlands, S. Bovismorbificans, S. Newport, S. Muenster, S. Nagoya) and 5 non-Salmonella strains. These strains were preserved in 50% glycerol at −80°C. The plasmid-based expression vectors are pET-32a(+).

Isolation and Purification of Phages

Phages were isolated from fecal and effluent of large-scale duck farms in Shandong, China. Briefly, the samples were left to stand for 24 h and then centrifuged at 5,000 × g for 20 min at 4°C. The containing phage supernatant was filtered through 0.22 μm and 0.45 μm membrane. 100 μL of filtrated phage concentrate was mixed with 100 μL of logarithmic growth phage host strain (S. Enteritidis CVCC 3377) and 2 × LB medium, followed by incubation at 37°C for 30 min, and added 5 ml of soft-top agar [LB containing 0.4% (w/v) agar], and then poured onto solid bottom agar (LB containing 1.5% [w/v] agar). After incubation at 37°C for 18-24 h, a single plaque was selected and resuspended in SM buffer. The isolated phages were purified a triple transfer of single plaque and propagated until the plaques were homogeneous (Tie et al., 2018). The purified phages were stored in glycerol (3:1 [v/v]) at 4°C and −80°C. Phage titers were determined by double agar plate method.

Phage titer (PFU/mL) = number of plaques × dilution factor × 10 (Shang et al., 2021).

Characterization of the Selected Phage

Phage Host Range

The host range of the phage was detected using the spot test method as described elsewhere (Hooton et al., 2011). Ten microliters of a suspension containing 108 PFU/mL phage particles was dropped on the surface of lawn cultures of the target strains included Salmonella, E. coli, Proteus mirabilis and Staphylococcus aureus of different serotypes. Lytic zones on plates were checked after 18 to 24 h of incubation at 37°C.

Transmission Electron Microscopy

Taken 10 μL of phage solution (about 1010 PFU/mL), dropped it on a copper grid, stained it with 2% phosphotungstic acid, dried it, and observed the phage morphology by transmission electron microscope (JEM-2100 Plus).

Optimal Multiplicity of Infection and 1-Step Growth Curve

The host bacterium CVCC 3377 (108 cfu/mL) and phage in logarithmic growth phase were prepared, and the phage and host bacterium were added to the tubes in the ratio of multiplicity of infection (MOI) 101, 100, 10−1, 10−2, 10−3, 10−4, 10−5, 10−6, and finally LB liquid medium was added to make the volume of each tube the same, place in a shaker at 37°C, 150 rpm for 4 h. The MOI with the highest phage efficacy was determined by plaque assay after serial dilution. The MOI with the highest phage titer was considered as the optimal MOI and repeated 3 times under the same conditions.

500 μL of phage lysate and 500 μL of Salmonella cultures (CVCC 3377) were added to the test tubes according to the optimal MOI. The tubes were incubated at 37°C for 10 min, centrifuged at 8,000 rpm for 10 min, and the supernatant was discarded. The sediment was washed twice with LB liquid medium, centrifuged at 8,000 rpm for 10 min, 5 mL of LB liquid medium prewarmed at 37°C was added and incubated at 150 rpm in a constant temperature shaker for 120 min. The samples were taken every 10 min, filtered through a 0.22 μm filter and then tested for value of the phage titre, and each time point was repeated 3 times and averaged. Using the time of infection as the horizontal coordinate and value of the phage titre as the vertical coordinate, a one-step growth curve was plotted; the incubation period, outbreak period and burst size of the phage were calculated.

Burst size (PFU/cell) = value of the phage titre at the end of the outbreak/host bacterial cells at the beginning of the infection (Pan et al., 2022).

Thermal and pH Stability Tests

Taken 1 mL of phage (108 PFU/mL) in a 1.5 mL sterile centrifuge tube, placed the tube in a constant temperature water bath at 40°C, 50°C, 60°C, 70°C and 80°C respectively, and aspirate 100 μL of phage solution at the above different temperatures for 0 min, 20 min, 40 min, 60 min and 80 min respectively after warming, and the efficacy of the phage was determined by the double layer agar plate method. Plates with 30-300 phage spots were selected and the average value was recorded to test the thermal stability of the phage.

The configured LB liquid medium was adjusted to pH 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 and 12 using HCl and NaOH. 900 μL of LB with different pH values were taken into 1.5 mL centrifuge tubes, 100 μL of phage (108 PFU/mL) was added to each tube, and then the centrifuge tubes were placed in a constant temperature water bath at 37°C for 1 h. After acting, 100 μL of liquid was aspirated from each tube and the efficacy of the phage was determined by the double layer agar plate method to evaluate phage pH stability.

Phage Genomic Sequencing

The bacteriophage solutions were treated with RNase and DNase I (Takara, Shanghai, China) at a final concentration 1μg/mL, respectively, incubated for 1 h at 37°C. At this stage, addition of 0.5 M EDTA stopped the endonuclease reaction, and then added protease K (200 μg, Sigma) and sodium dodecyl sulfate (SDS) with 0.5% final concentration mixed for incubation at 56°C overnight. Phage genomic DNA was extracted using the phenol/chloroform system and ethanol precipitated (Sambrook et al., 1989). The whole-genome sequencing analysis was performed using the Illumina NovaSeq sequencing platform by Shanghai Paisano Technology Co., Ltd (China). The individual ORFs predicted from the sequencing results were searched and analyzed individually by the NCBI search tool BLAST to infer the function of each gene (https://www.ncbi.nlm.nih.gov/). Annotating and making visual plots of ORFs with known functions using Circular Genome Viewer (CGview) software (https://Proksee.ca/). The phylogenetic evolutionary trees of evolutionarily significant terminal large subunit enzymes and coat proteins were constructed by MEGA (version 11.0) software to analyze the evolutionary relationships between phage P6 and other phages through Neighbor-Joining method with a bootstrap test of 1000 times. SignalP-5.0 (http://www.cbs.dtu.dk/services/SignalP/) (Nielsen et al. 1999) and PrediSi (http://www.predisi.de) (Hiller et al. 2004), 2 neural network-based programs, were employed to predict the signal peptide sequences and their cleavage sites in phage endolysin LysP6. For this purpose, the first 70 residues from the N-terminus were submitted to the signal peptide prediction software to calculate the cleavage probability.

Application of Phages in Duck Farming Process

Evaluation of the Lytic Effect of Phages on Planktonic Salmonella spp.

100 μL of fresh host bacterial culture (CVCC 3377) in logarithmic growth phase was added to a 96-well plate at MOI 103, 102, 101, 100, 10−1, 10−2 and set up a negative control group with SM buffer. In order to ensure the accuracy of data, each different treatment group was repeated 3 times. The microplates were incubated at 37°C, and the inhibition effect of the phage was measured every 1 h by detecting the changes in OD600.

Determining the Ability of the Phage to Reduce Biofilms

S. Enteritidis CVCC 3377 and duck-derived S. Enteritidis isolates 4, 24 and S. Typhimurium isolate 44 were added to sterile 96-well plates. 200 μL of LB liquid medium was used as the negative control. The plates were incubated at 37°C for 72 h. The contents of the wells were discarded and washed twice with PBS buffer. 200 μL of phage (1 × 107 PFU/mL) was added to the test group and incubated for 3 h. The liquid was aspirated, washed twice with PBS buffer and then dried. 200 μL of crystalline violet solution (0.25%) was added to each well, left for 20 min at room temperature, washed 3 times with PBS and incubated with 200 μL of anhydrous ethanol for 25 min at room temperature, and OD590 value was measured. The test was repeated 6 times to obtain the average value.Percentagereductioninbiofilm=((C−B)−(T−B))/(C−B)×100%.

