
==== Front
HardwareX
HardwareX
HardwareX
2468-0672
Elsevier

S2468-0672(24)00070-1
10.1016/j.ohx.2024.e00576
e00576
Hardware Article
Turbolysis: A low-cost, small footprint alternative to commercial bead beaters for cell lysis
Limberis Jason D. Jason.Limberis@ucsf.edu
⁎
Metcalfe John Z.
Division of Pulmonary and Critical Care Medicine, Zuckerberg San Francisco General Hospital and Trauma Centre, University of California, San Francisco, San Francisco, CA, USA
⁎ Corresponding author. Jason.Limberis@ucsf.edu
27 8 2024
9 2024
27 8 2024
19 e0057615 4 2024
13 8 2024
24 8 2024
© 2024 The Author(s)
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Graphical abstract

turboLysis is a novel mechanical cell lysis device that utilizes small beads to efficiently lyse tough cells like Mycobacterium, Saccharomyces, and Arabidopsis. We compared turboLysis to bead beating using the BeadBug 6 for several concentrations of Mycobacterium tuberculosis roughly correlated to the bacterial load commonly seen in patient samples. turboLysis performed similarly to the BeadBug at low bacterial concentrations and outperformed it at high concentrations above 2x105 CFU/ml (p < 0.005). Thus, turboLysis offers good cell lytic performance in a small form factor at a low cost.

Keywords

Cell lysis
Tuberculosis
DNA extraction
RNA extraction
==== Body
pmcSpecifications tableHardware name	turboLysis	
Subject area	Biological sciences	
Hardware type	Biological sample handling and preparation	
Closest commercial analog	Benchmark Scientific BeadBug	
Open source license	CERN Open Hardware License	
Cost of hardware	$40	
Source file repository	https://doi.org/10.17632/93tj5gwh3j.2	

1 Hardware in context

Nucleic acid extraction from difficult-to-lyse cells is a common problem in both research and diagnostics. Methods such as bead beating and sonication are often used to achieve lysis. turboLysis is a novel mechanical cell lysis device that utilizes small beads to efficiently lyse cells like Mycobacterium tuberculosis (a bacteria and the etiological agent of tuberculosis), Saccharomyces cerevisiae (bakers yeast), and Arabidopsis thaliana (a model plant used in research). While novel, our approach resembles commercial bead beaters such as the Benchmark Scientific BeadBug and the MP Biomedicals devices[1], [2]. However, turboLysis costs only a fraction of these commercial devices (which cost upwards of $2000).

2 Hardware description

turboLysis consists of four main components (Fig. 1): 1) The 3D-printed body with four holes for cylindrical magnets; 2) A 3D-printed screw cap with an inserted bearing; 3) A 3D-printed baseplate with a mounted brushless DC motor; and 4) a servo tester and ESC (Electronic Speed Controller). Upon assembly, the servo tester and ESC controller initiate the motor operation and rotation of the tube ensconced between the motor and the bearing in the screw cap. As the tube rotates, steel beads within it respond to the alternating magnetic fields, resulting in collision and disruption of cells trapped between them. This mechanism mirrors bead beating devices, which vigorously oscillate tubes to facilitate disruption of cell walls through bead collision. However, traditional devices are large and costly, limiting accessibility. In contrast, turboLysis presents a compact and affordable alternative suitable for integration into diagnostic platforms necessitating efficient lysis of robust cells such as M. tuberculosis.• Efficient Cell Lysis: turboLysis offers a cost-effective solution to efficiently disrupt organisms with tough cell walls, facilitating downstream applications such as DNA/RNA extraction and protein analysis.

• Compact Design: turboLysis is small, making it suitable for laboratories with limited space or for field applications, enabling on-site sample processing in remote or resource-limited settings.

• Cost Efficiency: TurboLysis is affordable compared to traditional bead-beating devices.

• Versatile Integration: turboLysis is relatively small and can be integrated into automated diagnostic devices.

