
==== Front
Poult Sci
Poult Sci
Poultry Science
0032-5791
1525-3171
Elsevier

S0032-5791(24)00812-5
10.1016/j.psj.2024.104233
104233
PHYSIOLOGY AND REPRODUCTION
Developmental variations of the reproductive organs of ganders from different goose breeds and the underlying mechanisms
Yan Haoyu *†‡1
Chen Jiasen *†‡1
Qing Enhua *†‡1
Li Xiaopeng *†‡
Wang Wanxia §
Ling Zihan *†‡
Chen Zhengyang *†‡
Jiang Shuhan *†‡
Yan Yue *†‡
Deng Shilin *†‡
Hu Jiwei *†‡
Li Liang *†‡
Wang Jiwen *†‡
Hu Shenqiang shenqiang.hu@sicau.edu.cn
*†‡2
⁎ State Key Laboratory of Swine and Poultry Breeding Industry, College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130, China
† Key Laboratory of Livestock and Poultry Multi-omics Ministry of Agriculture and Rural Affair, College of Animal Science and Technology, Sichuan Agricultural University, Chengdu 611130, China
‡ Farm Animal Genetic Resources Exploration and Innovation Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, China
§ Department of Animal Production, General Station of Animal Husbandry of Sichuan Province, Chengdu 610041, China
2 Corresponding author: shenqiang.hu@sicau.edu.cn
1 These authors have contributed equally to this study.

17 8 2024
11 2024
17 8 2024
103 11 10423331 5 2024
13 8 2024
© 2024 The Authors
2024
https://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
A deep understanding of the dynamics and mechanisms of male reproductive tract development is necessary for adoption of either genetic techniques or environmental management practices for improving fertility and hatchability in poultry. However, compared with other poultry such as chickens and ducks, less is known about the age- and breed-related changes in the reproductive tract development of domestic goose ganders exhibiting relatively poor reproductive performance as well as the regulatory mechanisms. In the present study, by taking 2 Chinese domestic goose breeds (Sichuan White goose, SW and Gang goose, GE; Anser cygnoides) and one European goose breed (Landes goose, LD; Anser anser) as the experimental objects, we comprehensive analyzed the morphological, histological, and genome-wide transcriptomic variations in their testicular and external genital development during the period from hatching to sexual maturity. Results from histomorphological analysis demonstrated that the reproductive tract of all goose breeds developed in both age- and breed-dependent manners, and the left and right testis developed asymmetrically throughout posthatch development. The tenth week posthatch was a critical developmental stage for all goose ganders, because both the testicular and external genital histomorphological parameters significantly changed before and after this period. During the first 10 wk posthatch, the weight, organ index, or size of male reproductive organs developed more rapidly in SW than in LD, and so were the testicular parenchymal-to-interstitial ratio and the external genital lymphatic lumen diameter. However, the testicular seminiferous epithelium thickness, seminiferous tubule diameter, and Leydig cell number, as well as the external genital keratinized epithelium thickness were significantly higher in LD than in SW at 10 wk of age. Through comparative transcriptomics analysis and RT-qPCR validation, several pathways related to germ and somatic cell function, organ remodeling, and energy metabolism were thought to be responsible for the developmental variations in the early testicular development between Chinese and European domestic ganders, where 10 hub genes involved in the cell cycle, RNA polymerase II-dependent transcription, and mitotic cell division pathways might play essential roles. These data shed new light on the interbreed differences in the male goose reproductive tract development and the molecular mechanisms regulating male goose testicular functions and fertility.

Key words

male goose
reproductive organ
developmental dynamics
histomorphology
transcriptomic analysis
==== Body
pmcINTRODUCTION

The reproductive tract of male poultry is basically composed of testis, epididymis, vas deferens, and external genitalia. The paramount biological actions of the testis are to secrete sex steroid hormones and produce spermatozoa that are competent to fertilize the oocytes, while the external genitalia primarily functions as an intromittent organ to deliver spermatozoa to the female reproductive tract for internal fertilization (Vizcarra, et al., 2022). In male poultry, the testicular development directly affects the sexual desire, semen quality, and the ontogeny of external genitalia (Vizcarra, et al., 2010; Hanafy, et al., 2016; Estermann, et al., 2021). A recent study showed that the duck testicular weight was strongly associated with its sexual behavior, and in general, the ducks with heavier testes displayed stronger sexual desire (Indriastuti, et al., 2022). Also, it has been reported that the plasma levels of testosterone secreted by the goose testes were positively correlated with the growth of external genitals (Sun, et al., 2018). Hence, a thorough understanding of the developmental dynamics of both testis and external genitalia is of great importance for the improvement of reproductive efficiency in male poultry, especially under the current situations in the face of increasing demands for global environmental protection and efficient poultry production, where artificial insemination has been extensively applied in poultry breeding and production (Mohan, et al., 2018; Wang, et al., 2024).

Although all birds reproduce via internal fertilization, there are dramatic variations in the size, shape, anatomic, and histological structures of the external genitalia among different poultry species (Herrera, et al., 2015). For instance, the external genitalia of chicken has evolutionarily degenerated as a nonintromittent phallic protuberance but is biologically functional, whereas those of waterfowl (e.g., duck and goose) are relatively developed and capable of insertion during copulation (Herrera, et al., 2013). Moreover, several lines of evidence indicated that there were also intra- and interbreed variations during the male reproductive tract development within the same poultry species (Faure, et al., 2017; Tesfay, et al., 2020; Ouyang, et al., 2021; Wang, et al., 2023). However, compared with chickens and ducks, less is known about the age- and breed-related changes in the testis and external genitalia of goose ganders during posthatch development as well as the underlying mechanisms.

Until now, only a few studies have reported that variations also occurred in the male goose reproductive tract development between different breeds or within the same breed. By analyzing the testicular histological characteristics and genome-wide transcriptomic expression patterns of adult ganders between Chinese and European domestic geese, it was revealed that the testicular organ index, semen volume, and long diameter of seminiferous tubules were significantly different in a breed-dependent manner, and the inositol phosphate signaling pathway could be responsible for these breed-related differences (Ran, et al., 2021). Another study reported that within the same goose population, significant differences were observed in the external genital morphological parameters of adult ganders, which seemed to be positively correlated with both body weights and plasma testosterone levels, and 17α-hydroxylase/17, 20-lyase (CYP17) was identified as a crucial gene in regulating goose external genital development (Sun, et al., 2018). Moreover, by comparing the transcriptomic profiles of the hypothalamic-pituitary-testicular-external genital axis of adult ganders exhibiting normal and abnormal external genitals, it was found that the neuroactive ligand-receptor interaction and WNT signaling pathways coregulated the goose external genitalia development through phospholipase C beta 1 (PLCB1) (Tang, et al., 2022). Nevertheless, it remains largely unknown about the developmental variations in the reproductive organs of goose ganders from different breeds during ontogenesis, especially during early posthatchings stages, as well as the underlying molecular mechanisms.