Where C = mean of OD590 of the control group, B = mean of OD590 of the blank group containing LB medium, and T = mean of OD590 of the phage treated group (Islam et al., 2019).

Phage Lysis of Salmonella spp. of Duck Origin with Different Drug Resistance Profiles

The Kirby-Bauer method was used to detect the resistance phenotypes of 55 strains of S. Enteritidis and S. an isolated from ducks to 7 antibiotics including amoxicillin and ampicillin belonged to the β-lactams, aminoglycosides gentamicin, kanamycin and streptomycin catalyzed by the aminoglycoside and the fluoroquinolone antimicrobials enrofloxacin and norfloxacin, which are commonly used in clinical practice. A double-layer agar plate assay was used to detect the effect of phage on 55 strains of duck-derived drug-resistant Salmonella.

Application of Phage in Ducklings

S. Enteritidis containing the pFCcGi fluorescent plasmid was selected for therapy assay of phage P6 against Salmonella in ducklings. Forty 2 day-old ducklings from Liuhe Jingwei Farming and Animal Husbandry Co., Ltd. (Taian, China) were divided into groups A, B, C and D, with ten ducks in each group. Phage (final concentration of 1.0 × 1010 PFU/mL) was added to the drinking water of groups B and C for 3 d, and groups C and D were attacked by intraperitoneal injection with 200 μL (1.0 × 108 CFU/mL) of S. Enteritidis containing the fluorescent plasmid pFCcGi at 5 d of age, and the feces were collected every other day. One gram of feces (wet weigh) was resuspended in 1 mL of PBS buffer, serial dilutions of supernatant were growth on LB solid plate with arabinose overnight at 37°C. The next day, visualized and counted the number of colonies found on each plate using a UV lamp.

Prokaryotic Expression and Biological Activity Assay of Endolysin LysP6

Cloning, Expression, and Purification of Recombinant LysP6

A recombinant LysP6 prokaryotic expression vector was constructed by homologous recombination. The gene encoding endolysin was amplified using the primers LysP6-F (GCCATGGGCTGATATATCGGATCCATGTCACCGGCACTACGAAA) and LysP6-R (CTCGGAGTGCGGCCGCAAGCTTTTGCTTCCCCCACAAACAGAC) (homologous arms underlined), and was cloned into the vector pET-32a(+) to obtain the expression plasmid pET32a-LysP6.

The successfully constructed plasmid was transformed into E.coil BL21 (DE3) recipient cells. The correctly identified E. coil BL21(DE3)-pET32a-LysP6 was cultured to the logarithmic growth stage, and IPTG was added to a final concentration of 1 mmol, and the induction was continued for 6 h. The bacterial precipitate was collected and sonicated in an ice bath. The sonicated product was centrifuged at 12,000 rpm for 20 min at 4°C. The supernatant and precipitate were collected separately and analyzed by SDS-PAGE. The precipitate after sonication was subjected to protein purification by 6xHis/Ni-NTA column, equipped with 6, 4, 2, 1 and 0 mol/mL of compound buffer (Table 1), and fixed to 500 mL. The dialysis bag was put into the compound buffer sequentially and stirred at 4°C for 24 h for protein renaturation.Table 1 Formulation of renaturation buffer.

Table 1Concentration (M)	Urea (g)	Liquid A (mL)	Liquid B (mL)	
6	180	47.5	202.5	
4	120	47.5	202.5	
2	60	47.5	202.5	
1	30	47.5	202.5	
0	0	47.5	202.5	

Antibacterial Effects of Endolysin LysP6

Inhibitory activity tests were designed to meet the principle of decreasing turbidity of bacterial suspensions relative to reference (Celia et al., 2008). S. Enteritidis (CVCC 3377) was recovered by streaking, and single colonies were picked and added to LB solid medium, shaken to logarithmic growth at 37°C, 150 rpm. Chloroform was added to the bacterial solution at the final concentration of 5%, centrifuged for 10 min, and washed twice with ultrapure water. Tris-HCl at pH 8.0 was added to the treated bacterial precipitates, and the turbidimetric method was used to detect the cleavage activity of LysP6 every 10 min by detecting OD600 after mixing the recombinant endolysin protein LysP6 with the bacterial solution and incubating at 37°C. In the plate method, the test bacteria were placed in a shaker at 37°C and entered the logarithmic growth stage, treated with 5% chloroform. 200 μL of the bacterial solution was evenly coated on LB solid medium, and then LysP6 and Tris-HCl solutions were added dropwise to different positions on the plate, and inverted in the incubator overnight at 37°C. If transparent or translucent spots appear on the plate, it indicates that the recombinant endolysin LysP6 is cleavable.

Determination of the Lytic Spectrum of Endolysin LysP6

The effect of LysP6 on the lysis of 24 strains belonged to 8 Salmonella serotypes (S. Enteritidis, S. Typhimurium, S. Kottbus, S. Newlands, S. Muenster, S. Nagoya, S. Newport, S. Bovismorbificans) of duck origin (3 strains each serotype), one standard strain of E. coli ATCC 25922, and one strain of Staphylococcus aureus.

Stability of Endolysin LysP6

The effect of different pH levels on LysP6 activity was evaluation. The Tris-HCl buffer was adjusted to pH 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 with hydrochloric acid and NaOH, and the buffers with different pH values were added into the precipitated S. Enteritidis (CVCC 3377) treated with chloroform, and then 150 μL of bacterial resuspension was added into the 96-well plate with 50 μL of LysP6 (100 μ g/mL) for treating at 37 °C for 1 h. The activity of LysP6 was detected by measuring OD600 every 10 min.

We evaluated the effect of different temperatures on endolysin activities. After LysP6 was treated at 4°C, 25°C, 37°C, 50°C, 60°C, 70°C and 80°C for 15 min, 150 μL of S. Enteritidis (CVCC 3377) resuspension and 50μL of LysP6 treated at different temperatures (100 μg/mL) were added to 96-well plates, which were incubated for 1 h at 37°C. The activity of LysP6 was determined by detecting the changes of OD600 value every 10 min.

Antibacterial Effects of Endolysin LysP6 in Combination with EDTA

The experiment was divided into 4 groups, 50 μL LysP6 (100 μg/mL) and 50 μL 0.01 mol/L EDTA solution as the test group, 100 μL Tris-HCl buffer, 100 μL LysP6 and 100 μL EDTA as the control group, and 100 μL of S. Enteritidis (CVCC 3377) in the logarithmic growth period were added to the above liquids, respectively, incubated at 37°C. The changes of OD600 values were determined.

Statistical Analysis

Results were indicated as mean values ± standard deviations. Statistical analysis of all data was performed by 2-way ANOVA with multiple comparisons using the SAS version 9.4 to determine differences between treatments. Statistical significance was set at P < 0.05.

RESULTS

Isolation and screening of phage and detection of host range

Thirteen Salmonella phage strains with different phage spot sizes were isolated using the double-layer agar plate method, and 2 phages with larger phage spots and higher titres were screened for subsequent experiments. The spot tests (Figure 1A) showed that the bacteriophage showed clear plaques. The phage was named P6, and it's shape was confirmed by transmission electron microscope (Figure 1B) with an ortho icosahedral head of about 400 nm in diameter and a short tail of about 150 nm in length, which is morphologically classified as belonging to short-tailed phages family. Host range assays revealed that the phage specifically lysed duck-derived S. Enteritidis and S. Typhimurium (Table 2).Figure 1 Morphological characteristics of Salmonella phage P6. (A) P6 plaques formed on double-layer agar plate. (B) TEM image of P6 particle. Phage P6 produced clear plaques and belongs to Podoviridae family.