• Customizable Modifications: Users can customize turboLysis to optimize cell lysis protocols for different sample types. For example, adjusting motor speed will cause a change in the speed of bead collision, which can be slowed for samples of large cells, tissue homogenization, or isolation of sensitive proteins. The bead composition can also be altered. For example, larger beads (∼1mm) can be used to disrupt tissues, smaller beads (∼0.5 mm) for lysing plant cells, and tiny beads (∼0.2 mm) for lysing bacteria. Combinations of beads may also increase collisions or break up tissues and then lyse cells. Third, bead shape may also be varied, with non-spherical beads used for tissue shearing. Fourth, adjustments in processing times allow for fine-tuning of lysis protocols, with shorter times sufficient for easily disrupted samples and longer times for tougher materials.

Fig. 1 Visual representation of turboLysis loaded with a sample tube containing steel beads.

Future improvements

We added a smaller ring to the device's body to aid in tube positioning, which could be further improved by making a baseplate that the body cap combination can clip into. This would allow the user to load the tube in the tube holder and then snap the body in place, removing any difficulties associated with tube loading. We also plan to develop a second version in which coils will make an alternating magnetic field using a stepper motor driver. This will drive the beads in two directions, causing them to crash into each other and allow for the elimination of moving parts, increasing the durability and assimilability of the device while maintaining its efficacy (Fig. 2). We also wish to increase the throughput, possibly by extending the body shaft and allowing for the stacking of tubes (with connecting attachments between them). This may also allow the use of 15 ml tubes, which are often used to homogenize tissue samples using large beads.Fig. 2 turboLysis outperforms the BeadBug (the reference group and thus, having a mean relative quantification of 1 in each comparison) for the lysis of M. tuberculosis cells at concentrations ≥ 2x106 CFU/ml and performs similarly at concentrations below this as measured using qPCR (n = 9 in each group). P-values are shown for pairwise t-tests.

3 Design files summary

Design file name	File type	Open source license	Location of the file	
turbolysis_cap	STL	GPL3.0	https://data.mendeley.com/datasets/93tj5gwh3j/1
(tinyurl.com/turboLysisDataTemp)	
turbolysis_body	STL	GPL3.0	
turbolysis_basePlate	STL	GPL3.0	
turbolysis_tubeHolder_print	STL	GPL3.0	
turbolysis_tubeHolder_cnc	STL	GPL3.0	
turbolysis_body_v2	STL	GPL3.0	
turbolysis_basePlate_v2	STL	GPL3.0	
turboLysis_cap	STL	GPL3.0	
turboLysis_usage_v2	MP4	GPL3.0	youtu.be/KBNZWMhjK1s	
turbolysis_assembly	MP4	GPL3.0	youtu.be/SUm3GhwZ-oc	

turbolysis_cap

The screwcap of the device with a position for the bearing.

turbolysis_body

The device body. In this version, we added a smaller ring to tube positioning.

turbolysis_basePlate

The device base.

turbolysis_tubeHolder_print

A 3D printable version of the tube holder to connect to the motor.

turbolysis_tubeHolder_cnc

A machinable version of the tube holder to connect to the motor.

turboLysis_usage

A video showing the usage of turboLysis.

turbolysis_body_v2

An untested device body version for use with turbolysis_basePlate_v2 allowing for rapid tube loading.

turbolysis_basePlate_v2

An untested device base to be used with turbolysis_body_v2.

4 Bill of materials summary

Designator	Component	Number	Cost per unit −currency	Total cost −
currency	Source of materials	Material type	
Magnet	Neodymium Cylinder Magnet	4	$2.79	$11.16	https://tinyurl.com/turboLysisMAG	Metal	
Brushless DC motor	RC RS2205	1	$4.87	$4.87	https://tinyurl.com/turboLysisRC	Other	
ESC	DC 12 V XXD 30A ESC	1	$4.02	$4.02	https://tinyurl.com/turboLysisESC	Other	
Servo	Digital Servo Tester (D-type)	1	$3.50	$3.50	https://tinyurl.com/turboLysisServo	Other	
Ball bearing tube holder	F6701ZZ Flanged Ball Bearing	1	$8.49	$8.49	https://tinyurl.com/turboLysisBearing	Other	
DC jack	5Pcs Female DC jack	1	$1.82	$1.82	https://tinyurl.com/turboLysisJack	Other	

In addition, 3D printer resin or filament and epoxy or hot glue are needed.