China is the largest goose producer and consumer in the world, and the goose industry is of great socio and economic values in Chinese agriculture. Considering that both the 2 Chinese indigenous goose breeds (Sichuan White goose, SW and Gang goose, GE) that originate from swan goose (Anser cygnoides) and one imported European goose breed (Landes goose, LD) that originate from graylag goose (Anser anser) have been extensively raised in China due to their excellent production performance and significant economic values, the objectives of this study were to systematically analyze and compare the morphological and histological changes in both testes and external genitals of ganders from these 3 goose breeds during the period from hatching to sexual maturity as well as the underlying mechanisms. These results would shed new light on the interbreed differences in the male goose reproductive tract development and the identification of key genes and pathways responsible for male goose reproductive functions.

MATERIALS AND METHODS

Ethics Statement

All experimental procedures involving the manipulation of geese in this study were conducted in concordance with the “Guidelines for Experimental Animals” of the Ministry of Science and Technology (Beijing, China). The animal use protocol has been reviewed and approved by the Sichuan Agricultural University Animal Ethical and Welfare Committee (Approval No: 20190035).

Experiment Animals and Sample Collection

All experimental goose ganders of SW, GE, and LD were provided by the Waterfowl Breeding Experimental Farm of Sichuan Agricultural University (Ya'an, Sichuan, China). A total of 100 healthy 0-day-old male geese from each breed were hatched at the same batch and raised under the same environmental and feeding conditions. At 0, 6, 10, and 30 wk of age, there were 10 individuals randomly selected from each goose breed for sample collection, respectively. By recording the live body weight after a 12-h fasting, they were euthanized by inhaling carbon dioxide, followed by cervical dislocation. After slaughter, both the bilateral testes and the external genitalia were weighed, measured, and photographed to reveal their morphological characteristics. The reproductive organ index was calculated using the following formula: reproductive organ index (%) = (reproductive organ weight (g)/body weight [kg]) × 100%. The long, short, and dorsoventral diameters of both left and right testis as well as the natural length and basal diameter of external genitalia were also measured. Then, at each sampling time point, both the left testes and the external genitals from 5 individuals per goose breed were used for histological examination, while the left testes (n = 3 per breed) sampled from the other 3 individuals from SW, GE, and LD at 10 wk of age, respectively, were rapidly frozen in liquid nitrogen and stored at -80°C until RNA extraction. A list of abbreviations is described in Supplementary Table 1.

Histological Observation

The freshly-collected goose testes and external genitals were firstly fixed with 4% formaldehyde at room temperature for 72 h, then dehydrated through a series of different concentrations of ethanol, and finally transferred to xylene and embedded in paraffin wax. After being cut into about 5 µm thick slices, they were stained with hematoxylin and eosin (H&E). The H&E-stained slices were observed and photographed under a digital trinocular camera microscope BA410-Digital (Motic China Group Co. Ltd., Xiamen, China). The testicular and external genital histological parameters were measured using Image-Pro Plus 6.0 software (National Institutes of Health, Bethesda, MD, USA), including the testicular parenchymal area, the testicular parenchymal-to-interstitial ratio, the thickness of seminiferous epithelium, the diameter of seminiferous tubules, the number of Sertoli cells, the number of spermatogonium, and the number and density of Leydig cells, as well as the thickness of keratinized epithelium and outer collagen and the diameter of lymphatic lumen of external genitalia. Each testicular and external genital histological parameter was calculated as the mean of the observations of all examined individuals per sampling time point per goose breed.

RNA Extraction, Library Construction, and Sequencing

Total RNA was extracted from the 6 left testes (n = 3 per breed) of SW and LD at 10 wk of age using Trizol reagent (Invitrogen, Carlsbad, CA), respectively, and treated with DNase I (Invitrogen, Carlsbad, CA) following the manufacturer's instruction. The RNA concentration and integrity were assessed using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA) and Agilent 2100 Bioanalyzer system (Agilent Technologies, Palo Alto, CA). The RNA-Seq libraries were prepared using the Illumina TruSeq mRNA Sample Preparation Kit (Illumina, San Diego, CA) following the manufacture's instruction and sequenced on an Illumina NovaSeq 6000 platform in PE150 mode. The sequencing data for this study have been deposited into the Sequence Read Archive (https://www.ncbi.nlm.nih.gov/sra) on the NCBI web server, with the BioProject ID: PRJNA1078596 and SRA Accession Number: SRR28040021 - 28040026.

Transcriptomic Bioinformatics Analysis

The raw reads of RNA-Seq were quality-controlled using FastQC v0.11.9 software. After removing the adaptor reads, reads with > 5% ambiguous bases, and low-quality reads, the clean reads were obtained and mapped to our recently assembled reference-grade genome of SW using the HISAT2 v2.2.1 software (Kim, et al., 2015). The output sequencing alignment/mapping (SAM) file was then converted into the binary alignment/mapping (BAM) file and sorted using SAMtools v1.6.0 (Li, et al., 2009). Subsequently, the relative expression of each transcript was calculated using featureCounts v1.6.0 (Liao, et al., 2014). The DESeq2 R package (v1.40.2) was used to identify differentially expressed genes (DEG) between different groups, with the criteria of |log2Foldchange| > 1 and adjusted P- value <0.05 (Love, et al., 2014). Both the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) enrichment analyses were performed using KOBAS v3.0 (Bu, et al., 2021). The protein-protein interaction (PPI) networks of those screened DEGs were analyzed using the STRING v10 database (Szklarczyk, et al., 2023), and the Cytoscape v3.10.1 software was used to visualize the PPI networks (Shannon, et al., 2003).

Quantitative Real-Time Reverse Transcription PCR Validation

Equal amount of total RNA extracted from each sample was reversely transcribed into the cDNA using the HiScript® RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China) following the manufacturer's instruction. Reactions of quantitative real-time reverse transcription PCR (RT-qPCR) were performed on the Bio-Rad CFX96 real-time PCR Detection System (Bio-Rad, Hercules, CA, USA). The RT-qPCR reaction system was performed in a total volume of 20 μL, containing 10 μL of 2 × ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China), 0.4 μL of each primer, 2 μL of cDNA, and 7.2 μL of ddH2O. The RT-qPCR amplification conditions were listed as follows: predenaturation at 95°C for 30 s; followed by 40 cycles of 95°C for 10 s and annealing/extension at the corresponding temperature of each primer set for 30 s. The target specificity of each primer set was evaluated using melting curve analysis, and the identity of all amplicons was verified by sequencing. The no-template controls and negative controls without reverse transcriptase were also included in all RT-qPCR runs. Each sample was run in triplicate. The relative expression levels of target genes were normalized to the 2 housekeeping genes GAPDH and β-ACTIN using the 2−ΔΔCT method (Livak and Schmittgen, 2001). The primers designed for RT-qPCR are listed in Table 1.Table 1 The primer pairs used for quantitative real-time PCR analysis.