Figure 1

Table 2 Spectrum of phage lytic activity.

Table 2Strains	P6	
S. Enteritidis CVCC 3377	+	
S. Enteritidis 56	+	
S. Enteritidis 57	+	
S. Enteritidis 58	+	
S. Enteritidis 59	+	
S. Enteritidis 60	+	
S. Enteritidis 61	+	
S. Enteritidis 62	+	
S. Enteritidis 63	+	
S. Enteritidis 64	+	
S. Typhimurium 65	+	
S. Typhimurium 66	+	
S. Typhimurium 67	+	
S. Typhimurium 68	+	
S. Typhimurium 69	+	
S. Typhimurium 70	+	
S. Typhimurium 71	+	
S. Typhimurium 72	+	
S. Typhimurium 73	+	
S. Typhimurium 74	-	
S. Kottbus 75	-	
S. Kottbus 76	-	
S. Kottbus 77	-	
S. Kottbus 78	-	
S. Kottbus 79	-	
S. Kottbus 80	-	
S. Kottbus 81	-	
S. Kottbus 82	-	
S. Kottbus 83	-	
S. Kottbus 84	-	
S. Newlands 85	-	
S. Newlands 86	-	
S. Newlands 87	-	
S. Bovismorbificans 88	-	
S. Newport 89	-	
S. Muenster 90	-	
S. Nagoya 91	-	
Proteus mirabilis	-	
Escherichia coli ATCC 25922	-	
Note: + Indicates that the bacterium can be cleaved; - Indicates that the bacterium cannot be cleaved.

Optimal MOI and 1-Step Growth Curve

The efficacy of phage P6 can reach up to 1010 PFU/mL when the MOI was 10−4 (Figure 2A), so the highest phage titer was observed at MOI of 0.0001, suggesting that the optimal infection multiplicity for the phage was determined to be 0.0001. The one-step growth experiment revealed a 10 min short latent period and an approximately 90 min burst time with a burst size of 100-300 PFU/cell (Figure 2B).Figure 2 Growth characteristics and biological stability of P6. (A) Temperature stability. Phages were incubated at different temperatures (40°C, 50°C, 60°C, 70°C, and 80°C) for 0 min, 20 min, 40 min, 60 min and 80 min, respectively. (B) pH stability. Phages were incubated at different pHs (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12) for 1h. (C) One-step growth curve of P6 using S. Enteritidis CVCC 3377 as the host in LB medium at MOI of 10−4. (D) Phage titers were determination at different MOIs (10−6 to 10). Data were expressed as the mean ± SD.

Figure 2

The Phage P6 Showed Good Tolerance to Acid-Base Environment and Temperature

The results of phage temperature stability assay showed (Figure 2C) that phage P6 could still maintain high activity when treated at 40°C to 70°C for 80 min with 7.00-8.11 Log PFU/mL, phage P6 demonstrated a high level of thermal tolerance. After incubation at 80°C for 20 min, phage P6 activity decreased (4.46 Log PFU/mL). The results of pH tolerance test showed that phage P6 was more tolerant to acid and alkali. Phage P6 (7.44-8.13 Log PFU/mL) can maintain high activity at pH values ranging from 3 to 12 (Figure 2D). Phage P6 activity was lost only at pH 2.

Genome Analysis

Whole genome sequencing analysis revealed that the phage P6 genome was a linear double-stranded DNA with a full length of 40,811 bp and a GC content of 47.24%. The base compositions accounted for A (25.28%), G (23.17%), T (24.07%), and C (27.48%), and it did not contain noncoding RNA, virulence genes or resistance genes, which proved that the phage P6 was safe for therapeutic applications. Sequencing analysis showed that phage P6 contained a repressor protein gene unique to lysogenic phage. A base G was inserted in the 14th position after the start codon in the gene sequence of phage P6 compared with that of the former phage, which resulted in a 40 amino acid sequence loss of the repressor protein in phage P6 (Figure 3AB). Besides, the phage P6 could not form blurred sopts on host bacteria strains, so phage P6 was identified as a lytic phage.

The full gene sequence of phage P6 has been uploaded to GenBank with the accession number OP265889.1. Phage P6 contained 63 open reading frames (ORFs), of which 30 ORFs were known to be functional (Table 3), and the rest of the ORFs were hypothetical proteins with unknown function. 63 start codons of ORFs, namely GTG (7/63, 11.1%), ATG (56/63, 88.9%), TAA (27/63, 42.9%), TGA (29/63, 46%), and TAG (7/63, 11.1%). 63 ORFs were categorized into three main groups based on the functions of the genes: (1) phage structural proteins; (2) lysis system proteins; (3) regulation proteins of phage DNA replication and assembly. The whole genome of phage P6 was mapped using the online software CGView (Figure 3C).Table 3 Genes annotation of known functions in phage P6.

Table 3ORF	Function	Identity	E-value	Accession no.	
1	Terminase family protein	100%	0	YP_004123808.1	
2	DNA-packaging protein	100%	3.00E-106	WP_000729927.1	
7	Phage regulatory protein	94.83%	8.00E-33	STI23937.1	
8	Lysis protein	100%	2.00E-101	WP_024132441.1	
10	Lysozyme	100%	8.00E-107	YP_009639262.1	
11	Holin	100%	1.00E-40	WP_000286100.1	
12	Antiterminator protein	100%	4.00E-125	WP_000027547.1	
15	Recombination protein	100%	2.00E-124	WP_001108030.1	
16	Recombination protein	100%	1.00E-103	WP_000815503.1	
22	DNA replication protein	99.64%	0	EAA8191409.1	
25	Helix-turn-helix transcriptional regulator	100%	1.00E-45	WP_000067726.1	
27	Repressor protein	100%	8.00E-121	EMG75078.1	
29	Superinfection exclusion protein B	91.86%	7.00E-138	AFH44346.1	
30	HNH endonuclease	100%	8.00E-119	WP_033572416.1	
35	DNA repair protein	100%	9.00E-175	WP_033572414.1	
36	RNA polymerase	100%	7.00E-63	WP_001253476.1	
46	Site-specific integrase	99.74%	0.00E+00	MBS2637113.1	
47	Glucose transporter protein	99.17%	1.00E-64	MBZ3820603.1	
48	Glycosyltransferase protein	99.68%	0.00E+00	HBL4349331.1	
50	Phage tailspike protein	100%	0.00E+00	WP_065675041.1	
51	Arc family DNA-binding protein	100%	3.00E-51	WP_065675042.1	
53	Lytic transglycosylase domain-containing protein	99.85%	0.00E+00	EEO3514370.1	
54	Phage DNA ejection protein	100%	0.00E+00	WP_031602539.1	
55	DNA transfer protein	100%	7.00E-73	EBX3288157.1	
57	Phage tail protein	99.57%	3.00E-152	EGI5198893.1	
58	Packaged DNA stabilization protein	100%	0.00E+00	WP_193628206.1	
59	Packaged DNA stabilization protein	100%	5.00E-120	WP_065675043.1	
61	Coat protein	100%	0.00E+00	WP_001196937.1	
62	Scaffolding protein	99.67%	0.00E+00	WP_006819467.1	
63	Portal protein	100%	0.00E+00	WP_138796105.1	

Figure 3 Genome sequencing of phage P6. Gene and amino acid sequences comparison of P6 repressor protein encoding gene (A) and amino acid (B). The dark blue represents homologs between the phage P6 and reference strain prophage, and light blue represents difference them. (C) Genomic map of phage P6. Blue color indicats the structural proteins of phage, red color represents the lysis system proteins, green color indicats the phage DNA assembly and replication system proteins, and grey color is the putative proteins, and the direction of the arrows represent the direction of gene expression.

