
==== Front
BMC Oral Health
BMC Oral Health
BMC Oral Health
1472-6831
BioMed Central London

4753
10.1186/s12903-024-04753-1
Research
The impact of photobiomodulation on angiogenic differentiation of two different dental derived stem cells using two irradiation protocols: an in vitro investigation
http://orcid.org/0000-0002-3499-2250
Atarbashi-Moghadam Fazele 1
Samadi-Rad Aryan 2
http://orcid.org/0000-0001-5188-0325
Hakimiha Neda 3
http://orcid.org/0000-0002-8996-496X
Taghipour Niloofar 4
http://orcid.org/0009-0007-0005-6134
Mahmoudian Amirhosein 5
http://orcid.org/0000-0002-8775-8732
Azadi Ali azadiali1377@gmail.com

6
http://orcid.org/0000-0002-6154-4349
Nokhbatolfoghahaei Hanieh haniehnokhbeh@gmail.com

7
1 https://ror.org/034m2b326 grid.411600.2 Department of Periodontics, Dental School of Shahid Beheshti University of Medical Sciences, Tehran, Iran
2 https://ror.org/034m2b326 grid.411600.2 School of Dentistry, Shahid Beheshti University of Medical Sciences, Tehran, Iran
3 https://ror.org/034m2b326 grid.411600.2 Laser Application in Medical Sciences Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran
4 https://ror.org/034m2b326 grid.411600.2 Department of Tissue Engineering and Applied Cell Sciences, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran
5 https://ror.org/034m2b326 grid.411600.2 Department of Periodontics, School of Dentistry, Shahid Beheshti University of Medical Sciences, Tehran, Iran
6 https://ror.org/034m2b326 grid.411600.2 Dentofacial Deformities Research Center, Research Institute for Dental Sciences, Shahid Beheshti University of Medical Sciences, Danshjoo BLVD, Velenjak, Shahid Chamran Highway, Tehran, 1983963113 Iran
7 https://ror.org/034m2b326 grid.411600.2 Dental Research Center, Research Institute for Dental Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran
14 9 2024
14 9 2024
2024
24 10902 6 2024
14 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.
The present study aimed to compare the effect of photobiomodulation with different energy densities on the angiogenic differentiation of human periodontal ligament stem cells (hPDLSCs) and stem cells from human exfoliated deciduous teeth (SHED). Photobiomodulation therapy with a 660 nm diode laser (2.4 J/cm2 and 3.9 J/cm2) on two consecutive days post-culture was applied to two types of stem cells (hPDLSCs and SHED). The Quantitative Real-time Polymerase Chain Reaction (RT-qPCR) test was undertaken to investigate Vascular Endothelial Growth Factor-A (VEGF-A) and Angiopoietin I (ANG-I) genes on days 1, 3, 5, 7, and 10 after the first session of laser application. The 4′,6-diamidino-2-phenylindole (DAPI) staining and Methyl Thiazolyl Tetrazolium (MTT) test were conducted on days 1, 3, and 5 after the first session of laser application, to assess the cell viability. The Two-way ANOVA with Tukey post hoc test was used to analyze the outcomes of the MTT and RT-qPCR tests. The results of the MTT and DAPI convergently illustrated that the groups receiving photobiomodulation with 2.4 J/cm2 had higher cell viability compared to 3.9 J/cm2. All experimental groups showed an upregulation of VEGF-A and ANG-I gene expression from day 1 to 5, followed by a downregulation from day 5 to 10. The groups with cultured hPDLSCs and SHED receiving photobiomodulation using 2.4 J/cm2 had the most amounts of VEGF-A and ANG-I gene expression on day 5, respectively. In conclusion, the 660 nm mediated photobiomodulation therapy of cultured SHED and hPDLSCs with 2.4 J/cm2 energy density may be associated with higher angiogenic differentiation (the expression of VEGF-A and ANG-I) as well as higher cell viability compared to the photobiomodulation therapy with 3.9 J/cm2.

Keywords

Angiogenesis
In vitro techniques
Lasers
Low-level light therapy
Mesenchymal stem cells
issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Photobiomodulation (PBM) is a nonthermal light therapy that triggers the special photo acceptors within the cells and leads to the modification of cellular reactions. Photobiomodulation has the ability to enhance cell proliferation and differentiation, induce the production of cytokines, and boost granulation tissue formation [1–3]. Moreover, PBM has been used to enhance wound healing and tissue repair as well as reduce pain and inflammation [4, 5]. It has shown promising effects on tissue regeneration compared to high-intensity light [6]. Previous studies showed that the combination of the PBM and stem cells led to enhanced angiogenesis through stimulation of angiogenic gene expressions like vascular endothelial growth factor (VEGF) and angiopoietin (ANG) 2 [2]. This was found by an increased number of H-type arteries, which are characterized by high levels of CD31 and EMCN expression [3, 7]. Recent studies have demonstrated the efficacy of PBM in enhancing angiogenesis in various models. For instance, an investigation on the chorioallantoic membrane burn wound model illustrated that PBM promoted angiogenesis by increasing the number of emerging blood vessels, significantly [8]. Other studies showed PBM’s effect on angiogenesis and osteogenesis, highlighting a substantial upregulation in blood vessel formation and new bone generation in PBM-treated groups [3, 9]. Furthermore, it has recently been shown that using the ERK/p38 MAKP signaling pathway, PBM interestingly promoted melanoma growth by the induction of angiogenesis [10]. These findings underscore the potential of PBM as a therapeutic intervention to enhance angiogenesis and improve clinical outcomes in various medical fields.