5 Build instructions

3D print the CAD files turbolysis_cap, turbolysis_basePlate, turbolysis_body, and turbolysis_tubeHolder_print. We recommend using a resin printer (we used the AnyCubic Mono X), and using a clear resin so that the tube can be viewed during use. However, it is only essential that the tube holder is balanced as this is the only moving part. If it is not balanced on testing, use sandpaper to remove material from the sides until it is balanced and spins correctly on the motor. If you can access a CNC machine, cut the turbolysis_tubeHolder_cnc out of aluminium (e.g., Aluminium 6061) instead of printing the turbolysis_tubeHolder_print using a surface roughness of Ra3.2 and tolerances according to the “m” grade of ISO 2768 standard. Fig. 1 shows a representation of the assembled device and the Supplementary video (see TurboLysis_assembly video) describes the assembly process. It is assembled by placing the ball-bearing tube holder in the turbolysis_cap with the flange facing away from you and securing it with hot glue or epoxy. Using an M5 tap, thread the hole in the turbolysis_tubeHolder_cnc; alternatively, if a tap is not available, then gently and repeatedly screw and unscrew the motor onto the turbolysis_tubeHolder_print to form a secure threaded connection. Screw the turbolysis_tubeHolder_cnc onto the Brushless DC motor and place it on the turbolysis_basePlate, aligning the holes and using the screws provided with the motor to affix it in place. Take the four magnets and join them, and mark the one side with a felt tip pen. Place the first magnet in the turbolysis_body with the marking facing in and affix in place with hot glue or epoxy and wait for it to set, repeat with the remaining magnets, alternating the direction of the markings. Place the turbolysis_body on the baseplate and secure in place with hot glue or epoxy. Plug the banana plugs on the motor to the ESC in any order, and attach the power lines to the DC jack. Plug the ESC to the Servo as shown in Fig. 1. Supply 12 V DC and test the motor spins without issue.

6 Operation instructions

Fill a 1.5 ml screw cap tube equipped with an o-ring with ∼300 mg of 0.2 mm steel beads and 3–5, 2 mm steel beads (see Turbolysis_usage video). Add 500 μl of sample to the tube and secure the cap. Place the turboLysis on a flat surface and plug 12 V DC into the connection jack. Place the tube, containing the beads and sample, in the body of the turboLysis and screw the top on gently until a little resistance is felt. (Placing and removing the tube can be aided by using forceps). Slowly turn the servo to start the motor. Once it starts, confirm the screw cap is fixed in place, and then turn the servo up to a value of 1250 (50 ms pulse width). After 3 min, turn off the servo and remove the tube.

There are possible safety hazards when operating turboLysis. First, aerosols may be generated due to the high-speed spinning, which could be infectious depending on the sample type used. Follow all government and institutional guidelines when working with hazardous sample types. Second, if the tube is not secured correctly, the tube holder may spin while the tube stays in place. This could cause friction to melt the tube and the contents to leak out. Using clear resin to allow viewing of the tube during operation can help mitigate this.

7 Validation and characterization

Tuberculosis is a significant public health concern, causing ∼1.3 million deaths annually[3]. Rapid diagnosis of tuberculosis and drug resistance is crucial to reduce morbidity and mortality and prevent transmission. However, M. tuberculosis has a tough, complex cell wall that provides protection against chemicals and makes it difficult to lyse. Lysis of M. tuberculosis for DNA extraction in the literature is varied, but bead-beating with 0.1 mm zirconium beads is commonly employed [4], [5], [6]. In our laboratory, we routinely perform bead-beating in 1.5 ml screw cap tubes containing ∼0.5 g, 0.1 mm zirconium beads, and ∼500 μl of sample in a buffer. The bead-beating is done on a BeadBug 6 (Benchmark Scientific, USA) at 4350 RPM (max speed) for two rounds of 1 min with 5 min rest between rounds. Thus, we compared turboLysis to the BeadBug 6 for several concentrations of M. tuberculosis (roughly correlated to the bacterial load commonly seen in patient samples) in triplicate. Bacteria were suspended in PBS and 500 μl aliquoted per tube. We evaluated the relative quantities of DNA per sample using a TaqMan qPCR for atpE (Forward primer: GTAACGCGCTTATCTCCGGT, Reverse primer: AGTATGCCGCCTCAACCAAA, probe: CAACCCGAGGCGCAAGGGC) in triplicate. The relative quantities were calculated by setting the reference group as the BeadBug 6 samples and using the formula Relative Quantification (RQ) = 2^(−ΔΔCt) where ΔΔCt = ΔCt(test samples) − ΔCt(reference samples) and ΔCt = Ct(target gene) − Ct(reference gene). Differences between the groups were calculated using pairwise t-tests.