Figure 3

In order to compare the evolutionary relationship between phage P6 and other phages, the phage's evolutionarily significant terminal enzyme large subunit (ORF1) and major coat protein (ORF61) were selected to draw gene evolution trees by MEGA-11 software. In Figure 4, the results showed that phage P6 was closer (98%) to Salmonella phage SW-70 (CP051272.1), and phage P6 belonging to the Viruses kingdom; Duplodnaviria phylum; Heunggongvirae order; Uroviricota order; Caudoviricetes family; Genus Lederbergvirus; Unclassified Lederbergvirus species.Figure 4 Analysis of P6 evolution based on the large terminase subunits (A) and major capsid protein (B). Both phylogentic trees were generated using MEGA-11 software and the maximum likelihood method with1000 bootstrap replicates.

Figure 4

Application of Phage P6 in Duck Farming Process

Lysis of Planktonic Salmonella by Phages

The results of the lysis effect of phage P6 on the S. Enteritidis (CVCC 3377) showed that the number of bacteria in the test groups treated with different MOI of pahge was lower than that in the control group, which indicated that the phage lysed some of the bacteria. When MOI = 102, pahge P6 had the best lytic effect on Salmonella within 10 h. (Figure 5A).Figure 5 The bactericidal ability of P6. (A) Growth dynamic patterns of the phage-S. Enteritidis (CVCC 3377)- MOI (0.01–1000) coculture combinations. Patterns are defined based on the average density (OD) value for each timepoint for each group. Points indicate the mean values, and error bars indicate standard deviations. (B) Polystyrene microtiter plate biofilm assay. Biofilm formation of S. Enteritidis (CVCC 3377) and other duck-derived Salmonella isolates in 96-well polystyrene microtiter plates. The plates were stained with crystal violet. The optical density of the bacterial biofilm formation was monitored by OD590 after 72 h incubation. Error bars indicate standard deviations. **: P < 0.01, ***: P < 0.001. (C) Detection of S. Enteritidis concentration in duck faeces from phage treatment group and control (nonphage treated). Bars represent the mean standard deviation (n = 10).

Figure 5

Role of Phages on Salmonella Biofilms

The biofilm removal effect of phage on the standard strain of S. Enteritidis CVCC 3377, duck-origin S. Enteritidis isolates 4, 24 and duck-origin S. Typhimurium strain 24 were shown in Figure 5B. The removal of Salmonella biofilm by phage within 3 h was obvious, which could significantly reduce the biofilm by 44% to 75% (P<0.05) depending on S. Enteritidis CVCC 3377 (75%), S. Enteritidis 4 (44%), S. Enteritidis 24 (52%), and S. Typhimurium (60%) strains tested.

Effectiveness of Phage Lysis against Salmonella with Different Resistance Profiles

As shown in Table 4, the most prevalent resistance spectrum of 55 duck-origin Salmonella isolates was AMX-AMP-STR (47.27%). The multidrug resistance rate was 65.45% (36/55), of which S. Enteritidis 4 was resistant to all 7 antibiotics. The inhibition results of phage P6 on Salmonella with different resistance spectra showed that phage P6 had lysis effect on 81.82% (45/55) of Salmonella, and could lyse 77.78% (28/36) of multidrug-resistant Salmonella.Table 4 The P6 phage against Salmonella with different drug resistance.

Table 4Bacteria number	Serotypes	Antimicrobial resistance patternsa	Phage effectb	
1	S.Typhimurium	AMP-GEN-STR-ENR	-	
2	S.Typhimurium	STR-ENR-NOR	-	
3	S.Typhimurium	AMX-AMP-GEN-STR-ENR-NOR	-	
4	S. Enteritidis	AMX-AMP-GEN-KAN-STR-ENR-NOR	-	
5	S.Typhimurium	GEN-STR-ENR-NOR	+	
6	S.Typhimurium	ENR-NOR	+	
7	S. Enteritidis	AMX-AMP-KAN-STR	-	
8	S. Enteritidis	AMX-AMP-GEN-STR	+	
9	S. Enteritidis	AMX-AMP-KAN-STR	+	
10	S. Enteritidis	AMP-KAN-STR	+	
11	S.Typhimurium	AMX-AMP-STR	+	
12	S.Typhimurium	AMX-AMP-STR-ENR	+	
13	S.Typhimurium	AMX-AMP-STR	+	
14	S.Typhimurium	AMX-AMP-STR	+	
15	S.Typhimurium	AMX-AMP-STR	+	
16	S.Typhimurium	AMX-AMP-STR	+	
17	S.Typhimurium	AMX-AMP-STR	+	
18	S.Typhimurium	AMX-AMP-STR	+	
19	S.Typhimurium	AMX-AMP-STR	+	
20	S.Typhimurium	AMX-AMP-STR	+	
21	S.Typhimurium	-	+	
22	S. Enteritidis	AMX-AMP-STR	+	
23	S. Enteritidis	AMX-AMP-STR	+	
24	S. Enteritidis	AMX-AMP-STR	+	
25	S. Enteritidis	KAN	+	
26	S.Typhimurium	STR	+	
27	S.Typhimurium	STR	+	
28	S.Typhimurium	STR	+	
29	S.Typhimurium	-	+	
30	S.Typhimurium	STR	-	
31	S.Typhimurium	-	+	
32	S.Typhimurium	STR	-	
33	S.Typhimurium	-	-	
34	S.Typhimurium	-	-	
35	S.Typhimurium	-	+	
36	S.Typhimurium	-	+	
37	S.Typhimurium	-	+	
38	S.Typhimurium	STR	+	
39	S.Typhimurium	STR	+	
40	S.Typhimurium	AMX-AMP-STR	+	
41	S.Typhimurium	AMX-AMP-STR	+	
42	S.Typhimurium	STR	+	
43	S.Typhimurium	STR	+	
44	S.Typhimurium	AMX-AMP-STR	+	
45	S.Typhimurium	AMX-AMP-STR	+	
46	S.Typhimurium	AMX-AMP-STR	+	
47	S.Typhimurium	AMX-AMP-STR	+	
48	S.Typhimurium	AMX-AMP-STR	+	
49	S.Typhimurium	AMX-AMP-STR	+	
50	S.Typhimurium	AMX-AMP-STR	+	
51	S.Typhimurium	AMX-AMP-STR	+	
52	S.Typhimurium	AMX-AMP-STR	+	
53	S.Typhimurium	AMX-AMP-STR	+	
54	S.Typhimurium	AMX-AMP-STR	+	
55	S.Typhimurium	AMX-AMP-STR	+	
Note: Amoxicillin, AMX; Ampicillin, AMP; Gentamicin,GEN;Kanamycin, KAN;Streptomycin, STR; Enrofloxacin, ENR; Norfloxacin, NOR

a : - No drug resistance profile.

b : + Indicates cleavable activity; - Indicates noncleavable activity.