Angiogenesis, defined as the formation of new blood vessels from existing vasculature, plays a crucial role as a source of necessary oxygen and nutrients and is an unelectable component in regeneration [11]. Additionally, it guides stem cells to the specific area of regeneration through arteries [12]. Angiogenesis can be controlled through the expression of a variety of genes; it has been shown in studies that angiogenesis can be mediated by genes like VEGF (through mitogen-activated protein kinase (MAPK)) [13] or ANG I – IV (via Tie-2 and Tie-1) [14].

PBM’s effect depends on the laser parameters like wavelength and energy density [15]. Mesenchymal stem cells from different origins can vary in their proliferative and differentiative ability. For instance, stem cells from human deciduous teeth (SHED) have a superior ability for proliferation compared to human dental pulp stem cells (hDPSCs) and human periodontal ligament stem cells (hPDLSCs) [16], or it has been demonstrated that SHED possesses a higher angiogenic ability compared to hDPSCs [17]. Furthermore, despite the positive effect of PBM on dental derived stem cells, it has been shown that the response to PBM may vary according to the nature of the cells and tissues [15].

Given the essential importance of angiogenesis in the process of tissue regeneration, it is imperative to augment this aspect in order to achieve a favorable outcome in tissue regeneration. The present investigation planned to assess the influence of 660 nm-PBM using different energy densities on angiogenic differentiation of the hPDLSCs and SHED.

Materials and methods

The present study design has received approval from the Ethics Committee at the Research Institute of Dental Sciences, Shahid Beheshti University of Medical Sciences (IR.SBMU.DRC.REC.1402.124).

Materials

Cells

The authors sourced hPDLSCs from the Iranian National Center of Genetic and Biologic Resources (IBRC C11326). The surface indicators of hPDLSCs were identified as CD90+ (99.6%), CD105+ (95.6%), CD34- (1.27%), and CD45- (1.08%). SHED with CD73+ (100%), CD90+ (100%%), CD105+ (99.8%), CD34- (2.08%), and CD45- (0.83%) surface characteristics were obtained from the Research Institute for Dental Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran. Both cell types were used from three passages.

Culture and test materials

From Boisera, France, the authors obtained trypsin/Ethylenediaminetetraacetic acid (trypsin/EDTA), Fetal bovine serum (FBS), High-glucose Dulbecco’s modified Eagle medium (DMEM), and Penicillin/Streptomycin (pen/strep). The Phosphate-buffered Saline (PBS), paraformaldehyde, dimethyl sulfoxide (DMSO), 4′,6-diamidino-2-phenylindole (DAPI) solution, and Methyl Thiazolyl Tetrazolium (MTT) solution were acquired from Sigma Aldrich, United States. The authors bought Ethanol from Merck, United States. YTzol Pure RNA and cDNA synthesis kits were procured from Yekta Tajhiz Azma, Iran. Lastly, the 2x SYBR® Green master mix Kit™ was purchased from Ampliqon, Denmark.

Assessment tools and devices

Diode laser with 660 nm wavelength: Konftec, Taiwan.

Fluorescent Microscope: Cytation3, BioTek, United States.

LightCycler 96: Roche, Switzerland.

ELISA Reader Device: ELX800, BioTek, United States.

NanoDrop™ 2000/2000c Spectrophotometers: Thermo Fisher Scientific, United States.

Study design

Experimental groups

Table 1; Fig. 1 elicit the study timeline, different experimental groups, the details regarding PBM therapy for each group, and the dates of laboratory tests. The authors considered two control groups containing cultured hPDLSCs and SHED, without any laser intervention, for the study. PBMs were carried out using a 660 nm diode (8 mm tip; 0.5 cm2 area) with a 1 mm distance from the cultured surface. In the groups with PBM (2.4), the laser parameters were (150 mW power; continuous mode; 8 s radiation; 2.4 J/cm2 energy density; 0.3 W/cm2 power density), and in the groups with PBM (3.9), the laser parameters were as (150 mW power; continuous mode; 13 s radiation; 3.9 J/cm2 energy density; 0.3 W/cm2 power density), in two consecutive days post-culture. The laser parameters and timing of application were adopted considering Etemadi et al. [18], Mylona et al. [19], Bergamo et al. [20], and Mahmoudian et al. [21] studies.

Table 1 Description of the treatment details in study groups

	Groups	Description	
1	PDL	Cultured hPDLSCs	
2	SHED	Cultured SHED	
3	PDL + PBM (2.4)	Cultured hPDLSCs + PBM using 660 nm diode with 2.4 J/cm2 energy Density (Days 1 and 2 post-culture)	
4	SHED + PBM (2.4)	Cultured SHED + PBM using 660 nm diode with 2.4 J/cm2 energy Density (Days 1 and 2 post-culture)	
5	PDL + PBM (3.9)	Cultured hPDLSCs + PBM using 660 nm diode with 3.9 J/cm2 energy Density (Days 1 and 2 post-culture)	
6	SHED + PBM (3.9)	Cultured SHED + PBM using 660 nm diode with 3.9 J/cm2 energy Density (Days 1 and 2 post-culture)	
PBM: Photobiomodulation; SHED: stem cells from human deciduous teeth; hPDLSC: Human Periodontal Ligament Stem Cell

Fig. 1 Characterization of experimental groups and the timeline of study

Cell culture

High-glucose DMEM supplemented with 15% FBS and 1% pen/strep was used as the standard medium culture in this study. Following the count with a hemocytometer, each well of a 48-well plate was populated with 4000 hPDLSCs and SHED and filled with 0.5 mL of the standard medium. The conditions were maintained at 98% humidity, 5% CO2, and 37 ◦C. To avoid the PBM therapy on a well affecting its adjacent wells, the authors ensured there was an empty row and column between the wells with cultured cells. The standard medium was refreshed every other day. After reaching 80% confluency, all the experiments and tests were carried out three times for accuracy.