First, we assessed whether the difference in beads (zirconium versus steel) affected the DNA concentration by performing bead beating using the BeadBug with both bead types. We found no difference (relative quantity = 1.18, p = 0.48). We then compared turboLysis to the BeadBug and found that they performed similarly on the samples with bacteria less than 2x106 CFU/ml, but the turboLysis outperformed the BeadBug on higher concentrations (Fig. 2).

Capabilities of turboLysis • Similar performance to commercial devices when used to lyse M. tuberculosis.

• Rapid lysis time and continuous usage.

• Possible to use battery power.

Limitations of turboLysis • Low throughput, limited to one tube at a time.

• Limited to 1.5 ml screw cap tubes.

The turboLysis offers good cell lysis performance in a small form factor and is a cheap alternative to commercial bead beating devices.

CRediT authorship contribution statement

Jason D. Limberis: Writing – review & editing, Writing – original draft, Visualization, Methodology, Investigation, Formal analysis, Conceptualization. John Z. Metcalfe: Writing – review & editing, Supervision, Funding acquisition.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Jason D. Limbers: My research focuses on the causative agent of tuberculosis, Mycobacterium tuberculosis. I apply a combination of wet work and bioinformatics to investigate genomic and transcriptional associates of drug resistance, clinical outcomes, and patient infectiousness. See www.SemiQuant.com for more information.

John Z. Metcalfe: My research focuses on fundamental questions in the tracking and early identification of drug-resistant tuberculosis (DR-TB) to better target and evaluate control interventions. Because of my commitment to working with critically underserved populations, I have been attracted to global health projects with strong programmatic relevance throughout my career, and I have experience conducting prospective studies in challenging environments.

Appendix A Supplementary data

The following are the Supplementary data to this article:Supplementary video 1

Supplementary video 2

Acknowledgments

Funding: This work was supported by the 10.13039/100000060 National Institute of Allergy and Infectious Diseases [R01AI177637 ].

Appendix A Supplementary data to this article can be found online at https://doi.org/10.1016/j.ohx.2024.e00576.
==== Refs
References

1 FastPrep-24TM Classic Instrument | MP Biomedicals. [cited 14 Apr 2024]. Available: https://www.mpbio.com/us/fastprep-24-classic-instrument-1-each.
2 D1036 - Benchmark Scientific, Inc. [cited 14 Apr 2024]. Available: https://www.benchmarkscientific.com/product/d1036/.
3 WHO. Global tuberculosis report 2027 November 2022023; 75. Available: https://www.who.int/publications/i/item/9789240083851.
4 George S. Xu Y. Rodger G. Morgan M. Sanderson N. Hoosdally S. DNA thermo-protection facilitates whole genome sequencing of mycobacteria direct from clinical samples by the nanopore platform bioRxiv 2020 10.1101/2020.04.05.026864
5 Doyle R.M. Burgess C. Williams R. Gorton R. Booth H. Brown J. Direct whole-genome sequencing of sputum accurately identifies drug-resistant mycobacterium tuberculosis faster than MGIT culture sequencing J. Clin. Microbiol. 2018 56 10.1128/JCM.00666-18
6 Käser M. Ruf M.T. Hauser J. Marsollier L. Pluschke G. Optimized method for preparation of DNA from pathogenic and environmental mycobacteria Appl. Environ. Microbiol. 75 2009 414 418 10.1128/AEM.01358-08 19047396