Table 1Gene	Forward primer (5′→3′)	Reverse primer (5′→3′)	Size (bp)	Tm (°C)	
CCNA2	ACGGATGACACCTACAACAAG	CAGCGATAACTGACGGCAAG	223	59	
AURKA	GTGGGACACTTGACTACTTGC	TCCGATGGAATGGGTTATGC	246	58	
FOXM1	GTGAAGCAAGATACGGAGAAA	GGAAGAGGAGGTAGGAATGG	99	56	
CDC20	CCAGCAGGAAGAACGGTAGA	AGATAGACGGAGTTGTCCAGAG	145	59	
TOP2A	AGGTGGGCGAAATGGTTAT	TGTCTGTCCAGGTCTGCTTG	113	58	
MELK	CTACAGGTGGACCCAAAGAA	TGGTTGTGAAACACGGAAAG	158	57	
CDK1	TGCTCGTTACTCTACTCCCG	GTTTCCAGGCTGCCAGGTTT	219	60	
BUB1	AGGCAACGCCATTCAAAGTC	AGTCAGTCAAGGGACGTTGT	306	60	
BUB1B	TATGCCACAGTCATGGGCAG	GGACGCCTTCCACAATTCCA	87	59	
*GAPDH	AGCAACATCAAGTGGGCAGA	CACCCATCACGAACATGGGA	157	60	
*β-ACTIN	TGACAATGGCTCCGGTATGT	ACCATCACACCCTGATGTCTG	105	59	
The asterisk indicates 2 housekeeping genes.

Statistical Analysis

The morphological and histological results were expressed as the mean ± SEM, and the SAS 9.4 software (SAS Institute Inc, North Carolina) was used for subsequent statistical analysis. Data were analyzed by 2-way analysis of variance (ANOVA), with week of age and breed as the fixed factors. When a significant effect was observed, the posthoc Duncan's multiple range test was used to assess significant differences between different weeks of age or breeds. A probability (P) value less than 0.01 was considered statistically extremely significant different, while a P-value less than 0.05 was considered significant different. Finally, both GraphPad Prism v8.0 software (San Diego, CA) and R 4.2.1 software were used to draw the figures.

RESULTS

Developmental Variations in Morphology of the Reproductive Organs of Ganders from 3 Goose Breeds

As shown in Figure 1A and B, the size and weight of both testes and external genitals of ganders from 3 goose breeds (SW, GE, and LD) increased during the posthatch period from 0 to 30 wk of age. Meanwhile, the left testis of ganders appeared to be larger in size than the right one throughout posthatch development in all 3 goose breeds, being more pronounced with increasing age. Statistically, both the weight (Figure 2A-D) and organ index (Figure 2E-H) of left, right, and bilateral testes as well as external genitalia were significantly higher at wk 30 than at the other weeks in all 3 goose breeds (P < 0.05); however, during the first 10 posthatch weeks, there were no significant differences (P > 0.05) in these indexes between different weeks for each goose breed, although their testicular and external genital organ indexes showed a decreasing tendency. Similarly, the long, short, and dorsoventral diameters of left and right testis were significantly higher at wk 30 than at the other weeks in SW, GE, and LD (P < 0.05). Compared to wk 0, the long and short diameters of left and right testis were significantly higher at wk 6 or 10 in SW, GE, and LD (Supplementary Figure 1A-F; P < 0.05). As shown in Supplementary Figure 1G-H, there also observed significant differences in the natural length in all 3 goose breeds and basal diameter of external genitalia in GE and LD between wk 10 and wk 30 (P < 0.05), being larger at wk 30.Figure 1 Morphological observation of the testes (A) and external genitals (B) of ganders from 3 goose breeds during posthatch development. SW, Sichuan White goose. GE, Gang goose. LD, Landes goose. L, Left. R, Right. W, Week of age.

Figure 1

Figure 2 Dynamic changes in morphology of the reproductive organs of ganders from 3 goose breeds during posthatch development. (A) Left testicular weight. (B) Right testicular weight. (C) Bilateral testicular weight. (D) External genital weight. (E) Left testicular organ index. (F) Right testicular organ index. (G) Bilateral testicular organ index. (H) External genital organ index. Different lowercase letters indicate significant differences across weeks in the same breed at P < 0.05. “*” indicates significant differences between the 2 designated groups at the level of P < 0.05, and “**” indicates extremely significant differences between the 2 designated groups at the level of P < 0.01. SW, Sichuan White goose. GE, Gang goose. LD, Landes goose. W, Week of age.

Figure 2

As for the breed-related differences, at 0 wk of age, both the weight (Figure 2A-C) and organ index (Figure 2E-G) of left, right, and bilateral testes were significantly higher (P < 0.05) in Chinse domestic goose breeds (SW or GE) than in European domestic goose breed (LD), while only the external genital weight of SW was significantly higher than that of LD (Figure 2D). Also, the right testicular long diameter, the short diameter of left and right testis (Supplementary Figure 1B-D), and the right testicular dorsoventral diameter (Supplementary Figure 1F) were significantly higher (P < 0.05) in SW or GE than in LD. At 6 wk of age, both the weight (Figure 2B-C) and organ index (Figure 2F-G) of right and bilateral testes were significantly higher (P < 0.05) in SW or GE than in LD, and so was the external genital organ index (P < 0.01; Figure 2H). Although the testicular dorsoventral diameter of SW or GE was significantly higher than that of LD (Supplementary Figure 1E-F; P < 0.05), the testicular long diameter was significantly higher in LD than in SW or GE (Supplementary Figure 1A-B; P < 0.05). At 10 wk of age, both the weight (Figure 2A-D) and organ index (Figure 2E-H) of left, right, and bilateral testes as well as external genitalia were significantly higher (P < 0.05) in SW and GE than in LD. The right testicular long diameter, the short diameter of left and right testis, and the dorsoventral diameter of left and right testis were significantly higher in SW and GE than in LD (Supplementary Figure 1B–F; P < 0.05). Moreover, the natural length and basal diameter of external genitalia were significantly higher in SW than in LD (Supplementary Figure 1G–H, P < 0.01). At 30 wk of age, there were no significant differences (P > 0.05) in both the weight (Figure 2A–D) and organ index (Figure 2E-H) of left, right, and bilateral testes as well as external genitalia between SW and LD, but the weights of left and bilateral testes were significantly higher (P < 0.05) in GE than in SW or LD, and so was the organ index of bilateral testes (P < 0.05). As shown in Supplementary Figure 1A–E, the testicular long and short diameters of SW were significantly lower (P < 0.05) than those of GE or LD, while the left testicular dorsoventral diameter of GE were significantly higher than that of SW and LD (P < 0.05).