MTT assay

The MTT solution, at a concentration of 0.5 mg/mL, was introduced to each well on days 1, 3, and 5. The cultures were then incubated for 4 h in an environment with 5% CO2, 37 ◦C temperature, and 98% humidity. Following this, 1 mL of dimethyl sulfoxide was added to the wells. The medium was subsequently moved to 96-well plates for analysis using the ELISA reader device at a wavelength of 570 nm.

DAPI staining

On days 1, 3, and 5, the medium was removed from the wells using PBS. A 4% concentration of paraformaldehyde solution was then applied for fixation. Subsequently, the wells were rinsed with PBS, and a DAPI solution with a concentration of 1 mg/mL was introduced to each well. The plates were then stored in a dark room at ambient temperature for 45 s. Finally, the wells were rinsed three times with PBS. The plates were then examined under a fluorescent microscope to visualize the blue-colored cell nuclei.

Total RNA extraction, cDNA synthesis, and real-time quantitative polymerase chain reaction (RT-qPCR)

The RT-qPCR analysis was performed to monitor the expressions of the VEGF-A and ANG-I genes on days 1, 3, 5, 7, and 10 after cell seeding. The expression of angiogenic genes was evaluated for up to 10 days because previous literature demonstrated that angiogenic gene overexpression would happen in the early days of the healing process (2 to 5 days) [22, 23]. The forward and reverse primer sequences for the targeted and housekeeping genes are displayed in Table 2. For RT-qPCR analysis, cells were gathered and preserved at -80 °C until the extraction of mRNA. The YTzol Pure RNA kit was used to isolate total cellular RNAs. The concentration and purity of the RNA extracted were assessed using NanoDrop™ 2000/2000c Spectrophotometers. The cDNA Synthesis Kit was used to synthesize Complementary DNA (cDNA) following the manufacturer’s guidelines. The qPCR was conducted in triplicate on a Roche light-cycler-96 using the 2x SYBR® Green master mix Kit™. Each qPCR reaction included 1 µL (20 ng) of cDNA, 0.5 µL of each primer (10 pmol/L), 10 µL of 2x Ampliqon Master Mix, and 8 µL of double-distilled water. The 2−∆∆CT method was utilized to analyze the expression of the target gene. The housekeeping GAPDH mRNA level was used for normalization.

Table 2 The sequences of target gene expression primers used for quantitative real-time polymerase chain reaction analysis

Name	Description	Primers Sequences (5’ to 3’)	
VEGF-A	Vascular Endothelial Growth Factor A [Homo sapiens (human)]	F: GAACTTTCTGCTGTCTTGGG

R: CTTCGTGATGATTCTGCCCT

	
ANG-I	Angiopoietin I [Homo sapiens (human)]	F: CAACAGTGTCCTTCAGAAGCAGC

R: CCAGCTTGATATACATCTGCACAG

	
GAPDH	glyceraldehyde-3-phosphate dehydrogenase [Homo sapiens (human)]	F: CCACTCCTCCACCTTTGACG

R: CCACCACCCTGTTGCTGTAG

	

Statistical analysis

The outcomes of the MTT assay and RT-qPCR analyses from various experimental groups were normalized against the control group from their own cell type. All statistical evaluations were conducted on three samples per group using GraphPad Prism v9 software. The Shapiro-Wilk test was employed to verify the normality assumption of the data. Any significant difference in each parameter among the groups was assessed using Two-way ANOVA. A P value of less than 0.05 was deemed significant.

Results

The Shapiro-Wilk analysis revealed that none of the MTT assay and RT-qPCR analysis data of the experimental groups deviated from the normal distribution.

MTT assay

Figure 2 presents the MTT assay results, comparing different days and groups. A Two-way ANOVA indicated a significant interaction between experimental groups and time (P = 0.006).

Fig. 2 Comparison of the effect of photobiomodulation with 2.4 and 3.9 J/cm2 energy densities on the viability of hPDLSCs and SHED after 1, 3, and 5 days. (A) and (B) sections demonstrate the comparison between cell viability on different days within each group and the comparison between cell viability of different groups within each day, respectively. Each experiment was done in triplicate (n = 3), and columns represent their data. (P < 0.05 = *, P < 0.01 = **)

Comparison between different days in each group

Within the PDL + PBM (2.4) group, cell proliferation was significantly higher on day 5 compared to days 1 and 3 (P = 0.01). Moreover, cell proliferation was significantly higher on day 3 compared to day 1 (P = 0.03). No significant differences were observed between days in other groups (Fig. 2A).

Comparison between different groups within each day

Comparing different groups on each day, the PDL + PBM (2.4) group showed significantly higher cell proliferation than the PDL + PBM (3.9) (P = 0.005) and SHED + PBM (3.9) (P = 0.003) groups on day 3. Similarly, on day 5, the PDL + PBM (2.4) group had higher cell proliferation compared to the PDL + PBM (3.9) (P = 0.02) and SHED + PBM (3.9) (P = 0.003) groups (Fig. 2B).

DAPI staining

Figure 3 illustrates the results of DAPI staining on days 1, 3, and 5. Qualitatively, the results are in convergence with the outcomes of the MTT assay, and it can be concluded that the groups PDL + PBM (2.4) and SHED + PBM (2.4) showed the most amounts of cell proliferation on days 3 and 5 among groups with cultured hPDLSCs and SHED, respectively.

Fig. 3 Results of the 4′,6-diamidino-2-phenylindole (DAPI) staining for qualitative comparison of the effect of photobiomodulation with 2.4 and 3.9 J/cm2 energy densities on the viability of hPDLSCs and SHED after 1, 3, and 5 days. Each experiment was done in triplicate (n = 3). Scale bar: 100 μm

RT-qPCR analysis

VEGF-A

Figure 4 depicts the results of the RT-qPCR test for tracing the expression of VEGF-A based on the comparison between different days and groups. Two-way ANOVA showed a significant interaction between the experimental groups and time (P < 0.0001).