Phage P6 can Effectively Reduce the Concentration of S. Enteritidis Carried in Duck Faeces

Animal experiments revealed that ducklings in each group were not exposed to any adverse effects during the breeding process. S. Enteritidis containing the pFCcGi fluorescent plasmid was not detected in the fecal specimens of Groups A and B. The ducklings that were only orally given 1.0 × 1010 PFU/mL of pahge did not have any adverse effects, and no apparent lesions in major internal organs by dissection. Therefore, we concluded that oral administration of phages suspension did not cause any significant harm to the ducklings (Group B). However, within 9 d of the trial period, the concentration of S. Enteritidis containing the pFCcGi fluorescent plasmid in the fecal samples of group C for 7 d was significantly lower (P< 0.05), with a maximum reduction of 1.64 Lg (cfu/g) as compared to group D (Figure 5C).

Prokaryotic Expression and Biological Activity Assay of Endolysin LysP6

Functional Prediction of Endolysin LysP6

ORF10 encoded the phage endolysin, namely LysP6, SignalP-5.0 analysis predicted an accurate cleavage site between residues18 and 24 for mutant signal peptides (Figure 6A, green line). PrediSi is a software that provides a normalized score on a scale between 0 and 1. A score greater than 0.5 means that the examined sequence very likely contains a signal peptide (Hiller et al. 2004). So the LysP6 lost signal peptides and cannot independently cross the outer membrane (Figure 6B), with the N-terminus of the protein in the cell membrane and the C-terminus in the periplasm. Analysis of the secondary structure of the protein revealed that LysP6 existed predominantly β-folded (Figure 6C). Endolysin LysP6 was deduced from predictive analyses to be a key protein in the cleavage system by cleaving the β1,4 glycosidic bond between the N-acetylcytidylic acid of peptidoglycan and the N-acetylglucosamine to degrade peptidoglycan in the bacterial cell wall.Figure 6 Structural prediction of the endolysin LysP6 encoded by P6. (A) Prediction of signal peptide. The first 70 residues from N-terminus of the LysP6 were selected for signal peptide predication. (B) Prediction of transmembrane helices by TMHMM. The LysP6 was detect in the absence extracellular domain. (C) LysP6 representation of the secondary structure shown on the amino acid sequence.

Figure 6

Cloning, Expression, and Purification of Endolysin Derived from Bacteriophage P6

The endolysin gene LysP6 was cloned into plasmid pET-32a(+), and the recombinant protein with an N-terminal 6× His-tag was expressed in E.coil BL21(DE3). LysP6 was purified by Ni-NTA affinity chromatography, and the recombinant protein (34 kDa) was detected by SDS-PAGE (Figure 7). LysP6 was expressed in the form of inclusion body, which were reconstituted and assayed for biological activity.Figure 7 Expression of endolysin LysP6. (A) Analysis of recombinant endolysin LysP6 expression patterns. M: Protein Marker; 1: Supernatant after ultrasonication; 2: Precipitation after ultrasonication. (B) The purified recombinant endolysin LysP6. M: Protein Marker; 1: Purified LysP6.

Figure 7

Antibacterial Effect of Endolysin LysP6

S. Enteritidis (CVCC 3377) was subjected to 5% chloroform treatment of the bacterial outer membrane followed by the addition of LysP6, which showed that a ring of inhibition could be formed around LysP6, while no halo formation in the control group. The results of turbidity assay showed that 100 μg/mL LysP6 could reduce the concentration of S. Enteritidis (CVCC 3377) by OD600 value of 0.25 (corresponding to a titer of ∼2×104cfu/mL) within 1 h. Both methods proved that LysP6 had lysogenic activity (Figure 8).Figure 8 LysP6 bacteriolytic activities against S. Enteritidis (CVCC 3377). (A) LysP6 forms plaques on the bacterial lawn by agar diffusion assay. PBS without adding LysP6 was used as control. (B) Lytic activity of LysP6 at different concentration. The concentration of protein used was indicated.

Figure 8

Determination of the Lytic Spectrum of Endolysin LysP6

By turbidimetric assay, the lysis profile of LysP6 was broader compared to that of phage P6, and that LysP6 was effective in lysis of Salmonella in all serotypes tested, and also in lysis of E. coli standard strain ATCC 25922 (Table 5).Table 5 The lytic spectrum of LysP6.

Table 5Bacterial strains	Phage P6	LysP6	
S. Enteritidis	+	+	
S. Typhimurium	+	+	
S. Kottbus	-	+	
S. Newlands	-	+	
S. Bovismorbificans	-	+	
S. Newport	-	+	
S. Muenster	-	+	
S. Nagoya	-	+	
E. coli ATCC 25922	-	+	
Staphylococcus aureus	-	-	
Note: + Indicates cleavable;-: Indicates noncleavable.

Stability of Endolysin LysP6

The effect of pH on the cleavage effect of LysP6 was examined by turbidimetry, and the results showed that the cleavage effect of LysP6 was the best at pH 9-10, and LysP6 had almost no cleavage activity at pH <5 and pH=12, which indicated that the activity of LysP6 was better in alkaline environments, while it was easy to be deactivated under acidic conditions (Figure 9A). LysP6 activity decreased at 15 min after treatment at 50°C, and LysP6 was completely inactivated under heat treatment at 70°C for 15 min (Figure 9B).Figure 9 Analysis of LysP6 stability and lytic activity in combination with EDTA. (A) Effects of different pH(A) and different temperature (B) on the lytic activity of LysP6 against S. Enteritidis CVCC 3377. (C) In vitro lysis activity of LysP6 in combination with EDTA on S. Enteritidis CVCC 3377 were measured by OD600 values. LysP6 was the positive control, and EDTA, PBS were the negative control. Error bars indicate the standard deviation. *: P < 0.05, ****: P < 0.0001.

Figure 9

Antibacterial Effect of Endolysin LysP6 in Combination with EDTA

When LysP6 alone acted on S. Enteritidis CVCC 3377 the bacterial inhibition effect was not obvious, EDTA group had a certain inhibition effect on the growth of Salmonella. However, the bacterial inhibition effect of LysP6 and EDTA combination group was the most obvious, the bacterial turbidity OD600 value did not rise during 24 h but decreased, which proved that the combination of LysP6 and EDTA had a good inhibition effect (Figure 9C).

DISCUSSION

An increase in phage host range is usually accompanied by a decrease in phage virulence on each individual host (Ford et al., 2014), so phages with a narrower lytic spectrum may be able to lysate host strains more efficiently compared to broad-spectrum lytic phage. Narrow host ranges phages only target a small number of strains, which may simultaneously reduce the risk of developing group resistance in bacteria throughout the microbial environment, with relatively little impact on the microflora (De Jonge et al., 2019). Currently, a great number of broad-spectrum phages have been studied at home and abroad (Li et al., 2020), whereas phages targeted to lyse S. Enteritidis and S. Typhimurium within dominant serotypes have seldom been reported (Wang et al., 2022; Martelli et al., 2017). Several interesting observations including determination of host range, antibacterial activity of phage P6 and recombinant endolysin LysP6 emerged in the present study.

The lytic activity of candidate therapeutic phages should be a necessary prerequisite. The MOI refers to the ratio of phages to bacteria. Optimum MOI ie the MOI with the lowest concentration of phage that effectively inhibits targeted bacteria. Compared with other phages such as phage LP31 and phage LPST153 at optimal MOI of 10−2 or 10−1(Ge et al., 2022; Islam et al., 2020), the optimal MOI of phage P6 was 10−4, indicating that phage P6 was high lytic activity. Compared with other reported Salmonella phages such as phage PST-H1 and phage KM16 (lysis cycle of 40 to 70 min, a burst volume of 120∼183 PFU/cell) (Cao et al., 2022; Jiang et al., 2021), the lysis cycle of phage P6 was longer (80–90 min), and the burst volume was larger (800∼1,000 PFU/cell), indicating the potential clinical applications of phage P6.