Developmental Variations in Histology of the Reproductive Organs of Ganders from 3 Goose Breeds

Next, the age-dependent changes in both testicular and external genital histological characteristics of 3 goose breeds (SW, GE, and LD) were analyzed. As shown in Figure 3A, during the posthatch period from 0 to 30 wk of age, the goose testes were mainly composed of 2 parts: parenchyma and interstitium. It was observed that the testicular parenchymal area increased gradually throughout posthatch development and the testicular parenchymal-to-interstitial ratio seemed to increase with increasing age in all 3 goose breeds. Also, the thickness of seminiferous epithelium and the diameter of seminiferous tubule increased remarkably during goose testicular development. Although the spermatogonia, Sertoli cells, and Leydig cells have been present in the goose testis since wk 0, we observed the spermatids and spermatozoa in the testes of SW, GE, and LD only at wk 30, when the ganders reached sexual maturation. Moreover, the diameter and number of these cells changed in an age-dependent manner. As shown in Figure 3B, the goose external genitals were histologically characterized by several key components, including keratinized epithelium, outer collagen, and lymphatic lumen. As the age increased, the lymphatic lumen of external genitalia became more apparent, and the keratinized epithelium andouter collagen differed largely in size, thickness, and volume.Figure 3 Histological observation of the testes (A) and external genitals (B) of ganders from 3 goose breeds during posthatch development. ST, Seminiferous tubule. SC, Sertoli cells. SM, Spermatogonium. LC, Leydig cells. SD, Spermatids. SA, Spermatozoa. KE, Keratinized epithelium. OC, Outer collagen. LL, Lymphatic lumen. SW, Sichuan White goose. GE, Gang goose. LD, Landes goose. W, Week of age.

Figure 3

Statistically, as shown in Figure 4, the testicular parenchymal area, the parenchymal-to-interstitial ratio, the thickness of seminiferous epithelium, the diameter of seminiferous tubules, and the number of Sertoli cells and spermatogonia were significantly higher at wk 30 than at the other weeks in almost all 3 goose breeds (P < 0.05), while the number and density of Leydig cells significantly decreased as the age increased, reaching the lowest levels at wk 30 in SW, GE, and LD (P < 0.05). During the first 10 posthatch weeks, there were no significant differences (P > 0.05) in the testicular parenchymal area, the parenchymal-to-interstitial ratio, the thickness of seminiferous epithelium, and the number of Sertoli cells between different weeks for each goose breed. By contrast, the diameter of seminiferous tubules of SW was significantly lower (P < 0.05) at wk 6 and 10 than at wk 0, while the number of spermatogonia of SW was significantly higher at wk 10 than at wk 0 (P < 0.05). As shown in Figure 5, the thickness of keratinized epithelium of external genitalia showed a tendency of increasing early and decreasing later during posthatch development in SW, GE, and LD, reaching the highest levels at wk 6 or wk 10 depending on the breed. The diameter of lymphatic lumen and the thickness of outer collagen increased gradually with increasing age in SW, GE, and LD, with significant higher levels at wk 30 (P < 0.05); however, no significant differences were observed during the first 10 posthatch weeks (P > 0.05).Figure 4 Dynamic changes in histology of the testes of ganders from 3 goose breeds. (A) Testicular parenchymal area. (B) Testicular parenchymal-to-interstitial ratio. (C) Seminiferous epithelium thickness. (D) Seminiferous tubule diameter. (E) Sertoli cell number. (F) Spermatogonium number. (G) Leydig cell number. (H) Leydig cell density. Different lowercase letters indicate significant differences across weeks in the same breed at P < 0.05. “*” indicates significant differences between the 2 designated groups at the level of P < 0.05, and “**” indicates extremely significant differences between the 2 designated groups at the level of P < 0.01. SW, Sichuan White goose. GE, Gang goose. LD, Landes goose. W, Week of age.

Figure 4

Figure 5 Dynamic changes in histology of the external genitals of ganders from 3 goose breeds. (A) Keratinized epithelium thickness. (B) Lymphatic lumen diameter. (C) Outer collagen thickness. Different lowercase letters indicate significant differences across weeks in the same breed at P < 0.05. “*” indicates significant differences between the 2 designated groups at the level of P < 0.05, and “**” indicates extremely significant differences between the 2 designated groups at the level of P < 0.01. SW, Sichuan White goose. GE, Gang goose. LD, Landes goose. W, Week of age.

Figure 5

As for the breed-related differences, as shown in Figure 4, at 0 wk of age, the testicular parenchymal area, the parenchymal-to-interstitial ratio, the thickness of seminiferous epithelium, the number of Sertoli cells, and the density of Leydig cells were significantly lower in SW or GE than in LD (P < 0.05), while the number of Leydig cells was significantly higher in SW than in GE and LD (P < 0.01). Also, the thickness of keratinized epithelium of external genitalia was significantly higher in SW and GE than in LD (P < 0.05), while the diameter of lymphatic lumen and the thickness of outer collagen were significantly higher in GE than in SW and LD (Figure 5; P < 0.01). At 6 wk of age, the testicular parenchymal area and the parenchymal-to-interstitial ratio of SW were significantly higher than those of GE and LD (P < 0.01), whereas the thickness of seminiferous epithelium, the diameter of seminiferous tubule, and the number of spermatogonium were significantly higher in LD than in SW and GE (Figure 4; P < 0.05). Also, the thickness of keratinized epithelium, the diameter of lymphatic lumen, and the thickness of outer collagen of external genitalia were significantly higher in LD than in SW or GE (Figure 5; P < 0.05). At 10 wk of age, the testicular parenchymal area and the parenchymal-to-interstitial ratio of SW were significantly higher than those of GE and LD (P < 0.01), while the thickness of seminiferous epithelium, the diameter of seminiferous tubule, the number and density of Leydig cells were significantly higher in LD than in SW (Figure 4; P < 0.05). The thickness of keratinized epithelium was significantly higher in LD than in SW, but the diameter of lymphatic lumen was significantly higher in SW than in LD (Figure 5; P < 0.05). At 30 wk of age, the thickness of seminiferous epithelium and the diameter of seminiferous tubule were significantly higher in LD than in SW (P < 0.01), while the number and density of Leydig cells were significantly higher in SW than in LD (Figure 4; P < 0.01). Also, the thickness of external genital keratinized epithelium was significantly higher in LD than in GE (Figure 5; P < 0.05).