Fig. 4 Comparison of the effect of photobiomodulation with 2.4 and 3.9 J/cm2 energy densities on the vascular endothelial growth factor A (VEGF-A) mRNA expression and angiogenic differentiation of hPDLSCs and SHED. (A) and (B) sections demonstrate the comparison between gene expression on different days within each group and the comparison between gene expression of different groups within each day, respectively. Each experiment was done in triplicate (n = 3), and columns represent their data. (P < 0.05 = *, P < 0.01 = **, P < 0.001 = ***, P < 0.0001 = ****)

Trend of the gene expression on different days within each group

All experimental groups demonstrate the same pattern in the expression of the VEGF-A gene, with an overexpression of the gene from day 1 to day 5, followed by a downregulation in the expression from day 5 to day 10. Hence, the most amount of gene expression can be seen on day 5 (Fig. 4A).

Comparison between different groups on day 5

Among groups with cultured hPDLSCs, PDL + PBM (2.4) (3.08 ± 0.13 expression fold) group showed significantly higher VEGF-A expression than PDL (1.99 ± 0.13 expression fold; P = 0.003) and PDL + PBM (3.9) (2.39 ± 0.11 expression fold; P = 0.01) (Fig. 4B).

Among groups with cultured SHED, SHED + PBM (2.4) (2.69 ± 0.07 expression fold) demonstrated significantly higher VEGF-A expression than SHED (P = 0.0007) and SHED + PBM (3.9) (P = 0.03) (Fig. 4B).

Comparison between the effect of PBM on hPDLSC and SHED

PDL + PBM (2.4) and SHED + PBM (2.4) groups illustrated the highest amounts of gene expression among groups with cultured hPDLSCs and SHED, respectively. Comparing PDL + PBM (2.4) and SHED + PBM (2.4), significantly higher VEGF-A gene expression was found on days 3 (P = 0.02), 7 (P = 0.03), and 10 (P = 0.02); however, they have no significant difference on day 5 (P = 0.09).

Table 3 represents complementary details of the results of the Two-way ANOVA regarding the comparison in the VEGF-A gene expression between each pair of the experimental groups.

Table 3 League table containing p-values associated with comparing each pair of experimental groups’ relative vascular endothelial growth factor (VEGF) gene expression resulting from two-way ANOVA and Tukey post hoc

1.00 ± 0.00	Day 1	PDL						
1.47 ± 0.12	Day 3	
1.99 ± 0.13	Day 5	
1.79 ± 0.07	Day 7	
1.56 ± 0.13	Day 10	
1.00 ± 0.00	Day 1	N/A	SHED					
1.15 ± 0.06	Day 3	0.11	
1.75 ± 0.08	Day 5	0.27	
1.41 ± 0.02	Day 7	0.03 *	
1.16 ± 0.04	Day 10	0.10	
1.17 ± 0.01	Day 1	0.01 *	0.01 *	PDL + PBM (2.4)				
2.19 ± 0.07	Day 3	0.01 *	0.0003 *	
3.08 ± 0.13	Day 5	0.003 *	0.002 *	
2.59 ± 0.10	Day 7	0.002 *	0.007 *				
2.22 ± 0.08	Day 10	0.02 *	0.001 *				
1.12 ± 0.02	Day 1	0.02 *	0.02 *	0.07	SHED + PBM (2.4)			
1.82 ± 0.07	Day 3	0.08	0.002 *	0.02 *	
2.69 ± 0.07	Day 5	0.02 *	0.0007 *	0.09	
2.18 ± 0.09	Day 7	0.03 *	0.01 *	0.03 *			
1.83 ± 0.08	Day 10	0.22	0.003 *	0.02 *			
1.14 ± 0.02	Day 1	0.03 *	0.03 *	0.62	0.57	PDL + PBM (3.9)		
1.74 ± 0.11	Day 3	0.20	0.02 *	0.03 *	0.83	
2.39 ± 0.11	Day 5	0.09	0.009 *	0.02 *	0.09	
2.27 ± 0.11	Day 7	0.03 *	0.02 *	0.10	0.87		
1.87 ± 0.07	Day 10	0.15	0.002 *	0.03 *	0.96		
1.07 ± 0.07	Day 1	0.62	0.62	0.43	0.86	0.62	SHED + PBM (3.9)	
1.27 ± 0.09	Day 3	0.36	0.46	0.001 *	0.008 *	0.03 *	
2.03 ± 0.14	Day 5	1.00	0.23	0.004 *	0.03 *	0.14	
1.57 ± 0.10	Day 7	0.16	0.32	0.001 *	0.007 *	0.006 *	
1.30 ± 0.08	Day 10	0.23	0.29	0.0009 *	0.007 *	0.005 *	
The first column at the left demonstrates the amount of relative gene expression (mean ± standard deviation) related to each group on each day compared to the control group. Each experiment was done in triplicate (n = 3). * sign indicates a significant difference between groups in each day. N/A = not applicable

ANG-I

Figure 5 depicts the results of the RT-qPCR test for tracing the expression of ANG-I based on the comparison between different days and groups. Two-way ANOVA showed a significant interaction between the experimental groups and time (P < 0.0001).