Although a great number of phages have been isolated, there are not many phages with really good application value, and inactivation due to harsh environmental conditions (temperature, pH), and phage safety issues are the main drawbacks of phage application for the control of Salmonella (Li et al., 2022). Therefore, the screening of phage with stable biological activity and good lysogenicity is an urgent problem for the clinical control of Salmonella. Compared to other Salmonella phages, which mostly tolerate temperatures ranging from 4°C to 60°C (Jiang et al., 2021; Islam et al., 2020) and have an optimal pH range of 4 to 12 (Thanki et al., 2022; Islam et al., 2020), phage P6 exhibited relatively high thermal stability as the phage titer could be detected after exposure to 80°C for 20 min, and retain a high activity with a wide pH range (3–12), allowing for its survival in poultry gastrointestinal tract.

Comparative analysis revealed that the gene for the deterrent protein of phage P6 was genetically mutated, and a base G was inserted at the 14th position after the start codon, resulting in a 40-amino-acid sequence missing from the expression of the repressor protein of phage P6, which caused phage P6 to remain in the lysed state and would not be converted to the prophage state. By deletion of the gene for the repressor protein, preventing the phage from entering the lysogenic cycle has been suggested by the BRED method, this technique has been reported in the modification of the Salmonella enterica phage SPN9CC, where the phage spots of the mutant phage SPN9CCM do not produce turbid centers, suggesting that the mutant phage can be converted from mild to virulent (Shin et al., 2014). In summary, phage spots for phage P6 were always translucent throughout the study, combined with the insertion of the bases of the inhibitory protein genes, determined that phage P6 belongs to the lysogenic phage. Genomic analysis showed that phage P6 did not contain any gens related to virulence and antibiotic resistance, making the pages suitable for clinic applications.

In order to better evaluate the prospects of phage P6 application, the lysis effect of phage P6 on Salmonella planktonicus was determined. Salmonella started to rebound after 10 h, which may be due to resistance to phage P6. The result wasconsistent with another study found that Pu20 phage could control the growth of Salmonella for 6 h (Zhang et al., 2021). Because of this, the large-scale application of phage is hindered. Some research reports suggested that combinations of phages or phage cocktails can be rationally formulated to both extend the host range and limit the rate of resistance emergence (Kortright et al., 2019; Bai et al., 2019). More investigations are needed to address questions regarding the time-dependent adaptation and longer exposure times on resistance development. Most foodborne pathogens can form biofilms on the surfaces of materials such as plastic, metal, glass, wood, and food and food processing equipment (Homero et al., 2021). Once bacteria form biofilms, they are difficult to eliminate, which poses a major problem for the food industry and farming. In recent years, researchers have found that some phages and their derivatives can effectively inhibit the formation of bacterial biofilms or eliminate those that already exist. Phage LP31 (1 × 107 PFU/mL) was found to almost completely remove biofilms formed by S. Enteritidis and S. Pullorum from surface of glass tubes at 1 h (Ge et al., 2022). One study found that treatment with a phage cocktail significantly reduced biofilms on 96-well plates (44∼63%) and stainless steel surfaces (Islam et al., 2019). In this study, we found that phage P6 treatment for 3 h could reduce biofilm of S. Enteritidis and S. Typhimurium on 96-well plates by 44% to 75%, which proved the phage P6 has the potential to be applied to biofilm removal.

Numerous studies have reported that phages possessed the ability to potentially kill multidrug-resistant (MDR) cells (Thurber, 2009). In present study, the results of evaluating the lysogenic effect of phage P6 on 55 strains of Salmonella with different drug-resistant profiles showed that about 81. 82% (45/55) were lysed in which 77.78% (28/36) were multi-drug-resistant strains including 4 Salmonella Enteritidis strains against to all 7 antibiotics tested, indicating a potential of P6 to prevent infection caused by MDR Salmonella strains. Quinolones are the last therapeutic resource against multidrug-resistant strains of Salmonella, however, it has been shown that quinolone resistance in Salmonella is one of the most frequently observed antimicrobial resistance (Yang et al., 2019), so it is of utmost importance to screen for phages that lyse multidrug-resistant Salmonella. Our assays demonstrated that phage P6 could lyse quinolone-resistant Salmonella. In published study, phage Pu20 infected 21 out of 26 Salmonella strains to different degrees (Zhang et al., 2021), which is consistent with our study.

In order to further explore whether the phage has an eliminate effect on Salmonella in ducklings, we brought the phage stock solution into the drinking water of ducklings to observe its elimination ability on Salmonella in ducklings. The results showed that Salmonella spp. isolated from ducklings in the experimental group treated with phage P6 showed a significant decrease within 7 d (P < 0.05). Compared with the control group of S. Enteritidis, Salmonella can be reduced by up to 1.64 orders of magnitude (Figure 5C), which has apparent antibacterial activity. Additionally, ducklings in the experimental group suffered no adverse symptoms. Therefore, we believe that oral administration of phage suspension did not cause any obvious harm to the ducklings, but in order to achieve a better sterilizing effect, we can consider the use of phage in conjunction with other antimicrobial agents.

Functional prediction and analysis revealed that endolysin LysP6 could cleave the glycosidic β1,4-bond between N-acetylcytidylic acid and N-acetylglucosamine of cell wall peptidoglycan, the site of action of endolysin LysP6 located in the single chemical bond of cell wall peptidoglycan, which may have a wider spectrum of bactericidal properties. Bacterial resistance to antibiotics is due to the fact that antibiotics usually inhibit the basic metabolic pathways of bacteria, leading to cell death. However, bacteria find other ways to overcome antimicrobial exposure (Gerstmans et al., 2016). Once endolysins act on a conserved structure such as peptidoglycan, it is difficult for bacteria to evolve a means of resisting endolysins without disrupting cellular integrity (Fischetti et al.,2010). There are no reports of bacterial resistance to endolysins (Blasco et al. 2020). Therefore, this study was conducted to express the recombinant endolysin LysP6 by the form of prokaryotic expression within E. coli BL21. Due to the existence of an extracellular membrane outside the cell wall of Salmonella, the endolysin could not directly contact the cell wall, so 5% chloroform was used to treat the extracellular membrane of Salmonella in this experiment, and through the detection of the lytic spectrum of LysP6, it was found that its spectrum of lytic activity was broader than the host range of the origining phage, and it had the effect of cleavage on the tested standard strains of duck-originated Salmonella and E. coli, ATCC 25922. EDTA is an outer membrane permeabilizer that chelates and adsorbs divalent ions and destabilizes the outer membrane, and some studies have improved the cleavage activity of endolysin by coupling it with EDTA (Briers et al., 2011; Lim et al., 2012).In some studies, some outer membrane permeabilizers such as EDTA can enhance the cleavage of phage endolysin (Gontijo et al., 2021), while others have reported that endolysin acts only in the presence of outer membrane permeabilizers. It has been observed that Lys68 encoded by Salmonella phage phi68 has antimicrobial activity in the presence of organic acids (EDTA, citric acid or malic acid) (Oliveira et al., 2014). Which is same as the LysP6 phage in present study. The above findings indicated that LysP6 cleavage of bacterial cell wall is achieved by cleavage of Gram-negative bacterial cell wall peptidoglycan, and subsequent studies can be carried out by encapsulating the endolysin with proteins specific for penetrating the outer membranes of different bacteria (caudipterygium protein or perforin) to achieve the effect of cleavage of different Gram-negative bacteria, and to provide theoretical support for the subsequent experiments.