Identification of the Testicular DEGs between SW and LD

The above results from both morphological and histological analyses demonstrated that the reproductive tract of all 3 goose breeds developed in both age- and breed-dependent manners, and the tenth week posthatch was a critical developmental stage for all goose ganders, as manifested by the significant changes in both their testicular and external genital histomorphological parameters before and after this period. Besides, the reproductive organ weight and index as well as the testicular parenchymal-to-interstitial ratio and the external genital lymphatic lumen diameter developed more rapidly in SW than in LD, while the testicular seminiferous epithelium thickness, seminiferous tubule diameter, and Leydig cell number, as well as the external genital keratinized epithelium thickness were significantly higher in LD than in SW at 10 wk of age. In this context, the left testes collected from SW and LD at 10 wk of age were used for transcriptomic analysis to further explore the molecular mechanisms regulating early posthatch development of the goose testis. As shown in Supplementary Table 2, a total of 143,028,184 raw reads were obtained from these 6 samples, and an average of 23,835,273 clean reads were obtained from each sample. Meanwhile, the Q20 and Q30 values ranged from 98.06 to 98.36 and from 93.82 to 94.83, respectively, and the average mapping rate of all samples was 91.5%. Moreover, our results from principal component analysis showed that these 6 testicular samples were clustered together according to the goose breed (Supplementary Figure 2). These data collectively demonstrated the high quality and biological repeatability of our sequencing data, which can be used for subsequent bioinformatic analysis. By comparing the testicular transcriptomes of SW and LD, a total of 1,346 DEGs, including 652 upregulated- and 694 downregulated genes, were successfully identified in the testes of SW (Figure 6A). The hierarchical clustering analysis of these identified DEGs unequivocally confirmed their differential expression patterns in the testes between SW and LD at 10 wk of age (Figure 6B).Figure 6 Volcano plot (A) and hierarchical clustering analysis (B) of the differentially expressed genes (DEGs) identified in the testes between Sichuan White goose (SW) and Landes goose (LD) at 10 wk of age. Up, Upregulated genes in SW vs. LD. Down, Downregulated genes in SW vs. LD. S10GW1-3 represents the left testis collected from the biological replicate 1-3 among SW at 10 wk of age, respectively. L10GW1-3 represents the left testis collected from the biological replicate 1-3 among LD at 10 wk of age, respectively.

Figure 6

Functional Enrichment Analysis of the Testicular DEG

Then, we performed GO enrichment analysis for the DEGs identified in the goose testes. As shown in Figure 7A, the top 10 GO biological process (BP) terms significantly enriched by these testicular DEGs included positive regulation of transcription by RNA polymerase II, neuron differentiation, cell differentiation, negative regulation of transcription by RNA polymerase II, animal organ morphogenesis, axon guidance, male gonad development, multicellular organism development, inner ear morphogenesis, and cell fate commitment. The top 10 significantly enriched GO cellular component (CC) terms included extracellular space, plasma membrane, basement membrane, nucleus, cell surface, collagen-containing extracellular matrix, axon, perinuclear region of cytoplasm, voltage-gated potassium channel complex, and GABA-ergic synapse. The top 10 significantly enriched GO molecular function (MF) terms included calcium ion binding, RNA polymerase II transcription regulatory region sequence-specific DNA binding, DNA-binding transcription factor activity, RNA polymerase II-specific, extracellular matrix structural constituent, identical protein binding, integrin binding, copper ion binding, DNA-binding transcription repressor activity, RNA polymerase II-specific, DNA-binding transcription activator activity, RNA polymerase II-specific, and voltage-gated potassium channel activity.Figure 7 The top 10 GO terms (A) and top 20 KEGG pathways (B) significantly enriched by the testicular DEGs between Sichuan White goose and Landes goose at 10 wk of age. BP, Biological process. CC, Cellular component. MF, Molecular function.

Figure 7

The KEGG enrichment analysis was also performed on the DEGs identified in the goose testes. As shown in Figure 7B, the top 20 significantly enriched KEGG pathways included progesterone-mediated oocyte maturation, oocyte meiosis, melanogenesis, ECM-receptor interaction, calcium signaling pathway, focal adhesion, cell cycle, neuroactive ligand-receptor interaction, WNT signaling pathway, intestinal immune network for IgA production, gap junction, apelin signaling pathway, steroid biosynthesis, cellular senescence, vascular smooth muscle contraction, cell adhesion molecules (CAM), MAPK signaling pathway, starch and sucrose metabolism, GnRH signaling pathway, and glycerolipid metabolism.

PPI Analysis of the Testicular DEGs

To further identify the key genes responsible for early posthatch development of the goose testis, we performed PPI network analysis for the testicular DEGs significantly enriched in either the top 10 GO terms of each category (Figure 7A) or top 20 KEGG pathways (Figure 7B). As depicted in Figure 8A, this network displayed the complex interactions among these testicular DEGs, and the DEGs within nodes with darker color and bigger size might play more important roles. Furthermore, by using the CytoHubba plugin in Cytoscape, the top 10 hub DEGs were screened from the PPI network depicted in Figure 8B, and they were Cyclin A2 (CCNA2), Aurora kinase A (AURKA), Forkhead box protein M1 (FOXM1), BUB1 mitotic checkpoint serine/threonine kinase B (BUB1B), Cell division cycle protein 20 (CDC20), DNA topoisomerase 2-alpha (TOP2A), BUB1 mitotic checkpoint serine/threonine kinase (BUB1), Cyclin-dependent kinase 1 (CDK1), Maternal embryonic leucine zipper kinase (MELK), Structural maintenance of chromosomes protein 2 (SMC2).Figure 8 Protein-protein interaction (PPI) network analysis of the testicular DEGs between Sichuan White goose and Landes goose at 10 wk of age. (A) The PPI network constructed with the testicular DEGs enriched in both the top 10 GO terms (Figure 7A) and top 20 KEGG pathways (Figure 7B). The size (area) of each node was drawn proportional to its degree of interaction, and the color of each node indicated its betweenness centrality. (B) Visualization of the top 10 hub genes (locating in the inner circle) screened from the PPI network depicted in A using CytoHubba plugin of Cytoscape tool.

Figure 8

Validation of the Expression Patterns of Several DEGs by RT-qPCR

To assess the accuracy of our transcriptomic sequencing data, a total of 9 hub DEGs (CCNA2, AURKA, FOXM1, BUB1B, CDC20, TOP2A, BUB1, CDK1, and MELK), which were identified through both functional enrichment analysis and PPI network construction, were selected for RT-qPCR validation. As shown in Figure 9, the expression levels of these DEGs in the testes of SW and LD determined by RT-qPCR showed similar trends to those observed by transcriptomic sequencing, supporting the reliability of our RNA-seq results.Figure 9 Validation of the expression patterns of several DEGs by RT-qPCR. The orange line represents the RNA-Seq results, while the blue column represents the RT-qPCR results. S10 represented the left testes collected from Sichuan White geese at 10 wk of age, while L10 represented those collected from Landes geese at 10 wk of age.