Fig. 5 Comparison of the effect of photobiomodulation with 2.4 and 3.9 J/cm2 energy densities on the Angiopoietin I (ANG-I) mRNA expression and angiogenic differentiation of hPDLSCs and SHED. (A) and (B) sections demonstrate the comparison between gene expression on different days within each group and the comparison between gene expression of different groups within each day, respectively. Each experiment was done in triplicate (n = 3), and columns represent their data. (P < 0.05 = *, P < 0.01 = **, P < 0.001 = ***, P < 0.0001 = ****)

Trend of the gene expression on different days within each group

All experimental groups demonstrate the same pattern in the expression of the ANG-I gene, with an overexpression of the gene from day 1 to day 5, followed by a downregulation in the expression from day 5 to day 10. Hence, the most amount of gene expression can be seen on day 5 (Fig. 5A).

Comparison between different groups on day 5

Among groups with cultured hPDLSCs, PDL + PBM (2.4) (2.02 ± 0.13 expression fold) possesses a higher amount of ANG-I expression compared to the other groups; however, no significant difference was observed between them (Fig. 5B).

Among groups with cultured SHED, SHED + PBM (2.4) (1.99 ± 0.11 expression fold) demonstrated significantly higher amounts of ANG-I expression (P = 0.03) compared to the SHED group (1.38 ± 0.03 expression fold) (Fig. 5B).

Comparison between the effect of PBM on hPDLSC and SHED

PDL + PBM (2.4) and SHED + PBM (2.4) groups illustrated the highest amounts of gene expression among groups with cultured hPDLSCs and SHED, respectively. Comparing these two groups, no significant differences were found in the expression of ANG-I on any of the experiment days.

Table 4 represents complementary details of the results of the Two-way ANOVA regarding the comparison in the ANG-I gene expression between each pair of the experimental groups.

Table 4 League table containing p-values associated with comparing each pair of experimental groups’ relative Angiopoietin I (ANG-I) gene expression resulting from Two-way ANOVA and Tukey post hoc

1.00 ± 0.00	Day 1	PDL						
1.30 ± 0.05	Day 3	
1.63 ± 0.07	Day 5	
1.49 ± 0.08	Day 7	
1.34 ± 0.11	Day 10	
1.00 ± 0.00	Day 1	N/A	SHED					
1.13 ± 0.04	Day 3	0.06	
1.38 ± 0.03	Day 5	0.06	
1.30 ± 0.08	Day 7	0.18	
1.19 ± 0.03	Day 10	0.40	
1.14 ± 0.02	Day 1	0.04 *	0.04 *	PDL + PBM (2.4)				
1.61 ± 0.06	Day 3	0.02 *	0.003 *	
2.02 ± 0.13	Day 5	0.09	0.04 *	
1.90 ± 0.10	Day 7	0.03 *	0.008 *				
1.76 ± 0.04	Day 10	0.04 *	0.0007 *				
1.12 ± 0.02	Day 1	0.03 *	0.03 *	0.93	SHED + PBM (2.4)			
1.50 ± 0.08	Day 3	0.14	0.03 *	0.51	
1.99 ± 0.11	Day 5	0.06	0.03 *	1.00	
1.84 ± 0.06	Day 7	0.02 *	0.004 *	0.93			
1.69 ± 0.07	Day 10	0.06	0.01 *	0.60			
1.11 ± 0.01	Day 1	0.008 *	0.008 *	0.69	0.99	PDL + PBM (3.9)		
1.33 ± 0.10	Day 3	1.00	0.21	0.08	0.32	
1.78 ± 0.11	Day 5	0.48	0.07 *	0.32	0.35	
1.61 ± 0.03	Day 7	0.32	0.04 *	0.11	0.04 *		
1.44 ± 0.05	Day 10	0.68	0.01 *	0.005 *	0.04 *		
1.03 ± 0.07	Day 1	0.97	0.97	0.31	0.40	0.44	SHED + PBM (3.9)	
1.25 ± 0.07	Day 3	0.84	0.30	0.01 *	0.07	0.82	
1.70 ± 0.11	Day 5	0.93	0.14	0.18	0.18	0.94	
1.43 ± 0.05	Day 7	0.82	0.31	0.03 *	0.005 *	0.03 *	
1.28 ± 0.06	Day 10	0.95	0.35	0.004 *	0.008 *	0.13	
The first column at the left demonstrates the amount of relative gene expression (mean ± standard deviation) related to each group on each day compared to the control group. Each experiment was done in triplicate (n = 3). * sign indicates a significant difference between groups in each day. N/A = Not applicable

Discussion

The aim of this investigation was to evaluate the effect of 660 nm-PBM with different energy densities on the angiogenic differentiation of hPDLSCs and SHED. The results showed that despite the PBM treatment with 3.9 J/cm2 energy density, the application of PBM with 2.4 J/cm2 energy density can positively affect the cell viability in both hPDLSCs and SHED. Moreover, treatment with PBM (2.4 J/cm2 energy density) enhanced the angiogenic differentiation of both hPDLSCs and SHED more than treatment with PBM (3.9 J/cm2 energy density). The application of PBM (2.4 J/cm2 energy density) resulted in higher amounts of VEGF-A expression in the hPDLSCs compared to SHED; however, the expression of ANG-I was not different between hPDLSCs and SHED. Lastly, it was found that the expression of angiogenic genes was upregulated from day 1 to day 5 (maximum), and afterward, it faced a downregulation to day 10.