In summary, the phage P6 in this study has the potential in biologics development for the prevention and control of Salmonella infections, considering various factors such as genomic characterization, host specificity, better cleavage properties, and the absence of resistance genes or virulence-related genes.

CONCLUSION

Short-tailed phage P6 exhibited superior against multidrug resistant isolates and their biofilm activities, biological safety, and showed good tolerance to acid-base environment and temperature. Phage P6 can effectively reduce the concentration of S. Enteritidis in ducks’ faeces. In additional, lysis profiles of phage-derived endolysins LysP6 were broader than phage P6. Phage P6 and endolysins LysP6 was great potentials in the control of Salmonella in poultry farming and breeding environment.

DISCLOSURES

The authors declare no conflict of interest.

ACKNOWLEDGEMENTS

This work was supported by the Key Technology Research and Development Program of Shandong Province [grant number 2022CXGC010606 ], the Natural Science Foundation of Shandong Province of China [grant number ZR2020MC176 ] and Shandong Modern Agricultural Technology & Industry System, China (SDAIT-11-03 ).
==== Refs
REFERENCES

Ahn J. Kim S. Jung L.S. Biswas D. In vitro assessment of the susceptibility of planktonic and attached cells of foodborne pathogens to bacteriophage p22-mediated Salmonella lysates J. Food Prot. 76 2013 2057 2062 24290682
Andino A. Hanning I. Salmonella enterica: survival, colonization, and virulence differences among serovars Sci. World J. 2015 2015 520179
Abraham S. Kaufman Y. Perreault F. Young R. Bar-Zeev E. Bursting out: linking changes in nanotopography and biomechanical properties of biofilm-forming Escherichia coli to the T4 lytic cycle NPJ Biofilms Microb. 7 2021 26
Authority E.F.S. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2013 EFSA J 13 2015 3991
Bai J. Jeon B. Ryu S. Effective inhibition of Salmonella Typhimurium in fresh produce by a phage cocktail targeting multiple host receptors Food Microbiol 77 2019 52 60 30297056
Blasco L. Ambroa A. Trastoy R. Bleriot I. Moscoso M. Fernández-Garcia L. Perez-Nadales E. Fernández-Cuenca F. Torre-Cisneros J. Oteo-Iglesias J. Oliver A. Canton R. Kidd T. Navarro F. Miró E. Pascual A. Bou G. Martínez-Martínez L. Tomas M. In vitro and in vivo efficacy of combinations of colistin and different endolysins against clinical strains of multi-drug resistant pathogens Sci. Rep. 10 2020 7163 32346029
Briers Y. Walmagh M. Lavigne R. Use of bacteriophage endolysin EL188 and outer membrane permeabilizers against Pseudomonas aeruginosa J. Appl. Microbiol. 110 2011 778 785 21241420
Cao Y. Ma R. Li Z. Mao X. Li Y. Wu Y. Wang L. Han K. Li L. Ma D. Zhou Y. Li X. Wang X. Broad-spectrum Salmonella phages PSE-D1 and PST-H1 controls Salmonella in foods Viruses 14 2022 2647 36560651
Celia L.K. Nelson D. Kerr D.E. Characterization of a bacteriophage lysin (Ply700) from Streptococcus uberis Vet. Microbiol. 130 2008 107 117 18242012
Cho J.K. Kang M.S. Kim K.-S. Serotypes, antimicrobial resistance of Salmonella spp. and plasmid profiles, phage types, PFGE of S. Enteritidis and S. Typhimurium isolated from ducks in Daegu-Gyeongbuk province Korean J. Vet. Res. 34 2011 217 226
Cooper C.J. Mirzaei M.K. Nilsson A.S. Adapting drug approval pathways for bacteriophage-based therapeutics Front. Microbiol. 7 2016 1209 27536293
De Jonge P.A. Nobrega F.L. Brouns S.J.J. Dutilh B.E. Molecular and evolutionary determinants of bacteriophage host range Trends Microbiol 27 2019 51 63 30181062
Fischetti V.A. Bacteriophage endolysins: a novel anti-infective to control gram-positive pathogens Int. J. Med. Microbiol. 300 2010 357 362 20452280
Ford B.E. Sun B. Carpino J. Chapler E.S. Ching J. Choi Y. Jhun K. Kim J.D. Lallos G.G. Morgenstern R. Singh S. Theja S. Dennehy J.J. Frequency and fitness consequences of bacteriophage phi6 host range mutations PLoS One 9 2014 e113078
García V. Mandomando I. Ruiz J. Herrera-León S. Alonso L. Rodicio M.R. Salmonella enterica serovars Typhimurium and Enteritidis causing mixed infections in febrile children in Mozambique Infect. Drug Resist. 11 2018 195 204 29430190
Ge H. Lin C. Xu Y. Hu M. Xu Z. Geng S. Jiao X. Chen X. A phage for the controlling of Salmonella in poultry and reducing biofilms Vet. Microbiol. 269 2022 109432
Gerstmans H. Rodríguez-Rubio L. Lavigne R. Briers Y. From endolysins to Artilysin® s: novel enzyme-based approaches to kill drug-resistant bacteria Biochem. Soc. T. 44 2016 123 128
Gontijo M.T.P. Jorge G.P. Brocchi M. Current status of endolysin-based treatments against Gram-negative bacteria J. Antibiot. 10 2021 1143
Hiller K. Grote A. Scheer M. Münch R. Jahn D. PrediSi: Prediction of signal peptides and their cleavage positions Nucleic Acids Res 32 2004 W375 W379 15215414
Homero U. Tortella G. Sandoval E. Cuozzo S.A. Extracellular polymeric substances (EPS) produced by Streptomyces sp. biofilms: chemical composition and anticancer properties Microbiol. Res. 253 2021 126877
Hooton S.P. Atterbury R.J. Connerton I.F. Application of a bacteriophage cocktail to reduce Salmonella typhimurium U288 contamination on pig skin Int. J. Food Microbiol. 151 2011 157 163 21899907
Islam M.S. Hu Y. Mizan M.F.R. Yan T. Nime I. Zhou Y. Li J. Characterization of Salmonella phage LPST153 that effectively targets most prevalent Salmonella serovars Microorganisms 8 2020 1089 32708328
Islam M.S. Zhou Y. Liang L. Nime I. Liu K. Yan T. Wang X. Li J. Application of a phage cocktail for control of Salmonella in foods and reducing biofilms Viruses 11 2019 841 31510005
Jajere S.M. A review of Salmonella enterica with particular focus on the pathogenicity and virulence factors, host specificity and antimicrobial resistance including multidrug resistance Vet. World 12 2019 504 521 31190705
Jiang L. Zheng R. Sun Q. Li C. Isolation, characterization, and application of Salmonella paratyphi phage KM16 against Salmonella paratyphi biofilm Biofouling 37 2021 276 288 33947280
Khan M.A.S. Rahman S.R. Use of phages to treat antimicrobial-resistant Salmonella infections in poultry Vet. Sci. 9 2022 438 36006353