Figure 9

DISCUSSION

The normal testicular and external genital development is indispensable for male fertility in waterfowl (Herrera, et al., 2013). In the present study, we firstly compared the age-dependent histomorphological changes in the testes and external genitals of 3 representative goose breeds to reveal their developmental variations, and then dissected the underlying molecular mechanisms using comparative transcriptomic analysis. At the morphological level, the bilateral testes of 3 goose breeds developed in an asymmetrical manner throughout posthatch development, with the left one consistently larger in size, and this asymmetry was more pronounced when reaching sexual maturity. These observations were similar to those reported in male broiler breeders where the testicular directional asymmetry appeared during the period from 56-day-old to achieving sexual maturity regardless of the timing of photostimulation (Tyler and Gous, 2009), which supported the compensation hypothesis that one testis serve as a ‘back-up’ when the other fails to develop or is impaired in most male birds owing to natural and sexual selection pressures (Calhim and Birkhead, 2009). Although the avian testicular left-right asymmetry showed intraspecific variations and was considered as an indicator of male reproductive potential (Calhim and Birkhead, 2009), whether or how this asymmetry is associated with the breed-related differences in male fertility of geese awaits further investigations. Meanwhile, the size, weight, and organ index of left, right, or bilateral testes as well as external genitalia varied significantly before and after 10 wk of age in 3 goose breeds, implying that the tenth week posthatch is generally a critical period for the reproductive organ development of domestic ganders. Moreover, at 10 wk of age, some key morphological indicators of testicular and external genital development were significantly higher in SW than in LD. It has been reported that the testicular weights of high sperm motility roosters were significantly higher than those of low sperm motility ones (Sun, et al., 2019), and in some mammal species, the sperm density was usually higher in males with longer natural lengths and thicker basal diameters of external genitalia (Yamada, et al., 2003). These data implied that the variations observed in early male reproductive tract development of 3 goose breeds could result in their different fertility.

At the histological level, the testicular parenchymal area, the parenchymal-to-interstitial ratio, the thickness of seminiferous epithelium, and the diameter of seminiferous tubule, as well as the number of Sertoli cells and spermatogonia per unit area of testis increased remarkably during posthatch development in 3 goose breeds, while the number and density of Leydig cells decreased gradually. Previous studies have shown that in male chickens and pigeons, the seminiferous tubule compartment constituted the major part of the mature testicular parenchyma, and both the size and volume of the seminiferous tubules increased with age (González-Morán and Soria-Castro, 2010; Olea, et al., 2018). Given that the enlarged seminiferous tubules are positively related to the number of Sertoli cells and germ cells (Sun, et al., 2019) and the Sertoli cells located around germ cells in the chicken testes can provide a niche to maintain spermatogenesis via specific secreted signals (Estermann, et al., 2021), it was understandable that the spermatids and spermatozoa were merely present in the testes of goose ganders at wk 30. A recent study on the chicken testicular development also revealed the positive correlations between the size of the seminiferous tubule and spermatogenic ability (Mfoundou, et al., 2022). With the growth of the ganders’ seminiferous tubules, the testicular parenchymal-to-interstitial ratio increased, which were postulated to result in the reduced number and density of Leydig cells per unit area. Consistent with the morphological observations, there were significant differences in the testicular and external genital histological indicators among 3 goose breeds. The testicular parenchymal area and the parenchymal-to-interstitial ratio were significantly lower in SW than in LD at wk 0, while the opposite was seen at wk 10. Meanwhile, the number of Sertoli cells and spermatogonia were significantly higher in the testes of LD than in those of SW at wk 0, while no significant differences were seen at wk 10. At wk 30, although the thickness of seminiferous epithelium and the diameter of seminiferous tubule were significantly higher in LD than in SW, there were no significant differences in the testicular parenchymal area, parenchymal-to-interstitial ratio, and the number of Sertoli cells and spermatogonia, and the number and density of Leydig cells were significantly lower in LD than in SW. These results demonstrated that the spermatogenic ability of SW and LD differs significantly before and after the tenth week posthatch, and the testes of SW seem to develop more rapidly than those of LD. As for the external genitalia, the thickness of keratinized epithelium was higher in LD than in SW, but the diameter of lymphatic lumen was higher in SW than in LD at wk 10. It has been reported that in waterfowl, the lymphatic lumen and outer collagen of external genitalia were used to maintain the spiral shape of the apical portion (Brennan, et al., 2010), and both indicators were positively related to fertilization (Coker, et al., 2002). Thus, these data further strengthened the notion that the developmental variations in the testes and external genitals between SW and LD can result in their different fertility, and the tenth week posthatch is a critical period for the reproductive tract development in domestic goose ganders.

To unravel the underlying mechanisms responsible for early testicular developmental variations between Chinese and European domestic goose ganders, we further analyzed and compared the genome-wide transcriptomic changes in the testes of SW and LD at wk 10. The results showed that a total of 652 upregulated- and 694 downregulated genes were identified in the testes of SW compare to those of LD. The GO enrichment analysis showed that most of these DEGs were significantly enriched in the BP terms related to organ development, including animal organ morphogenesis, male gonad development, and multicellular organism development. Meanwhile, the KEGG enrichment analysis showed that these DEGs were mostly enriched in the pathways related to germ and somatic cell function, organ remodeling, and energy metabolism, such as germ cell maturation, cell cycle, cellular senescence, GnRH and WNT signaling, steroid biosynthesis, ECM-receptor interaction, focal adhesion, neuroactive ligand-receptor interaction, vascular smooth muscle contraction, starch and sucrose metabolism, and glycerolipid metabolism. In accordance with our results, the postnatal development of the reproductive tract in waterfowl has been shown to be involved in the proliferation, differentiation, and maturation of both somatic and germ cells (Estermann, et al., 2021). Moreover, the GnRH and WNT pathways could regulate goose testicular development by affecting cellular functions such as steroid biosynthesis, proliferation, and differentiation (Leska, et al., 2015; Tang, et al., 2022). Similarly, the WNT signaling was revealed to be crucial for the differentiation of chicken spermatogonial stem cells (He, et al., 2018). By constructing the PPI network of these testicular DEGs, we further identified 6 hub genes involved in the ‘cell cycle’ KEGG pathway (CCNA2, CDK1, BUB1, BUB1B, CDC20, and MELK), 2 hub genes in the ‘positive regulation of transcription by RNA polymerase II’ GO-BP term (TOP2A and FOXM1), and 2 hub genes (AURKA and SMC2) in the mitotic cell division machinery. Among them, the cell cycle pathway has been demonstrated to be important for chicken spermatogenesis by regulating a series of somatic and germ cell division and differentiation (Song, et al., 2015). CCNA2 is a key component of the cell cycle and regulates both the G1/S and G2/M transition phases through interactions with cyclin-dependent protein kinases (CDKs) such as CDK1, which is an essential conditioning agent of cell cycle progression, during mammalian testicular development and spermatogenesis (Wolgemuth, et al., 2013; Ma, et al., 2020). Also, it has been shown that in the sheep testes, CDK1 was involved in regulating the proliferation of spermatogenic cells, which could be bound and activated by CCNA2 (Wolgemuth, et al., 2004; Huang, et al., 2021). Besides, BUB1, BUB1B, and CDC20 have been previously reported to play crucial roles in control of mammalian spermatogenesis by regulating male germ cell proliferation and differentiation (Jiang, et al., 2023), and MELK is recently identified as a novel regulator in cell cycle control, embryonic development, hematopoiesis, and oncogenesis (Jiang and Zhang, 2013).The developmental processes responsible for spermatogenesis are finely tuned at both the transcription and post-transcription levels, where RNA polymerase II transcribes all protein-coding genes and many noncoding RNAs (Bettegowda and Wilkinson, 2010). A recent study demonstrated that RNA polymerase II pausing plays an essential role in the regulation of meiosis during spermatogenesis (Kaye, et al., 2024). TOP2A showed effects on the dynamics of meiotic chromosome in germ cells by regulating several important processes including chromosome condensation and chromatid separation (Jiang, et al., 2023). FOXM1 is known as a transcriptional activator that involves cell-cycle regulation, and has been reported to be differentially expressed across different stages of spermatogenesis (Mueller, et al., 2023). In addition, AURKA plays essential roles in regulating mitosis progression, centrosome separation and mitotic spindle function, and is required for male germline maintenance and sperm motility (Marumoto, et al., 2005; Lester, et al., 2021). SMC2 has been implicated in control of cell cycle-specific activities by regulating chromosome condensation during mitosis (Ball Jr and Yokomori, 2001).Thus, it was postulated that differential expression of these hub DEGs involved in the cell cycle, RNA polymerase II-dependent transcription, and mitotic cell division pathways could lead to the observed testicular histomorphological differences between SW and LD, which can be considered as potential target genes used for molecular breeding of male goose fertility.