Angiogenesis is crucial for wound healing and granulation tissue formation processes, especially in the early days of healing. This process provides cells (both progenitor and inflammatory) nutrition, oxygen, and growth factors [23]. The present study showed upregulation of VEGF-A and ANG-I in all treatment groups until day 5. Therefore, it can be suggested that two sessions of PBM treatments can promote angiogenic differentiation of hPDLSCs and SHED in the early days of healing. A previous investigation demonstrated that PBM enhances the migration, proliferation, and angiogenesis of human umbilical vascular endothelial cells (HUVECs) through activation of the PI3K/AKT pathway, which leads to an increase in the levels of angiogenesis-related genes (VEGF-A, eNOS, and Hypoxia-inducible factor (HIF)-1α) [24]. In coherence with these results, PBM, with an energy density between 4 and 8 J/cm2, elicited a positive influence on the angiogenic phase of bone healing in the different mesenchymal stem cells (adipose-derived stem cells and bone marrow-derived stem cells) through increasing platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), VEGF, and activation of the ROS/HIF-1α pathway [25]. Regarding the impact of PBM on other cell types, Bergamo et al. [20] demonstrated that PBM can improve the angiogenic differentiation of human dental pulp fibroblasts. It has been found that the expression of the FGF-2 gene, which is attributed to the angiogenesis, was more upregulated in the groups with 2.5 J/cm2 and 3.7 J/cm2 compared to the groups with higher energy densities. Considering the different impacts of PBM on the different natures of the investigated cells [15], the different achieved results can be counted as justified. The present study’s findings can complete the previous results and provide complementary insight into the application of PBM for the enhancement of angiogenesis.

Cell therapy is now an expanding treatment strategy in the field of medical sciences, which, alongside tissue engineering, can be applied to many conditions as a treatment, like cancer, cardiovascular diseases, digestive system diseases, liver diseases, and arthritis [26, 27]. Dental derived stem cells like hPDLSCs, SHED, and dental pulp stem cells can be harvested from the extracted teeth and are easier and more accessible to be retrieved compared to other sources of stem cells; hence, they can be counted as serious options for future stem cell therapies. Therefore, underscoring the importance of angiogenesis, the results of the present study will be beneficial for further investigations in the field of stem cell therapy.

The novelty of the present study is that it compares the effect of PBM in the angiogenic differentiation of two different mesenchymal stem cell types with each other to bring complementary insight to the future perspective of regenerative therapies. Furthermore, exploring the target gene expressions over time will offer a more comprehensive vision of angiogenesis and help to understand its mechanisms better. Some limitations are also evident in this study. To gain better insight into the effect of PBM on angiogenesis, further complementary In vivo studies, with longer follow-up periods for the observation of long-term outcomes, followed by clinical studies on this subject, are strongly recommended. Moreover, the authors suggest future studies to investigate the effect of PBM with different laser parameters and energy densities on angiogenesis. Eventually, protein-level explorations will help the literature achieve comprehensive findings regarding the angiogenic differentiation of SHED and hPDLSCs. Other sources of mesenchymal stem cells and non-mesenchymal stem cells should be investigated in future studies, as biological variability can affect the reproducibility of the result. Furthermore, the investigation of other various angiogenic gene expressions, growth factors production, and underlying molecular mechanisms and signaling pathways are crucial for the comprehensive insight into the effect of PBM on angiogenesis.

Conclusion

Based on the present study’s limitations, it can be concluded that two consecutive session applications of PBM with 660 nm diode laser at an energy density of 2.4 J/cm2 have more positive effects on the angiogenic differentiation and cell proliferation of hPDLSCs and SHED compared to 3.9 J/cm2 energy density. Furthermore, the expression of the angiogenic genes (VEGF-A and ANG-I) was found to be maximum on day 5.

Acknowledgements

None.

Author contributions

Fazele Atarbashi-Moghadam: Conceptualization, Methodology, Supervision, Resources, Writing – Original Draft, Writing – Review and EditingArian Samadi Rad: Conceptualization, Investigation, Writing – Original Draft, Writing – Review and EditingNeda Hakimiha: Methodology, Investigation, Writing – Original Draft, Writing – Review and EditingNiloofar Taghipour: Methodology, Investigation, Writing – Original Draft, Writing – Review and EditingAmirhosein Mahmoudian: Methodology, Investigation, Writing – Original Draft, Writing – Review and EditingAli Azadi: Conceptualization, Methodology, Formal Analysis, Project Administration, Investigation, Software, Visualization, Writing – Original Draft, Writing – Review and EditingHanieh Nokhbatolfoghahaei: Conceptualization, Investigation, Methodology, Project Administration, Validation, Writing – Original Draft, Writing – Review and Editing. All authors read and approved the final manuscript.

Data availability

The data that support the findings of this study are available from the corresponding author.

Declarations

Ethical approval

The study was approved by the Ethics Committee of Shahid Beheshti University of Medical Sciences (IR.SBMU.DCR.REC.1402.124).

Consent to participate

Not applicable.

Consent to Publish

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Ali Azadi and Hanieh Nokhbatolfoghahaei contributed equally to this work.
==== Refs
References