Kim T.S. Kim G.S. Son J.S. Lai V.D. Mo I.P. Jang H. Prevalence, biosecurity factor, and antimicrobial susceptibility analysis of Salmonella species isolated from commercial duck farms in Korea J. Poult. Sci. 100 2021 100893
Knezevic P. Petrovic O. A colorimetric microtiter plate method for assessment of phage effect on Pseudomonas aeruginosa biofilm J. Microbiol. Meth. 74 2008 114 118
Kortright K.E. Chan B.K. Koff J.L. Turner P.E. Phage therapy: arenewed approach to combat antibiotic-resistant bacteria Cell Host Microbe 25 2019 219 232 30763536
Kumari S. Sarkar P.K. Bacillus cereus hazard and control in industrial dairy processing environment Food Control 69 2016 20 29
Kurtz J.R. Goggins J.A. McLachlan J.B. Salmonella infection: Interplay between the bacteria and host immune system Immunol. Lett. 190 2017 42 50 28720334
Kwiatek M. Parasion S. Nakonieczna A. Therapeutic bacteriophages as a rescue treatment for drug-resistant infections - an in vivo studies overview J. Appl. Microbiol. 128 2020 985 1002 31778593
Li J. Zhao F. Zhan W. Li Z. Zou L. Zhao Q. Challenges for the application of bacteriophages as effective antibacterial agents in the food industry J. Sci. Food Agr. 102 2022 461 471 34487550
Li P. Zhang X. Xie X. Tu Z. Gu J. Zhang A. Characterization and whole-genome sequencing of broad-host-range Salmonella-specific bacteriophages for bio-control. Microb Pathogenesis 143 2020 104119
Lim J.A. Shin H. Kang D.H. Ryu S. Characterization of endolysin from a Salmonella Typhimurium-infecting bacteriophage SPN1S Res. Microbiol. 163 2012 233 241 22289622
Liu M. Zhu X. Zhang C. Zhao Z. LuxQ-LuxU-LuxO pathway regulates biofilm formation by Vibrio parahaemolyticus Microbiol. Res. 250 2021 126791
Ljubojević Pelić D. Vidaković Knežević S. Pelić M. Živkov Baloš M. Milanov D. The epidemiological significance of duck meat as a source of Salmonella spp. a review Worlds Poult. Sci. J. 77 2021 105 114
Martelli F. Gosling R.J. Callaby R. Davies R. Observations on Salmonella contamination of commercial duck farms before and after cleaning and disinfection Avian. Pathol. 46 2017 131 137 27545288
Na H. Kong M. Ryu S. Characterization of LysPBC4, a novel Bacillus cereus-specific endolysin of bacteriophage PBC4 FEMS Microbiol. Lett. 363 2016 fnw092
Nielsen H. Brunak S. von Heijne G. Machine learning approaches for the prediction of signal peptides and other protein sorting signals Protein Eng 12 1999 3 9 10065704
Oliveira H. Thiagarajan V. Walmagh M. Sillankorva S. Lavigne R. Neves-Petersen M.T. Kluskens L. Azeredo J.A. Thermostable Salmonella Phage Endolysin, Lys68, with Broad Bactericidal Properties against Gram-Negative Pathogens in Presence of Weak Acids PLoS One 9 2014 e108376
Pan L. Li D. Sun Z. Lin W. Hong B. Qin W. Xu L. Liu W. Zhou Q. Wang F. Cai R. First characterization of a Hafnia phage reveals extraordinarily large burst size and unusual plaque polymorphism Front. Microbiol. 12 2022 754331
Raas M.W.D. Silva T.P. Freitas J.C.O. Campos L.M. Fabri R.L. Melo R.C.N. Whole slide imaging is a high-throughput method to assess Candida biofilm formation Microbiol. Res. 250 2021 126806
Rincon-Gamboa S.M. Poutou-Pinales R.A. Carrascal-Camacho A.K. Antimicrobial resistance of non-typhoid Salmonella in meat and meat products Foods 10 2021 1731 34441509
Roth N. Kasbohrer A. Mayrhofer S. Zitz U. Hofacre C. Domig K.J. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia coli: A global overview J. Poult. Sci. 98 2019 1791 1804
Sadekuzzaman M. Mizan M.F.R. Yang S. Kim H.S. Ha S.D. Application of bacteriophages for the inactivation of Salmonella spp. in biofilms Food Sci. Technol. Int. 24 2018 424 433 29546997
Sambrook J. Molecular cloning: A laboratory manual 9 1989 Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY 14 23
Shang Y. Sun Q. Chen H. Wu Q. Chen M. Yang S. Du M. Zha F. Ye Q. Zhang J. Isolation and characterization of a novel Salmonella phage vB_SalP_TR2 Front. Microbiol. 12 2021 664810
Shin H. Lee J.H. Yoon H. Kang D.H. Ryu S. Genomic investigation of lysogen formation and host lysis systems of the Salmonella temperate bacteriophage SPN9CC Appl. Environ. Microb. 80 2014 374 384
Thanki A.M. Clavijo V. Healy K. Wilkinson R.C. Sicheritz-Ponten T. Millard A.D. Clokie M.R.J. Development of a Phage Cocktail to Target Salmonella Strains Associated with Swine Pharmaceuticals-Base 15 2022 58
Thurber R.V. Current insights into phage biodiversity and biogeography Curr. Opin. Microbiol. 12 2009 582 587 19811946
Tie K. Yuan Y. Yan S. Yu X. Zhang Q. Xu H. Zhang Y. Gu J. Sun C. Lei L. Han W. Isolation and identification of Salmonella pullorum bacteriophage YSP2 and its use as a therapy for chicken diarrhea Virus Genes 54 2018 446 456 29564689
Tsai H.J. Hsiang P.H. The prevalence and antimicrobial susceptibilities of Salmonella and Campylobacter in ducks in Taiwan J. Vet. Med. Sci. 67 2005 7 12 15699587
Wang Y. Liu Y. Lyu N. Lyu N. Li Z. Ma S. Cao D. Zhu B. The temporal dynamics of antimicrobial-resistant-Salmonella enterica and predominant serovars in China Natl. Sci. Rev. 10 2022 nwac269 37035020
Yang X. Wu Q. Zhang J. Huang J. Chen L. Wu S. Zeng H. Wang J. Chen M. Wu H. Gu Q. Wei X. Prevalence, bacterial Load, and antimicrobial resistance of Salmonella serovars isolated from retail meat and meat products in China Front. Microbiol. 10 2019 2121 31608021
Yu C.Y. Chu C. Chou S.J. Chao M.R. Yeh C.M. Lo D.Y. Su Y.C. Horng Y.M. Weng B.C. Tsay J.G. Comparison of the association of age with the infection of Salmonella and Salmonella enterica serovar Typhimurium in Pekin ducks and Roman geese J. Poult. Sci. 87 2008 1544 1549
Yuksel F.N. Buzrul S. Akcelik M. Akcelik N. Inhibition and eradication of Salmonella typhimurium biofilm using P22 bacteriophage, EDTA and nisin Biofouling 34 2018 1046 1054 30621457
Zhang X. Niu Y.D. Nan Y. Stanford K. Holley R. McAllister T. Narvaez-Bravo C. SalmoFresh effectiveness in controlling Salmonella on romaine lettuce, mung bean sprouts and seeds Int. J. Food Microbiol. 305 2019 108250
Zhang Y. Ding Y. Li W. Zhu W. Wang J. Wang X. Application of a novel lytic podoviridae phage Pu20 for biological control of drug-resistant Salmonella in liquid eggs Pathogens 10 2021 34 33406779