In conclusion, both age and breed were key factors affecting male goose reproductive tract development. The tenth week posthatch was a critical developmental stage for ganders from all 3 goose breeds, because both the testicular and external genital histomorphological parameters significantly changed before and after this period. Moreover, during the first 10 wk posthatch, the weight, organ index, or size of male reproductive organs developed more rapidly in SW than in LD, and so were the testicular parenchymal-to-interstitial ratio and the external genital lymphatic lumen diameter. Through comparative transcriptomics analysis and RT-qPCR validation, several pathways related to germ and somatic cell function, organ remodeling, and energy metabolism were thought to be responsible for the developmental variations in the early testicular development between Chinese and European domestic ganders, where 10 hub genes involved in the cell cycle, RNA polymerase II-dependent transcription, and mitotic cell division pathways might play essential roles.

DISCLOSURES

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Appendix Supplementary materials

Image, application 1

Image, image 2

Image, image 3

Image, application 4

Image, application 5

ACKNOWLEDGMENTS

This study was financially supported by the Sichuan Science and Technology Program (2023NSFSC0227 ), the National Key R&D Program of China (2023YFD1300304 ), the Program for Waterfowl Industry Technology System Innovation Team of Sichuan Province (SCCXTD-2024-25 ), the Undergraduate Training Programs for Innovation and Entrepreneurship of Sichuan Province (S202310626054 ), and the Key Technology Support Program of Sichuan Province (2021YFYZ0014 ).

Supplementary material associated with this article can be found in the online version at doi:10.1016/j.psj.2024.104233.
==== Refs
REFERENCES