1. Santinoni CS Neves APC Almeida BFM Kajimoto NC Pola NM Caliente EA Bone marrow coagulated and low-level laser therapy accelerate bone healing by enhancing angiogenesis, cell proliferation, osteoblast differentiation, and mineralization J Biomed Mater Res A 2021 109 849 58 10.1002/jbm.a.37076 32815657
Santinoni CS, Neves APC, Almeida BFM, Kajimoto NC, Pola NM, Caliente EA, et al. Bone marrow coagulated and low-level laser therapy accelerate bone healing by enhancing angiogenesis, cell proliferation, osteoblast differentiation, and mineralization. J Biomed Mater Res A. 2021;109:849–58.32815657 10.1002/jbm.a.37076
2. Tim CR Bossini PS Kido HW Malavazi I Von Zeska Kress MR Carazzolle MF Effects of low level laser therapy on inflammatory and angiogenic gene expression during the process of bone healing: a microarray analysis J Photochem Photobiol B 2016 154 8 15 10.1016/j.jphotobiol.2015.10.028 26599085
Tim CR, Bossini PS, Kido HW, Malavazi I, Von Zeska Kress MR, Carazzolle MF, et al. Effects of low level laser therapy on inflammatory and angiogenic gene expression during the process of bone healing: a microarray analysis. J Photochem Photobiol B. 2016;154:8–15.26599085 10.1016/j.jphotobiol.2015.10.028
3. Bai J, Li L, Kou N, Bai Y, Zhang Y, Lu Y et al. Low level laser therapy promotes bone regeneration by coupling angiogenesis and osteogenesis. Stem Cell Res Ther. 2021;12.
4. Woodruff LD Bounkeo JM Brannon WM Dawes KS Barham CD Waddell DL The efficacy of laser therapy in wound repair: a meta-analysis of the literature Photomed Laser Surg 2004 22 241 7 10.1089/1549541041438623 15315732
Woodruff LD, Bounkeo JM, Brannon WM, Dawes KS, Barham CD, Waddell DL, et al. The efficacy of laser therapy in wound repair: a meta-analysis of the literature. Photomed Laser Surg. 2004;22:241–7.15315732 10.1089/1549541041438623
5. da Silva JP da Silva MA Almeida APF Lombardi Junior I Matos AP Laser therapy in the tissue repair process: a literature review Photomed Laser Surg 2010 28 17 21 10.1089/pho.2008.2372 19764898
da Silva JP, da Silva MA, Almeida APF, Lombardi Junior I, Matos AP. Laser therapy in the tissue repair process: a literature review. Photomed Laser Surg. 2010;28:17–21.19764898 10.1089/pho.2008.2372
6. Hamblin MR Huang YY Sharma SK Carroll J Biphasic dose response in low level light therapy - an update Dose Response 2011 9 602 18 22461763
Hamblin MR, Huang YY, Sharma SK, Carroll J. Biphasic dose response in low level light therapy - an update. Dose Response. 2011;9:602–18.22461763
7. Peng Y Wu S Li Y Crane JL Type H blood vessels in bone modeling and remodeling Theranostics 2020 10 426 10.7150/thno.34126 31903130
Peng Y, Wu S, Li Y, Crane JL. Type H blood vessels in bone modeling and remodeling. Theranostics. 2020;10:426.31903130 10.7150/thno.34126
8. Firouz B, Faihs L, Slezak P, Ghaffari Tabrizi-Wizsy N, Schicho K, Winter R et al. Testing the effects of photobiomodulation on angiogenesis in a newly established CAM burn wound model. Sci Rep. 2023;13.
9. Zhong J Zhang X Ruan Y Huang Y Photobiomodulation therapy’s impact on angiogenesis and osteogenesis in orthodontic tooth movement: in vitro and in vivo study BMC Oral Health 2024 24 1 15 10.1186/s12903-023-03824-z 38167114
Zhong J, Zhang X, Ruan Y, Huang Y. Photobiomodulation therapy’s impact on angiogenesis and osteogenesis in orthodontic tooth movement: in vitro and in vivo study. BMC Oral Health. 2024;24:1–15.38167114 10.1186/s12903-023-03824-z
10. Lin Y-Y;, Lee S-Y;, Cheng Y-J, Lin Y-Y, Lee S-Y, Cheng Y-J. Low-Level Laser Therapy Induces Melanoma Tumor Growth by Promoting Angiogenesis. Life 2023, Vol 13, Page 320. 2023;13:320.
11. Velazquez OC. Angiogenesis & Vasculogenesis: inducing the growth of new blood vessels and wound healing by stimulation of bone marrow derived Progenitor Cell mobilization and homing. J Vascular Surgery: Official Publication Soc Vascular Surg [and] Int Soc Cardiovasc Surg North Am Chap. 2007;45(Suppl A):A39.
12. Ding T, Kang W, Li J, Yu L, Ge S. An in situ tissue engineering scaffold with growth factors combining angiogenesis and osteoimmunomodulatory functions for advanced periodontal bone regeneration. J Nanobiotechnol. 2021;19.
13. Shibuya M Vascular endothelial growth factor (VEGF) and its receptor (VEGFR) signaling in angiogenesis: a crucial target for Anti- and pro-angiogenic therapies Genes Cancer 2011 2 1097 10.1177/1947601911423031 22866201
Shibuya M. Vascular endothelial growth factor (VEGF) and its receptor (VEGFR) signaling in angiogenesis: a crucial target for Anti- and pro-angiogenic therapies. Genes Cancer. 2011;2:1097.22866201 10.1177/1947601911423031
14. Fagiani E Christofori G Angiopoietins in angiogenesis Cancer Lett 2013 328 18 26 10.1016/j.canlet.2012.08.018 22922303
Fagiani E, Christofori G. Angiopoietins in angiogenesis. Cancer Lett. 2013;328:18–26.22922303 10.1016/j.canlet.2012.08.018
15. AlGhamdi KM Kumar A Moussa NA Low-level laser therapy: a useful technique for enhancing the proliferation of various cultured cells Lasers Med Sci 2012 27 237 49 10.1007/s10103-011-0885-2 21274733
AlGhamdi KM, Kumar A, Moussa NA. Low-level laser therapy: a useful technique for enhancing the proliferation of various cultured cells. Lasers Med Sci. 2012;27:237–49.21274733 10.1007/s10103-011-0885-2