Ball A.R. Jr Yokomori K. The structural maintenance of chromosomes (SMC) family of proteins in mammals Chrom. Res. 9 2001 85 96 11321372
Bettegowda A. Wilkinson M.F. Transcription and post-transcriptional regulation of spermatogenesis Philosoph. Transact. Royal Soc. B 365 2010 1637 1651
Brennan P.L. Clark C.J. Prum R.O. Explosive eversion and functional morphology of the duck penis supports sexual conflict in waterfowl genitalia Proceed. Royal Soc. B 277 2010 1309 1314
Bu D. Luo H. Huo P. Wang Z. Zhang S. He Z. Wu Y. Zhao L. Liu J. Guo J. KOBAS-i: Intelligent prioritization and exploratory visualization of biological functions for gene enrichment analysis Nucl. Acid. Res. 49 2021 W317 W325
Calhim S. Birkhead T.R. Intraspecific variation in testis asymmetry in birds: evidence for naturally occurring compensation Proceed. Royal Soc. B 276 2009 2279 2284
Coker C.R. McKinney F. Hays H. Briggs S.V. Cheng K.M. Intromittent organ morphology and testis size in relation to mating system in waterfowl Auk 119 2002 403 413
Estermann M.A. Major A.T. Smith C.A. Genetic regulation of avian testis development Genes 12 2021 1459 34573441
Faure M. Guibert E. Crochet S. Chartrin P. Brillard J.-P. Collin A. Froment P. Differential proliferation and metabolic activity of Sertoli cells in the testes of broiler and layer breeder chickens Poult. Sci. 96 2017 2459 2470 28339706
González-Morán M.G. Soria-Castro E. Histological and stereological studies on Leydig cells in the testes of Gallus domesticus from pre-hatching to sexual maturity Anim. Reproduct. Sci. 120 2010 129 135
Hanafy A. Khalil H. Abdel-Rahim W. Abdel-Ghany A. Testicular functions and sexual behavior in male Japanese quail after exposure to bisphenol A Asian J. Poult. Sci. 10 2016 40 51
He N. Wang Y. Zhang C. Wang M. Wang Y. Zuo Q. Zhang Y. Li B. Wnt signaling pathway regulates differentiation of chicken embryonic stem cells into spermatogonial stem cells via Wnt5a J. Cell. Biochem. 119 2018 1689 1701 28786525
Herrera A.M. Shuster S.G. Perriton C.L. Cohn M.J. Developmental basis of phallus reduction during bird evolution Curr. Biol. 23 2013 1065 1074 23746636
Herrera A.M. Brennan P.L. Cohn M.J. Development of avian external genitalia: interspecific differences and sexual differentiation of the male and female phallus Sex. Develop. 9 2015 43 52
Huang Y. Jiang X. Yan Y. Liu G. Liu C. Expression of cell proliferation regulatory factors bricd5, tnfrsf21, cdk1 correlates with expression of clock gene cry1 in testes of Hu rams during puberty Mol. Biol. Rep. 48 2021 7379 7385 34626314
Indriastuti R. Pardede B.P. Gunawan A. Ulum M.F. Arifiantini R.I. Purwantara B. Sperm transcriptome analysis accurately reveals male fertility potential in livestock Animals 12 2022 2955 36359078
Jiang P. Zhang D. Maternal embryonic leucine zipper kinase (MELK): A novel regulator in cell cycle control, embryonic development, and cancer Int. J. Mol. Sci. 14 2013 21551 21560 24185907
Jiang Y. Yang X. Li L. Lv X. Wang R. Zhang H. Liu R. Identification and verification of potential biomarkers in sertoli cell-only syndrome via bioinformatics analysis Scient. Rep. 13 2023 12164
Kaye E.G. Basavaraju K. Nelson G.M. Zomer H.D. Roy D. Joseph I.I. Rajabi-Toustani R. Qiao H. Adelman K. Reddi P.P. RNA polymerase II pausing is essential during spermatogenesis for appropriate gene expression and completion of meiosis Nat. Commun. 15 2024 848 38287033
Kim D. Langmead B. Salzberg S.L. HISAT: a fast spliced aligner with low memory requirements Nat. Meth. 12 2015 357 360
Leska A. Kiezun J. Kaminska B. Dusza L. Estradiol concentration and the expression of estrogen receptors in the testes of the domestic goose (Anser anser f. domestica) during the annual reproductive cycle Domes. Anim. Endocrinol. 51 2015 96 104
Lester W.C. Johnson T. Hale B. Serra N. Elgart B. Wang R. Geyer C.B. Sperry A.O. Aurora A Kinase (AURKA) is required for male germline maintenance and regulates sperm motility in the mouse Biol. Reproduct. 105 2021 1603 1616
Li H. Handsaker B. Wysoker A. Fennell T. Ruan J. Homer N. Marth G. Abecasis G. Durbin R. Subgroup G.P.D.P. The sequence alignment/map format and SAMtools Bioinformatics 25 2009 2078 2079 19505943
Liao Y. Smyth G.K. Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features Bioinformatics 30 2014 923 930 24227677
Livak K.J. Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method Methods 25 2001 402 408 11846609
Love M.I. Huber W. Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 Genom. Biol. 15 2014 1 21
Ma F. Wang X. Chung S.S. Sicinski P. Shang E. Wolgemuth D.J. Cyclin A2 is essential for mouse gonocyte maturation Cell Cycle 19 2020 1654 1664 32420805
Marumoto T. Zhang D. Saya H. Aurora-A—a guardian of poles Nat. Rev. Canc. 5 2005 42 50
Mfoundou J.D.L. Guo Y. Yan Z. Wang X. Morpho-histology and morphometry of chicken testes and seminiferous tubules among yellow-feathered broilers of different ages Vet. Sci. 9 2022 485 36136701
Mohan J. Sharma S. Kolluri G. Dhama K. History of artificial insemination in poultry, its components and significance World's Poult. Sci. J. 74 2018 475 488
Mueller L. Barrow P. Jacobsen B. Ebeling M. Weinbauer G. Reproductive findings in male animals exposed to selective survival of motor neuron 2 (SMN2) gene splicing-modifying agents Reproduct. Toxicol. 118 2023 108360
Olea G. Aguirre M. Lombardo D. Anatomical, histological and immunohistochemical study of testicular development in Columba livia (Aves: Columbiformes) Acta Histochemica 120 2018 446 455 29776745
Ouyang Q. Bao D. Lu Y. Hu J. Hu B. Lan C. Hu S. He H. Liu H. Li L. A comparative study of libido in drakes: from phenotypes to molecules Poult. Sci. 100 2021 101503
Ran M. Huang H. Hu B. Hu S. Hu J. Li L. He H. Liu H. Wang J. Comparative analysis of testicular histology and lncRNA–mRNA expression patterns between Landes Geese (Anser anser) and Sichuan white geese (Anser cygnoides) Front. Genet. 12 2021 627384
Shannon P. Markiel A. Ozier O. Baliga N.S. Wang J.T. Ramage D. Amin N. Schwikowski B. Ideker T. Cytoscape: a software environment for integrated models of biomolecular interaction networks Genom. Res. 13 2003 2498 2504
Song R. Yao X. Shi L. Ren Y. Zhao H. Effects of dietary selenium on apoptosis of germ cells in the testis during spermatogenesis in roosters Theriogenology 84 2015 583 588 25986065
Sun W. Gan X. Hu J. Li L. Wang J. CYP17 gene plays a key role in goose genital growth by influencing the testosterone level at puberty Poult. Sci. 97 2018 1748 1756 29462369
Sun Y. Xue F. Li Y. Fu L. Bai H. Ma H. Xu S. Chen J. Differences in semen quality, testicular histomorphology, fertility, reproductive hormone levels, and expression of candidate genes according to sperm motility in Beijing-You chickens Poult. Sci. 98 2019 4182 4189 31065698
Szklarczyk D. Kirsch R. Koutrouli M. Nastou K. Mehryary F. Hachilif R. Gable A.L. Fang T. Doncheva N.T. Pyysalo S. The STRING database in 2023: protein–protein association networks and functional enrichment analyses for any sequenced genome of interest Nucl. Acid. Res. 51 2023 D638 D646
Tang B. Hu S. Ouyang Q. Wu T. Lu Y. Hu J. Hu B. Li L. Wang J. Comparative transcriptome analysis identifies crucial candidate genes and pathways in the hypothalamic-pituitary-gonadal axis during external genitalia development of male geese BMC Genom. 23 2022 136
Tesfay H.H. Sun Y. Li Y. Shi L. Fan J. Wang P. Zong Y. Ni A. Ma H. Mani A.I. Comparative studies of semen quality traits and sperm kinematic parameters in relation to fertility rate between 2 genetic groups of breed lines Poultry Sci. 99 2020 6139 6146 33142532
Tyler N. Gous R. The effect of age at photostimulation of male broiler breeders on testes growth and the attainment of sexual maturity South Afric. J. Anim. Sci. 39 2009 169 175
Vizcarra J. Kirby J. Kreider D. Testis development and gonadotropin secretion in broiler breeder males Poultry Sci. 89 2010 328 334 20075286
Vizcarra J.A. Cerón-Romero N. Taofeek N. Kirby J. Reproduction in male birds Sturkie’s avian physiology 2022 Academic Press Cambridge, Massachusetts 987 1014
Wang J. Hao H. Zhang J. Song J. Ren X. Liu Y. Wang Q. Zhang Y. Wang X. Ma Z. Sperm mobility is predictive of the relative genetic contribution among competing mating geese, as determined by microsatellite genotype identification of potential sires Poult. Sci. 102 2023 102626
Wang Q. Wang Q. Wang C. Sun C. Yang N. Wen C. Genetic improvement of duration of fertility in chickens and its commercial application for extending insemination intervals Poult. Sci. 103 2024 103438
Wolgemuth D.J. Lele K.M. Jobanputra V. Salazar G. The A-type cyclins and the meiotic cell cycle in mammalian male germ cells Int. J. Androl. 27 2004 192 199 15271198
Wolgemuth D.J. Manterola M. Vasileva A. Role of cyclins in controlling progression of mammalian spermatogenesis Int. J. Developm. Biol. 57 2013 159
Yamada G. Satoh Y. Baskin L.S. Cunha G.R. Cellular and molecular mechanisms of development of the external genitalia Differentiation 71 2003 445 460 14641326