16. Trivanović D Jauković A Popović B Krstić J Mojsilović S Okić-Djordjević I Mesenchymal stem cells of different origin: comparative evaluation of proliferative capacity, telomere length and pluripotency marker expression Life Sci 2015 141 61 73 10.1016/j.lfs.2015.09.019 26408916
Trivanović D, Jauković A, Popović B, Krstić J, Mojsilović S, Okić-Djordjević I, et al. Mesenchymal stem cells of different origin: comparative evaluation of proliferative capacity, telomere length and pluripotency marker expression. Life Sci. 2015;141:61–73.26408916 10.1016/j.lfs.2015.09.019
17. Yong Z Kuang G Fengying S Shoumei X Duohong Z Jiacai H Comparison of the angiogenic ability between SHED and DPSC in a mice model with critical limb ischemic Tissue Eng Regen Med 2022 19 861 10.1007/s13770-022-00452-6 35474506
Yong Z, Kuang G, Fengying S, Shoumei X, Duohong Z, Jiacai H, et al. Comparison of the angiogenic ability between SHED and DPSC in a mice model with critical limb ischemic. Tissue Eng Regen Med. 2022;19:861.35474506 10.1007/s13770-022-00452-6
18. Etemadi A Faghih A Chiniforush N Effects of Photobiomodulation Therapy with various laser wavelengths on Proliferation of Human Periodontal ligament mesenchymal stem cells Photochem Photobiol 2022 98 1182 9 10.1111/php.13588 34970994
Etemadi A, Faghih A, Chiniforush N. Effects of Photobiomodulation Therapy with various laser wavelengths on Proliferation of Human Periodontal ligament mesenchymal stem cells. Photochem Photobiol. 2022;98:1182–9.34970994 10.1111/php.13588
19. Mylona V Anagnostaki E Chiniforush N Barikani H Lynch E Grootveld M Photobiomodulation effects on Periodontal Ligament Stem cells: a systematic review of in Vitro studies Curr Stem Cell Res Ther 2024 19 544 58 10.2174/1574888X17666220527090321 35638280
Mylona V, Anagnostaki E, Chiniforush N, Barikani H, Lynch E, Grootveld M. Photobiomodulation effects on Periodontal Ligament Stem cells: a systematic review of in Vitro studies. Curr Stem Cell Res Ther. 2024;19:544–58.35638280 10.2174/1574888X17666220527090321
20. Bergamo MT Vitor LLR Dionísio TJ Marques NCT Oliveira RC Ambrosio ECP Could the photobiomodulation therapy induce angiogenic growth factors expression from dental pulp cells? Lasers Med Sci 2021 36 1751 8 10.1007/s10103-021-03291-4 33796964
Bergamo MT, Vitor LLR, Dionísio TJ, Marques NCT, Oliveira RC, Ambrosio ECP, et al. Could the photobiomodulation therapy induce angiogenic growth factors expression from dental pulp cells? Lasers Med Sci. 2021;36:1751–8.33796964 10.1007/s10103-021-03291-4
21. Mahmoudian A Nokhbatolfoghahaie H Hakimiha N Atarbashi-Moghadam F Azadi A Effect of Fibroblast Growth factor 2 and low-level laser therapy on the adhesion and proliferation of Periodontal Ligament Stem cells: Effect of FGF2 and LLLT on PDLSCs adhesion J Lasers Med Sci 2024 15 e17 17 10.34172/jlms.2024.17 39051001
Mahmoudian A, Nokhbatolfoghahaie H, Hakimiha N, Atarbashi-Moghadam F, Azadi A. Effect of Fibroblast Growth factor 2 and low-level laser therapy on the adhesion and proliferation of Periodontal Ligament Stem cells: Effect of FGF2 and LLLT on PDLSCs adhesion. J Lasers Med Sci. 2024;15:e17–17.39051001 10.34172/jlms.2024.17
22. Shams F Moravvej H Hosseinzadeh S Mostafavi E Bayat H Kazemi B Overexpression of VEGF in dermal fibroblast cells accelerates the angiogenesis and wound healing function: in vitro and in vivo studies Sci Rep 2022 2022 12 1 1 15
Shams F, Moravvej H, Hosseinzadeh S, Mostafavi E, Bayat H, Kazemi B, et al. Overexpression of VEGF in dermal fibroblast cells accelerates the angiogenesis and wound healing function: in vitro and in vivo studies. Sci Rep 2022. 2022;12(1):12:1–15.
23. Saghiri MA Asatourian A Sheibani N Angiogenesis and the prevention of alveolar osteitis: a review study J Korean Assoc Oral Maxillofac Surg 2018 44 93 102 10.5125/jkaoms.2018.44.3.93 29963489
Saghiri MA, Asatourian A, Sheibani N. Angiogenesis and the prevention of alveolar osteitis: a review study. J Korean Assoc Oral Maxillofac Surg. 2018;44:93–102.29963489 10.5125/jkaoms.2018.44.3.93
24. Li Y Xu Q Shi M Gan P Huang Q Wang A Low-level laser therapy induces human umbilical vascular endothelial cell proliferation, migration and tube formation through activating the PI3K/Akt signaling pathway Microvasc Res 2020 129 103959 10.1016/j.mvr.2019.103959 31734375
Li Y, Xu Q, Shi M, Gan P, Huang Q, Wang A, et al. Low-level laser therapy induces human umbilical vascular endothelial cell proliferation, migration and tube formation through activating the PI3K/Akt signaling pathway. Microvasc Res. 2020;129:103959.31734375 10.1016/j.mvr.2019.103959
25. Berni M, Brancato AM, Torriani C, Bina V, Annunziata S, Cornella E et al. The role of low-level laser therapy in Bone Healing: systematic review. Int J Mol Sci. 2023;24.
26. Sánchez A Schimmang T García-Sancho J Cell and tissue therapy in regenerative medicine Adv Exp Med Biol 2012 741 89 102 10.1007/978-1-4614-2098-9_7 22457105
Sánchez A, Schimmang T, García-Sancho J. Cell and tissue therapy in regenerative medicine. Adv Exp Med Biol. 2012;741:89–102.22457105 10.1007/978-1-4614-2098-9_7
27. Hoang DM, Pham PT, Bach TQ, Ngo ATL, Nguyen QT, Phan TTK et al. Stem cell-based therapy for human diseases. Signal Transduct Target Ther. 2022;7.
